DOCSLIB.ORG

Identification and Validation of Novel and More Effective Choline Kinase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Validation of Novel and More Effective Choline Kinase www.nature.com/scientificreports OPEN Identifcation and validation of novel and more efective choline kinase inhibitors against Streptococcus pneumoniae Tahl Zimmerman1*, Valerie Chasten1, Juan Carlos Lacal2 & Salam A. Ibrahim1 Streptococcus pneumoniae choline kinase (sChoK) has previously been proposed as a drug target, yet the efectiveness of the frst and only known inhibitor of sChoK, HC-3, is in the millimolar range. The aim of this study was thus to further validate sChoK as a potential therapeutic target by discovering more powerful sChoK inhibitors. LDH/PK and colorimetric enzymatic assays revealed two promising sChoK inhibitor leads RSM-932A and MN58b that were discovered with IC50 of 0.5 and 150 μM, respectively, and were shown to be 2–4 magnitudes more potent than the previously discovered inhibitor HC-3. Culture assays showed that the minimum inhibitory concentration (MIC) of RSM- 932A and MN58b for S. pneumoniae was 0.4 μM and 10 μM, respectively, and the minimum lethal concentration (MLC) was 1.6 μM and 20 μM, respectively. Western blot monitoring of teichoic acid production revealed diferential patterns in response to each inhibitor. In addition, both inhibitors possessed a bacteriostatic mechanism of action, and neither interfered with the autolytic efects of vancomycin. Cells treated with MN58b but not RSM-932A were more sensitive to a phosphate induced autolysis with respect to the untreated cells. SEM studies revealed that MN58b distorted the cell wall, a result consistent with the apparent teichoic acid changes. Two novel and more highly potent putative inhibitors of sChoK, MN58b and RSM-932A, were characterized in this study. However, the efects of sChoK inhibitors can vary at the cellular level. sChoK inhibition is a promising avenue to follow in the development of therapeutics for treatment of S. pneumoniae. Te efectiveness of current therapeutics for pathogens such as S. pneumoniae has dropped with the emergence of resistant strains. Consequently, new methods for treating S. pneumoniae have to be developed continuously. Tis includes establishing novel targets for drug discovery eforts. Recently, choline kinase (ChoK) has been proposed as a drug target for Gram positive species generally 1 afer the frst ChoK inhibitor capable of inhibiting the growth of S. pneumoniae was discovered2,3. Like its eukaryotic counterparts, bacterial ChoKs phosphorylate choline (Cho) into phosphocholine (PCho). PCho is a precursor molecule that is utilized in the production of two types of teichoic acids: lipoteichoic acid (LTA) and cell wall teichoic acid (CTA)4,5. In S. pneumoniae, both LTA and CTA consist of the same types of polysaccharides; however, LTA is attached to a lipid and embedded in the cell membrane, and CTA is attached to the cell wall peptidoglycan layer in the cell wall 6. LTA is an important virulence factor 7, and production of this molecule has been validated as a drug target8. Choline is an essential nutrient for S. pneumoniae9, and the choline kinase of S. pneumoniae (sChoK) is an essential enzyme10. Te sChoK enzyme is an element of the pathway that mediates the decoration of teichoic acids with PCho via the intermediary CDP-choline. Genes that are part of this pathway are expressed via the lic gene locus. Te LicB gene expresses a Cho transporter which collects Cho from the external environment. LicA codes for sChoK, which phosphorylates Cho into PCho. LicC is a gene coding for cytidylyl transferase, which converts PCho into CDP-choline. Te LicD1 and LicD2 PCho transferases remove PCho from CDP-choline and attach them to N-acetylgalactosamine (GalNAc) residues located on pre-teichoic acid glycan subunits 11. Tese 1Food Microbiology and Biotechnology Laboratory, Department of Family and Consumer Sciences, College of Agriculture and Environmental Sciences, North Carolina A&T State University, 1601 