DOCSLIB.ORG

Clinical Significance of CD81 Expression by Clonal Plasma Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Clinical Significance of CD81 Expression by Clonal Plasma Cells Leukemia (2012) 26, 1862 --1869 & 2012 Macmillan Publishers Limited All rights reserved 0887-6924/12 www.nature.com/leu ORIGINAL ARTICLE Clinical significance of CD81 expression by clonal plasma cells in high-risk smoldering and symptomatic multiple myeloma patients B Paiva1,2, N-C Gutie´ rrez1,2, X Chen2, M-B Vı´driales1,2, M-A´ Montalba´n3, L Rosin˜ol4, A Oriol5, J Martı´nez-Lo´ pez3, M-V Mateos1,2, LLo´ pez-Corral1,2,EDı´az-Rodrı´guez2, J-J Pe´ rez1,2, E Ferna´ndez-Redondo3, F de Arriba6, L Palomera7, E Bengoechea8, M-J Terol9, RdePaz10, A Martin11, J Herna´ndez12, A Orfao2,13, J-J Lahuerta3, J Blade´ 4, A Pandiella2 and J-F San Miguel1,2 on behalf of the GEM (Grupo Espan˜ ol de Mieloma)/PETHEMA (Programa para el Estudio de la Terape´ utica en Hemopatı´as Malignas) cooperative study groups The presence of CD19 in myelomatous plasma cells (MM-PCs) correlates with adverse prognosis in multiple myeloma (MM). Although CD19 expression is upregulated by CD81, this marker has been poorly investigated and its prognostic value in MM remains unknown. We have analyzed CD81 expression by multiparameter flow cytometry in MM-PCs from 230 MM patients at diagnosis included in the Grupo Espan˜ol de Mieloma (GEM)05465years trial as well as 56 high-risk smoldering MM (SMM). CD81 expression was detected in 45% (103/230) MM patients, and the detection of CD81 þ MM-PC was an independent prognostic factor for progression-free (hazard ratio ¼ 1.9; P ¼ 0.003) and overall survival (hazard ratio ¼ 2.0; P ¼ 0.02); this adverse impact was validated in an additional series of 325 transplant-candidate MM patients included in the GEM05 o65 years trial. Moreover, CD81 þ SMM (n ¼ 34/56, 57%) patients had a shorter time to progression to MM (P ¼ 0.02). Overall, our results show that CD81 may have a relevant role in MM pathogenesis and represent a novel adverse prognostic marker in myeloma. Leukemia (2012) 26, 1862--1869; doi:10.1038/leu.2012.42 Keywords: multiple myeloma; plasma cells; CD81; flow cytometry; phenotype; survival INTRODUCTION PATIENTS AND METHODS Increasing knowledge of the biology of multiple myeloma (MM) Patients has unraveled significant associations between specific genetic and The study included 230 newly diagnosed, symptomatic, elderly MM 1--4 molecular subgroups and patients’ outcome. Updated information patients treated according to the Spanish GEM05465years protocol 5 6,7 has been recently published confirming previous observations on (NCT00443235: two arms of six cycles of bortezomib/melphalan/pre- the potential prognostic impact of the immunophenotypic charac- dnisone or bortezomib/thalidomide/prednisone, followed by maintenance teristics of bone marrow (BM) myelomatous plasma cells (MM-PCs) in with either bortezomib/thalidomide or bortezomib/prednisone for up to 3 þ MM patients. Of note, detection of CD19 MM-PC by multiparameter years),16 A validation set based on 325 newly diagnosed, symptomatic, flow cytometry (MFC) in MM at diagnosis correlates with an adverse transplant candidates MM patients enrolled in the Spanish GEM05o65- 5 outcome, although its clinical value is somehow hampered by the years trial (NCT00461747: randomized to receive induction with VBMCP/ þ 5 low