SLC22A5 Mutations in a Patient with Systemic Primary Carnitine Deficiency: the First Korean Case Confirmed by Biochemical and Molecular Investigation

Available online at www.annclinlabsci.org 424 Annals of Clinical & Laboratory Science, vol. 42, no. 4, 2012

SLC22A5 Mutations in a Patient with Systemic Primary Carnitine Deficiency: The First Korean Case Confirmed by Biochemical and Molecular Investigation

Young Ahn Yoon1, Dong Hwan Lee2, Chang-Seok Ki1, Soo-Youn Lee1, Jong-Won Kim1, Yong-Wha Lee3, and Hyung-Doo Park1

1Department of Laboratory Medicine and Genetics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul; 2Department of Pediatrics, Soonchunhyang University College of Medicine, Seoul, Korea; 3Depart- ment of Laboratory Medicine and Genetics, Soonchunhyang University Bucheon Hospital, Soonchunhyang University College of Medicine, Bucheon, Korea.

Abstract. Systemic primary carnitine deficiency (CDSP) is a rare autosomal recessive disorder that pres- ents episodic periods of hypoketotic hypoglycemia. The main symptoms of CDSP are skeletal and cardiac myopathy. CDSP is caused by a defect in plasma membrane uptake of carnitine, ultimately caused by the SLC22A5 gene. We report the case of a Korean patient with CDSP. He had an abnormal free carnitine level of 5.56 µmol/L (reference range, RR 10.4~87.1 µmol/L) and a palmitoylcarnitine level of 0.27 µmol/L (RR 0.5~9.7 µmol/L) in a newborn screening test. The patient showed an ammonia level of 129.4 ug/dL (RR, 25~65 ug/dL), a lactate level of 4.5 mmol/L (RR, 0.5-2.2 mmol/L), and a free carnitine level of 10.3 μmol/L (RR, 36-74 μmol/L) in blood. After PCR-sequencing analysis of the SLC22A5 gene, the patient was found to be a compound heterozygote for c.506G>A (p.R169Q) and c.1400C>G (p.S467C) mutations. These missense mutations are reported previously. The patient was started on L-carnitine supplement after CDSP diagnosis. The patient was treated with L-carnitine to reach a normal free carnitine level and has remained asymptomatic up to the current age of 21 months. The plasma free carnitine level normalized to 66.6 μmol/L at 4 weeks after treatment. To the best of our knowledge, this is the first report of a CDSP patient confirmed by molecular genetic investigation.

Key words: Systemic primary carnitine deficiency,SLC22A5 , OCTN2, mutation, Korea

Introduction of them originate in the diet. One member of the organic cation transporter (OCTN) family, Fatty acid oxidation in mitochondria provides an OCTN2, plays an important role in moving carni- important source of energy for heart and skeletal tine across the cell membrane. muscles. Carnitine (3-hydroxy-4-trimethylamino- butyric acid) plays an essential role in transporting Systemic primary carnitine deficiency (CDSP, long-chain fatty acids from the cytosol to the mito- OMIM #212140) is an autosomal recessive disor- chondrial matrix, where fatty acid oxidation takes der of the carnitine cycle caused by mutations in place. While some carnitines are synthesized from the SLC22A5 gene that encodes the high-affinity lysine and methionine in the liver and kidney, most carnitine transporter, OCTN2 [1]. The prevalence of CDSP is approximately 1 in 40,000 [2]. Address correspondence to Hyung-Doo Park, MD, PhD; Department Deficiency of carnitine transporters results in uri- of Laboratory Medicine and Genetics; Samsung Medical Center; Sungkyunkwan University School of Medicine, 50 Irwon-dong, nary carnitine loss, low serum free carnitine levels, Gangnam-gu, Seoul, 135-710, Korea; tel: +82-2-3410-0290; fax: +82- 2-3410-2719; e-mail: [email protected] or to Yong-Wha and decreased intracellular carnitine accumula- Lee, M.D., Ph.D.; Department of Laboratory Medicine and Genetics; tion. Since carnitine is needed for the entry of long- Soonchunhyang University Bucheon Hospital; Soonchunhyang University College of Medicine, 1174 Jung-dong, Wonmi-gu, chain fatty acids into mitochondria, carnitine defi- Bucheon, 420-767, Korea; tel: +82-32-621-5943; fax: +82-32-621- ciency diminishes the ability to use fat as an energy 5944; e-mail: [email protected] source during periods of stress and fasting. Over

Table 1. Primer sequences for mutation analysis of the SLC22A5 gene.