East Market Street, Greensboro, NC 27411, USA. 2Instituto de Investigaciones Biomédicas, Consejo Superior de Investigaciones Científcas, c/ Arturo Duperier 4, 28029 Fuenlabrada, Madrid, Spain. *email: [email protected] SCIENTIFIC REPORTS | (2020) 10:15418 | https://doi.org/10.1038/s41598-020-72165-6 1 Vol.:(0123456789) www.nature.com/scientificreports/ Figure 1. (A) MN58b (green) and RSM-932A (red) docked onto the crystal structure of apo-sChoK (accession #4R77) as well as the positions of the natural substrates choline (blue) and AMP (yellow); (B) a close up view of the binding sites; (C) Structures of RSM-932A (1,1′-([1,1′-biphenyl]-4,4′-diylbis(methylene))bis(4-((4- chlorophenyl)(methyl)amino)quinolin-1-ium) bromide) and MN58b (1,4-[4–4′-Bis-{[4-(dimethylamine) pyridinium-1-yl]methyl}diphenyl]butane dibromide). residues are then polymerized by an unidentifed protein to form teichoic acid which is11 transported across the cell membrane acid fippase TacF. Te TacL ligase attaches teichoic polymers to a glycolipid anchor to form LTA7. Meanwhile, teichoic acid polymers are cross-linked to peptidoglycan to form WTA by the action of LCP phosphotransferases11. Te enzyme of S. pneumoniae has previously been proposed as a drug target3. However, the sChoK inhibitor 12 originally tested, Hemicholinium-3 (HC-3), was weak: HC-3 had IC50 and minimum inhibitory concentra- tion (MIC) values in the millimolar range3. Te aim of this study was to discover stronger inhibitors of sChoK in order to further establish sChoK as a target. Here, we present two compounds which strongly inhibit sChoK activity and S. pneumoniae growth and viability: MN58b and RSM-932A (Fig. 1C)13,14, two compounds known to inhibit human choline kinase (hChoK)14. Using S. pneumoniae as a model, we present evidence to demonstrate that employing sChoK inhibitors is a promising strategy for blocking the growth of S. pneumoniae cells. Tese inhibitors, in turn, were found to have downstream efects on teichoic acid production and assembly, on cell wall shape, and on the sensitivity of the cell to autolysis. SCIENTIFIC REPORTS | (2020) 10:15418 | https://doi.org/10.1038/s41598-020-72165-6 2 Vol:.(1234567890) www.nature.com/scientificreports/ Methods and materials Recombinant sChoK expression and purifcation. A pET28a/sChoK construct was generously pro- vided to us by the group of Dr. Yuxing Chen15 and transformed into BL21 (DE3) cells. Cells were cultured at 200 rpm at 37 °C until an O.D.600 of 0.6 was reached and then induced with 1 mM IPTG overnight at 25 °C. Cells were then harvested by centrifugation and stored at − 20 °C. Cell lysis was performed by suspending each gram of pellet with 5 mL of B-PER Complete Bacterial Protein Extraction Reagent (Termo-Scientifc) per gram of cell. Te enzyme sChoK was purifed using HisPur Ni-NTA Resin (Termo Scientifc). Determining steading state kinetic constants by LDH/PK. Purifed sChoK was used in these assays. Steady-state enzymatic assays were monitored with the pyruvate kinase/lactate dehydrogenase (PK/LDH) reac- tion. Te steady-state rate of ADP formation was calculated using an extinction coefcient of 6,200 M−1 cm−1 to determine linear reductions in NADH concentrations that were observed by absorbance at 340 nm. Measure- ments were carried out at 25 °C in a UV-Star 96-well plate (Greiner) placed in a Synergy HT microplate reader (Biotek). Each well contained 200 µL of a solution containing 22 nM sChoK enzyme, 100 mM Tris pH 8, 10 mM MgCl2, 150 mM NaCl, 150 mM KCl, 100 mM NADH, 0.66 mM phosphoenolpyruvate, 20 units of LDH, and 10 units of PK, choline. ATP. Km and Vmax values were derived by plotting initial velocities against the substrate concentration and ftting this data into Eq. (1). v0 = (Vmax[S])/(Km +[S]) (1) where v0 is the initial velocity [S] = substrate concentration; Vmax = maximum velocity; and Km is the concentration at half-maximal velocity. Te kcat was calculated by dividing the Vmax by the enzyme concentration. Determining IC50 by LDH/PK. Using the conditions described above, the concentration of choline