frequency (4%) of CD19 MM cases. CD19 is physically VBAD plus bortezomib, or thalidomide/dexamethasone, or bortezomib/ 8--12 associated with CD225, CD21 and regulated by CD81, a thalidomide/dexamethason followed by high-dose therapy/autologous 13,14 tetraspanin widely expressed on B cells including mature PCs, stem cell transplantation) was used. MM patients’ response was assessed which is involved in the regulation of cell growth, motility, using the European Group for Blood and Marrow Transplant criteria.17 8 --11,15 signaling and BM homing. However, immunophenotypic Additionally, we have analyzed a total of 56 SMM patients newly studies of CD81 expression in patients with myeloma diagnosed according to the International Myeloma Working Group 13,14 are scanty, and its potential prognostic value remains criteria18 and with high-risk of progression to symptomatic disease, based unknown. Here, we report on the results of a prospective analysis on the presence of at least two of the three following criteria: BM PC about the prognostic impact of the expression of CD81 in MM-PCs infiltration X10%; high M-component (immunoglobulin GX30 g/l or by MFC at diagnosis in symptomatic and high-risk smoldering immunoglobulin AX20 g/l or B--J protein41 g/24 h); or X95% MM-PCs/ MM (SMM). BMPCs plus immune paresis. The median follow-up was 32 and 22 months 1Servicio de Hematologı´a, Hospital Universitario de Salamanca, Salamanca, Salamanca, Spain; 2Servicio de Hematologı´a, Centro de Investigacio´n del Ca´ncer (CIC, IBMCC USAL- CSIC), Salamanca, Spain; 3Servicio de Hematologı´a, Hospital 12 de Octubre, Madrid, Spain; 4Servicio de Hematologı´a, Hospital Clı´nic, IDIBAPS, Barcelona, Spain; 5Servicio de Hematologı´a, Hospital Universitari Germans Trias i Pujol, Badalona, Spain; 6Servicio de Hematologı´a, Hospital Morales Meseguer, Murcia, Spain; 7Servicio de Hematologı´a, Hospital Lozano Blesa, Zaragoza, Spain; 8Servicio de Hematologı´a, Hospital de Donostia, San Sebastian, Spain; 9Servicio de Hematologı´a, Hospital Clı´nico de Valencia, Valencia, Spain; 10Servicio de Hematologı´a, Hospital Universitario La Paz, Madrid, Spain; 11Servicio de Hematologı´a, Hospital Virgen de la Concha, Zamora, Spain; 12Servicio de Hematologı´a, Hospital General de Segovia, Segovia, Spain and 13Servicio General de Citometrı´a and Department of Medicine, Universidad de Salamanca, Salamanca, Spain. Correspondence: Professor J-F San Miguel, Servicio de Hematologı´a, Hospital Universitario de Salamanca, Paseo de San Vicente 58-182, 37007 Salamanca, Spain. E-mail: [email protected] Received 19 September 2011; revised 17 January 2012; accepted 1 February 2012; accepted article preview online 15 February 2012; advance online publication, 9 March 2012 CD81 expression in myeloma B Paiva et al 1863 for the MM and SMM series, respectively. All control and patient samples double-step data acquisition procedure and the CellQUEST PRO software were collected after informed consent was obtained from each individual, (BDB).5,19 according to the local ethical committees and the Helsinki Declaration. Fluorescence in situ hybridization analysis MFC immunophenotypic studies Fluorescence in situ hybridization was performed at baseline in immuno- Erythrocyte-lysed whole-BM samples were stained using a direct magnetic-enriched PCs from 211 of the 230 elderly MM patients. Patients 5,19 immunofluorescence technique