Positron Emission Tomography Imaging of Hepatocellular Carcinoma with Radiolabeled Choline

Total Page:16

File Type:pdf, Size:1020Kb

Load more

POSITRON EMISSION TOMOGRAPHY IMAGING OF HEPATOCELLULAR CARCINOMA WITH RADIOLABELED CHOLINE By YU KUANG Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Dissertation Adviser: Zhenghong Lee, Ph.D. Department of Biomedical Engineering CASE WESTERN RESERVE UNIVERSITY May, 2009 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of _____________________________________________________ candidate for the ______________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. To my parents 献给我亲爱的父母 ii Table of Contents Table of Contents ....................................................................................................................... i List of Tables ........................................................................................................................... xi List of Figures ......................................................................................................................... xii Acknowledgments................................................................................................................... xv List of Abbreviations ............................................................................................................. xvi Abstract ................................................................................................................................ xviii Chapter 1 Introduction .............................................................................................................. 1 1.1 Molecular Imaging of Cancer .................................................................................... 1 1.1.1 Positron emission tomography for cancer imaging ................................................. 1 1.1.2 Molecular imaging modalities ................................................................................. 3 1.1.3 Positron emission tomography imaging for hepatocellular carcinoma .................... 7 1.2 Basic Principle of Positron Emission Tomography ................................................... 8 1.2.1 Positron emission and annihilation ..................................................................... 8 1.2.2 511 keV photon interactions in matter .............................................................. 10 1.2.2.1 Compton scattering ....................................................................................... 10 1.2.2.2 Rayleigh scattering........................................................................................... 12 1.2.2.3 Photoelectric effect .......................................................................................... 12 1.2.3 Data collection .................................................................................................. 13 i 1.2.3.1 Coincidence detection ...................................................................................... 13 1.2.3.2 Electronic timing window ................................................................................ 14 1.2.3.3 Time-of-flight .................................................................................................. 14 1.2.4 Detectors and scanner design ............................................................................ 15 1.2.4.1 Scintillation crystals ......................................................................................... 15 1.2.4.2 Dead time ......................................................................................................... 17 1.2.4.3 PET/CT ............................................................................................................ 18 1.2.4.4 Collimation ...................................................................................................... 18 1.2.5 LORs and projection data ................................................................................. 19 1.2.5.1 Lines of response (LORs) ................................................................................ 19 1.2.5.2 Organization of data ......................................................................................... 20 1.2.5.3 Projections and sinograms ............................................................................... 21 1.2.6 Image reconstruction ......................................................................................... 22 1.2.6.1 Forward problem .............................................................................................. 22 1.2.6.2 Radon transform............................................................................................... 22 1.2.6.3 Analytical reconstruction ................................................................................. 23 1.2.6.3.1 Simple backprojection ............................................................................... 23 1.2.6.3.2 Filtered backprojection (FBP) ................................................................... 24 1.2.6.4 Iterative reconstruction .................................................................................... 24 1.2.6.4.1 Five basic steps.......................................................................................... 24 ii 1.2.6.4.2 Maximum-likelihood expectation-maximization ...................................... 25 1.2.7 Attenuation correction ........................................................................................... 27 1.2.8 Scatter and randoms .......................................................................................... 28 1.2.8.1 Coincidence events .......................................................................................... 28 1.2.8.2 Scatter Correction ............................................................................................ 30 1.2.8.3 Random Correction .......................................................................................... 30 1.3 Review of the literatures ............................................................................................... 31 1.3.1 Hepatitis B viral infection induced hepatocellular carcinoma ............................... 31 1.3.1.1 Chronic hepatitis B viral Infection and hepatocellular carcinoma ................... 31 1.3.1.2 Woodchuck hepatitis virus infection induced woodchuck Model of hepatocellular carcinoma ............................................................................................. 34 1.3.2 Medical imaging of hepatocellular carcinoma ....................................................... 36 1.3.2.1 Diagnosis techniques for hepatocellular carcinoma ....................................... 36 1.3.2.2 Tumor glucose metabolism and FDG-PET imaging on cancer ....................... 38 1.3.2.3 Tumor-associated de novo fatty acid synthesis ............................................... 39 1.3.3 Imaging lipid synthesis in Cancer with PET .......................................................... 43 1.4 Organization of the thesis ............................................................................................. 45 Chapter 2 2-Deoxy-2-[18F]-fluoro-D-glucose Positron Emission Tomography Imaging of Hepatocellular Carcinoma ...................................................................................................... 46 2.1 Introduction ................................................................................................................... 46 iii 2.2 Materials and methods .................................................................................................. 48 2.2.1 Materials ................................................................................................................ 48 2.2.2 Animals .................................................................................................................. 48 2.2.3 Radiopharmaceuticals ............................................................................................ 49 2.2.4 Imaging protocol .................................................................................................... 49 2.2.5 Image analysis ........................................................................................................ 50 2.2.6 Histology ................................................................................................................ 51 2.2.7 Tissue excision ....................................................................................................... 51 2.2.8 Hexokinase activity assay ...................................................................................... 52 2.2.9 Glucose-6-phosphatase activity assay.................................................................... 53 2.2.10 Statistical Analysis ............................................................................................... 54 2.3 Results ........................................................................................................................... 54 2.3.1 PET imaging .......................................................................................................... 54 2.3.2 Enzyme activity ....................................................................................................
Recommended publications
  • Identification of a Non-LTR Retrotransposon from the Gypsy Moth

