Soliman and El-Sayed Journal of Genetic Engineering and Biotechnology Journal of Genetic Engineering (2021) 19:106 https://doi.org/10.1186/s43141-021-00200-8 and Biotechnology RESEARCH Open Access Molecular identification and antimicrobial activities of some wild Egyptian mushrooms: Bjerkandera adusta as a promising source of bioactive antimicrobial phenolic compounds Elham R. S. Soliman* and Heba El-Sayed Abstract Background: The discovery of potential, new cost-effective drug resources in the form of bioactive compounds from mushrooms is one way to control the resistant pathogens. In the present research, the fruiting bodies of five wild mushrooms were collected from Egypt and identified using internal transcribed spacer region (ITS) of the rRNA encoding gene and their phylogenetic relationships, antimicrobial activities, and biochemical and phenolic compounds were evaluated. Results: The sequences revealed identity to Bjerkandera adusta, Cyclocybe cylindracea, Agrocybe aegerita, Chlorophyllum molybdites, and Lentinus squarrosulus in which Cyclocybe cylindracea and Agrocybe aegerita were closely related, while Chlorophyllum molybdites was far distant. Cyclocybe cylindracea and Agrocybe aegerita showed 100% similarity based on the sequenced ITS-rDNA fragment and dissimilar antimicrobial activities and chemical composition were detected. Bjerkandera adusta and Cyclocybe cylindracea showed strong antimicrobial activity against Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, Micrococcus luteus, Streptococcus pneumoniae, and Candida albicans. This activity could be attributed to the detected phenolic and related compounds’ contents. Conclusion: Our finding provides a quick and robust implement for mushroom identification that would facilitate mushroom domestication and characterization for human benefit. Keywords: Phylogenetic, HPLC, Fruiting fungi, rRNA-ITS Background [2, 3], as well as excellent recyclers and decomposers Mushrooms belong to a special group of macroscopic [4], and thus play a significant role throughout the fungi with distinctive fruiting bodies of Basidiomycota environment. They are typically abundant worldwide and some belong to Ascomycota [1]. In areas with during the wet season and have been discovered high humidity, wild mushrooms grow naturally on grown on different substrates [5, 6]. tree trunks or rotting woody debris. They are used as Mushrooms have a high content of proteins, carbohy- nutritious foods and therapeutic sources worldwide drates, crude fibers, minerals, vitamins, and secondary metabolites, as well as a source of bioactive substances that promote good health, e.g., antioxidants, antimicro- * Correspondence: [email protected] Botany and Microbiology Department, Faculty of Science, Helwan University, bials, anticancer, cholesterol-lowering, and immune- Helwan, Egypt stimulating effects have been reported for certain © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Soliman and El-Sayed Journal of Genetic Engineering and Biotechnology (2021) 19:106 Page 2 of 11 mushroom species [7–9]. Accurate identification know- Al-Beheira Governorate and Cairo, Egypt, between Janu- ledge of edible mushrooms is essential for effective ex- ary and February 2017. The mushroom samples were ploration in human benefits. About 140,000 different characterized morphologically following the method- species of mushrooms exist on the planet; only about ology suggested by Largent and Stuntz [17]. The samples 10% is well characterized. As macroscopic fungi, mush- verified up to genus level [18] as follows: Mush 1, Bjer- rooms are identified depending on their morphological kandera sp.; Mush 2 and 3, Cyclocybe sp.; Mush 4, Chlor- characters. Nowadays, molecular markers are prevailed ophyllum sp.; and Mush 5, Lentinus (Fig. 1). The in the identification of different organisms because of samples were dried at room temperature to a constant their robustness and efficiency. Identification based on weight, then preserved in a dry place until use. The direct sequencing of the internal transcribed spacers re- macroscopic features of the collected mushroom were gion of the rRNA encoding gene is a precise tool for recorded. The specimens collected were deposited in identification and constructing phylogenetic relation- Mycology Laboratory, Faculty of Science, Helwan Uni- ships among different