previously described in detail, with harboring a t(4;14), t(14;16) and/or del(17p) were classified with high-risk three four-color monoclonal antibody combinations---(fluorescein isothio- disease and all other cases as standard-risk, according to the International cyanate/phycoerythrin/PerCP-Cy5.5/antigen-presenting cell). CD38/CD56/ Myeloma Working Group guidelines.21 CD19/CD45, CD38/CD27/CD45/CD28 and b2-microglobulin/CD81/CD38/ CD117 aimed at the identification, quantification and characterization of MM-PCs, including CD81 surface expression. DNA PC content was assessed mRNA gene expressing profiling (GEP) by MFC according to standard methods,20 through simultaneous staining To investigate a potential correlation between both the CD81 surface for MM-PCs and DNA with CD38/CD138 (fluorescein isothiocyanate) and protein (MFC) and the genomic mRNA expressions, we used a data set of propidium iodide, respectively. Acquisition was performed in a FACSCa- GEP (full data available at GEO, GSE16558) that we had previously gener- libur flow cytometer (BD Biosciences (BDB), San Jose, CA, USA) with a ated on a subset of 23 of the 230 MM patients and in 6 healthy adults.22 1E5 1E5 1E4 1E4 Heterogeneous CD81-/+ 1E3 1E3 expression on MM-PC CD81 CD81 0 0 -1E3 0 1E31E4 1E5 0 1E31E4 1E5 CD19 CD19 1E5 1E5 1E4 1E4 Homogeneous CD81+ 1E3 1E3 expression on MM-PC CD81 CD81 1E2 0 0 -1E2 0 1E31E4 1E5 0 1E31E4 1E5 CD19 CD19 1E5 1E5 1E4 1E4 CD81- expression on MM-PC 1E3 CD81 CD81 1E3 0 0 0 1E31E4 1E5 -1E20 1E2 1E31E4 1E5 CD19 CD19 1E5 1E5 1E4 1E4 Patterns of CD81 expression 1E3 1E3 on normal PC CD81 CD81 1E2 1E2 0 0 -1E20 1E2 1E3 1E4 1E5 0 1E31E4 1E5 CD19 CD19 Figure 1. Bivariate dot plot histograms illustrating the patterns of CD81 vs CD19 expression in MM-PCs and normal PCs. Illustrative examples of CD81 heterogeneous (from negative to positive, À/ þ ; a, b), homogeneous positive (c, d) and negative (e, f) patterns of expression are shown. In (g, h), the pattern of CD81 expression on normal PCs from healthy adults is represented. In all bivariate dot plots, BMPCs are represented in black dots, mature B cells in dark-grey dots and B-cell precursors in light-grey dots. & 2012 Macmillan Publishers Limited Leukemia (2012) 1862 --1869 CD81 expression in myeloma B Paiva et al 1864 Expression values for each probe set were calculated using the RMAExpress program that uses the Robust Multi-Array Average algorithm.22 Cell culture and western blotting MM cell lines (RPMI-8226, RPMI-LR5, NCI-H929, OPM-2, JJN3, MM1S, MM1R, MM144, U266, U266-DOX4, U266-LR7, SJR and MGG) were grown at 37 1C in a humidified atmosphere in the presence of 5% CO2 --95% air in RPMI 1640 medium supplemented with 10% fetal bovine serum and antibiotics. MM cell lines were prepared for protein analysis in non-reducing conditions following standard procedures.23 For immunoprecipitation and western blot analyses, an anti-CD81 antibody was purchased from BDB. Statistical analyses The Mann--Whitney U and Pearson correlation tests were used to estimate the statistical significance of differences between groups of cases and correlations between variables, respectively. Time to progression, progres- sion-free survival (PFS) and overall survival (OS) distribution curves were plotted using the Kaplan--Meier method; the log-rank test was used to estimate the statistical significance of differences observed between curves.