    Identification of a Non-LTR Retrotransposon from the Gypsy Moth

    Insect Molecular Biology (1999) 8(2), 231-242 Identification of a non-L TR retrotransposon from the gypsy moth K. J. Garner and J. M. Siavicek sposons (Boeke & Corces, 1989), or retroposons USDA Forest Service, Northeastern Research Station, (McClure, 1991). Many non-L TR retrotransposons Delaware, Ohio, U.S.A. have been described in insects, including the Doc (O'Hare et al., 1991), F (Di Nocera & Casari, 1987), I (Fawcett et al., 1986) and jockey (Priimiigi et al., 1988) Abstract elements of Drosophila melanogaster, the T1Ag A family of highly repetitive elements, named LDT1, (Besansky, 1990) and Q (Besansky et al., 1994) ele- has been identified in the gypsy moth, Lymantria ments of Anopheles gambiae, and the R1Bm (Xiong & dispar. The complete element is 5.4 kb in length and Eickbush, 1988a) and R2Bm (Burke et al., 1987) lacks long-terminal repeats, The element contains two families of ribosomal DNA insertions in Bombyx mori. open reading frames with a significant amino acid Gypsy moths (Lymantria dispar) are currently wide- sequence similarity to several non-L TR retrotrans- spread forest pests in the north-eastern United States posons. The first open reading frame contains a and the adjacent regions of Canada. Population region that potentially encodes a polypeptide similar markers have been sought to distinguish the North to DNA-binding GAG-like proteins. The second American gypsy moths introduced from Europe in 1869 encodes a polypeptide resembling both endonuclease from those recently introduced from Asia (Bogdano- and reverse transcriptase sequences. A" members of wicz et al., 1993; Pfeifer et al., 1995; Garner & Siavicek, the LDT1 element family sequenced thus far have poly- 1996; Schreiber et al., 1997).
  • The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease

    The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease

    The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease by Sepehr Ehsani A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto © Copyright by Sepehr Ehsani 2012 The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease Sepehr Ehsani Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto 2012 Abstract The cellular prion protein (PrPC) is unique amongst mammalian proteins in that it not only has the capacity to aggregate (in the form of scrapie PrP; PrPSc) and cause neuronal degeneration, but can also act as an independent vector for the transmission of disease from one individual to another of the same or, in some instances, other species. Since the discovery of PrPC nearly thirty years ago, two salient questions have remained largely unanswered, namely, (i) what is the normal function of the cellular protein in the central nervous system, and (ii) what is/are the factor(s) involved in the misfolding of PrPC into PrPSc? To shed light on aspects of these questions, we undertook a discovery-based interactome investigation of PrPC in mouse neuroblastoma cells (Chapter 2), and among the candidate interactors, identified two members of the ZIP family of zinc transporters (ZIP6 and ZIP10) as possessing a PrP-like domain. Detailed analyses revealed that the LIV-1 subfamily of ZIP transporters (to which ZIPs 6 and 10 belong) are in fact the evolutionary ancestors of prions (Chapter 3).
  • Using Rnai to Elucidate Mechanisms of Human Disease

