DOCSLIB.ORG

Flow Cytometric Analysis of B-Cell Lymphoproliferative Disorders

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Flow Cytometric Analysis of B-Cell Lymphoproliferative Disorders Flow cytometric analysis of B-cell lymphoproliferative disorders David M. Dorfman, M.D., Ph.D. Department of Pathology Brigham and Women’s Hospital and Harvard Medical School Boston, MA Objectives • Review basic principles of flow cytometric immunophenotypic analysis of B cell lymphoproliferative disorders • Discuss recent studies to overcome limitations and shortcomings – New markers – New methods Incidence of B-cell neoplasms, United States Subtype Incidence rate 2011-2012 New cases, 2016 per 100,000 Lymphoid neoplasms 34.4 136,960 Lymphoid neoplasms, B 29.0 93.3% 117,470 B-LL/L 1.4 82.2% 4,930 CLL/SLL 5.1 20,980 FL 3.4 13,960 DLBCL 6.3 27,650 MM 5.9 24,280 Lymphoid neoplasms, T/NK 2.1 8,380 T-LL/L 0.3 1,070 T-PLL <0.1 160 T-LGL 0.2 670 ATL/L <0.1 180 Teras et al. CA Cancer J Clin 2016; 66:443-459 (North American AssociationTeras of et Central al. CA Cancer Cancer Registries) J Clin 2016; 66:443-459 (North American Association of Central Cancer Registries) SS <0.1 Teras et al. CA Cancer J Clin70 2016; 66:443-459 (North American Association of Central Cancer Registries) 94% WHO revised 4th ed., 2017 Flow cytometric analysis of B-cell lymphoproliferative disorders • B-cell antigen expression (CD19, CD20, CD22) • Monoclonal surface immunoglobulin κ or λ light chain expression (or absence of surface immunoglobulin) • Expression of additional B-cell antigens or other antigens, including abnormal expression levels • Presence of cells with abnormal light scatter characteristics ( high forward scatter or side scatter) B-ALL MCL FL, HL MZL, CLL, MM LPL DLBCL DLBCL WHO revised 4th ed. Case 1. 61 year old woman with lymphocytosis (WBC = 12,720/μl, 60% lymphocytes) CD45+, CD19+, CD20 dim+, CD5+, CD11c dim+, CD23+, sIg lambda+ CD10-, sIg kappa- Chronic lymphocytic leukemia/small lymphocytic lymphoma [Older adults; ≥5000/ul; PB, BM, lymphoid tissues] CLL/SLL CD20 bright+ reactive B cells neoplastic B cells CD20 dim+ Subpopulation gating based on differential staining for pan-B-cell markers (CD19, CD20, CD22) can be helpful to distinguish neoplastic B-cell populations from reactive, polyclonal background cells Normal Lymph Node B-CLL/SLL Follicular lymphoma reactive neoplastic reactive neoplastic Mantle cell lymphoma Follicular lymphoma Marginal zone lymphoma Huang et al, Ohio State University, Am J Clin Pathol 2005; 123:826-832 Case 2. 67 year old man with lymphadenopathy underwent a staging bone marrow biopsy CD19+, CD20+, CD5+, sIg lambda+ CD10-, CD11c-, CD23-, sIg kappa- Mantle cell lymphoma (t(11;14) CCND1) [older adults; LNs>spleen>BM>extranodal; 3-5 yr survival] CD20 x CD5 CLL MCL sIg κ x sIg λ CD23 x CD79b 13 Dr. M. Linden, University of Minnesota Percentage of CLL/SLL cases deviating from classical antigenic patterns Classic antigenic pattern % of cases deviating CD20 dim positive 11-38% CD22 dim positive 0-8% CD23 negative 3-5% FMC7 negative (CD20 epitope) 7-14% CD79b negative 5-18% Surface immunoglobulin dim positive 5-42% CD5 positive ? S. Kroft and A. Harrington, Clin Lab Med 2017; 37: 697 CD200 (Ig superfamily membrane glycoprotein) distinguishes CLL/SLL from Mantle cell lymphoma CLL/SLL 79/79+ MCL 0/14+ + >20%+ Palumbo et al., Catania, Leuk Res 2009; 33:1212 Case 3. A 54-year-old woman with a history of non-Hodgkin’s lymphoma presented with inguinal lymphadenopathy. An FNA was performed. CD19+, CD20+, CD10+, CD38+, sIg kappa+ CD5-, sIg lambda- F ollicular lymphoma (t(14;18) BCL2) [Older adults; LN>spleen>BM>PB] Wang and Zu Arch Pathol Lab Med 2017; 141:1236 CD5+, CD10+ B-cell neoplasms CD5+, CD10+ Mantle cell lymphoma Coexpression of CD5 and CD10 occurs in <1% of B cell lymphomas, including DLBCL, follicular lymphoma, mantle cell lymphoma, CLL/SLL, other small cell B cell lymphomas, and precursor B lymphoblastic leukemia/lymphoma, and is of uncertain clinical significance. [Dong et al. B-cell lymphomas with coexpression of CD5 and CD10. Am J Clin Pathol 2003; 119:218-230.] Surface immunoglobulin-negative B-LPDs B cells before (left) and after (right) 37C incubation and increased light chain reagent (Harrington and Kroft. Clin Lab Med 2017; 37:697) Biclonal B-cell lymphoproliferative disorders account for <5% of cases (23/477 in study cited), and include CLL/SLL, aCLL, HCL, LPL, SMZL, FL, LCL Sanchez et al. Blood 2003; 102:2994 Case 4. A 58 year old woman presented with splenomegaly, and anemia CD45+, CD19+, CD20 dim+, CD23 var+, sIg kappa+ CD5-, CD10-, CD11c-, sIg kappa- Marginal zone lymphoma [Older adults; spleen>PB / MALT / LN; indolent] , HCL-v Wang and Zu Arch Pathol Lab Med 2017; 141:1236 Case 5. 55 year old man with weakness, fatigue, progressive neuropathy, anemia, IgM kappa paraprotein (2.77 g/dl) CD19+, CD20+, sIg kappa+ CD5-, CD10-, CD11c-, CD23-, sIg lambda- and… Plasma cell component: CD38+, CD138+ cIg kappa+ CD19-, CD56-, cIg lambda- Lymphoplasma- cytic lymphoma (MYD88 L265P) [Older adults; BM; WMG = BM + IgM monoclonal gammopathy; indolent] Case 6. A 43-year-old woman presented with slight leukopenia and thrombo- cytopenia. WBC= 4,200/ul with 59% lymphocytes, 4% atypical lymphocytes with cytoplasmic projections. Bone marrow examination revealed 65% lymphocytes, some with cytoplasmic projections. negative control CD19+, CD20+, sIg kappa+, CD11c+, CD25+, CD103+ CD5-, CD10- Hairy cell leukemia (BRAF V600E) [Older adults; BM, splenic red pulp, PB] CD200 expression in B-cell lymphoproliferative disorders by flow cytometric analysis *HCL CD1d is a MHC class I-liCD1d is a* MHC class I-like CD1d is a MHC class I-like cell surface cell surface glycoprotein expressed in a wide glycoprotein expressed in a wide range range of cells, with increased expression in of cells, with increased expression in resting, naïve, and marginal zone B cells vs. resting, naïve, and marginal zone B activated and memory B cells cellsExpression vs. activatedin CLL/SLL is andless than memory in MCL; B expression cells in MZL but not LPL/WMG ke cell surfaceExpression glycoprotein in CLL/SLL expressed is less than in in a MCL; wide expression in MZL but not LPL/WMG range of cells, with increased expression+ in resting, naïve, and marginal zone B cells vs. activated and memory B cells Expression in CLL/SLL is less than in MCL; expression in MZL but not LPL/WMG +HCL-V Pillai et al Am J Clin Pathol 2013; 140:536-543 CD200 and CD1d expression in CD5-, CD10- B-cell lymphoproliferative disorders Hairy cell leukemia Hairy cell leukemia- variant Mason et al. Am Am J Clin 148:33 2017; Pathol et Mason al. Lympho- plasmacytic lymphoma Marginal zone