was set to the Km and increasing amounts of inhibitor were tested. Percent inhibition was determined. Te IC50 was determined as the concentration of inhibitor required to reach 50% inhibition. Determining IC50 colorimetrically. When using cell extracts such as BL21 (DE3) extracts containing sChoK or S. pneumoniae extracts as the enzyme source, a colorimetric method was used to quantify Cho con- sumption and PCho production as described previously16. Determining MN58b and RSM-932A competitivity by LDH/pK. Te mechanism of action of the inhibitors with respect to each substrate was determined using a previously described method13,14. Briefy, using the IC50 of each inhibitor determined at the Km of choline, the concentration of one substrate was kept constant, and initial velocities were measured while varying the second substrate in the presence and absence of the inhibi- tor. Te percentage of inhibition (%I) was determined by dividing each initial velocity in the presence of the inhibitor with its corresponding initial velocity in the absence of compound. %I was plotted against concentra- tion and ftted using a two-parameter-ft nonlinear regression algorithm of GnuPlot v 4.3 into Eq. (2). %I = 100 × (([I]/Ki +[S][I]/αKsKi/(1 +[S]/Ks +[I]/Ki +[S][I]/αKsKi)) (2) where [S] is the concentration of the varied substrate, [I] is the concentration of inhibitor, Ks is the dissociation constant of the substrate (assumed to be equal to the K m), Ki is the dissociation constant of the inhibitor, and α is a numerical constant that measures the efect the substrate has on the binding of the inhibitor and vice versa. Docking of MN58b and RSM-932A onto sChoK. With regard to the kinetic data, MN58b and RSM- 932A were docked into the active site and choline site alone, respectively using apo-sChoK structure as a model (RCSB accession #4R77). Te entire active site was defned as all of the residues of sChoK known from the crystal structure of sChoK to make contact with both ATP (43, 90, 183, 89, 91, 31, 818, and 194) and choline (residue numbers 197, 251, 254, 268, 178, 213, 29, 176), while the choline site was defned as only those residues making contact with choline.
Load more

Recommended publications
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Dissecting the Telomere-Independent Pathways Underlying Human Cellular Senescence
    Dissecting the Telomere-Independent Pathways Underlying Human Cellular Senescence By Emilie Marie Isabelle Rovillain A thesis submitted to the University College of London for the degree of Doctor of Philosophy Department of Neurodegenerative diseases Institute of Neurology UCL Queen Square London WC1 3BG 2010 ABSTRACT Cellular senescence is an irreversible program of cell cycle arrest triggered in normal somatic cells in response to a variety of intrinsic and extrinsic stimuli including telomere attrition, DNA damage, physiological stress and oncogene activation. Finding that inactivation of the pRB and p53 pathways by SV40-LT antigen cooperates with hTERT to immortalize cells has allowed us to use a thermolabile mutant of SV40- LT to develop human fibroblasts where the cells are immortal if grown at 34oC but undergo an irreversible growth arrest within 5 days at 38oC. When these cells cease dividing, senescence-associated-β-galactosidase (SA-β-Gal) activity is induced and the growth-arrested cells have many features of senescent cells. Since these cells growth-arrest in a synchronous manner, I have used Affymetrix expression profiling to identify the genes differentially expressed upon senescence. This identified 816 up- and 961 down-regulated genes whose expression was reversed when growth arrest was abrogated. I have shown that senescence was associated with activation of the NF-B pathway and up-regulation of a number of senescence-associated-secretory- proteins including IL6. Perturbation of NF-κB signalling either by direct silencing of NF- B subunits or by upstream modulation overcame growth-arrest indicating that activation of NF-B signalling has a causal role in promoting senescence.