    Using Rnai to Elucidate Mechanisms of Human Disease

    Cell Death and Differentiation (2008) 15, 809–819 & 2008 Nature Publishing Group All rights reserved 1350-9047/08 $30.00 www.nature.com/cdd Review From sequence to function: using RNAi to elucidate mechanisms of human disease NM Wolters1 and JP MacKeigan*,1 RNA interference (RNAi) has emerged as one of the most powerful tools for functionally characterizing large sets of genomic data. Capabilities of RNAi place it at the forefront of high-throughput screens, which are able to span the human genome in search of novel targets. Although RNAi screens have been used to elucidate pathway components and discover potential drug targets in lower organisms, including Caenorhabditis elegans and Drosophila, only recently has the technology been advanced to a state in which large-scale screens can be performed in mammalian cells. In this review, we will evaluate the major advancements in the field of mammalian RNAi, specifically in terms of high-throughput assays. Crucial points of experimental design will be highlighted, as well as suggestions as to how to interpret and follow-up on potential cell death targets. Finally, we assess the prospective applications of high-throughput screens, the data they are capable of generating, and the potential for this technique to further our understanding of human disease. Cell Death and Differentiation (2008) 15, 809–819; doi:10.1038/sj.cdd.4402311; published online 18 January 2008 The sequencing of the human genome ushered a new era into maintaining the balance between cell survival, cell death, the field of modern biology; it is now possible to elucidate and autophagy represents a crucial regulatory point in human molecular pathways relevant to development and disease health and that when this balance is tipped, a variety of with a breadth never before seen.
  • The Beaver's Phylogenetic Lineage Illuminated by Retroposon Reads

    The Beaver's Phylogenetic Lineage Illuminated by Retroposon Reads

    www.nature.com/scientificreports OPEN The Beaver’s Phylogenetic Lineage Illuminated by Retroposon Reads Liliya Doronina1,*, Andreas Matzke1,*, Gennady Churakov1,2, Monika Stoll3, Andreas Huge3 & Jürgen Schmitz1 Received: 13 October 2016 Solving problematic phylogenetic relationships often requires high quality genome data. However, Accepted: 25 January 2017 for many organisms such data are still not available. Among rodents, the phylogenetic position of the Published: 03 March 2017 beaver has always attracted special interest. The arrangement of the beaver’s masseter (jaw-closer) muscle once suggested a strong affinity to some sciurid rodents (e.g., squirrels), placing them in the Sciuromorpha suborder. Modern molecular data, however, suggested a closer relationship of beaver to the representatives of the mouse-related clade, but significant data from virtually homoplasy- free markers (for example retroposon insertions) for the exact position of the beaver have not been available. We derived a gross genome assembly from deposited genomic Illumina paired-end reads and extracted thousands of potential phylogenetically informative retroposon markers using the new bioinformatics coordinate extractor fastCOEX, enabling us to evaluate different hypotheses for the phylogenetic position of the beaver. Comparative results provided significant support for a clear relationship between beavers (Castoridae) and kangaroo rat-related species (Geomyoidea) (p < 0.0015, six markers, no conflicting data) within a significantly supported mouse-related clade (including Myodonta, Anomaluromorpha, and Castorimorpha) (p < 0.0015, six markers, no conflicting data). Most of an organism’s phylogenetic history is fossilized in their heritable genomic material. Using data from genome sequencing projects, particularly informative regions of this material can be extracted in sufficient num- bers to resolve the deepest history of speciation.
  • A Field Guide to Eukaryotic Transposable Elements

    A Field Guide to Eukaryotic Transposable Elements

    GE54CH23_Feschotte ARjats.cls September 12, 2020 7:34 Annual Review of Genetics A Field Guide to Eukaryotic Transposable Elements Jonathan N. Wells and Cédric Feschotte Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York 14850; email: [email protected], [email protected] Annu. Rev. Genet. 2020. 54:23.1–23.23 Keywords The Annual Review of Genetics is online at transposons, retrotransposons, transposition mechanisms, transposable genet.annualreviews.org element origins, genome evolution https://doi.org/10.1146/annurev-genet-040620- 022145 Abstract Annu. Rev. Genet. 2020.54. Downloaded from www.annualreviews.org Access provided by Cornell University on 09/26/20. For personal use only. Copyright © 2020 by Annual Reviews. Transposable elements (TEs) are mobile DNA sequences that propagate All rights reserved within genomes. Through diverse invasion strategies, TEs have come to oc- cupy a substantial fraction of nearly all eukaryotic genomes, and they rep- resent a major source of genetic variation and novelty. Here we review the defining features of each major group of eukaryotic TEs and explore their evolutionary origins and relationships. We discuss how the unique biology of different TEs influences their propagation and distribution within and across genomes. Environmental and genetic factors acting at the level of the host species further modulate the activity, diversification, and fate of TEs, producing the dramatic variation in TE content observed across eukaryotes. We argue that cataloging TE diversity and dissecting the idiosyncratic be- havior of individual elements are crucial to expanding our comprehension of their impact on the biology of genomes and the evolution of species. 23.1 Review in Advance first posted on , September 21, 2020.
  • Identification and Validation of Novel and More Effective Choline Kinase

