DOCSLIB.ORG

Features of Human CD3+CD20+ T Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Features of Human CD3+CD20+ T Cells Published July 13, 2016, doi:10.4049/jimmunol.1600089 The Journal of Immunology Features of Human CD3+CD20+ T Cells Elisabeth Schuh,*,† Kerstin Berer,‡ Matthias Mulazzani,x,{ Katharina Feil,x Ingrid Meinl,* Harald Lahm,‖ Markus Krane,‖,# Rudiger€ Lange,‖,# Kristina Pfannes,** Marion Subklewe,** Robert Gurkov,€ †† Monika Bradl,† Reinhard Hohlfeld,*,‡‡ Tania Kumpfel,*€ Edgar Meinl,*,1 and Markus Krumbholz*,1,2 Monoclonal Abs against CD20 reduce the number of relapses in multiple sclerosis (MS); commonly this effect is solely attributed to depletion of B cells. Recently, however, a subset of CD3+CD20+ T cells has been described that is also targeted by the anti-CD20 mAb rituximab. Because the existence of cells coexpressing CD3 and CD20 is controversial and features of this subpopulation are poorly understood, we studied this issue in detail. In this study, we confirm that 3–5% of circulating human T cells display CD20 on their surface and transcribe both CD3 and CD20. We report that these CD3+CD20+ T cells pervade thymus, bone marrow, and secondary lymphatic organs. They are found in the cerebrospinal fluid even in the absence of inflammation; in the cerebrospinal fluid of MS patients they occur at a frequency similar to B cells. Phenotypically, these T cells are enriched in CD8+ and CD45RO+ memory cells and in CCR72 cells. Functionally, they show a higher frequency of IL-4–, IL-17–, IFN-g–, and TNF-a–producing cells compared with T cells lacking CD20. CD20-expressing T cells respond variably to immunomodulatory treatments given to MS patients: they are reduced by fingolimod, alemtuzumab, and dimethyl fumarate, whereas natalizumab disproportionally increases them in the blood. After depletion by rituximab, they show earlier and higher repopulation than CD20+ B cells. Taken together, human CD3+CD20+ T cells pervade lymphatic organs and the cerebrospinal fluid, have a strong ability to produce different cytokines, and respond to MS disease modifying drugs. The Journal of Immunology, 2016, 197: 000–000. argeting CD20 with depleting mAbs is an approved marker. In fact, CD20 is expressed during B cell development and therapy in rheumatic diseases (1) and is promising in maturation from pre-B cells to plasmablasts (5, 6). However, there multiple sclerosis (MS) (2–4). The therapeutic success are conflicting reports that CD20 is also expressed by some T + has so far solely been attributed to the depletion of CD20 B cells T cells. The first report of CD20-expressing T cells in the circu- because CD20 is commonly considered as a specific B cell lation dates back to 1993, where a subset of CD3+CD20+ T cells has been described in healthy subjects (7) and later also in pe- ripheral T cell lymphoma (8). The description of CD3+CD20+ *Institute of Clinical Neuroimmunology, Biomedical Center and University Hospital, T cells in rheumatoid arthritis patients and controls (9) was dis- Ludwig Maximilian University, 82152 Martinsried, Germany; †Department of Neuro- puted and has been regarded as an artifact of flow cytometry (10). immunology, Center for Brain Research, Medical University, 1090 Vienna, Austria; + + ‡ x Yet recently, a subset of CD3 CD20 T cells that is also targeted Max-Planck Institute of Biochemistry, 82152 Martinsried, Germany; Department of Neurology, University Hospital, Ludwig Maximilian University, 81377 Munich, by rituximab has been described (11). The issue remains com- { Germany; Medical Graduate Center, Technical University, 81675 Munich, plicated, however, because CD3+ B cells have been described as a Germany; ‖German Heart Center, Department of Cardiovascular Surgery and Exper- imental Surgery Laboratory, 80636 Munich, Germany; #German Center for Cardio- result from ex