Load more

Recommended publications
  • PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than Cd79a and Selective Association with T(8;21)-Acute Myelogenous Leukemia
    [CANCER RESEARCH 64, 7399–7404, October 15, 2004] PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than CD79a and Selective Association with t(8;21)-Acute Myelogenous Leukemia Enrico Tiacci,1 Stefano Pileri,2 Annette Orleth,1 Roberta Pacini,1 Alessia Tabarrini,1 Federica Frenguelli,1 Arcangelo Liso,3 Daniela Diverio,4 Francesco Lo-Coco,5 and Brunangelo Falini1 1Institutes of Hematology and Internal Medicine, University of Perugia, Perugia, Italy; 2Unit of Hematopathology, University of Bologne, Bologne, Italy; 3Section of Hematology, University of Foggia, Foggia, Italy; 4Department of Cellular Biotechnologies and Hematology, University La Sapienza of Rome, Rome, Italy; and 5Department of Biopathology, University Tor Vergata of Rome, Rome, Italy ABSTRACT (13, 16). PAX5 expression also occurs in the adult testis and in the mesencephalon and spinal cord during embryogenesis (17), suggesting an The transcription factor PAX5 plays a key role in the commitment of important role in the development of these tissues. hematopoietic precursors to the B-cell lineage, but its expression in acute Rearrangement of the PAX5 gene through reciprocal chromosomal leukemias has not been thoroughly investigated. Hereby, we analyzed routine biopsies from 360 acute leukemias of lymphoid (ALLs) and mye- translocations has been described in different types of B-cell malig- loid (AMLs) origin with a specific anti-PAX5 monoclonal antibody. Blasts nancies (18–23), and, more recently, PAX5 has also been shown to be from 150 B-cell ALLs showed strong PAX5 nuclear expression, paralleling targeted by aberrant hypermutation in Ͼ50% of diffuse large B-cell that of CD79a in the cytoplasm. Conversely, PAX5 was not detected in 50 lymphomas (24).
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Bispecific CAR-T Cells Targeting Both CD19 and CD22 for Therapy Of
    Dai et al. Journal of Hematology & Oncology (2020) 13:30 https://doi.org/10.1186/s13045-020-00856-8 RAPID COMMUNICATION Open Access Bispecific CAR-T cells targeting both CD19 and CD22 for therapy of adults with relapsed or refractory B cell acute lymphoblastic leukemia Hanren Dai1,2,3†, Zhiqiang Wu1†, Hejin Jia2†, Chuan Tong1, Yelei Guo1, Dongdong Ti1, Xiao Han1, Yang Liu4, Wenying Zhang2, Chunmeng Wang2, Yajing Zhang2, Meixia Chen2, Qingming Yang2, Yao Wang1* and Weidong Han1,2* Abstract Background: Despite the impressive complete remission (CR) induced by CD19 CAR-T cell therapy in B-ALL, the high rate of complete responses is sometimes limited by the emergence of CD19-negative leukemia. Bispecific CAR-modified T cells targeting both CD19 and CD22 may overcome the limitation of CD19-negative relapse. Methods: We here report the design of a bispecific CAR simultaneous targeting of CD19 and CD22. We performed a phase 1 trial of bispecific CAR T cell therapy in patients with relapsed/refractory precursor B-ALL at a dose that ranged from 1.7 × 106 to 3 × 106 CAR T cells per kilogram of body weight. Results: We demonstrate bispecific CD19/CD22 CAR T cells could trigger robust cytolytic activity against target cells. MRD-negative CR was achieved in 6 out of 6 enrolled patients. Autologous CD19/CD22 CAR T cells proliferated in vivo and were detected in the blood, bone marrow, and cerebrospinal fluid. No neurotoxicity occurred in any of the 6 patients treated. Of note, one patient had a relapse with blast cells that no longer expressed CD19 and exhibited diminished CD22 site density approximately 5 months after treatment.
