DOCSLIB.ORG

Supplementary Table 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Wild type F1/F10 (villus/crypt) Probe set Gene symbol Gene name Fold change p value defensin related 1450709_at Defcr5 cryptdin 5 0.009 < 1e-07 cDNA sequence 1429378_x_at AY761184 AY761184 0.038 < 1e-07 intelectin 1 (galactofuranos 1418165_at Itln1 e binding) 0.043 1.00E-07 defensin related sequence cryptdin peptide 1418550_x_at Defcr-rs1 (paneth cells) 0.044 < 1e-07 1439426_x_at Lyz2 lysozyme 2 0.059 < 1e-07 potassium intermediate/sm all conductance calcium- activated channel, subfamily N, 1435945_a_at Kcnn4 member 4 0.061 1.00E-07 cysteine and glycine-rich 1420731_a_at Csrp2 protein 2 0.065 1.20E-06 CDC28 protein 1416698_a_at Cks1b kinase 1b 0.065 < 1e-07 transferrin 1452661_at Tfrc receptor 0.066 2.00E-07 solute carrier family 12, 1417622_at Slc12a2 member 2 0.066 3.00E-07 fatty acid binding protein 6, ileal 1450682_at Fabp6 (gastrotropin) 0.067 < 1e-07 1415849_s_at Stmn1 stathmin 1 0.069 < 1e-07 deleted in malignant brain 1418287_a_at Dmbt1 tumors 1 0.070 3.00E-07 RIKEN cDNA 9130208D14 1440922_at 9130208D14Rik gene 0.071 1.26E-05 cell division cycle 20 homolog (S. 1439377_x_at Cdc20 cerevisiae) 0.072 7.00E-07 heat shock 1427126_at Hspa1b protein 1B 0.080 3.00E-07 defensin related 1450631_x_at Defcr6 cryptdin 6 0.081 < 1e-07 carbonic 1418094_s_at Car4 anhydrase 4 0.082 6.00E-07 cysteine rich 1416039_x_at Cyr61 protein 61 0.082 1.00E-07 1436996_x_at Lyz1 lysozyme 1 0.084 < 1e-07 aldehyde dehydrogenase 1 family, 1451260_at Aldh1b1 member B1 0.090 5.00E-07 nucleolar protein 1455035_s_at Nol5a 5A 0.093 1.40E-06 cysteine rich 1438133_a_at Cyr61 protein 61 0.096 1.00E-07 heat shock 1452388_at Hspa1a protein 1A 0.105 2.00E-07 topoisomerase 1454694_a_at Top2a (DNA) II alpha 0.106 1.00E-07 heat shock 1427127_x_at Hspa1b protein 1B 0.107 5.00E-07 heat shock protein 1 1426351_at Hspd1 (chaperonin) 0.108 1.00E-07 minichromosom e maintenance deficient 5, cell division cycle 46 1436808_x_at Mcm5 (S. cerevisiae) 0.108 < 1e-07 protease, 1437671_x_at Prss23 serine, 23 0.111 6.00E-07 ATPase family, AAA domain 1438178_x_at Atad3a containing 3A 0.111 2.00E-07 inner centromere 1439436_x_at Incenp protein 0.114 < 1e-07 tubulin, alpha 1423846_x_at Tuba1b 1B 0.121 < 1e-07 angiogenin, ribonuclease A family, member 1440832_at Ang4 4 0.122 1.80E-06 CDC28 protein kinase regulatory 1417457_at Cks2 subunit 2 0.123 1.00E-07 microsomal glutathione S- 1415897_a_at Mgst1 transferase 1 0.124 4.00E-07 complement component 1, q subcomponent 1455821_x_at C1qbp binding protein 0.125 3.00E-07 solute carrier family 7 (cationic amino acid transporter, y+ system), 1454991_at Slc7a1 member 1 0.127 1.00E-07 non-SMC condensin I complex, 1436707_x_at Ncaph subunit H 0.127 9.00E-07 proteolipid 1453572_a_at Plp2 protein 2 0.128 8.00E-07 H2A histone family, member 1416746_at H2afx X 0.130 7.30E-06 small nucleolar RNA, C/D box 1433674_a_at Snord22 22 0.130 < 1e-07 heat shock protein 1 1450668_s_at Hspe1 (chaperonin 10) 0.130 7.00E-07 ATPase family, AAA domain 1456541_x_at Atad3a containing 3A 0.131 6.00E-07 cystic fibrosis transmembrane conductance regulator 1420579_s_at Cftr homolog 0.135 2.20E-06 heat shock 105kDa/110kDa 1425993_a_at Hsph1 protein 1 0.135 1.00E-07 kinesin family 1437716_x_at