    Identification and Validation of Novel and More Effective Choline Kinase

    www.nature.com/scientificreports OPEN Identifcation and validation of novel and more efective choline kinase inhibitors against Streptococcus pneumoniae Tahl Zimmerman1*, Valerie Chasten1, Juan Carlos Lacal2 & Salam A. Ibrahim1 Streptococcus pneumoniae choline kinase (sChoK) has previously been proposed as a drug target, yet the efectiveness of the frst and only known inhibitor of sChoK, HC-3, is in the millimolar range. The aim of this study was thus to further validate sChoK as a potential therapeutic target by discovering more powerful sChoK inhibitors. LDH/PK and colorimetric enzymatic assays revealed two promising sChoK inhibitor leads RSM-932A and MN58b that were discovered with IC50 of 0.5 and 150 μM, respectively, and were shown to be 2–4 magnitudes more potent than the previously discovered inhibitor HC-3. Culture assays showed that the minimum inhibitory concentration (MIC) of RSM- 932A and MN58b for S. pneumoniae was 0.4 μM and 10 μM, respectively, and the minimum lethal concentration (MLC) was 1.6 μM and 20 μM, respectively. Western blot monitoring of teichoic acid production revealed diferential patterns in response to each inhibitor. In addition, both inhibitors possessed a bacteriostatic mechanism of action, and neither interfered with the autolytic efects of vancomycin. Cells treated with MN58b but not RSM-932A were more sensitive to a phosphate induced autolysis with respect to the untreated cells. SEM studies revealed that MN58b distorted the cell wall, a result consistent with the apparent teichoic acid changes. Two novel and more highly potent putative inhibitors of sChoK, MN58b and RSM-932A, were characterized in this study.
  • Mg-SINE: a Short Interspersed Nuclear Element from the Rice Blast Fungus, Magnaporthe Grisea (Transposon/Repeated DNA) PRADEEP KACHROO*, SALLY A

    Mg-SINE: a Short Interspersed Nuclear Element from the Rice Blast Fungus, Magnaporthe Grisea (Transposon/Repeated DNA) PRADEEP KACHROO*, SALLY A

    Proc. Natl. Acad. Sci. USA Vol. 92, pp. 11125-11129, November 1995 Genetics Mg-SINE: A short interspersed nuclear element from the rice blast fungus, Magnaporthe grisea (transposon/repeated DNA) PRADEEP KACHROO*, SALLY A. LEONGt, AND BHARAT B. CHATTOO*t *Department of Microbiology and Biotechnology Center, Faculty of Science, M. S. University of Baroda, Baroda 390 002, India; and tU.S. Department of Agriculture-Agricultural Research Service Plant Disease Research Unit, 1630 Linden Drive, University of Wisconsin, Madison, WI 53706 Communicated by M. S. Swaminathan, M. S. Swaminathan Research Foundation, Madras, India, June 28, 1995 ABSTRACT A short interspersed nuclear element, Mg- Magnaporthe grisea, an ascomycetous fungus responsible for SINE, was isolated and characterized from the genome of the the blast disease of rice (Oryza sativa), is known to generate rice blast fungus, Magnaporthe grisea. Mg-SINE was isolated new pathogenic variants at a high frequency (15). Various as an insertion element within Pot2, an inverted-repeat trans- mechanisms have been postulated to explain pathogenic vari- poson from M. grisea and shows typical features of a mam- ability in this fungus (15-17), although its molecular basis malian SINE. Mg-SINE is present as a 0.47-kb interspersed remains elusive. We initiated an analysis of repeated DNA sequence at "100 copies per haploid genome in both rice and sequences of M. grisea in order to delineate their role in non-rice isolates of M. grisea, indicating a common evolution- genome organization and generation of variability. We report ary origin. Secondary structure analysis ofMg-SINE revealed here the presence of a SINE sequence in the genome of M.
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
  • 5' Exonuclease ERL1 in Chloroplast Ribosomal RNA