    [Show full text]
  • CD81 Is Required for CD19-Complex Formation and Terminal Human B
    Supplemental Table 1. Primer sequences for PCR amplification and sequencing of CD81 coding regions from genomic DNA. Exon Forward primer Forward primer sequence Reverse primer Reverse primer sequence 1 CD81exon1F GGGGCGGGGCCTATGGAG CD81exon1R GGACCTGCCCAACGTGGA 2 CD81exon2F TGTGGGGTGGGCGCACTC CD81exon2R CACGCCATGCCCGACTGT 3 CD81exon3F ATCCCTGGCAGTCAGCAACC CD81exon3R TCCGCCCTGAGCACCAGC 4 CD81exon4F GTCAGGTCGTGGGCTGGT CD81exon4R CTGGAGATCCTCCTGGCAAGT 5 CD81exon5F TCTGGGGTCTAGCCTCGAAGC CD81exon5R CTGGGCGTAGGCAGGATT 6 CD81exon6F GGCCCCTGGATGCATTCT CD81exon6R AGTGTGGTCGCTCCCTGTGG 7+8 CD81exon7+8F CTGCGTGACAACGGGAAG CD81exon7+8R TATACACAGGCGGTGATGG Supplemental Table 2. Primer sequences for PCR amplification and sequencing of CD81 and CD225 transcripts. Gene Forward primer Forward primer sequence Reverse primer Reverse primer sequence CD81 CD81_mRNA_F1 GACCCCACCGCGCATCCT CD81_mRNA_R1 GGATGGCCCCGTAGCAGC CD81_mRNA_F2 CGCCCAACACCTTCTATGTA CD81_mRNA_R2 TGCCCGAGGGACACAAAT CD81_mRNA_F3 TTCCACGAGACGCTTGACTGCT CD81_mRNA_R3 AGGCCCGTCTCCACTCAT IFITM1 IFITM1_mRNA_F1 TCATTGGTCCCTGGCTAATTCAC IFITM1_mRNA_R1 GGTCACGTCGCCAACCAT IFITM1_mRNA_F2 ACAGCGAGACCTCCGTGC IFITM1_mRNA_R2 TCTAGGGGCAGGACCAAG Supplemental Table 3. PCR primers and TaqMan probes for CD81 transcript level quantification. Target Forward primer Forward primer sequence Reverse primer Reverse primer sequence TaqMan probe TaqMan probe Sequence total CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA CD81_RQ_R AGAGGTTGCTGATGATGTTGCTG T-CD81 ACTGACTGCTTTGACCACCTCAGTGCTCA wild type CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA
    [Show full text]
  • CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-Lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity
    cancers Article CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity Shabirul Haque 1,2,* and Sarah R. Vaiselbuh 1,2,3 1 Feinstein Institute for Medical Research, Northwell Health, 350 Community Drive, Manhasset, NY 11030, USA; [email protected] 2 Department of Pediatrics, Staten Island University Hospital, Northwell Health, 475 Seaview Ave, Staten Island, NY 10305, USA 3 Monsey Health Center, 40 Robert Pitt Drive, Monsey, NY 10952, USA * Correspondence: [email protected] Simple Summary: Our research describes our designer exosomes express CD19 Chimeric Antigen Receptor (Exo-CD19 CAR). This novel Exo-CD19 CAR is cytotoxic for CD19-positive leukemia B-cells without interfering with cytotoxicity in CD19-negative cells. This innovation can be translated into broader clinical applications as CD19 CAR exosome-based nano-immunotherapy for B-cell leukemia instead of whole CD19 CAR T-cell immunotherapy. Abstract: CAR-T cell therapy is not without some clinical adverse effects, namely cytokine storms, due to a massive release of cytokines when CAR-T cells multiply in the body. Our goal was to develop exosomes expressing CD19 CAR to treat CD19-positive B-cell malignancies, instead of using whole CD19 CAR-T cells, thereby reducing the clinical risk of uncontrolled cytokine storms. Exosomes are Citation: Haque, S.; Vaiselbuh, S.R. extracellular nanovesicles (30–150 nm), composed of lipids, proteins, and nucleic acids, that carry the CD19 Chimeric Antigen fingerprint of their parent cells. Exosomes are a preferred delivery system in nano-immunotherapy. Receptor-Exosome Targets CD19 Here, HEK293T parent cells were transduced with CD19 CAR plasmids and cellular CD19 CAR Positive B-lineage Acute Lymphocytic expression was confirmed.
