DOCSLIB.ORG

SLC22A5 Mutations in a Patient with Systemic Primary Carnitine Deficiency: the First Korean Case Confirmed by Biochemical and Molecular Investigation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SLC22A5 Mutations in a Patient with Systemic Primary Carnitine Deficiency: the First Korean Case Confirmed by Biochemical and Molecular Investigation Available online at www.annclinlabsci.org 424 Annals of Clinical & Laboratory Science, vol. 42, no. 4, 2012 SLC22A5 Mutations in a Patient with Systemic Primary Carnitine Deficiency: The First Korean Case Confirmed by Biochemical and Molecular Investigation Young Ahn Yoon1, Dong Hwan Lee2, Chang-Seok Ki1, Soo-Youn Lee1, Jong-Won Kim1, Yong-Wha Lee3, and Hyung-Doo Park1 1Department of Laboratory Medicine and Genetics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul; 2Department of Pediatrics, Soonchunhyang University College of Medicine, Seoul, Korea; 3Depart- ment of Laboratory Medicine and Genetics, Soonchunhyang University Bucheon Hospital, Soonchunhyang University College of Medicine, Bucheon, Korea. Abstract. Systemic primary carnitine deficiency (CDSP) is a rare autosomal recessive disorder that pres- ents episodic periods of hypoketotic hypoglycemia. The main symptoms of CDSP are skeletal and cardiac myopathy. CDSP is caused by a defect in plasma membrane uptake of carnitine, ultimately caused by the SLC22A5 gene. We report the case of a Korean patient with CDSP. He had an abnormal free carnitine level of 5.56 µmol/L (reference range, RR 10.4~87.1 µmol/L) and a palmitoylcarnitine level of 0.27 µmol/L (RR 0.5~9.7 µmol/L) in a newborn screening test. The patient showed an ammonia level of 129.4 ug/dL (RR, 25~65 ug/dL), a lactate level of 4.5 mmol/L (RR, 0.5-2.2 mmol/L), and a free carnitine level of 10.3 µmol/L (RR, 36-74 µmol/L) in blood. After PCR-sequencing analysis of the SLC22A5 gene, the patient was found to be a compound heterozygote for c.506G>A (p.R169Q) and c.1400C>G (p.S467C) muta- tions. These missense mutations are reported previously. The patient was started on L-carnitine supplement after CDSP diagnosis. The patient was treated with L-carnitine to reach a normal free carnitine level and has remained asymptomatic up to the current age of 21 months. The plasma free carnitine level normalized to 66.6 µmol/L at 4 weeks after treatment. To the best of our knowledge, this is the first report of a CDSP patient confirmed by molecular genetic investigation. Key words: Systemic primary carnitine deficiency,SLC22A5 , OCTN2, mutation, Korea Introduction of them originate in the diet. One member of the organic cation transporter (OCTN) family, Fatty acid oxidation in mitochondria provides an OCTN2, plays an important role in moving carni- important source of energy for heart and skeletal tine across the cell membrane. muscles. Carnitine (3-hydroxy-4-trimethylamino- butyric acid) plays an essential role in transporting Systemic primary carnitine deficiency (CDSP, long-chain fatty acids from the cytosol to the mito- OMIM #212140) is an autosomal recessive disor- chondrial matrix, where fatty acid oxidation takes der of the carnitine cycle caused by mutations in place. While some carnitines are synthesized from the SLC22A5 gene that encodes the high-affinity lysine and methionine in the liver and kidney, most carnitine transporter, OCTN2 [1]. The prevalence of