    [Show full text]
  • DATASHEET USA: [email protected]
    DATASHEET USA: [email protected] FOR IN VITRO RESEARCH USE ONLY Europe: [email protected] NOT FOR USE IN HUMANS OR ANIMALS China: [email protected] Choline kinase alpha Polyclonal Anbody Catalog number: 13520-1-AP Background Size: 39 μg/150 μl CHKA(Choline kinase alpha) is also named as CHK, CKI, EK(Ethanolamine kinase) Source: Rabbit and belongs to the choline/ethanolamine kinase family. Choline kinase (ATP:choline Isotype: IgG phosphotransferase) is a cytosolic enzyme that catalyzes the commied step in the Synonyms: synthesis of PC by the CDP-choline pathway. The enzyme catalyzes the CHKA; CHETK alpha, CHK, phosphorylaon of choline with ATP to form phosphocholine and CHKA, Choline kinase alpha, ADP(PMID:9506987). It has 2 isoforms produced by alternave splicing with the CK, CKI, EK, Ethanolamine molecular weight of 52 kDa and 50 kDa. kinase; Applications Tested applicaons: ELISA, WB, IHC, IP Cited applicaons: IHC, WB Species specificity: Human,Mouse,Rat; other species not tested. Cited species: Human, mouse, rat Caculated Choline kinase 439aa,52 kDa alpha MW: Immunohistochemical of paraffin- Observed Choline kinase 50 kDa,52 kDa embedded human liver using 13520- 1-AP(CHKA anbody) at diluon of alpha MW: 1:50 (under 10x lens) Posive WB detected in COLO 320 cells, mouse colon ssue Posive IP detected in Mouse spleen ssue Posive IHC detected in Human liver ssue Recommended diluon: WB: 1:200-1:2000 IP: 1:200-1:2000 IHC: 1:20-1:200 Applicaon key: WB = Western blong, IHC = Immunohistochemistry, IF = Immunofluorescence, IP = Immunoprecipitaon Immunohistochemical of paraffin- Immunogen information embedded human liver using 13520- 1-AP(CHKA anbody) at diluon of Immunogen: Ag4761 1:50 (under 40x lens) GenBank accession number: BC036471 Gene ID (NCBI): 1119 Full name: Choline kinase alpha Product information Purificaon method: Angen affinity purificaon Storage: PBS with 0.02% sodium azide and 50% glycerol pH 7.3.
    [Show full text]
  • Choline Kinase Inhibition As a Treatment Strategy for Cancers With
    Choline Kinase Inhibition as a Treatment Strategy of Cancers with Deregulated Lipid Metabolism Sebastian Trousil Imperial College London Department of Surgery and Cancer A dissertation submitted for the degree of Doctor of Philosophy 2 Declaration I declare that this dissertation is my own and original work, except where explicitly acknowledged. The copyright of this thesis rests with the author and is made available under a Creative Commons Attribution Non-Commercial No Derivatives licence. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the licence terms of this work. Abstract Aberrant choline metabolism is a characteristic shared by many human cancers. It is predominantly caused by elevated expression of choline kinase alpha, which catalyses the phosphorylation of choline to phosphocholine, an essential precursor of membrane lipids. In this thesis, a novel choline kinase inhibitor has been developed and its therapeutic potential evaluated. Furthermore the probe was used to elaborate choline kinase biology. A lead compound, ICL-CCIC-0019 (IC50 of 0.27 0.06 µM), was identified through a focused library screen. ICL-CCIC-0019 was competitive± with choline and non-competitive with ATP. In a selectivity screen of 131 human kinases, ICL-CCIC-0019 inhibited only 5 kinases more than 20% at a concentration of 10 µM(< 35% in all 131 kinases). ICL- CCIC-0019 potently inhibited cell growth in a panel of 60 cancer cell lines (NCI-60 screen) with a median GI50 of 1.12 µM (range: 0.00389–16.2 µM).
    [Show full text]
  • Functional Interactions Between Choline Kinase Α, Epidermal Growth
    Oncogene (2012) 31, 1431–1441 & 2012 Macmillan Publishers Limited All rights reserved 0950-9232/12 www.nature.com/onc ORIGINAL ARTICLE Functional interactions between Choline kinase a, epidermal growth factor receptor and c-Src in breast cancer cell proliferation T Miyake and SJ Parsons Department of Microbiology and Cancer Center, University of Virginia Health System, Charlottesville, VA, USA Epidermal growth factor receptor (EGFR) family mem- 1999b, 2000), implicating its function in tumorigenesis. bers and c-Src are co-overexpressed in many cancers. The The non-receptor tyrosine kinase, c-Src, is also over- synergistic effect of EGFR and c-Src has been shown in expressed in many of these same tumors, suggesting that the tumorigenesis of breast and other cancers. Reported the two tyrosine kinases may functionally interact. In mechanisms of synergy include transcriptional regulation breast tumors, for example, 70–100% overexpress c-Src, by STAT5b and the regulation of cellular ATP production with the majority of these tumors co-overexpressing one by mitochondrial protein COX II. Here, we report a new of the EGFR family members (HER1-4) (reviewed in mechanism of EGFR-c-Src synergy through choline Ishizawar and Parsons, 2004). Breast cancer cells or kinase a (CHKA). The first enzyme of the phosphatidyl murine fibroblasts that co-overexpress EGFR and c-Src choline production pathway, CHKA, is overexpressed in exhibit synergistic increases in anchorage-independent many cancers, and the product of the enzyme, phospho- growth in cell culture and development of tumors in choline, is also increased in tumor cells. In this report, mouse xenograft models than those overexpressing only we find that CHKA forms a complex with EGFR in a one of the pair (Maa et al., 1995; Biscardi et al., 1998).