vivo storage of blood samples, leading to contact- vascular Research (partner site Munich Heart Alliance), 80636 Munich, Germany; dependent Ag exchange between T and B lymphocytes (12). **Department of Medicine III, University Hospital, Ludwig Maximilian University, We therefore aimed to clarify this issue by analysis of the ex- 81377 Munich, Germany; ††Department of Otolaryngology, University Hospital, Ludwig Maximilian University, 81377 Munich, Germany; and ‡‡Munich Cluster pression of CD20 on human T cells in detail. First, we confirmed for Systems Neurology (SyNergy), 81377 Munich, Germany that indeed ∼3–5% of human T cells in blood display CD20 on the 1E.M. and M.K. contributed equally to the study. surface and also transcribe both CD3 and CD20. We then exam- 2Current address: Department of Neurology and Stroke, Hertie Institute for Clinical ined their occurrence in human primary and secondary lymphatic Brain Research, Eberhard Karls University, Tubingen, Germany. organs and also in the cerebrospinal fluid. We determined their ORCIDs: 0000-0002-3517-5084 (M.M.); 0000-0002-4477-3406 (H.L.); 0000-0002- phenotype and their ability to produce cytokines. Furthermore, we 6662-5957 (R.L.); 0000-0003-2239-1586 (M.B.). analyzed how these cells are affected by different immunomod- Received for publication January 15, 2016. Accepted for publication June 2, 2016. ulatory treatments in MS patients. Thus, this study increases our This work was supported partially by Deutsche Forschungsgemeinschaft (Grant SFB knowledge about the biology of human CD3+CD20+ T cells and TR128), the Munich Cluster for Systems Neurology (Grant ExC 1010 SyNergy), the Clinical Competence Network for Multiple Sclerosis, and Verein zur Therapiefor- their response to immunomodulatory treatments in MS. schung fur€ Multiple Sklerose-Kranke. Address correspondence and reprint requests to Dr. Edgar Meinl, Institute of Clinical Materials and Methods Neuroimmunology, Biomedical Center and University Hospital, Ludwig Maximilian Patients and control donors University of Munich, Grosshaderner Strasse 9, D-82152 Martinsried, Germany. E-mail address: [email protected] All human samples were collected following written informed consent The online version of this article contains supplemental material. according to local ethics policy guidelines of the Ludwig-Maximilian University and the German Heart Center in accordance with the Decla- Abbreviations used in this article: FMOC, fluorescence minus-one control; FSC, forward scatter of light; FSC-A, forward scatter–area; FSC-H, forward scatter– ration of Helsinki. Peripheral blood was obtained from patients with a height; HC, healthy control; MS, multiple sclerosis; NMOSD, neuromyelitis optica confirmed diagnosis of MS (n = 39); neuromyelitis optica spectrum dis- spectrum disorder; OND, other neurological disease; SSC, side scatter of light. order (NMOSD) (n = 18), who either were untreated or received several courses of rituximab, alemtuzumab, natalizumab, fingolimod, or dimethyl Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00 fumarate and healthy controls (HC, n = 11). Clinical data of MS and www.jimmunol.org/cgi/doi/10.4049/jimmunol.1600089 2 CD3+CD20+ T CELLS NMOSD patients included in this study for therapy response are depicted Reverse Transcription Kit (Applied Biosystems, Foster City, CA). For real- in Supplemental Table I. Cerebrospinal fluid samples were obtained from a time PCR, TaqMan assays for cyclophilin A (peptidyl-prolyl isomerase A; total of 14 untreated patients, 6 of which had MS (n = 6). Eight patients did Applied Biosystems), CD3, CD20 (both Applied Biosystems), and CD19 not show any evidence of CNS inflammation and were classified as other [(e4) 844-F, GCAACCTGACCATGTCATTCC, (e4-5) 875Tf (C . G), neurological diseases (OND) (status epilepticus, n = 1; stroke, n =3; CACTGCTCGGCCAGTAC