CDSP is approximately 1 in 40,000 [2]. Address correspondence to Hyung-Doo Park, MD, PhD; Department Deficiency of carnitine transporters results in uri- of Laboratory Medicine and Genetics; Samsung Medical Center; Sungkyunkwan University School of Medicine, 50 Irwon-dong, nary carnitine loss, low serum free carnitine levels, Gangnam-gu, Seoul, 135-710, Korea; tel: +82-2-3410-0290; fax: +82- 2-3410-2719; e-mail: [email protected] or to Yong-Wha and decreased intracellular carnitine accumula- Lee, M.D., Ph.D.; Department of Laboratory Medicine and Genetics; tion. Since carnitine is needed for the entry of long- Soonchunhyang University Bucheon Hospital; Soonchunhyang University College of Medicine, 1174 Jung-dong, Wonmi-gu, chain fatty acids into mitochondria, carnitine defi- Bucheon, 420-767, Korea; tel: +82-32-621-5943; fax: +82-32-621- ciency diminishes the ability to use fat as an energy 5944; e-mail: [email protected] source during periods of stress and fasting. Over 0091-7370/12/0400-424. © 2012 by the Association of Clinical Scientists, Inc. SLC22A5 mutations in Korea 425 Table 1. Primer sequences for mutation analysis of the SLC22A5 gene. Exon Primer Sequence (5’→3’) Primer Sequence (5’→3’) 1 1-1F GTCGTGCGCCCTATGTAAG 1-1R CGAGAAGTTGGCGATGGT 1 1-2F CTGTCCTCCGTGTTCCTGAT 2-2R GTCTCCATCGCTAGGGTGTT 2 2F GGGGCCTACAATGCTATGAA 2R CCCTGCGCTGAAAGAATACTA 3 3F CTGGCAACACTGTTCACACC 3R CTGGTCTCATGTCTGGCTCA 4 4F CCCTAGCGCCATGAACTTAG 4R TTGGCTCTTTTGAGTGTGGA 5 5F GATGGCAACACTGCTCTTCA 5R GTGAGCAGGGAGGACTTCAG 6 6F GCTAAGATGCCAGGGATTCA 6R TTCTGAGGTTCCATCCCATT 7 7F TGAAGTAAGACGCAGGGTTACA 7R GCTGTGATGGGCTTGATTTT 8 8F AGCCTCCTTTCAGCAATCAA 8R GGATGGAGCCCATGTACTGT 9 9F CCAGAGTCCTGGGAGCATAA 9R GGCTACTGCCATGGAGATGT 10 10F CTGCTGCAGGATTCTCTTCC 10R TGTAGGTAGCCCCAGTGTCC half of the known cases initially present with pro- Materials and Methods gressive heart failure and generalized muscle weak- ness. The onset age of these symptoms ranges from The male patient was born at 39 weeks and 3 days 12 months to 7 years. During the first year of life, of gestation to healthy non-consanguineous Korean affected patients develop acute metabolic decom- parents. The weight of the patient at birth was 3700 pensation with hypoketotic hypoglycemia, Reye g (75-90th percentile). The family history was un- syndrome, and sudden unexpected infant death remarkable. The patient was vaginally delivered [3]. and is the third child of his parents. He was re- ferred to our hospital because low free carnitine CDSP is diagnosed by identifying low serum free (C0, the marker of primary carnitine deficiency) carnitine levels. It is confirmed by measuring de- and palmitoylcarnitine (C16) levels were detected creased carnitine transporter activity in skin fibro- in a dried blood spot of the newborn screening test. blast or by a molecular test of the SLC22A5 gene on In acylcarnitine analysis by tandem mass spec- 5q31.1-32 [4,5]. SLC22A5 expands about 30kb and trometry, the free carnitine level was 5.56 µmol/L encodes a polypeptide of 557 amino acids that is (reference range, RR, 10.4~87.1 µmol/L) and pal- composed of 10 exons [6,7]. Hydropathy analysis mitoylcarnitine was 0.27 µmol/L (RR, 0.5~9.7 has suggested that the OCTN2 carnitine trans- µmol/L). Additional biochemical analyses were porter builds up 12 transmembrane spanning do- performed on the patient. mains with both the N- and