lymphoma CD11c CD103 CD200 CD1d Pattern of CD200 and CD1d expression in CD5-, CD10- B-cell lymphoproliferative disorders + + -- + - - + 100.00% 80.00% Neg Dim 60.00% Pos Bright 40.00% Am J Clin 148:33 2017; Pathol et Mason al. 20.00% 0.00% HCL HCLv LPL MZL +/+: 94% sensitive and 98% specific for HCL +/-: 60% sensitive and 97% specific for LPL -/+: 41% sensitive and 100% specific for MZL CD5-negative, CD10-negative B-cell lymphoproliferative disorders Cytogenetics/Molecular Treatment HCL BRAF V600E; MAP2K1 Purine analogs (cladribine, pentostatin) HCL-V MAP2K1 Purine analogs +Rituximab (anti-CD20), anti-CD22 , or anti-CD52 immunotherapy LPL MYD88 Rituximab ± (multi-agent) chemotherapy MZL -7q (SMZL), NOTCH2, MLL2, KLF2, Rituximab ± (multi-agent) chemotherapy PTPRD (NMZL) ? + anti-CD200 immunotherapy in HCL, LPL/WMG Case 7. 59 year old woman with a history of DLBCL, now with WBC = 69,110/ul with 57% atypical cells CLL/SLL CD19+, CD20+, sIg kappa+ CD5-, CD10-, sIg lambda- Large B cell lymphoma (5-10% are CD5+ de novo or arising from CLL/SLL) [Elderly and younger; nodal and extranodal>BM; 60-65% 5 year survival] Expression of T-cell markers in B-LPDs (Tsuyama et al. Oncotarget 2017; 8:33487-33500) • CD2, CD3, CD4, CD5, CD7, CD8 expression was evaluated in 501 B- LPDs, including 225 DLBCLs, by flow cytometry • T-cell markers other than CD5 were expressed in 27/501 patients (5%), all large B cell lymphomas: 25 DLBCL and 2 IVLBCL • CD8 > CD7 > CD2 > CD4; 8 cases had >1 T-cell marker; no CD3+ cases • CD5 was present in 31/225 DLBCLs (15%); CD5 was coexpressed with other T-cell markers in 5/31 CD5+ DLBCLs (16%) • Poorer survival in CD5+ DLBCL vs. CD5- DLBCL, but no differences in survival with expression of other T-cell markers • CD8 previously reported in CLL (0.5-3% of cases) Case 8. 46 year old man with a right parapharyngeal mass and leukocytosis (WBC = 17,830/ul; 14% lymphocytes, 30% atypical lymphocytes CD45+, CD19+, CD20+, CD10+, CD38+, sIg kappa+ CD5-, sIg lambda- Burkitt lymphoma/leukemia (MYC translocation) [Children and young adults; extranodal>LN; highly aggressive but curable] Bright CD38 staining is an indicator of MYC rearrangement MYC rearrangement Numerical MYC aberrations Normal MYC 106 cases of CD10+ high grade lymphomas Maleki et al. Leuk Lymph 2009;50:1054-57. Burkitt lymphoma vs. Double-hit lymphoma with MYC and BCL translocations Burkitt lymphoma: CD19+, CD20+, CD10+, CD38 bright+ Double-hit lymphoma: Roth et al. Oncol Res 2016; 23:137 CD45↓, CD19+, CD20↓, CD10+, CD38+ Immunophenotypic findings for mature B-cell neoplasms 1, 2 3,4 5 6 7 8 9, 10+ Pan-B sIg CD5 CD10 CD23 CD11c other (CD19/ Κ v. λ CD20) CLL/SLL +/↓ +/↓ + - + v CD79b-, CD200+ MCL + + + - - - CD79b+, CD200-, Cyclin D1+, Sox 11+ Follicular + + - + v - CD38, Bcl-2+, Bcl-6+ MZL + + - - v v CD200-, CD1d+ LPL + + - - - - CD200+, CD1d-, cIg+ plasma cells HCL + + - - - + CD25+, CD103+, CD200+, CD1d+ HCL-V + + - - - + CD25-, CD103+, CD200-, CD1d- DLBCL + +/- -/+ +/- v Bcl-2+, Bcl-6+/- Burkitt + + - + - - CD38+, TdT-, Myc+, Bcl-6+,
Load more

Recommended publications
  • PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than Cd79a and Selective Association with T(8;21)-Acute Myelogenous Leukemia