TATGGCACTG, (e5) 952 RAGATAAGCC- cluster headache, n = 1; intracerebral bleeding, n = 1; and dementia, n = 2). AAAGTCACAGCTGAGA)] were used in combination with the TaqMan Bone marrow was obtained by iliac crest aspiration for diagnostic reasons. PCR Core Reagent Kit (Applied Biosystems). Samples were run in In addition, we received thymic tissue from five infantile patients (01, duplicates in MicroAmp Optical 96-well reaction plates (Applied Bio- male, 87 d old; 02, female, 10 d; 03, male, 93 d; 04, male, 10 d; and 05, systems) in a 7900HT Fast Real-Time PCR System (Applied Biosystems). female, 7 d), which was removed during heart surgery. Data were analyzed using SDSv2.3 software (Applied Biosystems). Preparation of tissue samples from thymus, adenoids, bone-marrow, blood, Statistics and cerebrospinal fluid. Thymic and lymphatic tissue were minced into very small fragments by gentle mechanical disruption and stirred in RPMI 1640 Statistical significance was assessed with Prism Software (GraphPad) by medium on ice (2 3 10 min) to obtain single-cell suspensions. PBMC were unpaired, paired t test, or one-way ANOVA following Tukey, Holm–Sı´da´k, prepared by Pancoll (Pan Biotech, Aidenbach, Germany) density gradient or Bonferroni correction as appropriate. The p values (*p , 0.05, **p , centrifugation. Bone marrow samples, anticoagulated with EDTA, were 0.01, ***p , 0.001, and ****p , 0.0001) were considered significant and prepared by erythrocyte lysis. Samples were incubated for 12 min in lysis designated accordingly. buffer and further washed with PBS buffer, according to the manufac- turer’s protocol (Beckman Coulter, Krefeld, Germany). Results Flow cytometry Identification and phenotype of human CD3+CD20+ T cells Single lymphocytes of human PBMC were identified by forward scatter We compared two mAbs against CD20 and found that clone 2H7 is of light (FSC) and side scatter of light (SSC). We further divided + + 2 more
Load more

Recommended publications
  • PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than Cd79a and Selective Association with T(8;21)-Acute Myelogenous Leukemia
    [CANCER RESEARCH 64, 7399–7404, October 15, 2004] PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than CD79a and Selective Association with t(8;21)-Acute Myelogenous Leukemia Enrico Tiacci,1 Stefano Pileri,2 Annette Orleth,1 Roberta Pacini,1 Alessia Tabarrini,1 Federica Frenguelli,1 Arcangelo Liso,3 Daniela Diverio,4 Francesco Lo-Coco,5 and Brunangelo Falini1 1Institutes of Hematology and Internal Medicine, University of Perugia, Perugia, Italy; 2Unit of Hematopathology, University of Bologne, Bologne, Italy; 3Section of Hematology, University of Foggia, Foggia, Italy; 4Department of Cellular Biotechnologies and Hematology, University La Sapienza of Rome, Rome, Italy; and 5Department of Biopathology, University Tor Vergata of Rome, Rome, Italy ABSTRACT (13, 16). PAX5 expression also occurs in the adult testis and in the mesencephalon and spinal cord during embryogenesis (17), suggesting an The transcription factor PAX5 plays a key role in the commitment of important role in the development of these tissues. hematopoietic precursors to the B-cell lineage, but its expression in acute Rearrangement of the PAX5 gene through reciprocal chromosomal leukemias has not been thoroughly investigated. Hereby, we analyzed routine biopsies from 360 acute leukemias of lymphoid (ALLs) and mye- translocations has been described in different types of B-cell malig- loid (AMLs) origin with a specific anti-PAX5 monoclonal antibody. Blasts nancies (18–23), and, more recently, PAX5 has also been shown to be from 150 B-cell ALLs showed strong PAX5 nuclear expression, paralleling targeted by aberrant hypermutation in Ͼ50% of diffuse large B-cell that of CD79a in the cytoplasm. Conversely, PAX5 was not detected in 50 lymphomas (24).