Exon Primer Sequence (5’→3’) Primer Sequence (5’→3’)

1 1-1F GTCGTGCGCCCTATGTAAG 1-1R CGAGAAGTTGGCGATGGT 1 1-2F CTGTCCTCCGTGTTCCTGAT 2-2R GTCTCCATCGCTAGGGTGTT 2 2F GGGGCCTACAATGCTATGAA 2R CCCTGCGCTGAAAGAATACTA 3 3F CTGGCAACACTGTTCACACC 3R CTGGTCTCATGTCTGGCTCA 4 4F CCCTAGCGCCATGAACTTAG 4R TTGGCTCTTTTGAGTGTGGA 5 5F GATGGCAACACTGCTCTTCA 5R GTGAGCAGGGAGGACTTCAG 6 6F GCTAAGATGCCAGGGATTCA 6R TTCTGAGGTTCCATCCCATT 7 7F TGAAGTAAGACGCAGGGTTACA 7R GCTGTGATGGGCTTGATTTT 8 8F AGCCTCCTTTCAGCAATCAA 8R GGATGGAGCCCATGTACTGT 9 9F CCAGAGTCCTGGGAGCATAA 9R GGCTACTGCCATGGAGATGT 10 10F CTGCTGCAGGATTCTCTTCC 10R TGTAGGTAGCCCCAGTGTCC

half of the known cases initially present with pro- Materials and Methods gressive heart failure and generalized muscle weakness. The onset age of these symptoms ranges from The male patient was born at 39 weeks and 3 days 12 months to 7 years. During the first year of life, of gestation to healthy non-consanguineous Korean affected patients develop acute metabolic decom- parents. The weight of the patient at birth was 3700 pensation with hypoketotic hypoglycemia, Reye g (75-90th percentile). The family history was un- syndrome, and sudden unexpected infant death remarkable. The patient was vaginally delivered [3]. and is the third child of his parents. He was re- ferred to our hospital because low free carnitine CDSP is diagnosed by identifying low serum free (C0, the marker of primary carnitine deficiency) carnitine levels. It is confirmed by measuring de- and palmitoylcarnitine (C16) levels were detected creased carnitine transporter activity in skin fibro- in a dried blood spot of the newborn screening test. blast or by a molecular test of the SLC22A5 gene on In acylcarnitine analysis by tandem mass spec- 5q31.1-32 [4,5]. SLC22A5 expands about 30kb and trometry, the free carnitine level was 5.56 µmol/L encodes a polypeptide of 557 amino acids that is (reference range, RR, 10.4~87.1 µmol/L) and pal- composed of 10 exons [6,7]. Hydropathy analysis mitoylcarnitine was 0.27 µmol/L (RR, 0.5~9.7 has suggested that the OCTN2 carnitine trans- µmol/L). Additional biochemical analyses were porter builds up 12 transmembrane spanning do- performed on the patient. mains with both the N- and C-termini facing the cytoplasm [8]. Various mutations in the SLC22A5 A molecular defect in the SLC22A5 gene was inves- gene have been identified in patients with CDSP tigated to confirm the CDSP diagnosis. After ob- [1,9]. Oral carnitine supplements of 100mg/kg/day taining informed consent from the parents, blood can normalize serum free carnitine levels and im- samples were collected from the patient. Genomic prove the accompanying symptoms with potential- DNA was isolated from peripheral blood leuko- ly excellent clinical outcomes [10,11]. Here, we cytes using a Wizard genomic DNA purification present the first Korean patient with CDSP who kit according to the manufacturer’s instructions was confirmed by biochemical and molecular (Promega, Madison, WI). The SLC22A5 gene was analysis. 426 Annals of Clinical & Laboratory Science, vol. 42, no. 4, 2012

Figure 1. Direct sequencing of the SLC22A5 gene in the patient revealed 2 compound heterozygous mutations: c.506G>A (p.R169Q) and c.1400C>G (p. S467C). amplified by PCR using primers designed by the The patient was started on L-carnitine supplement authors (Table 1) and a Thermal Cycler 9700 after CDSP diagnosis. The plasma free carnitine (Applied Biosystems, Foster City, CA). Sequence level was normalized at 66.6 μmol/L by 4 weeks analysis of all coding exons and flanking introns of after treatment and at 50.3 μmol/L by 8 weeks. the SLC22A5 gene was performed using the BigDye Serum levels of blood urea nitrogen and creatinine Terminator Cycle Sequencing Ready Reaction kit were within normal range. The echocardiogram re- (Applied Biosystems) on an ABI Prism 3130 ge- vealed normal findings and no complications were netic analyzer (Applied Biosystems). Nucleotide observed. The patient has shown a normal develop- numbering reflects cDNA numbering with c.1 cor- mental course. responding to the A of the ATG translation initia- tion codon in the reference sequence of SLC22A5 We identified 2 different mutations in the SLC22A5 (NM_003060). gene of the patient. Specifically, the patient had compound heterozygote mutations for c.506G>A Results and c.1400C>G of the SLC22A5 gene (Figure 1). The c.506G>A and c.1400C>G transitions resulted At 3 weeks after birth, the patient showed a serum in an amino acid substitution from Arg to Gln at alanine aminotransferase level of 25 U/L (RR, < 31 codon 169 (p.R169Q) in exon 3 and from Ser to U/L), an aspartate aminotransferase level of 15 U/L Cys at codon 467 (p.S467C) in exon 8, respectively (RR, < 31 U/L), an ammonia level of 129.4 ug/dL (reference sequence from NM_003060.3). These (RR, 25~65 ug/dL), and a lactate level of 4.5 missense mutations were reported previously [2,12]. mmol/L (RR, 0.5-2.2 mmol/L). The organic acid The p.R169Q and p.S467C mutations occurred in profiles in urine were normal. The plasma free car- the intertransmembrane loop 2 and transmem- nitine level was 10.3 μmol/L (RR, 36-74 μmol/L). brane domain 11 regions, respectively. SLC22A5 mutations in Korea 427