    [CANCER RESEARCH 64, 7399–7404, October 15, 2004] PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than CD79a and Selective Association with t(8;21)-Acute Myelogenous Leukemia Enrico Tiacci,1 Stefano Pileri,2 Annette Orleth,1 Roberta Pacini,1 Alessia Tabarrini,1 Federica Frenguelli,1 Arcangelo Liso,3 Daniela Diverio,4 Francesco Lo-Coco,5 and Brunangelo Falini1 1Institutes of Hematology and Internal Medicine, University of Perugia, Perugia, Italy; 2Unit of Hematopathology, University of Bologne, Bologne, Italy; 3Section of Hematology, University of Foggia, Foggia, Italy; 4Department of Cellular Biotechnologies and Hematology, University La Sapienza of Rome, Rome, Italy; and 5Department of Biopathology, University Tor Vergata of Rome, Rome, Italy ABSTRACT (13, 16). PAX5 expression also occurs in the adult testis and in the mesencephalon and spinal cord during embryogenesis (17), suggesting an The transcription factor PAX5 plays a key role in the commitment of important role in the development of these tissues. hematopoietic precursors to the B-cell lineage, but its expression in acute Rearrangement of the PAX5 gene through reciprocal chromosomal leukemias has not been thoroughly investigated. Hereby, we analyzed routine biopsies from 360 acute leukemias of lymphoid (ALLs) and mye- translocations has been described in different types of B-cell malig- loid (AMLs) origin with a specific anti-PAX5 monoclonal antibody. Blasts nancies (18–23), and, more recently, PAX5 has also been shown to be from 150 B-cell ALLs showed strong PAX5 nuclear expression, paralleling targeted by aberrant hypermutation in Ͼ50% of diffuse large B-cell that of CD79a in the cytoplasm. Conversely, PAX5 was not detected in 50 lymphomas (24).
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Bispecific CAR-T Cells Targeting Both CD19 and CD22 for Therapy Of
    Dai et al. Journal of Hematology & Oncology (2020) 13:30 https://doi.org/10.1186/s13045-020-00856-8 RAPID COMMUNICATION Open Access Bispecific CAR-T cells targeting both CD19 and CD22 for therapy of adults with relapsed or refractory B cell acute lymphoblastic leukemia Hanren Dai1,2,3†, Zhiqiang Wu1†, Hejin Jia2†, Chuan Tong1, Yelei Guo1, Dongdong Ti1, Xiao Han1, Yang Liu4, Wenying Zhang2, Chunmeng Wang2, Yajing Zhang2, Meixia Chen2, Qingming Yang2, Yao Wang1* and Weidong Han1,2* Abstract Background: Despite the impressive complete remission (CR) induced by CD19 CAR-T cell therapy in B-ALL, the high rate of complete responses is sometimes limited by the emergence of CD19-negative leukemia. Bispecific CAR-modified T cells targeting both CD19 and CD22 may overcome the limitation of CD19-negative relapse. Methods: We here report the design of a bispecific CAR simultaneous targeting of CD19 and CD22. We performed a phase 1 trial of bispecific CAR T cell therapy in patients with relapsed/refractory precursor B-ALL at a dose that ranged from 1.7 × 106 to 3 × 106 CAR T cells per kilogram of body weight. Results: We demonstrate bispecific CD19/CD22 CAR T cells could trigger robust cytolytic activity against target cells. MRD-negative CR was achieved in 6 out of 6 enrolled patients. Autologous CD19/CD22 CAR T cells proliferated in vivo and were detected in the blood, bone marrow, and cerebrospinal fluid. No neurotoxicity occurred in any of the 6 patients treated. Of note, one patient had a relapse with blast cells that no longer expressed CD19 and exhibited diminished CD22 site density approximately 5 months after treatment.