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Bispecific CAR-T Cells Targeting Both CD19 and CD22 for Therapy Of
    Dai et al. Journal of Hematology & Oncology (2020) 13:30 https://doi.org/10.1186/s13045-020-00856-8 RAPID COMMUNICATION Open Access Bispecific CAR-T cells targeting both CD19 and CD22 for therapy of adults with relapsed or refractory B cell acute lymphoblastic leukemia Hanren Dai1,2,3†, Zhiqiang Wu1†, Hejin Jia2†, Chuan Tong1, Yelei Guo1, Dongdong Ti1, Xiao Han1, Yang Liu4, Wenying Zhang2, Chunmeng Wang2, Yajing Zhang2, Meixia Chen2, Qingming Yang2, Yao Wang1* and Weidong Han1,2* Abstract Background: Despite the impressive complete remission (CR) induced by CD19 CAR-T cell therapy in B-ALL, the high rate of complete responses is sometimes limited by the emergence of CD19-negative leukemia. Bispecific CAR-modified T cells targeting both CD19 and CD22 may overcome the limitation of CD19-negative relapse. Methods: We here report the design of a bispecific CAR simultaneous targeting of CD19 and CD22. We performed a phase 1 trial of bispecific CAR T cell therapy in patients with relapsed/refractory precursor B-ALL at a dose that ranged from 1.7 × 106 to 3 × 106 CAR T cells per kilogram of body weight. Results: We demonstrate bispecific CD19/CD22 CAR T cells could trigger robust cytolytic activity against target cells. MRD-negative CR was achieved in 6 out of 6 enrolled patients. Autologous CD19/CD22 CAR T cells proliferated in vivo and were detected in the blood, bone marrow, and cerebrospinal fluid. No neurotoxicity occurred in any of the 6 patients treated. Of note, one patient had a relapse with blast cells that no longer expressed CD19 and exhibited diminished CD22 site density approximately 5 months after treatment.
    [Show full text]
  • CD81 Is Required for CD19-Complex Formation and Terminal Human B
    Supplemental Table 1. Primer sequences for PCR amplification and sequencing of CD81 coding regions from genomic DNA. Exon Forward primer Forward primer sequence Reverse primer Reverse primer sequence 1 CD81exon1F GGGGCGGGGCCTATGGAG CD81exon1R GGACCTGCCCAACGTGGA 2 CD81exon2F TGTGGGGTGGGCGCACTC CD81exon2R CACGCCATGCCCGACTGT 3 CD81exon3F ATCCCTGGCAGTCAGCAACC CD81exon3R TCCGCCCTGAGCACCAGC 4 CD81exon4F GTCAGGTCGTGGGCTGGT CD81exon4R CTGGAGATCCTCCTGGCAAGT 5 CD81exon5F TCTGGGGTCTAGCCTCGAAGC CD81exon5R CTGGGCGTAGGCAGGATT 6 CD81exon6F GGCCCCTGGATGCATTCT CD81exon6R AGTGTGGTCGCTCCCTGTGG 7+8 CD81exon7+8F CTGCGTGACAACGGGAAG CD81exon7+8R TATACACAGGCGGTGATGG Supplemental Table 2. Primer sequences for PCR amplification and sequencing of CD81 and CD225 transcripts. Gene Forward primer Forward primer sequence Reverse primer Reverse primer sequence CD81 CD81_mRNA_F1 GACCCCACCGCGCATCCT CD81_mRNA_R1 GGATGGCCCCGTAGCAGC CD81_mRNA_F2 CGCCCAACACCTTCTATGTA CD81_mRNA_R2 TGCCCGAGGGACACAAAT CD81_mRNA_F3 TTCCACGAGACGCTTGACTGCT CD81_mRNA_R3 AGGCCCGTCTCCACTCAT IFITM1 IFITM1_mRNA_F1 TCATTGGTCCCTGGCTAATTCAC IFITM1_mRNA_R1 GGTCACGTCGCCAACCAT IFITM1_mRNA_F2 ACAGCGAGACCTCCGTGC IFITM1_mRNA_R2 TCTAGGGGCAGGACCAAG Supplemental Table 3. PCR primers and TaqMan probes for CD81 transcript level quantification. Target Forward primer Forward primer sequence Reverse primer Reverse primer sequence TaqMan probe TaqMan probe Sequence total CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA CD81_RQ_R AGAGGTTGCTGATGATGTTGCTG T-CD81 ACTGACTGCTTTGACCACCTCAGTGCTCA wild type CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA
    [Show full text]
  • CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-Lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity
    cancers Article CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity Shabirul Haque 1,2,* and Sarah R. Vaiselbuh 1,2,3 1 Feinstein Institute for Medical Research, Northwell Health, 350 Community Drive, Manhasset, NY 11030, USA; [email protected] 2 Department of Pediatrics, Staten Island University Hospital, Northwell Health, 475 Seaview Ave, Staten Island, NY 10305, USA 3 Monsey Health Center, 40 Robert Pitt Drive, Monsey, NY 10952, USA * Correspondence: [email protected] Simple Summary: Our research describes our designer exosomes express CD19 Chimeric Antigen Receptor (Exo-CD19 CAR). This novel Exo-CD19 CAR is cytotoxic for CD19-positive leukemia B-cells without interfering with cytotoxicity in CD19-negative cells. This innovation can be translated into broader clinical applications as CD19 CAR exosome-based nano-immunotherapy for B-cell leukemia instead of whole CD19 CAR T-cell immunotherapy. Abstract: CAR-T cell therapy is not without some clinical adverse effects, namely cytokine storms, due to a massive release of cytokines when CAR-T cells multiply in the body. Our goal was to develop exosomes expressing CD19 CAR to treat CD19-positive B-cell malignancies, instead of using whole CD19 CAR-T cells, thereby reducing the clinical risk of uncontrolled cytokine storms. Exosomes are Citation: Haque, S.; Vaiselbuh, S.R. extracellular nanovesicles (30–150 nm), composed of lipids, proteins, and nucleic acids, that carry the CD19 Chimeric Antigen fingerprint of their parent cells. Exosomes are a preferred delivery system in nano-immunotherapy. Receptor-Exosome Targets CD19 Here, HEK293T parent cells were transduced with CD19 CAR plasmids and cellular CD19 CAR Positive B-lineage Acute Lymphocytic expression was confirmed.
    [Show full text]
  • T Cells the Usual Subsets
    T cells: the usual subsets Chen Dong and Gustavo J. Martinez T cells have important roles in immune responses and function by directly secreting soluble mediators or important for adaptation of immune responses in different microenvironments and might be particularly through cell contact-dependent mechanisms. Many T cell subsets have been characterized. Although relevant for host defence against pathogens that colonize different tissues. Distinct T cell subsets, or effector T cells were originally considered to be terminally differentiated, a growing body of evidence has differentiation states, can be identified based on the cell surface markers expressed and/or the effector challenged this view and suggested that the phenotype of effector T cells is not completely fixed but is molecules produced by a particular T cell population. This Poster summarizes our current understanding of more flexible or plastic. T cells can have ‘mixed’ phenotypes (that is, have characteristics usually the surface markers, transcriptional regulators, effector molecules and functions of the different T cell associated with more than one T cell subset) and can interconvert from one subset phenotype to another, subsets that participate in immune responses. Further knowledge of how these T cell subsets are regulated IMMUNOLOGY although instructive signalling can lead to long-term fixation of cytokine memory. T cell plasticity can be and cooperate with each other will provide us with better tools to treat immune-related diseases. Cytotoxic T cell Exhausted T cell
    [Show full text]
  • Point Mutation in CD19 Facilitates Immune Escape of B Cell Lymphoma from CAR-­T Cell Therapy