Kif22 member 22 0.139 3.00E-07 DNA segment, Chr 17, human 1417822_at D17H6S56E-5 D6S56E 5 0.140 4.70E-06 cell division cycle associated 1436847_s_at Cdca8 8 0.146 2.03E-05 small nucleolar RNA host gene (non-protein 1439399_a_at Snhg1 coding) 1 0.146 1.00E-07 ribosomal 1416453_x_at Rps12 protein S12 0.146 1.20E-06 heat shock 1452318_a_at Hspa1b protein 1B 0.147 2.00E-07 protein tyrosine phosphatase- like (proline instead of catalytic arginine), 1457434_s_at Ptpla member a 0.149 2.30E-06 uridine-cytidine 1439740_s_at Uck2 kinase 2 0.152 6.97E-05 carbamoyl- phosphate 1455540_at Cps1 synthetase 1 0.152 1.01E-05 1452614_at Bcl2l15 BCLl2-like 15 0.153 2.00E-07 1438938_x_at Phb2 prohibitin 2 0.154 2.80E-06 ribosomal 1451077_at Rpl5 protein L5 0.155 1.09E-05 RIKEN cDNA 1300001I01 1428106_at 1300001I01Rik gene 0.155 2.70E-06 1442710_at NA NA 0.155 5.00E-07 RIKEN cDNA 2810417H13 1419153_at 2810417H13Rik gene 0.156 1.40E-06 proliferation- 1420142_s_at Pa2g4 associated 2G4 0.156 6.80E-06 cyclin- dependent 1455287_at Cdk6 kinase 6 0.158 3.90E-06 solute carrier organic anion transporter family, member 1433933_s_at Slco2b1 2b1 0.159 2.26E-05 alanyl (membrane) 1421424_a_at Anpep aminopeptidase 0.159 0.0007021 nucleolar protein family A, 1416606_s_at Nola2 member 2 0.160 1.70E-06 translocase of inner mitochondrial membrane 8 homolog a1 1416345_at Timm8a1 (yeast) 0.160 2.23E-05 high mobility group nucleosomal binding domain 1455897_x_at Hmgn1 1 0.161 2.00E-07 brain expressed 1448595_a_at Bex1 gene 1 0.161 3.70E-05 predicted gene, OTTMUSG0000 OTTMUSG0000 1437610_x_at 0016200 0016200 0.162 4.00E-07 high mobility 1437313_x_at Hmgb2 group box 2 0.162 2.00E-07 1425952_a_at Gcg glucagon 0.164 1.09E-05 FAST kinase 1426741_a_at Fastkd2 domains 2 0.164 5.00E-07 solute carrier family 12, 1448780_at Slc12a2 member 2 0.166 9.98E-05 complement component 1, q subcomponent 1448274_at C1qbp binding protein 0.166 5.60E-06 predicted gene, OTTMUSG0000 OTTMUSG0000 1455319_x_at 0022847 0022847 0.167 1.40E-06 CDC28 protein kinase regulatory 1417458_s_at Cks2 subunit 2 0.168 7.00E-07 MAD2 (mitotic arrest deficient, homolog)-like 1 1422460_at Mad2l1 (yeast) 0.169 1.59E-05 L1 cell adhesion 1450435_at L1cam molecule 0.169 1.40E-06 ribosomal 1433928_a_at Rpl13a protein L13a 0.170 5.00E-07 transglutaminas e 2, C 1455900_x_at Tgm2 polypeptide 0.171 2.00E-06 PYD and CARD domain 1417346_at Pycard containing 0.171 6.10E-06 ribosomal 1439374_x_at Rps10 protein S10 0.173 8.63E-05 heat shock protein 90kDa alpha (cytosolic), class 1416364_at Hsp90ab1 B member 1 0.174 1.80E-06 TRM1 tRNA methyltransferas e 1 homolog (S. 1436494_x_at Trmt1 cerevisiae) 0.174 3.50E-06 ornithine aminotransferas 1416452_at Oat e 0.174 1.41E-05 interferon induced transmembrane 1417460_at Ifitm2 protein 2 0.174 2.36E-05 ribosomal 1416807_at Rpl36a protein L36a 0.175 4.30E-06 chaperonin containing Tcp1, subunit 3 1459987_s_at Cct3 (gamma) 0.175 1.30E-06 bleomycin 1438961_s_at Blmh hydrolase 0.176 9.00E-07 1419513_a_at Ect2 ect2 oncogene 0.176 1.44E-05 eukaryotic translation elongation factor 1448252_a_at Eef1b2 1 beta 2 0.178 5.00E-07 small nucleolar RNA, C/D box 1433675_at Snord22 22 0.178 1.40E-06 1443649_at NA NA 0.179 9.90E-06 ribosomal 1438986_x_at Rps17 protein S17 0.179 1.10E-06 interleukin