    [Show full text]
  • CD81 Is Required for CD19-Complex Formation and Terminal Human B
    Supplemental Table 1. Primer sequences for PCR amplification and sequencing of CD81 coding regions from genomic DNA. Exon Forward primer Forward primer sequence Reverse primer Reverse primer sequence 1 CD81exon1F GGGGCGGGGCCTATGGAG CD81exon1R GGACCTGCCCAACGTGGA 2 CD81exon2F TGTGGGGTGGGCGCACTC CD81exon2R CACGCCATGCCCGACTGT 3 CD81exon3F ATCCCTGGCAGTCAGCAACC CD81exon3R TCCGCCCTGAGCACCAGC 4 CD81exon4F GTCAGGTCGTGGGCTGGT CD81exon4R CTGGAGATCCTCCTGGCAAGT 5 CD81exon5F TCTGGGGTCTAGCCTCGAAGC CD81exon5R CTGGGCGTAGGCAGGATT 6 CD81exon6F GGCCCCTGGATGCATTCT CD81exon6R AGTGTGGTCGCTCCCTGTGG 7+8 CD81exon7+8F CTGCGTGACAACGGGAAG CD81exon7+8R TATACACAGGCGGTGATGG Supplemental Table 2. Primer sequences for PCR amplification and sequencing of CD81 and CD225 transcripts. Gene Forward primer Forward primer sequence Reverse primer Reverse primer sequence CD81 CD81_mRNA_F1 GACCCCACCGCGCATCCT CD81_mRNA_R1 GGATGGCCCCGTAGCAGC CD81_mRNA_F2 CGCCCAACACCTTCTATGTA CD81_mRNA_R2 TGCCCGAGGGACACAAAT CD81_mRNA_F3 TTCCACGAGACGCTTGACTGCT CD81_mRNA_R3 AGGCCCGTCTCCACTCAT IFITM1 IFITM1_mRNA_F1 TCATTGGTCCCTGGCTAATTCAC IFITM1_mRNA_R1 GGTCACGTCGCCAACCAT IFITM1_mRNA_F2 ACAGCGAGACCTCCGTGC IFITM1_mRNA_R2 TCTAGGGGCAGGACCAAG Supplemental Table 3. PCR primers and TaqMan probes for CD81 transcript level quantification. Target Forward primer Forward primer sequence Reverse primer Reverse primer sequence TaqMan probe TaqMan probe Sequence total CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA CD81_RQ_R AGAGGTTGCTGATGATGTTGCTG T-CD81 ACTGACTGCTTTGACCACCTCAGTGCTCA wild type CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA
    [Show full text]
  • CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-Lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity
    cancers Article CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity Shabirul Haque 1,2,* and Sarah R. Vaiselbuh 1,2,3 1 Feinstein Institute for Medical Research, Northwell Health, 350 Community Drive, Manhasset, NY 11030, USA; [email protected] 2 Department of Pediatrics, Staten Island University Hospital, Northwell Health, 475 Seaview Ave, Staten Island, NY 10305, USA 3 Monsey Health Center, 40 Robert Pitt Drive, Monsey, NY 10952, USA * Correspondence: [email protected] Simple Summary: Our research describes our designer exosomes express CD19 Chimeric Antigen Receptor (Exo-CD19 CAR). This novel Exo-CD19 CAR is cytotoxic for CD19-positive leukemia B-cells without interfering with cytotoxicity in CD19-negative cells. This innovation can be translated into broader clinical applications as CD19 CAR exosome-based nano-immunotherapy for B-cell leukemia instead of whole CD19 CAR T-cell immunotherapy. Abstract: CAR-T cell therapy is not without some clinical adverse effects, namely cytokine storms, due to a massive release of cytokines when CAR-T cells multiply in the body. Our goal was to develop exosomes expressing CD19 CAR to treat CD19-positive B-cell malignancies, instead of using whole CD19 CAR-T cells, thereby reducing the clinical risk of uncontrolled cytokine storms. Exosomes are Citation: Haque, S.; Vaiselbuh, S.R. extracellular nanovesicles (30–150 nm), composed of lipids, proteins, and nucleic acids, that carry the CD19 Chimeric Antigen fingerprint of their parent cells. Exosomes are a preferred delivery system in nano-immunotherapy. Receptor-Exosome Targets CD19 Here, HEK293T parent cells were transduced with CD19 CAR plasmids and cellular CD19 CAR Positive B-lineage Acute Lymphocytic expression was confirmed.