    [Show full text]
  • Systemic Induction of the Angiogenesis Switch by the Tetraspanin D6.1A/CO-029
    Research Article Systemic Induction of the Angiogenesis Switch by the Tetraspanin D6.1A/CO-029 Sabine Gesierich,1 Igor Berezovskiy,1 Eduard Ryschich,2 and Margot Zo¨ller1,3 1Department of Tumor Progression and Immune Defence, German Cancer Research Centre; 2Department of Surgery, University of Heidelberg, Heidelberg; and 3Department of Applied Genetics, Faculty of Chemistry and Bioscience, University of Karlsruhe, Karlsruhe, Germany Abstract transcription of angiogenic factors (6, 7). Recent studies in Expression of the tetraspanin CO-029 is associated with poor knockout and transgenic mouse models have provided further prognosis in patients with gastrointestinal cancer. In a evidence that tumor angiogenesis is not only guided by the pancreatic tumor line, overexpression of the rat homologue, tumor cell itself, but is also closely tied to the tumor microenvi- ronment (8). D6.1A, induces lethally disseminated intravascular coagula- tion, suggesting D6.1A engagement in angiogenesis. D6.1A- Tetraspanins are a large family of proteins grouped according to overexpressing tumor cells induce the greatest amount of structural relatedness. The key feature of tetraspanins is their angiogenesis in vivo, and tumor cells as well as exosomes potential to associate with each other and with a multitude of derived thereof strikingly increase endothelial cell branching molecules from other protein families (9–11), the most prominent in vitro. Tumor cell–derived D6.1A stimulates angiogenic partners being integrins (12). The tetraspanin, D6.1A (rat)/CO-029 a h a h factor transcription, which includes increased matrix metal- (human), associates with 3 1 and 6 1 and, after disassembly of a h loproteinase and urokinase-type plasminogen activator se- hemidesmosomes, with 6 4.
    [Show full text]
  • Point Mutation in CD19 Facilitates Immune Escape of B Cell Lymphoma from CAR-­T Cell Therapy
    Open access Original research J Immunother Cancer: first published as 10.1136/jitc-2020-001150 on 6 October 2020. Downloaded from Point mutation in CD19 facilitates immune escape of B cell lymphoma from CAR- T cell therapy 1 1 1 1 1 1 Zhen Zhang, Xinfeng Chen, Yonggui Tian, Feng Li , Xuan Zhao, Jinyan Liu, 1 1,2,3,4 Chang Yao, Yi Zhang To cite: Zhang Z, Chen X, ABSTRACT relapses after CD19 CAR-T cell therapy are Tian Y, et al. Point mutation Background Tumor relapse due to mutation in CD19 can attributed to the antigen loss, indicating an in CD19 facilitates immune hinder the efficacy of chimeric antigen receptor (CAR)- T urgent need for investigating the mechanisms escape of B cell lymphoma from cell therapy. Herein, we focused on lymphoma patients CAR- T cell therapy. Journal underlying recurrence and for improving whose B cells exhibited a point mutation in CD19 of B cells 4 5 for ImmunoTherapy of Cancer the efficacy of CAR- T cell therapy. Inter- 2020; :e001150. doi:10.1136/ after CAR-T cell infusion. 8 + estingly, one of the specific mechanisms jitc-2020-001150 Methods The CAR- T and CD19 B cells from peripheral blood or bone marrow were assessed using flow of tumor escape that has been reported cytometry. Genome sequencing was conducted to identify suggests that exon mutations affecting the ► Additional material is + published online only. To view, the molecular characteristics of CAR- T and CD19 B cells CD19 gene and its splicing isoforms, leading please visit the journal online from pre-rela pse and postrelapse samples.
    [Show full text]
  • A Shared Pathway of Exosome Biogenesis Operates at Plasma And
    bioRxiv preprint doi: https://doi.org/10.1101/545228; this version posted February 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A shared pathway of exosome biogenesis operates at plasma and endosome membranes Francis K. Fordjour1, George G. Daaboul2, and Stephen J. Gould1* 1Department of Biological Chemistry Johns Hopkins University Baltimore, MD USA 2Nanoview Biosciences Boston, MA USA Corresponding author: Stephen J. Gould, Ph.D. Department of Biological Chemistry Johns Hopkins University Baltimore, MD USA Email: [email protected] Tel (01) 443 847 9918 1 bioRxiv preprint doi: https://doi.org/10.1101/545228; this version posted February 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Summary: This study of exosome cargo protein budding reveals that cells use a common pathway for budding exosomes from plasma and endosome membranes, providing a new mechanistic explanation for exosome heterogeneity and a rational roadmap for exosome engineering. Keywords: Protein budding, tetraspanin, endosome, plasma membrane, extracellular vesicle, CD9, CD63, CD81, SPIR, interferometry Abbreviations: EV, extracellular vesicles; IB, immunoblot; IFM, immunofluorescence microscopy; IPMC, intracellular plasma membrane-connected compartment; MVB, multivesicular body; SPIR, single-particle interferometric reflectance; SPIRI, single-particle interferometric reflectance imaging 2 bioRxiv preprint doi: https://doi.org/10.1101/545228; this version posted February 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved.