C-termini facing the cytoplasm [8]. Various mutations in the SLC22A5 A molecular defect in the SLC22A5 gene was inves- gene have been identified in patients with CDSP tigated to confirm the CDSP diagnosis. After ob- [1,9]. Oral carnitine supplements of 100mg/kg/day taining informed consent from the parents, blood can normalize serum free carnitine levels and im- samples were collected from the patient. Genomic prove the accompanying symptoms with potential- DNA was isolated from peripheral blood leuko- ly excellent clinical outcomes [10,11]. Here, we cytes using a Wizard genomic DNA purification present the first Korean patient with CDSP who kit according to the manufacturer’s instructions was confirmed by biochemical and molecular (Promega, Madison, WI). The SLC22A5 gene was analysis. 426 Annals of Clinical & Laboratory Science, vol. 42, no. 4, 2012 Figure 1. Direct sequencing of the SLC22A5 gene in the patient revealed 2 compound heterozygous mutations: c.506G>A (p.R169Q) and c.1400C>G (p. S467C). amplified by PCR using primers designed by the The patient was started on L-carnitine supplement authors (Table 1) and a Thermal Cycler 9700 after CDSP diagnosis. The plasma free carnitine (Applied Biosystems, Foster City, CA). Sequence level was normalized at 66.6 µmol/L by 4 weeks analysis of all coding exons and flanking introns of after treatment and at 50.3 µmol/L by 8 weeks. the SLC22A5 gene was performed using the BigDye Serum levels of blood urea nitrogen and creatinine Terminator Cycle Sequencing Ready Reaction kit were within normal range. The echocardiogram re- (Applied Biosystems) on an ABI Prism 3130 ge- vealed normal findings and no complications were netic analyzer (Applied Biosystems). Nucleotide observed. The patient has shown a normal develop- numbering reflects cDNA numbering with c.1 cor- mental course. responding to the A of the ATG translation initia- tion codon in the reference sequence of SLC22A5 We identified 2 different mutations in the SLC22A5 (NM_003060). gene of the patient. Specifically, the patient had compound heterozygote mutations for c.506G>A Results and c.1400C>G of the SLC22A5 gene (Figure 1). The c.506G>A and c.1400C>G transitions resulted At 3 weeks after birth, the patient showed a serum in an amino acid substitution from Arg to Gln at alanine aminotransferase level of 25 U/L (RR, < 31 codon 169 (p.R169Q) in exon 3 and from Ser to U/L), an aspartate aminotransferase level of 15 U/L Cys at codon 467 (p.S467C) in exon 8, respectively (RR, < 31 U/L), an ammonia level of 129.4 ug/dL (reference sequence from NM_003060.3). These (RR, 25~65 ug/dL), and a lactate level of 4.5 missense mutations were reported previously [2,12]. mmol/L (RR, 0.5-2.2 mmol/L). The organic acid The p.R169Q and p.S467C mutations occurred in profiles in urine were normal. The plasma free car- the intertransmembrane loop 2 and transmem- nitine level was 10.3 µmol/L (RR, 36-74 µmol/L). brane domain 11 regions, respectively. SLC22A5 mutations in Korea 427 Discussion family study could not be performed and the muta- tional pattern of the patient could not be evaluated CDSP is a treatable disorder if it is diagnosed and as de novo or inherited. Information about geno- treated at an early period. Major presenting mani- type-phenotype correlation could not be deduced festations of CDSP include cardiac failure. Other from only one case.