organisms or species [10]. Nine- versity, Egypt. teen mushroom samples of Termitomyces aurantiacus, Tricholoma matsutake, Tricholoma robustum, P. ostrea- DNA isolation and molecular identification tus, Schizophyllum commune, and Pleurotus pulmonar- Total genomic DNA was isolated from fruit bodies ac- ius collected from Southwest Nigeria were successfully cording to [19]. The total isolated DNA were column identified using the rDNA-ITS region and the obtained purified using DNA Purification MiniSpin Kit (VIO- sequences were used to construct their phylogenetic re- GENE cat# PF1001) according to the manufacturer’s latedness with reference strains in the NCBI gene-bank protocol. The purified DNA was used as a template for [11]. Molecular identification using the rDNA-ITS re- PCR reaction using Mytaq Red DNA polymerase master gion as a basis for species identification was generated mix (BIOLINE cat # BIO-21108) according to manufac- for 33 representative mushroom samples collected from ture instructions. Briefly, the reaction was containing 1× powdered mycelium samples, grocery store mushrooms, PCR red master mix buffer, 2.0 μl of 10 pm/μl of each and capsules from commercial dietary supplements. primer; ITS1 (5′ TCCGTAGGTGAACCTGCGG 3′) Generally, the ITS sequences were efficaciously applied and ITS4 (5′ TCCTCCGCTTATTGATATGC 3′), 1.0 μl to verify and certify dietary supplements containing of DNA template (~ 30 ng), 0.25 μl of MyTaq™ DNA mushrooms [12]. polymerase (5 U/μl), then the total volume was adjusted Extracts from several mushroom species have been re- to 50 μl using sterile water. The amplification reactions ported to have antimicrobial activity derived from their were performed in Thermal Cycler (Biometra, Germany) phenolic contents [13–15]. Phenolic acids prevailed in as follow: 1st cycle of 3 min at 95 °C for initial denatur- mushrooms, including benzoic and cinnamic acid ation, followed by 35 cycles of 20 s at 95 °C (denatur- derivatives. In numerous mushroom species, p- ation), 20 s at 55 °C (annealing), 30 s at 72 °C hydroxybenzoic, protocatechuic, gallic, vanillic, and (extension), and then a final extension was carried out syringic acids have been found. Cinnamic acid and its for 10 min at 72 °C; the reaction was held at 4 °C. The derivatives, such as P-coumaric acid, O-coumaric acid, PCR products were separated on 1% agarose gel, the caffeic acid, ferulic acid, and chlorogenic acid, were also amplified fragments were purified using a PCR-M clean- reported. Certain flavonoids such as quercetin, rutin, up system (VIOGENE cat# PF1001) according to the and chrysin have been identified [16]. manufacturer’s protocol, followed by sequencing with The present study aimed to employ molecular ITS1 primer at GATC Company using ABI 3730xl characterization for the identification of morphologically DNA-sequencer. different mushrooms collected from Egypt. The discov- ery of new cost-effective drug resources in the form of Sequencing data analysis bioactive compounds from mushrooms as a promising The obtained nucleotide sequences were aligned to the source of them is one way to control drug-resistant total nucleotide collection of NCBI using Basic Local pathogens. In this regard, the bioactivity of mushroom Alignment Search Tool for nucleotide blast (https:// extracts was evaluated in an attempt to explore new nat- blast.ncbi.nlm.nih.gov/Blast.cgi). The phylogenetic tree is ural sources for controlling widespread microbes affect- constructed using the UPGMA tree build method with ing human health. 100 bootstrapping in Geneious 8.1.9 software [20]. Methods Preparation of ethanol crude extracts Mushroom samples Dried fruiting bodies were grounded in a grinder into a Five morphologically different wild mushrooms labeled fine powder before extraction. Five grams of the pow- Mush 1 to 5 were collected from their natural habitat in dered samples were extracted with 95% ethanol (50 mL) Soliman and El-Sayed Journal of Genetic Engineering and Biotechnology (2021) 19:106 Page 3 of 11 Fig. 1 Morphological characterization of the collected wild mushroom fruiting bodies at 30 °C at constant shaking of 150 rpm for 24 h. The were dissolved in sterile distilled water to a final concen- extracts were centrifuged at 3000 rpm, 4 °C for 15 min tration of 10 μg/ml. A hundred microliters of extracts to give a clear supernatant