    [Show full text]
  • Identification of 18 Immune Cell Subsets Using 13-Color Panel
    Immunophenotyping Identification of 18 immune cell subsets in human blood using a 13-color panel Background Cell type Function Phenotype Flow cytometry has become the method of choice for Eosinophils Parasitic immunity CD45+, SSCmid/hi, CD14 –, CD16 –, CD19– immunophenotyping and identifying specific cellular + mid/hi subsets. Within seconds, it provides a thorough overview of Neutrophils Innate Immunity CD45 , SSC , CD14 –, CD16+, CD19– the major cell types that constitute a sample. Using multiple + mid markers simultaneously increases the number of parameters Classical Phagocytosis of CD45 , SSC , monocytes pathogens and CD14+, CD16– that can be analyzed per run and decreases the amount of antigen presentation starting material required to perform an assay. This can be Intermediate Phagocytosis of CD45+, SSCmid, critical for precious sample material and long-term immune- monocytes pathogens and CD14+, CD16mid monitoring studies. In this application note, we demonstrate antigen presentation 13-color immunophenotyping of human peripheral blood Non-classical Phagocytosis of CD45+, SSCmid, + + mononuclear cells (PBMCs) using the MACSQuant® Analyzer 16, monocytes pathogens and CD14 , CD16 antigen presentation a compact and reliable benchtop flow cytometer equipped + low + with three lasers. The markers selected allow for the Class-switched Adaptive immunity CD45 , SSC , CD19 , memory B cells CD27+, IgD–, CD14– simultaneous identification and analysis of 18 different cell Non-switched Adaptive immunity CD45+, SSClow, CD19+, populations, thus maximizing the amount of information that memory B cells CD27+, IgD+, CD14– can be retrieved from the sample material analyzed. This is Naive B cells Adaptive immunity – CD45+, SSClow, CD19+, critical when input material is limited, as is often the case for non-antigen CD27–, IgD+, CD14– pediatric or disease studies.
    [Show full text]
  • Tetraspanin CD151 Plays a Key Role in Skin Squamous Cell Carcinoma
    Oncogene (2013) 32, 1772–1783 & 2013 Macmillan Publishers Limited All rights reserved 0950-9232/13 www.nature.com/onc ORIGINAL ARTICLE Tetraspanin CD151 plays a key role in skin squamous cell carcinoma QLi1, XH Yang2,FXu1, C Sharma1, H-X Wang1, K Knoblich1, I Rabinovitz3, SR Granter4 and ME Hemler1 Here we provide the first evidence that tetraspanin CD151 can support de novo carcinogenesis. During two-stage mouse skin chemical carcinogenesis, CD151 reduces tumor lag time and increases incidence, multiplicity, size and progression to malignant squamous cell carcinoma (SCC), while supporting both cell survival during tumor initiation and cell proliferation during the promotion phase. In human skin SCC, CD151 expression is selectively elevated compared with other skin cancer types. CD151 support of keratinocyte survival and proliferation may depend on activation of transcription factor STAT3 (signal transducers and activators of transcription), a regulator of cell proliferation and apoptosis. CD151 also supports protein kinase C (PKC)a–a6b4 integrin association and PKC-dependent b4 S1424 phosphorylation, while regulating a6b4 distribution. CD151–PKCa effects on integrin b4 phosphorylation and subcellular localization are consistent with epithelial disruption to a less polarized, more invasive state. CD151 ablation, while minimally affecting normal cell and normal mouse functions, markedly sensitized mouse skin and epidermoid cells to chemicals/drugs including 7,12-dimethylbenz[a]anthracene (mutagen) and camptothecin (topoisomerase inhibitor), as well as to agents targeting epidermal growth factor receptor, PKC, Jak2/Tyk2 and STAT3. Hence, CD151 ‘co-targeting’ may be therapeutically beneficial. These findings not only support CD151 as a potential tumor target, but also should apply to other cancers utilizing CD151/laminin-binding integrin complexes.