    Open access Original research J Immunother Cancer: first published as 10.1136/jitc-2020-001150 on 6 October 2020. Downloaded from Point mutation in CD19 facilitates immune escape of B cell lymphoma from CAR- T cell therapy 1 1 1 1 1 1 Zhen Zhang, Xinfeng Chen, Yonggui Tian, Feng Li , Xuan Zhao, Jinyan Liu, 1 1,2,3,4 Chang Yao, Yi Zhang To cite: Zhang Z, Chen X, ABSTRACT relapses after CD19 CAR-T cell therapy are Tian Y, et al. Point mutation Background Tumor relapse due to mutation in CD19 can attributed to the antigen loss, indicating an in CD19 facilitates immune hinder the efficacy of chimeric antigen receptor (CAR)- T urgent need for investigating the mechanisms escape of B cell lymphoma from cell therapy. Herein, we focused on lymphoma patients CAR- T cell therapy. Journal underlying recurrence and for improving whose B cells exhibited a point mutation in CD19 of B cells 4 5 for ImmunoTherapy of Cancer the efficacy of CAR- T cell therapy. Inter- 2020; :e001150. doi:10.1136/ after CAR-T cell infusion. 8 + estingly, one of the specific mechanisms jitc-2020-001150 Methods The CAR- T and CD19 B cells from peripheral blood or bone marrow were assessed using flow of tumor escape that has been reported cytometry. Genome sequencing was conducted to identify suggests that exon mutations affecting the ► Additional material is + published online only. To view, the molecular characteristics of CAR- T and CD19 B cells CD19 gene and its splicing isoforms, leading please visit the journal online from pre-rela pse and postrelapse samples.
    [Show full text]
  • Identification of 18 Immune Cell Subsets Using 13-Color Panel
    Immunophenotyping Identification of 18 immune cell subsets in human blood using a 13-color panel Background Cell type Function Phenotype Flow cytometry has become the method of choice for Eosinophils Parasitic immunity CD45+, SSCmid/hi, CD14 –, CD16 –, CD19– immunophenotyping and identifying specific cellular + mid/hi subsets. Within seconds, it provides a thorough overview of Neutrophils Innate Immunity CD45 , SSC , CD14 –, CD16+, CD19– the major cell types that constitute a sample. Using multiple + mid markers simultaneously increases the number of parameters Classical Phagocytosis of CD45 , SSC , monocytes pathogens and CD14+, CD16– that can be analyzed per run and decreases the amount of antigen presentation starting material required to perform an assay. This can be Intermediate Phagocytosis of CD45+, SSCmid, critical for precious sample material and long-term immune- monocytes pathogens and CD14+, CD16mid monitoring studies. In this application note, we demonstrate antigen presentation 13-color immunophenotyping of human peripheral blood Non-classical Phagocytosis of CD45+, SSCmid, + + mononuclear cells (PBMCs) using the MACSQuant® Analyzer 16, monocytes pathogens and CD14 , CD16 antigen presentation a compact and reliable benchtop flow cytometer equipped + low + with three lasers. The markers selected allow for the Class-switched Adaptive immunity CD45 , SSC , CD19 , memory B cells CD27+, IgD–, CD14– simultaneous identification and analysis of 18 different cell Non-switched Adaptive immunity CD45+, SSClow, CD19+, populations, thus maximizing the amount of information that memory B cells CD27+, IgD+, CD14– can be retrieved from the sample material analyzed. This is Naive B cells Adaptive immunity – CD45+, SSClow, CD19+, critical when input material is limited, as is often the case for non-antigen CD27–, IgD+, CD14– pediatric or disease studies.