enhancer 1417948_s_at Ilf2 binding factor 2 0.179 2.14E-05 minichromosom e maintenance deficient 7 (S. 1438320_s_at Mcm7 cerevisiae) 0.179 1.40E-06 S- adenosylmethio nine 1448484_at Amd1 decarboxylase 1 0.179 3.00E-07 similar to calponin 3, 1436836_x_at LOC100047856 acidic 0.180 1.10E-06 cell division cycle associated 1416802_a_at Cdca5 5 0.181 5.64E-05 ribosomal 1455950_x_at Rpl35 protein L35 0.184 4.00E-07 muscleblind-like 1434678_at Mbnl3 3 (Drosophila) 0.184 3.20E-06 inosine 5@#$%&- phosphate dehydrogenase 1415851_a_at Impdh2 2 0.186 1.70E-06 1434280_at NA NA 0.186 7.00E-07 1422489_at Gcs1 glucosidase 1 0.186 8.70E-06 ribosomal 1416603_at Rpl22 protein L22 0.187 1.20E-06 small nucleolar RNA host gene (non-protein 1436506_a_at Snhg6 coding) 6 0.188 1.30E-06 RIKEN cDNA 3110001A13 1416893_at 3110001A13Rik gene 0.188 0.0001044 phosphatidyleth anolamine 1438649_x_at Pebp1 binding protein 1 0.188 1.30E-06 ribosomal 1434231_x_at Rpl35 protein L35 0.189 8.00E-07 ribosomal 1437510_x_at Rps17 protein S17 0.190 1.30E-06 5- aminoimidazole- 4-carboxamide ribonucleotide formyltransferas e/IMP 1428506_at Atic cyclohydrolase 0.191 9.60E-06 FGF receptor activating 1424615_at Frag1 protein 1 0.191 4.30E-06 protein tyrosine phosphatase- like (proline instead of catalytic arginine), 1456315_a_at Ptpla member a 0.192 0.0001153 ribosomal 1438794_x_at Rps13 protein S13 0.192 1.50E-06 1450920_at Ccnb2 cyclin B2 0.193 2.55E-05 1447046_at NA NA 0.194 7.10E-06 asparagine- linked glycosylation 8 homolog (yeast, alpha-1,3- glucosyltransfer 1455887_at Alg8 ase) 0.194 5.62E-05 methionine adenosyltransfer 1438630_x_at Mat2a ase II, alpha 0.194 4.00E-07 GDP-mannose 4, 6- 1434158_at Gmds dehydratase 0.195 2.80E-06 cysteine rich 1457823_at Cyr61 protein 61 0.196 0.0004907 phenylalanyl- tRNA synthetase, beta 1435103_x_at Farsb subunit 0.196 3.10E-06 ribosomal 1436840_x_at Rpl35 protein L35 0.196 8.00E-07 phosphohistidin 1427903_at Phpt1 e phosphatase 1 0.197 0.0001114 ribosomal 1448245_at Rpsa protein SA 0.197 1.40E-06 predicted gene, 1433510_x_at 100043718 100043718 0.197 1.70E-06 E2F transcription 1455790_at E2f2 factor 2 0.198 6.30E-06 MYB binding protein (P160) 1423431_a_at Mybbp1a 1a 0.199 5.40E-06 RIKEN cDNA 2410006H16 1447936_at 2410006H16Rik gene 0.200 7.00E-07 tripartite motif- 1415869_a_at Trim28 containing 28 0.200 6.90E-06 1452426_x_at NA NA 0.200 2.60E-06 guanine nucleotide binding protein- 1433656_a_at Gnl3 like 3 (nucleolar) 0.201 7.00E-07 transmembrane 1428465_at Tmem147 protein 147 0.201 9.93E-05 1426946_at Ipo5 importin 5 0.202 1.10E-05 regulator of chromosome 1426897_at Rcc2 condensation 2 0.202 0.0001447 cold shock domain protein 1435800_a_at Csda A 0.202 1.84E-05 predicted gene, 1438940_x_at 100040836 100040836 0.202 5.70E-06 CCAAT/enhanc er binding protein (C/EBP), 1418901_at Cebpb beta 0.203 1.52E-05 ribosomal 1455001_x_at Rpl13a protein L13a 0.203 1.11E-05 SH2 domain 1453377_at Sh2d4a containing 4A 0.205 6.60E-06 RIKEN cDNA 1110038B12 1441081_a_at 1110038B12Rik gene 0.205 9.00E-07 AFFX- TransRecMur/X57 transferrin 349_3_at Tfrc receptor 0.206 8.80E-06 inosine 5@#$%&- phosphate
Recommended publications
  • Lupus-Associated Endogenous Retroviral LTR Polymorphism and Epigenetic Imprinting Promote HRES-1/Rab4 Expression and Mtor Activation