Discussion family study could not be performed and the muta- tional pattern of the patient could not be evaluated CDSP is a treatable disorder if it is diagnosed and as de novo or inherited. Information about geno- treated at an early period. Major presenting mani- type-phenotype correlation could not be deduced festations of CDSP include cardiac failure. Other from only one case. In spite of the report of a large fatty acid oxidation disorders affect the heart, liver, deletion involving the SLC22A5 gene, most muta- and skeletal muscle. The onset age of cardiomyopa- tions can be detected by sequencing analysis [16]. thy and skeletal muscle weakness varies from 12 As previously reported, compound heterozygotes months to 7 years. Echocardiography is most effec- that carry missense or truncated mutations had tive in demonstrating cardiomyopathy, which in- consistently low plasma free carnitine levels [4]. volves poor contractility and thickened ventricular The p.R169Q mutation affects an arginine residue walls. During infancy, fasting stress may cause a that is conserved in the entire transporter super- hypoketotic hypoglycemic coma that may lead to family to which OCTN2 belongs. This results in sudden unexpected death. Newborn screening tests completely abolished carnitine transporter activity using tandem mass spectrometry can identify pa- [12,17]. The p.S467C mutation of SLC22A5 im- tients with CDSP by showing low levels of free car- paired in vitro carnitine uptake as predicted from nitine at birth. Other acylcarnitines such as propi- the in vivo low plasma free carnitine phenotype [2]. onylcarnitine, palmitoylcarnitine, and stearoylcarnitine are also usually detected at low Molecular genetic diagnosis is important to con- levels. firm patients with inborn metabolic diseases screened by tandem mass spectrometry. Clinical A large number of heterogeneous mutations have symptoms may be drastically improved by carni- been reported in the SLC22A5 gene. According to tine supplementation [11]. Diagnosis of the unaf- previous reports, there is no clear association be- fected child at birth allows carnitine treatment to tween genotype and phenotype in CDSP except start at an early age, which may prevent life-threat- the tendency for increased nonsense mutation fre- ening situations such as the development of cardio- quency in symptomatic patients [13]. Missense mu- myopathy. This is the first case of CDSP with mo- tation and in-frame deletion mutation occur in lecular confirmation in Korea. Upcoming 71% of asymptomatic patients with CDSP (20/28 developments in diagnostic techniques, such as ex- patients) [13]. In addition to the specific mutation, panded newborn screening and molecular genetic evidence suggests that other factors such as fasting testing, are expected to enable identification of and recurrent infection could play a significant role more CDSP cases in the Korean population in the in symptomatic patients [8,13-15]. The onset age near future. and phenotype did not differ among patients re- gardless of the mutation type observed [14,16]. Acknowledgement

To date, no CDSP case has been reported in the This study was supported by a Samsung Biomedical Research Korean population. Using PCR-sequencing analy- Institute grant, SBRI C-B1-304-1. sis, we have identified for the first time 2 different References SLC22A5 mutations in a neonate. In contrast to other cases reported in the pediatric period, the pa- 1. Nezu J, Tamai I, Oku A, Ohashi R, Yabuuchi H, Hashimoto N, Nikaido H, Sai Y, Koizumi A, Shoji Y, Takada G, Matsuishi tient of the present study did not show any symp- T, Yoshino M, Kato H, Ohura T, Tsujimoto G, Hayakawa J, toms. This may be due to early detection by tan- Shimane M, Tsuji A. Primary systemic carnitine deficiency is dem mass spectrometry in the newborn screening caused by mutations in a gene encoding sodium ion-dependent carnitine transporter. Nat Genet 1999;21:91-94. test. Although CDSP is a rare disease, many as- 2. Koizumi A, Nozaki J, Ohura T, Kayo T, Wada Y, Nezu J, ymptomatic newborns with CDSP are screened by Ohashi R, Tamai I, Shoji Y, Takada G, Kibira S, Matsuishi T, tandem mass spectrometry [16]. Unfortunately, a Tsuji A. Genetic epidemiology of the carnitine transporter 428 Annals of Clinical & Laboratory Science, vol. 42, no. 4, 2012