Load more

Recommended publications
  • Interplay Between Metformin and Serotonin Transport in the Gastrointestinal Tract: a Novel Mechanism for the Intestinal Absorption and Adverse Effects of Metformin
    INTERPLAY BETWEEN METFORMIN AND SEROTONIN TRANSPORT IN THE GASTROINTESTINAL TRACT: A NOVEL MECHANISM FOR THE INTESTINAL ABSORPTION AND ADVERSE EFFECTS OF METFORMIN Tianxiang Han A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Eshelman School of Pharmacy. Chapel Hill 2013 Approved By: Dhiren R. Thakker, Ph.D. Michael Jay, Ph.D. Kim L. R. Brouwer, Pharm.D., Ph.D. Joseph W. Polli, Ph.D. Xiao Xiao, Ph.D. © 2013 Tianxiang Han ALL RIGHTS RESERVED ii ABSTRACT TIANXIANG HAN: Interplay between Metformin and Serotonin Transport in the Gastrointestinal Tract: A Novel Mechanism for the Intestinal Absorption and Adverse Effects of Metformin (Under the direction of Dhiren R. Thakker, Ph.D.) Metformin is a widely prescribed drug for Type II diabetes mellitus. Previous studies have shown that this highly hydrophilic and charged compound traverses predominantly paracellularly across the Caco-2 cell monolayer, a well-established model for human intestinal epithelium. However, oral bioavailability of metformin is significantly higher than that of the paracellular probe, mannitol (~60% vs ~16%). Based on these observations, the Thakker laboratory proposed a “sponge” hypothesis (Proctor et al., 2008) which states that the functional synergy between apical (AP) transporters and paracellular transport enhances the intestinal absorption of metformin. This dissertation work aims to identify AP uptake transporters of metformin, determine their polarized localization, and elucidate their roles in the intestinal absorption and adverse effects of metformin. Chemical inhibition and transporter-knockdown studies revealed that four transporters, namely, organic cation transporter 1 (OCT1), plasma membrane monoamine transporter (PMAT), serotonin reuptake transporter (SERT) and choline high-affinity transporter (CHT) contribute to AP uptake of metformin in Caco-2 cells.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Analysis of OAT, OCT, OCTN, and Other Family Members Reveals 8
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.23.887299; this version posted December 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Reclassification of SLC22 Transporters: Analysis of OAT, OCT, OCTN, and other Family Members Reveals 8 Functional Subgroups Darcy Engelhart1, Jeffry C. Granados2, Da Shi3, Milton Saier Jr.4, Michael Baker6, Ruben Abagyan3, Sanjay K. Nigam5,6 1Department of Biology, University of California San Diego, La Jolla 92093 2Department of Bioengineering, University of California San Diego, La Jolla 92093 3School of Pharmacy and Pharmaceutical Sciences, University of California San Diego, La Jolla 92093 4Department of Molecular Biology, Division of Biological Sciences, University of California at San Diego, San Diego, CA, USA 5Department of Pediatrics, University of California San Diego, La Jolla 92093 6Department of Medicine, University of California San Diego, La Jolla 92093 *To whom correspondence should be addressed: [email protected] Running title: Functional subgroups for SLC22 1 bioRxiv preprint doi: https://doi.org/10.1101/2019.12.23.887299; this version posted December 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Among transporters, the SLC22 family is emerging as a central hub of endogenous physiology.
    [Show full text]
  • Disease-Induced Modulation of Drug Transporters at the Blood–Brain Barrier Level
    International Journal of Molecular Sciences Review Disease-Induced Modulation of Drug Transporters at the Blood–Brain Barrier Level Sweilem B. Al Rihani 1 , Lucy I. Darakjian 1, Malavika Deodhar 1 , Pamela Dow 1 , Jacques Turgeon 1,2 and Veronique Michaud 1,2,* 1 Tabula Rasa HealthCare, Precision Pharmacotherapy Research and Development Institute, Orlando, FL 32827, USA; [email protected] (S.B.A.R.); [email protected] (L.I.D.); [email protected] (M.D.); [email protected] (P.D.); [email protected] (J.T.) 2 Faculty of Pharmacy, Université de Montréal, Montreal, QC H3C 3J7, Canada * Correspondence: [email protected]; Tel.: +1-856-938-8697 Abstract: The blood–brain barrier (BBB) is a highly selective and restrictive semipermeable network of cells and blood vessel constituents. All components of the neurovascular unit give to the BBB its crucial and protective function, i.e., to regulate homeostasis in the central nervous system (CNS) by removing substances from the endothelial compartment and supplying the brain with nutrients and other endogenous compounds. Many transporters have been identified that play a role in maintaining BBB integrity and homeostasis. As such, the restrictive nature of the BBB provides an obstacle for drug delivery to the CNS. Nevertheless, according to their physicochemical or pharmacological properties, drugs may reach the CNS by passive diffusion or be subjected to putative influx and/or efflux through BBB membrane transporters, allowing or limiting their distribution to the CNS. Drug transporters functionally expressed on various compartments of the BBB involve numerous proteins from either the ATP-binding cassette (ABC) or the solute carrier (SLC) superfamilies.