    Lupus-Associated Endogenous Retroviral LTR Polymorphism and Epigenetic Imprinting Promote HRES-1/Rab4 Expression and Mtor Activation

    Lupus-associated endogenous retroviral LTR polymorphism and epigenetic imprinting promote HRES-1/Rab4 expression and mTOR activation Aparna Godavarthy, … , Katalin Banki, Andras Perl JCI Insight. 2019. https://doi.org/10.1172/jci.insight.134010. Research In-Press Preview Immunology Graphical abstract Find the latest version: https://jci.me/134010/pdf LUPUS-ASSOCIATED ENDOGENOUS RETROVIRAL LTR POLYMORPHISM AND EPIGENETIC IMPRINTING PROMOTE HRES-1/RAB4 EXPRESSION AND MTOR ACTIVATION Aparna Godavarthy*1, Ryan Kelly*1, John Jimah1, Miguel Beckford1, Tiffany Caza1,2, David Fernandez1,2, Nick Huang1,3, Manuel Duarte1,2, Joshua Lewis1,2, Hind J. Fadel4, Eric M. Poeschla4, Katalin Banki5, and Andras Perl1,2,3 * These authors contributed equally to the study. 1, Division of Rheumatology, Department of Medicine; 2, Department of Microbiology and Immunology; 3, Department of Biochemistry and Molecular Biology, and 5, Department of Pathology, State University of New York, Upstate Medical University, College of Medicine, 750 East Adams Street, Syracuse, New York 13210; 4, Department of Molecular Medicine; Mayo Clinic College of Medicine, 200 First Street SW, Rochester 55905, USA; Correspondence: Andras Perl, M.D., Ph.D. , State University of New York, College of Medicine, 750 East Adams Street, Syracuse, New York 13210; Phone: (315) 464-4194; Fax: (315) 464- 4176; E-mail: [email protected] Key Words: Systemic Lupus Erythematosus, T Cells, HRES-1/Rab4. mTOR, Autoimmunity The authors have declared that no conflict of interest exists. Supplementary Materials include Supplemental Methods and Supplementary Figures S1-S26. 1 ABSTRACT Overexpression and long terminal repeat (LTR) polymorphism of the HRES-1/Rab4 human endogenous retrovirus locus have been associated with T-cell activation and disease manifestations in systemic lupus erythematosus (SLE).
  • Supplement 1 Overview of Dystonia Genes