    [Show full text]
  • ORIGINAL ARTICLE Flow Cytometric Protein Expression Profiling As a Systematic Approach for Developing Disease-Specific Assays
    Leukemia (2006) 20, 2102–2110 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Flow cytometric protein expression profiling as a systematic approach for developing disease-specific assays: identification of a chronic lymphocytic leukaemia-specific assay for use in rituximab-containing regimens AC Rawstron, R de Tute, AS Jack and P Hillmen Haematological Malignancy Diagnostic Service (HMDS), Leeds Teaching Hospitals, Leeds, UK Depletion of disease below the levels detected by sensitive sustained remissions only occur in patients achieving an MRD- minimal residual disease (MRD) assays is associated with negative complete response.12 Therefore MRD is increasingly prolonged survival in chronic lymphocytic leukaemia (CLL). being used as an end point for therapeutic trials, and several Flow cytometric MRD assays are now sufficiently sensitive and rapid to guide the duration of therapy in CLL, but generally rely studies are now using the assessment of MRD to define the on assessment of CD20 expression, which cannot be accurately duration of therapy. measured during and after therapeutic approaches containing Approaches using allele-specific oligonucleotide polymerase rituximab. The aim of this study was to use analytical software chain reaction (ASO-PCR) to the immunoglobulin gene of the developed for microarray analysis to provide a systematic B-CLL cell are generally accepted to show the highest sensitivity approach for MRD flow assay development. Samples from CLL for MRD detection. However, more recent four-colour ap- patients (n ¼ 49), normal controls (n ¼ 21) and other B-lympho- proaches show sensitivities nearing that of ASO-PCR6,11,13 with proliferative disorders (n ¼ 12) were assessed with a panel of 66 antibodies.
    [Show full text]
  • B-Cell Receptor Pathway Inhibitors Affect CD20 Levels and Impair Antitumor Activity of Anti-CD20 Monoclonal Antibodies
    Letters to the Editor 1163 13 Kuruvilla J, Gutierrez M, Shah BD, Gabrail NY, de Nully Brown P, 14 Yu L, Mohamed AJ, Simonson OE, Vargas L, Blomberg KE, Bjorkstrand B et al. Stone RM et al. Preliminary evidence of anti tumor activity of selinexor Proteasome-dependent autoregulation of Bruton tyrosine kinase (Btk) promoter (KPT-330) in a phase I trial of a first-in-class oral selective inhibitor via NF-kappaB. Blood 2008; 111: 4617–4626. of nuclear export (SINE) in patients (pts) with relapsed/refractory non 15BurgerJA,BurgerM,KippsTJ.Chronic lymphocytic leukemia B cells Hodgkin’s lymphoma (NHL) and chronic lymphocytic leukemia (CLL). Blood 2013; express functional CXCR4 chemokine receptors that mediate spontaneous 122: 90. migration beneath bone marrow stromal cells. Blood 1999; 94: 3658–3667. Supplementary Information accompanies this paper on the Leukemia website (http://www.nature.com/leu) B-cell receptor pathway inhibitors affect CD20 levels and impair antitumor activity of anti-CD20 monoclonal antibodies Leukemia (2014) 28, 1163–1167; doi:10.1038/leu.2014.12 also tested a primary MCL sample and upon treatment with BCR inhibitors observed a significant downregulation of surface CD20 levels and a trend towards impaired R-CDC and O-CDC (Supplementary Figure 1b). Moreover, we determined the Signaling via the aberrantly activated B-cell receptor (BCR) has a influence of BCR inhibitors on CD20 surface levels in a critical role in the pathogenesis of B-cell tumors by promoting series of 15 tumor cell lines, including Burkitt’s lymphoma (Ramos, survival and clonal expansion of malignant B cells.1,2 Multiple Daudi and BJAB), ALL (NALM-6), diffuse large B-cell lymphoma preclinical studies indicate that blocking various components of (BCR-dependent Ly-1, Ly-7, Ly-10, DHL-6, HBL-1, U2932 and the BCR signaling pathway holds a great therapeutic potential in BCR-independent Ly-4, Ly-19, Pfeiffer) and CLL (EHEB and MEC-1).