    5' Exonuclease ERL1 in Chloroplast Ribosomal RNA

    Dissertation zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) im Fachbereich 18 - Naturwissenschaften der Universität Kassel vorgelegt von: Heiko Tobias Schumacher Kassel im Mai 2009 Datum der Disputation: 16. Juli 2009 Die Natur ist aller Meister Meister, sie zeigt uns erst den Geist der Geister Johann Wolfgang v. Goethe Erklärung Hiermit versichere ich, dass ich die vorliegende Dissertation selbständig und ohne unerlaubte Hilfe angefertigt und andere als die in der Dissertation angegebenen Hilfsmittel nicht benutzt habe. Alle Stellen, die wörtlich oder sinngemäß aus veröffentlichten oder unveröffentlichten Schriften entnommen sind, habe ich als solche kenntlich gemacht. Kein Teil dieser Arbeit ist in einem anderen Promotions- oder Habilitationsverfahren verwendet worden. Kassel, den 03. Mai 2009 __________________________________ Heiko Tobias Schumacher Zusätzliche Erklärung über kooperative Arbeiten und Publikation Teile der in dieser Dissertation präsentierten Resultate sind das Ergebnis kooperativer Arbeiten von Heiko Tobias Schumacher (Universität Kassel) und Jutta Maria Helm (Universität für Bodenkultur Wien) am Institut für Molekularbiologie und Biotech- nologie in Heraklion, Griechenland. Die folgenden Arbeiten wurden von Jutta Maria Helm durchgeführt: • Herstellung transgener Nicotiana benthamiana-Pflanzen zur Überexpression bzw. Suppression von ERL1 (vergl. Abschnitt 2.2.6.). • Herstellung doppelt-homozygoter Kreuzungen zwischen der GFP-exprimieren- den Nicotiana benthamiana-Linie GFP 6.4 mit ERL1-überexprimierenden Pflan- zen (vergl. Abschnitt 3.3.2.). • Chlorophyll a Fluoreszenz-Messungen zur Charakterisierung grundlegender bioenergetischer Parameter in ERL1-überexprimierenden Pflanzen (vergl. Ab- schnitt 3.4.3.). • Klonierung kleiner ribosomaler RNAs zur Analyse der 3’-Enden pflanzlicher 5.8S, 5S und 4.5S rRNAs (vergl. Abschnitte 2.2.11. und 3.6.1.). Der Elektronenmikroskop-Service wurde von Eva Papadogiorgaki geleitet.
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Dissecting the Telomere-Independent Pathways Underlying Human Cellular Senescence

    Dissecting the Telomere-Independent Pathways Underlying Human Cellular Senescence

    Dissecting the Telomere-Independent Pathways Underlying Human Cellular Senescence By Emilie Marie Isabelle Rovillain A thesis submitted to the University College of London for the degree of Doctor of Philosophy Department of Neurodegenerative diseases Institute of Neurology UCL Queen Square London WC1 3BG 2010 ABSTRACT Cellular senescence is an irreversible program of cell cycle arrest triggered in normal somatic cells in response to a variety of intrinsic and extrinsic stimuli including telomere attrition, DNA damage, physiological stress and oncogene activation. Finding that inactivation of the pRB and p53 pathways by SV40-LT antigen cooperates with hTERT to immortalize cells has allowed us to use a thermolabile mutant of SV40- LT to develop human fibroblasts where the cells are immortal if grown at 34oC but undergo an irreversible growth arrest within 5 days at 38oC. When these cells cease dividing, senescence-associated-β-galactosidase (SA-β-Gal) activity is induced and the growth-arrested cells have many features of senescent cells. Since these cells growth-arrest in a synchronous manner, I have used Affymetrix expression profiling to identify the genes differentially expressed upon senescence. This identified 816 up- and 961 down-regulated genes whose expression was reversed when growth arrest was abrogated. I have shown that senescence was associated with activation of the NF-B pathway and up-regulation of a number of senescence-associated-secretory- proteins including IL6. Perturbation of NF-κB signalling either by direct silencing of NF- B subunits or by upstream modulation overcame growth-arrest indicating that activation of NF-B signalling has a causal role in promoting senescence.
  • Sva Elements: Hominid Specific Retrotransposons

    Sva Elements: Hominid Specific Retrotransposons

    Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2006 SVA elements: hominid specific etrr otransposons Hui Wang Louisiana State University and Agricultural and Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Recommended Citation Wang, Hui, "SVA elements: hominid specific er trotransposons" (2006). LSU Doctoral Dissertations. 2016. https://digitalcommons.lsu.edu/gradschool_dissertations/2016 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. SVA ELEMENTS: HOMINID SPECIFIC RETROTRANSPOSONS A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Department of Biological Sciences By Hui Wang B.S., Shanghai Jiao Tong University, P.R.China, 2000 M.S., Shanghai Jiao Tong University, P.R.China, 2003 December 2006 ACKNOWLEDGEMENTS I would like to thank Dr. Mark A. Batzer, my advisor, for his continuous guidance, constant encouragement, and financial support during my Ph.D study at LSU. It is my great pleasure to learn from and work with such a knowledgeable, considerate, and helpful scholar. I want to express my sincere gratitude to my committee members, Dr. David Donze, Dr. Joomyeong Kim, Dr. Stephania Cormier and Dr. Karin Peterson. I would like to thank all of them for kindly serving on my committee. Also I want to thank members in the Batzer’s laboratory for their scientific guidance and friendship, especially to Dr.