    Supplement 1 Overview of Dystonia Genes

    Supplement 1 Overview of genes that may cause dystonia in children and adolescents Gene (OMIM) Disease name/phenotype Mode of inheritance 1: (Formerly called) Primary dystonias (DYTs): TOR1A (605204) DYT1: Early-onset generalized AD primary torsion dystonia (PTD) TUBB4A (602662) DYT4: Whispering dystonia AD GCH1 (600225) DYT5: GTP-cyclohydrolase 1 AD deficiency THAP1 (609520) DYT6: Adolescent onset torsion AD dystonia, mixed type PNKD/MR1 (609023) DYT8: Paroxysmal non- AD kinesigenic dyskinesia SLC2A1 (138140) DYT9/18: Paroxysmal choreoathetosis with episodic AD ataxia and spasticity/GLUT1 deficiency syndrome-1 PRRT2 (614386) DYT10: Paroxysmal kinesigenic AD dyskinesia SGCE (604149) DYT11: Myoclonus-dystonia AD ATP1A3 (182350) DYT12: Rapid-onset dystonia AD parkinsonism PRKRA (603424) DYT16: Young-onset dystonia AR parkinsonism ANO3 (610110) DYT24: Primary focal dystonia AD GNAL (139312) DYT25: Primary torsion dystonia AD 2: Inborn errors of metabolism: GCDH (608801) Glutaric aciduria type 1 AR PCCA (232000) Propionic aciduria AR PCCB (232050) Propionic aciduria AR MUT (609058) Methylmalonic aciduria AR MMAA (607481) Cobalamin A deficiency AR MMAB (607568) Cobalamin B deficiency AR MMACHC (609831) Cobalamin C deficiency AR C2orf25 (611935) Cobalamin D deficiency AR MTRR (602568) Cobalamin E deficiency AR LMBRD1 (612625) Cobalamin F deficiency AR MTR (156570) Cobalamin G deficiency AR CBS (613381) Homocysteinuria AR PCBD (126090) Hyperphelaninemia variant D AR TH (191290) Tyrosine hydroxylase deficiency AR SPR (182125) Sepiaterine reductase
  • Topoisomerase 1 Suppresses Replication Stress and Genomic Instability by Preventing Interference Between Replication and Transcription

    Topoisomerase 1 Suppresses Replication Stress and Genomic Instability by Preventing Interference Between Replication and Transcription

    Topoisomerase 1 suppresses replication stress and genomic instability by preventing interference between replication and transcription. Sandie Tuduri, Laure Crabbé, Chiara Conti, Hélène Tourrière, Heidi Holtgreve-Grez, Anna Jauch, Véronique Pantesco, John de Vos, Aubin Thomas, Charles Theillet, et al. To cite this version: Sandie Tuduri, Laure Crabbé, Chiara Conti, Hélène Tourrière, Heidi Holtgreve-Grez, et al.. Topoi- somerase 1 suppresses replication stress and genomic instability by preventing interference between replication and transcription.. Nature Cell Biology, Nature Publishing Group, 2009, 11 (11), pp.1315- 1324. 10.1038/ncb1984. hal-00430775 HAL Id: hal-00430775 https://hal.archives-ouvertes.fr/hal-00430775 Submitted on 14 Jun 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Topoisomerase I suppresses genomic instability by preventing interference between replication and transcription Sandie Tuduri 1,2, Laure Crabbé 1, Chiara Conti 3, Hélène Tourrière 1, Heidi Holtgreve-Grez 4, Anna Jauch 4, Véronique Pantesco 5, John De Vos 5, Aubin
  • Anti-IDH3A Antibody (ARG42205)

    Anti-IDH3A Antibody (ARG42205)

    Product datasheet [email protected] ARG42205 Package: 100 μl anti-IDH3A antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes IDH3A Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name IDH3A Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 28-366 of Human IDH3A (NP_005521.1). Conjugation Un-conjugated Alternate Names Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial; EC 1.1.1.41; NAD; Isocitric dehydrogenase subunit alpha; + Application Instructions Application table Application Dilution ICC/IF 1:50 - 1:200 IHC-P 1:50 - 1:200 WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Raji Calculated Mw 40 kDa Observed Size ~ 40 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw www.arigobio.com 1/3 cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol IDH3A Gene Full Name isocitrate dehydrogenase 3 (NAD+) alpha Background Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate.
  • Peripheral Neuropathy in Complex Inherited Diseases: an Approach To