    [Show full text]
  • New Advances in Leukaemia Immunotherapy by the Use of Chimeric Artificial Antigen Receptors
    Biagi et al. Italian Journal of Pediatrics 2011, 37:46 http://www.ijponline.net/content/37/1/46 ITALIAN JOURNAL OF PEDIATRICS REVIEW Open Access New advances in leukaemia immunotherapy by the use of Chimeric Artificial Antigen Receptors (CARs): state of the art and perspectives for the near future Ettore Biagi*, Virna Marin, Greta Maria Paola Giordano Attianese, Irene Pizzitola, Sarah Tettamanti, Elisabetta Cribioli and Andrea Biondi Abstract Leukaemia immunotherapy represents a fascinating and promising field of translational research, particularly as an integrative approach of bone marrow transplantation. Adoptive immunotherapy by the use of donor-derived expanded leukaemia-specific T cells has showed some kind of clinical response, but the major advance is nowadays represented by gene manipulation of donor immune cells, so that they acquire strict specificity towards the tumour target and potent lytic activity, followed by significant proliferation, increased survival and possibly anti- tumour memory state. This is achieved by gene insertion of Chimeric T-cell Antigen Receptors (CARs), which are artificial molecules containing antibody-derived fragments (to bind the specific target), joined with potent signalling T-Cell Receptor (TCR)-derived domains that activate the manipulated cells. This review will discuss the main application of this approach particularly focusing on the paediatric setting, raising advantages and disadvantages and discussing relevant perspectives of use in the nearest future. Keywords: Leukaemia immunotherapy,
    [Show full text]
  • Point Mutation in CD19 Facilitates Immune Escape of B Cell Lymphoma from CAR-­T Cell Therapy
    Open access Original research J Immunother Cancer: first published as 10.1136/jitc-2020-001150 on 6 October 2020. Downloaded from Point mutation in CD19 facilitates immune escape of B cell lymphoma from CAR- T cell therapy 1 1 1 1 1 1 Zhen Zhang, Xinfeng Chen, Yonggui Tian, Feng Li , Xuan Zhao, Jinyan Liu, 1 1,2,3,4 Chang Yao, Yi Zhang To cite: Zhang Z, Chen X, ABSTRACT relapses after CD19 CAR-T cell therapy are Tian Y, et al. Point mutation Background Tumor relapse due to mutation in CD19 can attributed to the antigen loss, indicating an in CD19 facilitates immune hinder the efficacy of chimeric antigen receptor (CAR)- T urgent need for investigating the mechanisms escape of B cell lymphoma from cell therapy. Herein, we focused on lymphoma patients CAR- T cell therapy. Journal underlying recurrence and for improving whose B cells exhibited a point mutation in CD19 of B cells 4 5 for ImmunoTherapy of Cancer the efficacy of CAR- T cell therapy. Inter- 2020; :e001150. doi:10.1136/ after CAR-T cell infusion. 8 + estingly, one of the specific mechanisms jitc-2020-001150 Methods The CAR- T and CD19 B cells from peripheral blood or bone marrow were assessed using flow of tumor escape that has been reported cytometry. Genome sequencing was conducted to identify suggests that exon mutations affecting the ► Additional material is + published online only. To view, the molecular characteristics of CAR- T and CD19 B cells CD19 gene and its splicing isoforms, leading please visit the journal online from pre-rela pse and postrelapse samples.
    [Show full text]
  • Altered Expression of CD63 and Exosomes in Scleroderma Dermal
    Journal of Dermatological Science 84 (2016) 30–39 Contents lists available at ScienceDirect Journal of Dermatological Science journal homepage: www.jdsjournal.com Altered expression of CD63 and exosomes in scleroderma dermal fibroblasts Kayo Nakamura, Masatoshi Jinnin*, Miho Harada, Hideo Kudo, Wakana Nakayama, Kuniko Inoue, Aki Ogata, Ikko Kajihara, Satoshi Fukushima, Hironobu Ihn Department of Dermatology and Plastic Surgery, Faculty of Life Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto 860-8556, Japan A R T I C L E I N F O A B S T R A C T Article history: Background: Exosomes are small vesicles shed from various cells. They contain proteins, lipids, and Received 6 January 2016 nucleic acids, and are regarded as a tool of cell-cell communication. Received in revised form 13 June 2016 Objectives: To reveal the putative role of exosomes in systemic sclerosis (SSc), and to elucidate the effect of Accepted 29 June 2016 exosomes on wound healing. Methods: The expression of common markers for exosomes (CD63, CD9, and CD81) and type I collagen Keywords: were examined with real-time PCR, immunohistochemical analysis, ELISA, immunoblotting, and flow Exosomes cytometry. The effect of serum-derived exosomes on wound healing was tested on full-thickness wounds CD63 in the mid-dorsal skin of BALB/c mice. Systemic sclerosis Results: The expression levels of CD63 as well as CD9 and CD81 tended to be increased in SSc dermal fibroblasts compared to normal fibroblasts. Increased exosomes in a cultured media of SSc fibroblasts stimulated the expression levels of type I collagen in normal fibroblasts. As the mechanism, collagen- related microRNA levels in SSc fibroblast-derived exosomes were dysregulated, indicating that both the amount and the content of exosomes were altered in SSc.