    [Show full text]
  • Novel Non-Congeneric Derivatives of the Choline Kinase Alpha Inhibitor ICL-CCIC-0019
    pharmaceutics Article Novel Non-Congeneric Derivatives of the Choline Kinase Alpha Inhibitor ICL-CCIC-0019 Ning Wang 1, Diana Brickute 1, Marta Braga 1 , Chris Barnes 1, Haonan Lu 1 , Louis Allott 1,2,* and Eric O. Aboagye 1,* 1 Comprehensive Cancer Imaging Centre, Department of Surgery and Cancer, Faculty of Medicine, Imperial College London, Hammersmith Hospital, London W12 0NN, UK; [email protected] (N.W.); [email protected] (D.B.); [email protected] (M.B.); [email protected] (C.B.); [email protected] (H.L.) 2 Positron Emission Tomography Research Centre, Faculty of Health Sciences, University of Hull, Kingston upon Hull HU6 7RX, UK * Correspondence: [email protected] (L.A.); [email protected] (E.O.A.) Abstract: Choline kinase alpha (CHKA) is a promising target for the development of cancer therapeu- tics. We have previously reported ICL-CCIC-0019, a potent CHKA inhibitor with high cellular activity but with some unfavorable pharmacological properties. In this work, we present an active analogue of ICL-CCIC-0019 bearing a piperazine handle (CK146) to facilitate further structural elaboration of the pharmacophore and thus improve the biological profile. Two different strategies were evaluated in this study: (1) a prodrug approach whereby selective CHKA inhibition could be achieved through modulating the activity of CK146, via the incorporation of an "-(Ac) Lys motif, cleavable by elevated levels of histone deacetylase (HDAC) and cathepsin L (CTSL) in tumour cells; (2) a prostate-specific Citation: Wang, N.; Brickute, D.; membrane antigen (PSMA) receptor targeted delivery strategy.
    [Show full text]
  • Mitochondrial Diseases: Expanding the Diagnosis in the Era of Genetic Testing
    Saneto. J Transl Genet Genom 2020;4:384-428 Journal of Translational DOI: 10.20517/jtgg.2020.40 Genetics and Genomics Review Open Access Mitochondrial diseases: expanding the diagnosis in the era of genetic testing Russell P. Saneto1,2 1Center for Integrative Brain Research, Neuroscience Institute, Seattle, WA 98101, USA. 2Department of Neurology/Division of Pediatric Neurology, Seattle Children’s Hospital/University of Washington, Seattle, WA 98105, USA. Correspondence to: Dr. Russell P. Saneto, Department of Neurology/Division of Pediatric Neurology, Seattle Children’s Hospital/ University of Washington, 4800 Sand Point Way NE, Seattle, WA 98105, USA. E-mail: [email protected] How to cite this article: Saneto RP. Mitochondrial diseases: expanding the diagnosis in the era of genetic testing. J Transl Genet Genom 2020;4:348-428. http://dx.doi.org/10.20517/jtgg.2020.40 Received: 29 Jun 2020 First Decision: 27 Jul 2020 Revised: 15 Aug 2020 Accepted: 21 Aug 2020 Available online: 29 Sep 2020 Academic Editor: Andrea L. Gropman Copy Editor: Cai-Hong Wang Production Editor: Jing Yu Abstract Mitochondrial diseases are clinically and genetically heterogeneous. These diseases were initially described a little over three decades ago. Limited diagnostic tools created disease descriptions based on clinical, biochemical analytes, neuroimaging, and muscle biopsy findings. This diagnostic mechanism continued to evolve detection of inherited oxidative phosphorylation disorders and expanded discovery of mitochondrial physiology over the next two decades. Limited genetic testing hampered the definitive diagnostic identification and breadth of diseases. Over the last decade, the development and incorporation of massive parallel sequencing has identified approximately 300 genes involved in mitochondrial disease.
