DOCSLIB.ORG

Functional Interrogation of Genetically Simple and Complex Cancers

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

FUNCTIONAL INTERROGATION OF GENETICALLY SIMPLE AND COMPLEX CANCERS by Edward R. Kastenhuber A Dissertation Presented to the Faculty of the Louis V. Gerstner, Jr. Graduate School of Biomedical Sciences, Memorial Sloan Kettering Cancer Center in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy New York, NY December, 2018 ___________________ ___________________ Scott W. Lowe Date Dissertation Mentor Copyright ©2018 by Edward Kastenhuber Dedication To my parents, for all their love and support. iii ABSTRACT The rapid expansion of cancer genomics over recent years has provided a valuable catalog of the events that drive malignancy, but functional dissection of oncogenes and tumor suppressor genes are needed to fully appreciate the roles of cancer-associated genes. Cancer types vary dramatically in genomic complexity, with pediatric cancers tending towards low mutation rates and certain other diseases tending towards hypermutation and highly rearranged genomes. Targeting driving oncogenes for therapy has precedent, particularly in low complexity cancers, and pre-clinical models provide an opportunity to refine such strategies. Treating high complexity tumors remains particularly challenging in part due to intratumoral heterogeneity, presumed to be linked to enhanced adaptability of cancer cell populations. Patterns of evolution supporting intratumoral heterogeneity have been extensively observed, but functional dissection of heterogeneity has been limited. Fibrolamellar hepatocellular carcinoma (FL-HCC) is a rare but lethal liver cancer that primarily affects adolescents and young adults. It has been described to harbor only one recurrent genetic event: somatic deletion of a segment of chromosome 19, resulting in DNAJB1-PRKACA gene fusion. Efforts to understand and treat FL-HCC have been confounded by a lack of models that accurately reflect the genetics and biology of the disease. Herein, CRISPR/Cas9 genome editing and transposon-mediated somatic gene transfer is implemented to demonstrate that expression of both the endogenous fusion protein or chimeric cDNA leads to the formation of indolent liver tumors in mice that closely resemble human FL-HCC. Notably, overexpression of the wild type PRKACA iv was unable to fully recapitulate the oncogenic activity of DNAJB1-PRKACA, implying that FL-HCC does not result from enhanced PRKACA expression alone. Tumorigenesis was significantly enhanced by genetic activation of β-catenin, an observation supported by the discovery of recurrent Wnt pathway mutations in human FL-HCC, as well as treatment with hepatotoxin DDC, which causes tissue injury, inflammation and fibrosis. Our study validates the DNAJB1-PRKACA fusion kinase as an oncogenic driver and candidate drug target for FL-HCC and establishes a practical model for preclinical studies to identify strategies to treat this disease. In contrast, many cancers do not contain a single identifiable driver. Instead, evolutionary processes govern cancer initiation, metastasis, and therapeutic resistance. A better understanding how initiating driver events affect intratumoral heterogeneity, and how diversity affects the robustness of a population, is central to understand the evolution. Our hypothesis is that p53 deficiency tends to permit the accumulation of greater subclonal diversity than in p53 wild type cancer cell populations. TP53, the most frequently mutated gene in human cancer, is activated by various stress stimuli and acts to cull damaged cells. By using derivatives of the Eµ-myc model of B-cell lymphoma, we examined how p53 inactivation affects the heterogeneity of resulting disease. We aim to resolve whether p53 loss allows the outgrowth of a single aneuploid “jackpot” clone, or does it allow the long-term survival of a wider field of sub-optimally fit clones, which could serve a diverse reservoir of potential resistance to changing conditions, as in dissemination and treatment? v BIOGRAPHICAL SKETCH Edward Kastenhuber grew up in Newtown, Pennsylvania and attended the University of Pittsburgh, where he graduated with a degree in bioengineering. He enjoyed a number of research experiences in engineering and medicine. With Gregory Armstrong (Children’s Hospital of Philadelphia), he explored the epidemiology of optic nerve gliomas arising in children with neurofibromatosis. With Yong He and Sanjeev Shroff, he studied how mechanical stress can influence gene expression and endothelial cell behavior in the context of high blood pressure. Under the direction of Mark Gartner, Edward joined a senior design project team that designed, prototyped and installed an ultra-low cost neonatal incubator for Hôpital Albert Schweitzer Haiti. After reading about cancer immunotherapy for glioblastoma in the university newspaper, Edward was inspired by the work of Hideho Okada and knew he wanted to become involved in this work. Dr. Okada accepted