    [Show full text]
  • Combination Immunotherapy with Anti-CD20 and Anti-HLA-DR Monoclonal Antibodies Induces Synergistic Anti-Lymphoma Effects in Human Lymphoma Cell Lines
    UC Davis UC Davis Previously Published Works Title Combination immunotherapy with anti-CD20 and anti-HLA-DR monoclonal antibodies induces synergistic anti-lymphoma effects in human lymphoma cell lines Permalink https://escholarship.org/uc/item/8pk1f4nx Journal Leukemia & Lymphoma, 48(5) ISSN 1042-8194 Authors Tobin, Evan Denardo, Gerald Zhang, Nan et al. Publication Date 2007-05-01 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Rituximab & ChLym-1 Combined Immunotherapy Combination Immunotherapy with Anti-CD20 and Anti-HLA-DR Monoclonal Antibodies Induces Synergistic Anti-lymphoma Effects in Human Lymphoma Cell Lines Evan Tobin1, Gerald DeNardo1, Nan Zhang2, Alan L. Epstein2, Cathy Liu1 & Sally DeNardo1 1 Department of Internal Medicine, University of California Davis, CA, USA 2 Department of Pathology, University of Southern California Keck School of Medicine, Los Angeles, CA, USA Running Title: Rituximab & ChLym-1 Combined Immunotherapy Keywords: Lymphoma; immunotherapy; rituximab; Lym-1; CD20; HLA-DR 1Address for correspondence: Gerald L. DeNardo, M.D. Division of Hematology and Oncology 1508 Alhambra Blvd., No. 3100 Sacramento, CA 95816 Telephone (916) 734-3787 Fax (916) 703-5014 E-mail: [email protected] 1 Rituximab & ChLym-1 Combined Immunotherapy ABSTRACT Rituximab is effective in about one half of patients with indolent lymphoma. Even these patients relapse and develop rituximab resistance. To increase potency and circumvent resistance, the anti-lymphoma effects of rituximab, an anti-CD20 MAb1, combined with chLym-12, an anti- HLA-DR MAb, were assessed in human lymphoma cell lines by examining growth inhibition and cell death, apoptosis induction, ADCC3 and CDC4. There were additive effects in all assays and synergism in cell lines, such as B35M, which displayed resistance to either MAb alone.
    [Show full text]
  • Immunohistochemical Expression of CD23 and CD40 May Identify Prognostically Favorable Subgroups of Diffuse Large B-Cell Lymphoma: a Nordic Lymphoma Group Study1
    722 Vol. 9, 722–728, February 2003 Clinical Cancer Research Immunohistochemical Expression of CD23 and CD40 May Identify Prognostically Favorable Subgroups of Diffuse Large B-cell Lymphoma: A Nordic Lymphoma Group Study1 Johan Linderoth,2 Mats Jerkeman, to a germinal center origin or attributable to increased Eva Cavallin-Ståhl, Stein Kvaløy, and apoptosis via induction of bax and/or enhanced T-cell inter- Emina Torlakovic action, resulting in improved autologous tumor response. Confirmatory studies are necessary. Department of Oncology, Lund University Hospital, 221 85 Lund, Sweden [J. L., M. J., E. C-S.]; Department of Oncology, the Norwegian Radium Hospital, Oslo, Norway [S. K.]; and Department INTRODUCTION of Pathology, The Norwegian Radium Hospital, Oslo, Norway [E. T.] DLBCL3 is the most frequent lymphoma subtype and en- compasses the majority, ϳ60–70%, of the aggressive lympho- mas. Biologically and clinically, it shows considerable hetero- ABSTRACT geneity. Eventually, 30–40% of the patients with advanced Purpose: In search for subgroups of diffuse large B-cell stage DLBCL who are treated with current therapies will be lymphoma (DLBCL) with different histogenetic origin and long-time survivors, whereas the rest will succumb to the dis- prognosis, as has been described by gene expression profil- ease. There is an obvious need for prognostic information to ing, we examined tumor specimens from 125 patients with design a more risk-adapted primary therapy. The IPI is one DLBCL, uniformly treated by either cyclophosphamide- available, validated tool, based on clinical features (age, stage, Adriamycin-vincristine-prednisone or methotrexate, doxo- level of lactate dehydrogenase, performance status, and number rubicin, cyclophosphamide, vincristine, prednisone, and of extranodal sites; Ref.
    [Show full text]