    [Show full text]
  • Selective Inhibition of Choline Kinase Simultaneously Attenuates MAPK and PI3K/AKT Signaling
    Oncogene (2010) 29, 139–149 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 $32.00 www.nature.com/onc ORIGINAL ARTICLE Selective inhibition of choline kinase simultaneously attenuates MAPK and PI3K/AKT signaling A Yalcin1,2, B Clem1, S Makoni1, A Clem1, K Nelson1, J Thornburg1, D Siow1, AN Lane1, SE Brock1, U Goswami1, JW Eaton1, S Telang1 and J Chesney1 1Department of Biochemistry and Molecular Biology, James Graham Brown Cancer Center (Molecular Targets Program), University of Louisville, Louisville, KY, USA and 2Department of Biochemistry, School of Veterinary Medicine, Uludag University, Bursa, Turkey Choline is an essential anabolic substrate for the synthesis Introduction of phospholipids. Choline kinase phosphorylates choline to phosphocholine that serves as a precursor for the production Human cancers have been found to transport and of phosphatidylcholine, the major phospholipid constituent of phosphorylate increased choline relative to adjacent membranes and substrate for the synthesis of lipid signaling normal tissues (Degani et al., 1986; Onodera et al., 1986; molecules. Nuclear magnetic resonance (NMR)-based meta- Ackerstaff et al., 2003; Eliyahu et al., 2007; Glunde and bolomic studies of human tumors have identified a marked Bhujwalla, 2007). The high concentration of phospho- increase in the intracellular concentration of phosphocholine choline observed in cancers is due, in part, to the growth relative to normal tissues. We postulated that the observed factor-activated Ras and phosphatidylinositol 3-kinase intracellular pooling of phosphocholine may be required to (PI3K) signaling cascades that stimulate the initial sustain the production of the pleiotropic lipid second enzyme of the cytidylyl diphosphate-choline (or Kenne- messenger, phosphatidic acid.
    [Show full text]
  • How Do Glycolytic Enzymes Favour Cancer Cell Proliferation by Nonmetabolic Functions?
    Oncogene (2015) 34, 3751–3759 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc REVIEW How do glycolytic enzymes favour cancer cell proliferation by nonmetabolic functions? H Lincet1,2,3 and P Icard1,4 Cancer cells enhance their glycolysis, producing lactate, even in the presence of oxygen. Glycolysis is a series of ten metabolic reactions catalysed by enzymes whose expression is most often increased in tumour cells. HKII and phosphoglucose isomerase (PGI) have mainly an antiapoptotic effect; PGI and glyceraldehyde-3-phosphate dehydrogenase activate survival pathways (Akt and so on); phosphofructokinase 1 and triose phosphate isomerase participate in cell cycle activation; aldolase promotes epithelial mesenchymal transition; PKM2 enhances various nuclear effects such as transcription, stabilisation and so on. This review outlines the multiple non-glycolytic roles of glycolytic enzymes, which are essential for promoting cancer cells' survival, proliferation, chemoresistance and dissemination. Oncogene (2015) 34, 3751–3759; doi:10.1038/onc.2014.320; published online 29 September 2014 INTRODUCTION implications in many other functions, such as apoptosis, In normal tissue, the vast majority of nonproliferating differen- detoxification, cell cycle control, signalling pathways and so on. tiated cells use oxidative phosphorylation (OXPHOS) for ATP production. These cells metabolise glucose to pyruvate through Hexokinases glycolysis, then oxidise this pyruvate through the tricarboxylic acid In the cytosol, glucose (or fructose) is phosphorylated by cycle, generating ATP through ATP synthase, the rate of the hexokinases (HK) (glucose kinase or fructose kinase) to glucose- production being coupled with proton transport and on oxygen 6-phosphate (G6P). HK catalye the first irreversible reaction of respiration.1 In contrast, rapidly proliferating tumour cells con- glycolysis.