    [Show full text]
  • Extracellular Vesicle Human CD9/CD63/CD81 Antibody Panel
    Extracellular Vesicle Human CD9/CD63/CD81 Antibody Panel Antibody panel for the detection of extracellular vesicles using CD9, CD63, and CD81 markers Catalog #100-0211 1 Kit Product Description The Extracellular Vesicle Human CD9/CD63/CD81 Antibody Panel is suitable for the detection of extracellular vesicles (EVs) derived from human cells. It comprises three primary antibodies that are immunoreactive toward human CD9, CD63, and CD81; these are proteins that are typically expressed on EVs and widely used as markers to analyze and isolate these cell-derived particles. CD9, CD63, and CD81 belong to the tetraspanin family of membrane proteins, which possess four transmembrane domains and interact with diverse proteins on the cell surface to form multimolecular networks termed tetraspanin-enriched microdomains. CD9, CD63, and CD81 proteins are expressed on the surface of many cells, including B cells, T cells, NK cells, monocytes, dendritic cells, thymocytes, endothelial cells, and fibroblasts, and are involved in modulating a variety of cellular processes including cell activation, adhesion, differentiation, and tumor invasion. The antibodies provided in this panel have been reported for use in analyzing primary cells, cell lines, and EVs by ELISA, flow cytometry, immunocytochemistry, immunoprecipitation, and Western blotting. They have been reported to cross-react with their cognate antigens in non-human primates, including baboons and rhesus and cynomolgus macaques. Product Information The following products comprise the Extracellular
    [Show full text]
  • Aberrant Expression of Tetraspanin Molecules in B-Cell Chronic Lymphoproliferative Disorders and Its Correlation with Normal B-Cell Maturation
    Leukemia (2005) 19, 1376–1383 & 2005 Nature Publishing Group All rights reserved 0887-6924/05 $30.00 www.nature.com/leu Aberrant expression of tetraspanin molecules in B-cell chronic lymphoproliferative disorders and its correlation with normal B-cell maturation S Barrena1,2, J Almeida1,2, M Yunta1,ALo´pez1,2, N Ferna´ndez-Mosteirı´n3, M Giralt3, M Romero4, L Perdiguer5, M Delgado1, A Orfao1,2 and PA Lazo1 1Instituto de Biologı´a Molecular y Celular del Ca´ncer, Centro de Investigacio´n del Ca´ncer, Consejo Superior de Investigaciones Cientı´ficas-Universidad de Salamanca, Salamanca, Spain; 2Servicio de Citometrı´a, Universidad de Salamanca and Hospital Universitario de Salamanca, Salamanca, Spain; 3Servicio de Hematologı´a, Hospital Universitario Miguel Servet, Zaragoza, Spain; 4Hematologı´a-hemoterapia, Hospital Universitario Rı´o Hortega, Valladolid, Spain; and 5Servicio de Hematologı´a, Hospital de Alcan˜iz, Teruel, Spain Tetraspanin proteins form signaling complexes between them On the cell surface, tetraspanin antigens are present either as and with other membrane proteins and modulate cell adhesion free molecules or through interaction with other proteins.25,26 and migration properties. The surface expression of several tetraspanin antigens (CD9, CD37, CD53, CD63, and CD81), and These interacting proteins include other tetraspanins, integri- F 22,27–30F their interacting proteins (CD19, CD21, and HLA-DR) were ns particularly those with the b1 subunit HLA class II 31–33 34,35 analyzed during normal B-cell maturation and compared to a moleculesFeg HLA DR -, CD19, the T-cell recep- group of 67 B-cell neoplasias. Three patterns of tetraspanin tor36,37 and several other members of the immunoglobulin expression were identified in normal B cells.
    [Show full text]