OCTN2 gene in a Japanese population and phenotypic charac- 11. Cederbaum SD, Koo-McCoy S, Tein I, Hsu BY, Ganguly A, terization in Japanese pedigrees with primary systemic carni- Vilain E, Dipple K, Cvitanovic-Sojat L, Stanley C. Carnitine tine deficiency. Hum Mol Genet 1999;8:2247-2254. membrane transporter deficiency: a long-term follow up and 3. Longo N, Amat di San Filippo C, Pasquali M. Disorders of OCTN2 mutation in the first documented case of primary car- carnitine transport and the carnitine cycle. Am J Med Genet C nitine deficiency. Mol Genet Metab 2002;77:195-201. Semin Med Genet 2006;142C:77-85. 12. Burwinkel B, Kreuder J, Schweitzer S, Vorgerd M, Gempel K, 4. Shoji Y, Koizumi A, Kayo T, Ohata T, Takahashi T, Harada K, Gerbitz KD, Kilimann MW. Carnitine transporter OCTN2 Takada G. Evidence for linkage of human primary systemic mutations in systemic primary carnitine deficiency: a novel carnitine deficiency with D5S436: a novel gene locus on chro- Arg169Gln mutation and a recurrent Arg282ter mutation as- mosome 5q. Am J Hum Genet 1998;63:101-108. sociated with an unconventional splicing abnormality. Biochem 5. Wang Y, Korman SH, Ye J, Gargus JJ, Gutman A, Taroni F, Biophys Res Commun 1999;261:484-487. Garavaglia B, Longo N. Phenotype and genotype variation in 13. Rose EC, di San Filippo CA, Ndukwe Erlingsson UC, Ardon primary carnitine deficiency. Genet Med 2001;3:387-392. O, Pasquali M, Longo N. Genotype-phenotype correlation in 6. Wu X, Prasad PD, Leibach FH, Ganapathy V. cDNA sequence, primary carnitine deficiency. Hum Mutat 2011. transport function, and genomic organization of human 14. Lamhonwah AM, Olpin SE, Pollitt RJ, Vianey-Saban C, Divry OCTN2, a new member of the organic cation transporter fam- P, Guffon N, Besley GT, Onizuka R, De Meirleir LJ, ily. Biochem Biophys Res Commun 1998;246:589-595. Cvitanovic-Sojat L, Baric I, Dionisi-Vici C, Fumic K, Maradin 7. Tamai I, Ohashi R, Nezu J, Yabuuchi H, Oku A, Shimane M, M, Tein I. Novel OCTN2 mutations: no genotype-phenotype Sai Y, Tsuji A. Molecular and functional identification of so- correlations: early carnitine therapy prevents cardiomyopathy. dium ion-dependent, high affinity human carnitine transport- Am J Med Genet 2002;111:271-284. er OCTN2. J Biol Chem 1998;273:20378-20382. 15. Spiekerkoetter U, Huener G, Baykal T, Demirkol M, Duran 8. Wang Y, Taroni F, Garavaglia B, Longo N. Functional analysis M, Wanders R, Nezu J, Mayatepek E. Silent and symptomatic of mutations in the OCTN2 transporter causing primary car- primary carnitine deficiency within the same family due to nitine deficiency: lack of genotype-phenotype correlation. identical mutations in the organic cation/carnitine transporter Hum Mutat 2000;16:401-407. OCTN2. J Inherit Metab Dis 2003;26:613-615. 9. Tang NL, Ganapathy V, Wu X, Hui J, Seth P, Yuen PM, 16. Li FY, El-Hattab AW, Bawle EV, Boles RG, Schmitt ES, Scaglia Wanders RJ, Fok TF, Hjelm NM. Mutations of OCTN2, an F, Wong LJ. Molecular spectrum of SLC22A5 (OCTN2) gene organic cation/carnitine transporter, lead to deficient cellular mutations detected in 143 subjects evaluated for systemic car- carnitine uptake in primary carnitine deficiency. Hum Mol nitine deficiency. Hum Mutat 2010;31:E1632-1651. Genet 1999;8:655-660. 17. Wang Y, Kelly MA, Cowan TM, Longo N. A missense muta- 10. Stanley CA. Carnitine deficiency disorders in children. Ann N tion in the OCTN2 gene associated with residual carnitine Y Acad Sci 2004;1033:42-51. transport activity. Hum Mutat 2000;15:238-245.