    [Show full text]
  • Epistasis-Driven Identification of SLC25A51 As a Regulator of Human
    ARTICLE https://doi.org/10.1038/s41467-020-19871-x OPEN Epistasis-driven identification of SLC25A51 as a regulator of human mitochondrial NAD import Enrico Girardi 1, Gennaro Agrimi 2, Ulrich Goldmann 1, Giuseppe Fiume1, Sabrina Lindinger1, Vitaly Sedlyarov1, Ismet Srndic1, Bettina Gürtl1, Benedikt Agerer 1, Felix Kartnig1, Pasquale Scarcia 2, Maria Antonietta Di Noia2, Eva Liñeiro1, Manuele Rebsamen1, Tabea Wiedmer 1, Andreas Bergthaler1, ✉ Luigi Palmieri2,3 & Giulio Superti-Furga 1,4 1234567890():,; About a thousand genes in the human genome encode for membrane transporters. Among these, several solute carrier proteins (SLCs), representing the largest group of transporters, are still orphan and lack functional characterization. We reasoned that assessing genetic interactions among SLCs may be an efficient way to obtain functional information allowing their deorphanization. Here we describe a network of strong genetic interactions indicating a contribution to mitochondrial respiration and redox metabolism for SLC25A51/MCART1, an uncharacterized member of the SLC25 family of transporters. Through a combination of metabolomics, genomics and genetics approaches, we demonstrate a role for SLC25A51 as enabler of mitochondrial import of NAD, showcasing the potential of genetic interaction- driven functional gene deorphanization. 1 CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria. 2 Laboratory of Biochemistry and Molecular Biology, Department of Biosciences, Biotechnologies and Biopharmaceutics,
    [Show full text]
  • Morin Improves Urate Excretion and Kidney Function Through Regulation of Renal Organic Ion Transporters in Hyperuricemic Mice
    J Pharm Pharmaceut Sci (www.cspsCanada.org) 13(3) 411 - 427, 2010 Morin Improves Urate Excretion and Kidney Function through Regulation of Renal Organic Ion Transporters in Hyperuricemic Mice Cai-Ping Wang, Xing Wang, Xian Zhang, Yun-Wei Shi, Lei Liu, Ling-Dong Kong State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093, P. R. China Received, May 17, 2010; Revised, September 23, 2010; Accepted, October 5, 2010; October 5, 2010. ABSTRACT - Purpose. Morin (2′,3,4′,5,7-pentahydroxyflavone), a plant-derived flavonoid, has beneficial effects on hyperuricemia and renal dysfunction in animals. Since the decreased renal excretion of uric acid is the hallmark of hyperuricemia, here we studied the effects of oral morin administration on renal organic ion transporters in potassium oxonate-induced hyperuricemic mice. Methods. Hyperuricemia in mice was induced by potassium oxonate. Uric acid and creatinine concentrations in urine and serum, and fractional excretion of uric acid (FEUA) were performed to evaluate renal urate handling. Changes in expression levels of renal organic ion transporters were detected by Western blotting and semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) methods. Results. Morin treatment significantly increased urinary uric acid/creatinine ratio and FEUA, resulting in reduction of serum uric acid levels in hyperuricemic mice. And kidney conditions were also improved after morin treatment in this model. Protein and mRNA levels of glucose transporter 9 (mGLUT9) and urate transporter 1 (mURAT1) were significantly decreased, and of organic anion transporter 1 (mOAT1) were remarkably increased in the kidney of morin-treated hyperuricemic mice. Morin treatment also blocked down-regulations of renal organic cation and carnitine transporters (mOCT1, mOCT2, mOCTN1 and mOCTN2) in hyperuricemic mice.