    [Show full text]
  • Optimal Minimal Panels of Immunohistochemistry for Diagnosis of B-Cell Lymphoma for Application in Countries with Limited Resources and for Triaging Cases Before
    AJCP /ORIGINAL ARTICLE Optimal Minimal Panels of Immunohistochemistry for Diagnosis of B-Cell Lymphoma for Application in Countries With Limited Resources and for Triaging Cases Before Referral to Specialist Centers Downloaded from https://academic.oup.com/ajcp/article-abstract/145/5/687/2195691 by World Health Organization user on 09 January 2019 Maria Giulia Disanto, MD,1 Maria Raffaella Ambrosio, MD, PhD,2 Bruno Jim Rocca, MD, PhD,2 Hazem A. H. Ibrahim, FRCPath, PhD,1,3 Lorenzo Leoncini, MD, PhD,2 and Kikkeri N. Naresh, MD, FRCPath1 From the 1Department of Histopathology, Imperial College Healthcare NHS Trust & Imperial College, London, United Kingdom; 2Department of Medical Biotechnologies, Section of Pathology, University of Siena, Siena, Italy; and 3Department of Histopathology, Faculty of Medicine, Mansoura University, Mansoura, Egypt. Key Words: Lymphoma; B-cell lymphoma; Immunohistochemistry; Diagnosis; Classification; Developing countries Am J Clin Pathol May 2016;145:687-695 DOI: 10.1093/AJCP/AQW060 ABSTRACT Lymphomas are a collection of different malignancies “arising” from lymphoid cells. They include about 49 entities, Objectives: Establish and validate optimal minimal and over 19 provisional entities and subsets.1 About 85% of immunohistochemistry panels for usage in a staged lymphomas are of B-cell origin. Precision in lymphoma diag- algorithmic manner for precise diagnosis of B-cell nosis requires expertise and infrastructure. The entities are lymphomas in countries with limited resources. Suggest defined based on morphology, immunohistochemistry (on short panels of immunostains to be used in referring units some occasions in situ hybridization), cytogenetics/fluores- that refer suspected lymphomas to specialist diagnostic cent in situ hybridization (FISH), molecular genetics and clin- centers in resourceful countries.
    [Show full text]
  • Flow Cytometry CPT: 88182, 88184, 88185, 88187, 88188, 88189, 86355, 86356, 86357, 86359, 86360, 86361, 86367
    Medicare Local Coverage Determination Policy Flow Cytometry CPT: 88182, 88184, 88185, 88187, 88188, 88189, 86355, 86356, 86357, 86359, 86360, 86361, 86367 CMS Policy for Alaska, Arizona, Idaho, Montana, North Dakota, Medically Supportive Oregon, South Dakota, Utah, Washington, and Wyoming ICD Codes are listed Local policies are determined by the performing test location. This is determined by the state on subsequent page(s) in which your performing laboratory resides and where your testing is commonly performed. of this document. Coverage Indications, Limitations, and/or Medical Necessity Flow cytometry (FCM) is a complex process to examine blood, body fluids, CSF, bone marrow, lymph node, tonsil, spleen and other solid tissues. The use of peripheral blood and fine needle aspirate material avoids more invasive procedures for diagnosis. A flow cytometer evaluates the physical and/or chemical characteristics of single cells as the cells pass individually in a fluid stream through a measuring device. Surface receptors, intracellular molecules, and DNA bind with fluorescent dyes that allow detection and evaluation. When light of one wave length excites electrons of certain chemicals to energy levels above their ground state and upon return to ground state emits light of a longer wavelength, fluorescence is produced. A flow cytometer detects cell characteristics by measuring the fluorescence produced by fluorochromes conjugated either directly with cell components or conjugated to antibodies directed against cell components. Indications • Cytopenias and Hypercellular Hematolymphoid Disorders Hematolymphoid neoplasia can present with cytopenias (anemia, leucopenia and/or thrombocytopenia) or elevated leukocyte counts. If medical review and preliminary laboratory testing fails to reveal a cause, bone marrow aspiration and biopsy are indicated to rule out an infiltrative process or a stem cell disorder.