    [Show full text]
  • Expression Profiling of Choline and Ethanolamine Kinases in MCF7, HCT116 and Hepg2 Cells, and the Transcriptional Regulation by Epigenetic Modification
    MOLECULAR MEDICINE REPORTS 11: 611-618, 2015 Expression profiling of choline and ethanolamine kinases in MCF7, HCT116 and HepG2 cells, and the transcriptional regulation by epigenetic modification CHUA SIANG LING1, KHOO BOON YIN2, SEE TOO WEI CUN1 and FEW LING LING1 1School of Health Sciences, Universiti Sains Malaysia, Kubang Kerian, Kelantan 16150; 2Institute for Research in Molecular Medicine, Universiti Sains Malaysia, Penang 11800, Malaysia Received December 10, 2013; Accepted September 4, 2014 DOI: 10.3892/mmr.2014.2707 Abstract. The function of choline kinase (CK) and etha- cell lines were varied. The effects of TSA treatment on the nolamine kinase (EK) is to catalyse the phosphorylation mRNA expression levels of ck and ek imply that ck and ek of choline and ethanolamine, respectively, in order to yield mRNA expression may be regulated by epigenetic modifica- phosphocholine (PCho) and phosphoethanolamine (PEtn). A tion. high expression level of PCho, due to elevated CK activity, has previously been associated with malignant transformation. In Introduction the present study, a quantitative polymerase chain reaction was performed to determine the mRNA expression profiles of ck Choline kinase (CK) and ethanolamine kinase (EK) are enzymes and ek mRNA variants in MCF7 breast, HCT116 colon and that initiate the first step in the Kennedy pathway, resulting in HepG2 liver cancer cells. The ck and ek mRNA expression the biosynthesis of phosphatidylcholine and phosphatidyletha- profiles showed that total ckα was expressed most abundantly nolamine (1). In the presence of Mg2+, CK and EK catalyse the in the HepG2 cells. The HCT116 cells exhibited the highest ATP-dependent phosphorylation of choline and ethanolamine ckβ and ek1 mRNA expression levels, whereas the highest into phosphocholine (PCho) and phoshoethanolamine (PEtn), ek2α mRNA expression levels were detected in the MCF7 respectively.
    [Show full text]
  • Hepatitis C Viral Replication Complex
    viruses Review Hepatitis C Viral Replication Complex Hui-Chun Li 1, Chee-Hing Yang 2 and Shih-Yen Lo 2,3,* 1 Department of Biochemistry, Tzu Chi University, Hualien 97004, Taiwan; [email protected] 2 Department of Laboratory Medicine and Biotechnology, Tzu Chi University, Hualien 97004, Taiwan; [email protected] 3 Department of Laboratory Medicine, Buddhist Tzu Chi General Hospital, Hualien 97004, Taiwan * Correspondence: [email protected]; Tel.: +886-3-8565301 (ext. 2322) Abstract: The life cycle of the hepatitis C virus (HCV) can be divided into several stages, including viral entry, protein translation, RNA replication, viral assembly, and release. HCV genomic RNA replication occurs in the replication organelles (RO) and is tightly linked to ER membrane alterations containing replication complexes (proteins NS3 to NS5B). The amplification of HCV genomic RNA could be regulated by the RO biogenesis, the viral RNA structure (i.e., cis-acting replication elements), and both viral and cellular proteins. Studies on HCV replication have led to the development of direct-acting antivirals (DAAs) targeting the replication complex. This review article summarizes the viral and cellular factors involved in regulating HCV genomic RNA replication and the DAAs that inhibit HCV replication. Keywords: hepatitis C virus; replication organelles; NS3 to NS5B proteins; direct-acting antivirals 1. Introduction Infection with the hepatitis C virus (HCV) can cause chronic hepatitis C (CHC), Citation: Li, H.-C.; Yang, C.-H.; Lo, liver cirrhosis, hepatocellular carcinoma, and other extra-hepatic manifestations. The S.-Y. Hepatitis C Viral Replication prevalence of CHC patients worldwide was around 71 million in 2017 (https://www.who.
    [Show full text]