    [Show full text]
  • Human Intestinal Nutrient Transporters
    Gastrointestinal Functions, edited by Edgard E. Delvin and Michael J. Lentze. Nestle Nutrition Workshop Series. Pediatric Program. Vol. 46. Nestec Ltd.. Vevey/Lippincott Williams & Wilkins, Philadelphia © 2001. Human Intestinal Nutrient Transporters Ernest M. Wright Department of Physiology, UCLA School of Medicine, Los Angeles, California, USA Over the past decade, advances in molecular biology have revolutionized studies on intestinal nutrient absorption in humans. Before the advent of molecular biology, the study of nutrient absorption was largely limited to in vivo and in vitro animal model systems. This did result in the classification of the different transport systems involved, and in the development of models for nutrient transport across enterocytes (1). Nutrients are either absorbed passively or actively. Passive transport across the epithelium occurs down the nutrient's concentration gradient by simple or facilitated diffusion. The efficiency of simple diffusion depends on the lipid solubility of the nutrient in the plasma membranes—the higher the molecule's partition coefficient, the higher the rate of diffusion. Facilitated diffusion depends on the presence of simple carriers (uniporters) in the plasma membranes, and the kinetic properties of these uniporters. The rate of facilitated diffusion depends on the density, turnover number, and affinity of the uniporters in the brush border and basolateral membranes. The ' 'active'' transport of nutrients simply means that energy is provided to transport molecules across the gut against their concentration gradient. It is now well recog- nized that active nutrient transport is brought about by Na+ or H+ cotransporters (symporters) that harness the energy stored in ion gradients to drive the uphill trans- port of a solute.
    [Show full text]
  • Frontiersin.Org 1 April 2015 | Volume 9 | Article 123 Saunders Et Al
    ORIGINAL RESEARCH published: 28 April 2015 doi: 10.3389/fnins.2015.00123 Influx mechanisms in the embryonic and adult rat choroid plexus: a transcriptome study Norman R. Saunders 1*, Katarzyna M. Dziegielewska 1, Kjeld Møllgård 2, Mark D. Habgood 1, Matthew J. Wakefield 3, Helen Lindsay 4, Nathalie Stratzielle 5, Jean-Francois Ghersi-Egea 5 and Shane A. Liddelow 1, 6 1 Department of Pharmacology and Therapeutics, University of Melbourne, Parkville, VIC, Australia, 2 Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen, Denmark, 3 Walter and Eliza Hall Institute of Medical Research, Parkville, VIC, Australia, 4 Institute of Molecular Life Sciences, University of Zurich, Zurich, Switzerland, 5 Lyon Neuroscience Research Center, INSERM U1028, Centre National de la Recherche Scientifique UMR5292, Université Lyon 1, Lyon, France, 6 Department of Neurobiology, Stanford University, Stanford, CA, USA The transcriptome of embryonic and adult rat lateral ventricular choroid plexus, using a combination of RNA-Sequencing and microarray data, was analyzed by functional groups of influx transporters, particularly solute carrier (SLC) transporters. RNA-Seq Edited by: Joana A. Palha, was performed at embryonic day (E) 15 and adult with additional data obtained at University of Minho, Portugal intermediate ages from microarray analysis. The largest represented functional group Reviewed by: in the embryo was amino acid transporters (twelve) with expression levels 2–98 times Fernanda Marques, University of Minho, Portugal greater than in the adult. In contrast, in the adult only six amino acid transporters Hanspeter Herzel, were up-regulated compared to the embryo and at more modest enrichment levels Humboldt University, Germany (<5-fold enrichment above E15).