    Peripheral Neuropathy in Complex Inherited Diseases: an Approach To

    PERIPHERAL NEUROPATHY IN COMPLEX INHERITED DISEASES: AN APPROACH TO DIAGNOSIS Rossor AM1*, Carr AS1*, Devine H1, Chandrashekar H2, Pelayo-Negro AL1, Pareyson D3, Shy ME4, Scherer SS5, Reilly MM1. 1. MRC Centre for Neuromuscular Diseases, UCL Institute of Neurology and National Hospital for Neurology and Neurosurgery, London, WC1N 3BG, UK. 2. Lysholm Department of Neuroradiology, National Hospital for Neurology and Neurosurgery, London, WC1N 3BG, UK. 3. Unit of Neurological Rare Diseases of Adulthood, Carlo Besta Neurological Institute IRCCS Foundation, Milan, Italy. 4. Department of Neurology, University of Iowa, 200 Hawkins Drive, Iowa City, IA 52242, USA 5. Department of Neurology, University of Pennsylvania, Philadelphia, PA 19014, USA. * These authors contributed equally to this work Corresponding author: Mary M Reilly Address: MRC Centre for Neuromuscular Diseases, 8-11 Queen Square, London, WC1N 3BG, UK. Email: [email protected] Telephone: 0044 (0) 203 456 7890 Word count: 4825 ABSTRACT Peripheral neuropathy is a common finding in patients with complex inherited neurological diseases and may be subclinical or a major component of the phenotype. This review aims to provide a clinical approach to the diagnosis of this complex group of patients by addressing key questions including the predominant neurological syndrome associated with the neuropathy e.g. spasticity, the type of neuropathy, and the other neurological and non- neurological features of the syndrome. Priority is given to the diagnosis of treatable conditions. Using this approach, we associated neuropathy with one of three major syndromic categories - 1) ataxia, 2) spasticity, and 3) global neurodevelopmental impairment. Syndromes that do not fall easily into one of these three categories can be grouped according to the predominant system involved in addition to the neuropathy e.g.
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
  • Identification and Validation of Novel and More Effective Choline Kinase

    Identification and Validation of Novel and More Effective Choline Kinase

    www.nature.com/scientificreports OPEN Identifcation and validation of novel and more efective choline kinase inhibitors against Streptococcus pneumoniae Tahl Zimmerman1*, Valerie Chasten1, Juan Carlos Lacal2 & Salam A. Ibrahim1 Streptococcus pneumoniae choline kinase (sChoK) has previously been proposed as a drug target, yet the efectiveness of the frst and only known inhibitor of sChoK, HC-3, is in the millimolar range. The aim of this study was thus to further validate sChoK as a potential therapeutic target by discovering more powerful sChoK inhibitors. LDH/PK and colorimetric enzymatic assays revealed two promising sChoK inhibitor leads RSM-932A and MN58b that were discovered with IC50 of 0.5 and 150 μM, respectively, and were shown to be 2–4 magnitudes more potent than the previously discovered inhibitor HC-3. Culture assays showed that the minimum inhibitory concentration (MIC) of RSM- 932A and MN58b for S. pneumoniae was 0.4 μM and 10 μM, respectively, and the minimum lethal concentration (MLC) was 1.6 μM and 20 μM, respectively. Western blot monitoring of teichoic acid production revealed diferential patterns in response to each inhibitor. In addition, both inhibitors possessed a bacteriostatic mechanism of action, and neither interfered with the autolytic efects of vancomycin. Cells treated with MN58b but not RSM-932A were more sensitive to a phosphate induced autolysis with respect to the untreated cells. SEM studies revealed that MN58b distorted the cell wall, a result consistent with the apparent teichoic acid changes. Two novel and more highly potent putative inhibitors of sChoK, MN58b and RSM-932A, were characterized in this study.
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
  • Gene and Protein Expression Profiling of Human Ovarian Cancer Cells Treated with the Heat Shock Protein 90 Inhibitor 17-Allylamino-17-Demethoxygeldanamycin

    Gene and Protein Expression Profiling of Human Ovarian Cancer Cells Treated with the Heat Shock Protein 90 Inhibitor 17-Allylamino-17-Demethoxygeldanamycin

    Research Article Gene and Protein Expression Profiling of Human Ovarian Cancer Cells Treated with the Heat Shock Protein 90 Inhibitor 17-Allylamino-17-Demethoxygeldanamycin Alison Maloney,1 Paul A. Clarke,1 Soren Naaby-Hansen,3,4 Rob Stein,3,5 Jens-Oliver Koopman,3,4 Akunna Akpan,3,4 Alice Yang,3,4 Marketa Zvelebil,3,4 Rainer Cramer,3,4 Lindsay Stimson,1 Wynne Aherne,1 Udai Banerji,1,2 Ian Judson,1,2 Swee Sharp,1 Marissa Powers,1 Emmanuel deBilly,1 Joanne Salmons,1 Michael Walton,1 Al Burlingame,3,4 Michael Waterfield,3,4 and Paul Workman1 1Haddow Laboratories, Cancer Research UK Centre for Cancer Therapeutics, The Institute of Cancer Research; 2Royal Marsden NHS Foundation Trust, Sutton, Surrey, United Kingdom; 3Ludwig Institute for Cancer Research and Departments of 4Biochemistry and Molecular Biology and 5Oncology, University College London, London, United Kingdom Abstract anticancer agents and provide a means of obtaining a detailed The promising antitumor activity of 17-allylamino-17-deme- molecular signature of drug action (1, 2). In addition, these thoxygeldanamycin (17AAG) results from inhibition of the methods may identify pharmacodynamic markers that can be used molecular chaperone heat shock protein 90(HSP90)and to evaluate drugs in clinical trials. Gene expression microarrays are subsequent degradation of multiple oncogenic client proteins. increasingly used to investigate the molecular responses to cancer Gene expression microarray and proteomic analysis were used drugs in tumor cells (1). Although valuable, analysis of gene to profile molecular changes in the A2780human ovarian expression at the mRNA level alone cannot adequately predict cancer cell line treated with 17AAG.
  • Molecular Genetics of Microcephaly Primary Hereditary: an Overview