    [Show full text]
  • MGD011, a CD19 X CD3 Dual-Affinity Retargeting Bi-Specific Molecule Incorporating Extended Circulating Half-Life for the Treatment of B-Cell Malignancies
    Published OnlineFirst September 23, 2016; DOI: 10.1158/1078-0432.CCR-16-0666 Cancer Therapy: Preclinical Clinical Cancer Research MGD011, A CD19 x CD3 Dual-Affinity Retargeting Bi-specific Molecule Incorporating Extended Circulating Half-life for the Treatment of B-Cell Malignancies Liqin Liu, Chia-Ying K. Lam, Vatana Long, Lusiana Widjaja, Yinhua Yang, Hua Li, Linda Jin, Steve Burke, Sergey Gorlatov, Jennifer Brown, Ralph Alderson, Margaret D. Lewis, Jeffrey L. Nordstrom, Scott Koenig, Paul A. Moore, Syd Johnson, and Ezio Bonvini Abstract Purpose: CD19, a B-cell lineage-specific marker, is highly autologous B-cell depletion in PBMCs from both species. represented in B-cell malignancies and an attractive target for MGD011-mediated killing was accompanied by target-depen- therapeutic interventions. MGD011 is a CD19 x CD3 DART dent T-cell activation and expansion, cytokine release and bispecific protein designed to redirect T lymphocytes to eliminate upregulation of perforin and granzyme B. MGD011 demon- CD19-expressing cells. MGD011 has been engineered with a strated antitumor activity against localized and disseminated modified human Fc domain for improved pharmacokinetic (PK) lymphoma xenografts reconstituted with human PBMCs. In properties and designed to cross-react with the corresponding cynomolgus monkeys, MGD011 displayed a terminal half-life antigens in cynomolgus monkeys. Here, we report on the preclin- of 6.7 days; once weekly intravenous infusion of MGD011 at ical activity, safety and PK properties of MGD011. dosesupto100mg/kg, the highest dose tested, was well Experimental Design: The activity of MGD011 was evaluated tolerated and resulted in dose-dependent, durable decreases in several in vitro and in vivo models.
    [Show full text]
  • Clinical Significance of CD81 Expression by Clonal Plasma Cells
    Leukemia (2012) 26, 1862 --1869 & 2012 Macmillan Publishers Limited All rights reserved 0887-6924/12 www.nature.com/leu ORIGINAL ARTICLE Clinical significance of CD81 expression by clonal plasma cells in high-risk smoldering and symptomatic multiple myeloma patients B Paiva1,2, N-C Gutie´ rrez1,2, X Chen2, M-B Vı´driales1,2, M-A´ Montalba´n3, L Rosin˜ol4, A Oriol5, J Martı´nez-Lo´ pez3, M-V Mateos1,2, LLo´ pez-Corral1,2,EDı´az-Rodrı´guez2, J-J Pe´ rez1,2, E Ferna´ndez-Redondo3, F de Arriba6, L Palomera7, E Bengoechea8, M-J Terol9, RdePaz10, A Martin11, J Herna´ndez12, A Orfao2,13, J-J Lahuerta3, J Blade´ 4, A Pandiella2 and J-F San Miguel1,2 on behalf of the GEM (Grupo Espan˜ ol de Mieloma)/PETHEMA (Programa para el Estudio de la Terape´ utica en Hemopatı´as Malignas) cooperative study groups The presence of CD19 in myelomatous plasma cells (MM-PCs) correlates with adverse prognosis in multiple myeloma (MM). Although CD19 expression is upregulated by CD81, this marker has been poorly investigated and its prognostic value in MM remains unknown. We have analyzed CD81 expression by multiparameter flow cytometry in MM-PCs from 230 MM patients at diagnosis included in the Grupo Espan˜ol de Mieloma (GEM)05465years trial as well as 56 high-risk smoldering MM (SMM). CD81 expression was detected in 45% (103/230) MM patients, and the detection of CD81 þ MM-PC was an independent prognostic factor for progression-free (hazard ratio ¼ 1.9; P ¼ 0.003) and overall survival (hazard ratio ¼ 2.0; P ¼ 0.02); this adverse impact was validated in an additional series of 325 transplant-candidate MM patients included in the GEM05 o65 years trial.
    [Show full text]