    [Show full text]
  • New Mesh Headings for 2018 Single Column After Cutover
    New MeSH Headings for 2018 Listed in alphabetical order with Heading, Scope Note, Annotation (AN), and Tree Locations 2-Hydroxypropyl-beta-cyclodextrin Derivative of beta-cyclodextrin that is used as an excipient for steroid drugs and as a lipid chelator. Tree locations: beta-Cyclodextrins D04.345.103.333.500 D09.301.915.400.375.333.500 D09.698.365.855.400.375.333.500 AAA Domain An approximately 250 amino acid domain common to AAA ATPases and AAA Proteins. It consists of a highly conserved N-terminal P-Loop ATPase subdomain with an alpha-beta-alpha conformation, and a less-conserved C- terminal subdomain with an all alpha conformation. The N-terminal subdomain includes Walker A and Walker B motifs which function in ATP binding and hydrolysis. Tree locations: Amino Acid Motifs G02.111.570.820.709.275.500.913 AAA Proteins A large, highly conserved and functionally diverse superfamily of NTPases and nucleotide-binding proteins that are characterized by a conserved 200 to 250 amino acid nucleotide-binding and catalytic domain, the AAA+ module. They assemble into hexameric ring complexes that function in the energy-dependent remodeling of macromolecules. Members include ATPASES ASSOCIATED WITH DIVERSE CELLULAR ACTIVITIES. Tree locations: Acid Anhydride Hydrolases D08.811.277.040.013 Carrier Proteins D12.776.157.025 Abuse-Deterrent Formulations Drug formulations or delivery systems intended to discourage the abuse of CONTROLLED SUBSTANCES. These may include physical barriers to prevent chewing or crushing the drug; chemical barriers that prevent extraction of psychoactive ingredients; agonist-antagonist combinations to reduce euphoria associated with abuse; aversion, where controlled substances are combined with others that will produce an unpleasant effect if the patient manipulates the dosage form or exceeds the recommended dose; delivery systems that are resistant to abuse such as implants; or combinations of these methods.
    [Show full text]
  • RNA-Seq Reveals Altered Gene Expression Levels in Proximal
    www.nature.com/scientificreports OPEN RNA‑seq reveals altered gene expression levels in proximal tubular cell cultures compared to renal cortex but not during early glucotoxicity Linnéa M. Nilsson1, Miguel Castresana‑Aguirre 2, Lena Scott3 & Hjalmar Brismar 1,3* Cell cultures are often used to study physiological processes in health and disease. It is well‑known that cells change their gene expression in vitro compared to in vivo, but it is rarely experimentally addressed. High glucose is a known trigger of apoptosis in proximal tubular cells (PTC). Here we used RNA-seq to detect diferentially expressed genes in cultures of primary rat PTC, 3 days old, compared to cells retrieved directly from rat outer renal cortex and between PTC exposed to 15 mM glucose and control for 8 h. The expression of 6,174 genes was signifcantly up- or downregulated in the cultures of PTC compared to the cells in the outer renal cortex. Most altered were mitochondrial and metabolism related genes. Gene expression of proapoptotic proteins were upregulated and gene expression of antiapoptotic proteins were downregulated in PTC. Expression of transporter related genes were generally downregulated. After 8 h, high glucose had not altered the gene expression in PTC. The current study provides evidence that cells alter their gene expression in vitro compared to in vivo and suggests that short‑term high glucose exposure can trigger apoptosis in PTC without changing the gene expression levels of apoptotic proteins. Cell cultures, both primary and immortalized, are ofen used as models in biological research to investigate physi- ological processes in health and disease.