    Molecular Genetics of Microcephaly Primary Hereditary: an Overview

    brain sciences Review Molecular Genetics of Microcephaly Primary Hereditary: An Overview Nikistratos Siskos † , Electra Stylianopoulou †, Georgios Skavdis and Maria E. Grigoriou * Department of Molecular Biology & Genetics, Democritus University of Thrace, 68100 Alexandroupolis, Greece; [email protected] (N.S.); [email protected] (E.S.); [email protected] (G.S.) * Correspondence: [email protected] † Equal contribution. Abstract: MicroCephaly Primary Hereditary (MCPH) is a rare congenital neurodevelopmental disorder characterized by a significant reduction of the occipitofrontal head circumference and mild to moderate mental disability. Patients have small brains, though with overall normal architecture; therefore, studying MCPH can reveal not only the pathological mechanisms leading to this condition, but also the mechanisms operating during normal development. MCPH is genetically heterogeneous, with 27 genes listed so far in the Online Mendelian Inheritance in Man (OMIM) database. In this review, we discuss the role of MCPH proteins and delineate the molecular mechanisms and common pathways in which they participate. Keywords: microcephaly; MCPH; MCPH1–MCPH27; molecular genetics; cell cycle 1. Introduction Citation: Siskos, N.; Stylianopoulou, Microcephaly, from the Greek word µικρoκεϕαλi´α (mikrokephalia), meaning small E.; Skavdis, G.; Grigoriou, M.E. head, is a term used to describe a cranium with reduction of the occipitofrontal head circum- Molecular Genetics of Microcephaly ference equal, or more that teo standard deviations
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Reprogramming of Isocitrate Dehydrogenases Expression and Activity by the Androgen

    Reprogramming of Isocitrate Dehydrogenases Expression and Activity by the Androgen

    Author Manuscript Published OnlineFirst on May 8, 2019; DOI: 10.1158/1541-7786.MCR-19-0020 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 Reprogramming of isocitrate dehydrogenases expression and activity by the androgen 2 receptor in prostate cancer 3 4 Kevin Gonthier1,2, Raghavendra Tejo Karthik Poluri1,2, Cindy Weidmann1, Maude Tadros1, and 5 Étienne Audet-Walsh1,2,3 6 7 1 Endocrinology - Nephrology Research Axis, Centre de recherche du CHU de Québec - 8 Université Laval, Québec City, Canada 9 2 Department of molecular medicine, Faculty of Medicine, Université Laval, Québec City, 10 Canada 11 3 Centre de recherche sur le cancer de l’Université Laval, Québec City, Canada 12 13 Keywords: steroid; metabolism; glioma; nuclear receptor; castration-resistant prostate cancer, 14 IDH1, oncometabolism 15 16 Abbreviated title: Reprogramming of IDH activity by AR in PCa 17 18 Corresponding Author: Étienne Audet-Walsh, Centre de recherche du CHU de Québec, 2705 19 Boulevard Laurier, room R-4714, Québec City, QC, Canada, G1V 4G2 20 Phone: 1-418-525-4444 ext. 48678 ; e-mail : [email protected] 21 22 Disclosure statement: the authors declare no potential conflicts of interest. 1 Downloaded from mcr.aacrjournals.org on September 24, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 8, 2019; DOI: 10.1158/1541-7786.MCR-19-0020 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 23 Abstract 24 Mutations of the isocitrate dehydrogenase genes IDH1 and IDH2, key enzymes involved in 25 citrate metabolism, are important oncogenic events in several cancer types, including in 1-3% of 26 all prostate cancer (PCa) cases.