    [Show full text]
  • The Effects of Genetic Mutations and Drugs on the Activity of the Thiamine Transporter, SLC19A2
    UCSF UC San Francisco Previously Published Works Title The Effects of Genetic Mutations and Drugs on the Activity of the Thiamine Transporter, SLC19A2. Permalink https://escholarship.org/uc/item/0fb7q1fj Journal The AAPS journal, 23(2) ISSN 1550-7416 Authors Enogieru, Osatohanmwen J Koleske, Megan L Vora, Bianca et al. Publication Date 2021-03-01 DOI 10.1208/s12248-021-00562-4 Peer reviewed eScholarship.org Powered by the California Digital Library University of California The AAPS Journal (2021) 23:35 DOI: 10.1208/s12248-021-00562-4 Brief/Technical Note Theme: Celebrating Women in the Pharmaceutical Sciences Guest Editors: Diane Burgess, Marilyn Morris and Meena Subramanyam The Effects of Genetic Mutations and Drugs on the Activity of the Thiamine Transporter, SLC19A2 Osatohanmwen J. Enogieru,1 Megan L. Koleske,1 Bianca Vora,1 Huy Ngo,1 Sook Wah Yee,1 Derrick Chatad,2 Marina Sirota,3,4,5 and Kathleen M. Giacomini1,4 Received 11 November 2020; accepted 26 January 2021 Abstract. A rare cause of megaloblastic anemia (MA) is thiamine-responsive megalo- blastic anemia (TRMA), a genetic disorder caused by mutations in SLC19A2 (encoding THTR1), a thiamine transporter. The study objectives were to (1) functionally characterize selected TRMA-associated SLC19A2 variants and (2) determine whether current prescrip- tion drugs associated with drug-induced MA (DIMA) may act via inhibition of SLC19A2. Functional characterization of selected SLC19A2 variants was performed by confocal microscopy and isotopic uptake studies of [3H]-thiamine in HEK293 cells. Sixty-three drugs associated with DIMA were screened for SLC19A2 inhibition in isotopic uptake studies. Three previously uncharacterized SLC19A2 variants identified in TRMA patients exhibited disrupted localization to the plasma membrane along with near-complete loss-of-function.
    [Show full text]
  • Role of SLC22A4, SLC22A5, and RUNX1 Genes in Rheumatoid
    Role of SLC22A4, SLC22A5, and RUNX1 Genes in Rheumatoid Arthritis ALFONSO MARTÍNEZ, ANTONIO VALDIVIA, DORA PASCUAL-SALCEDO, ALEJANDRO BALSA, BENJAMÍN FERNÁNDEZ-GUTIÉRREZ, EMILIO G. de la CONCHA, and ELENA URCELAY ABSTRACT. Objective. Excessively suppressed expression of the SLC22A4 gene by RUNX1 is associated with the pathogenesis of rheumatoid arthritis (RA). Two etiological polymorphisms in the RUNX1 and SLC22A4 genes have been defined in a Japanese population. We studied additional polymorphisms to ascertain whether any SLC22A4/SLC22A5 haplotype is relevant for RA predisposition in a Spanish population. Method. We performed a case-control study comprising 416 patients with RA and 501 healthy subjects. Results. The etiologic SLC22A4 mutation was rarely found in homozygosis (0.72% patients vs 0.40% controls). None of the 4 haplotypes present in the SLC22A4/SLC22A5 region in 5q31 showed signifi- cant association with RA in our Spanish cohort. The causative RUNX1 variant found in a Japanese cohort displayed the same genotype distribution in our population. However, no difference was observed when allele or genotype frequencies were compared between Spanish patients with RA and controls. Conclusion. The SLC22A4 and RUNX1 polymorphisms described as etiological in the Japanese study did not show a significant role in RA susceptibility in our population. The mechanism proposed by these Japanese investigators could underlie RA susceptibility irrespective of ethnicity, but the lower mutation rate present in our population hampered detection of a significant effect. Most probably the lack of mutated SLC22A4 substrate explains the absence of RUNX1 association with RA observed in our pop- ulation. (J Rheumatol 2006;33:842–6) Key Indexing Terms: RHEUMATOID ARTHRITIS SUSCEPTIBILITY SLC22A4/SLC22A5/RUNX1 POLYMORPHISMS The interplay of both genetic and environmental factors con- used for detecting genes contributing to susceptibility or tributes to the development of rheumatoid arthritis (RA).
    [Show full text]