Edward into his lab as a technician where postdocs Ryo Ueda, Xinmei Xhu, and especially Mitsugu Fujita contributed greatly appreciated mentoring. It was here that Edward really got to know the joy of scientific investigation and the culture of the laboratory. Having taken a minor concentration in Italian studies during his undergraduate studies, Edward found an exciting and rewarding opportunity working in S. Aureus vaccine development for Novartis in Siena, Italy for which he is indebted to Fabio Bagnoli for his mentorship. Upon returning to the United States, Edward was hired as a research technician by Jason Huse as he was starting up his lab focused on molecular profiling and pathogenesis vi of glioma. Dr. Huse provided Edward a great deal of independence and responsibility while bringing the lab from empty benches to a productive scientific endeavor. Along with the generous support by Cameron Brennan to learn the R programming language and incorporate more data analysis into his work, Edward published a first author paper with the Huse lab. In 2011, Edward was accepted by the Gerstner Sloan Kettering Graduate School and joined the laboratory of Scott Lowe the following year. He has been supported by the Geoffrey Beene Foundation and the NIH Ruth L. Kirschstein National Research Service Award. vii ACKNOWLEDGEMENTS I thank my thesis mentor Scott Lowe for his leadership, advice, and support. He has led by example through his accomplished career, the extraordinarily enriching environment he has cultivated, and the resources to do the best possible science. He has challenged me to always pursue a standard of excellence driven by curiosity, yet he provided me with an uncommon level of independence. He has opened many doors for me: by inviting me to the p53 workshop (Singapore), the AACR general meeting (Chicago, IL), and an HHMI Science Meeting (Bethesda, MD); by introducing me to countless amazing scientists; and by initiating exciting collaborations with other labs. I am deeply indebted to members of the Lowe lab: Direna Alonso-Curbelo (for her enthusiasm and ideas), Pancho Barriga, Timour Baslan, Lynn Boss, Matt Bott, May Chalarca, Katerina Chatzi (an excellent lab neighbor, friend and advisor), Chi-Chao Chen (for sharing the entire Lowe lab PhD experience together), Sean Chen, Ray Ho, Shauna Houlihan (for indispensible advice including a key experiment with DDC), Amanda Kim, Josef Leibold (with whom I have enjoying sharing a bench and brainstorming over the years), Mei-Ling Li, Grace Xiang Li, Eva Loizou (for her support and sharing the Lowe lab PhD experience together), Riccardo Mezzadra, Wei Luan, Scott Millman, Paul Romesser, Stella Paffenholz, Marcus Ruscetti, Francisco Sanchez-Rivera (for his limitless generosity and sage advice), Janelle Simon, Anahi Tehuitzil, Sha Tian, Kaloyan Tsanov, Corina Amor Vegas, Leah Zamechek, and Zhen Zhao. And also former lab members that have already moved on: Sarah Ackerman, Erica Anderson, Iris Appelmann, Ana Banito, Benedikt Bosbach, Chong Chen, Luke Dow, Saya Ebbesen (for viii incorporating me into the lab), Danielle Grace, Chun-Hao Huang, Thomas Kitzing, Kiki Liu (for teaching me about lymphoma), Geulah Livshits, Amaia Lujambio (for teaching me about liver cancer), Eusebio (Chebi) Manchado (for being an excellent benchmate), Allison Mayle, Ozlem Mert, Cornelius Meithing, Kevin O’Rourke, Cory Rillahan, Anna Saborowski, Michael Saborowski, Adi Shroff, Nilgun Tasdemir, Merri Taylor, Darjus Tschaharganeh (for teaching me about liver cancer), and Susi Weissmuller. I appreciate the consistent insight that I have been fortunate to receive from my thesis committee members Timothy Chan and Charles Sawyers. I have always been impressed by how broad their knowledge base extends and have always been inspired by their enthusiasm and encouragement. I would especially like to thank collaborators Gadi Lalazar and Sanford Simon, Linas Mazutis, Roshan Sharma and Dana Pe’er, J. Erby Wilkinson, Nitin Shirole and Rafaella Sordella, Carol Prives, Neal Rosen, Luke Dow, and Ghassan Abou Alfa. I would also like to thank some of the other people that have taken the time to teach me something, provide me with useful tools and methods, to edit my work, to help brainstorm, and to generally help me enjoy the last few years. Thanks to Charles Sherr (for his advice, stories, and tough questions), Yadira Soto-Feliciano, Viraj Sangvi, Robert Bowman, Yilong Zou, Joana DeCampos Vidigal, Andrea Ventura, Johanna Joyce, Leila Akkari, Oakley Olson, Alberto Schumacher, Dan Marks, Robert Benezra, Zhirong Bao, Steve Albanese, Manu Vanaerschot, Maria Skamagki, Javier Carmona.
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
  • Autophagy: from Basic Science to Clinical Application

    Autophagy: from Basic Science to Clinical Application

    nature publishing group REVIEW See COMMENTARY page XX Autophagy: from basic science to clinical application J Va n L i m b e r g e n 1 , 2 , 3 , C S t e v e n s 4 , E R N i m m o 1 , D C W i l s o n 2 , 3 a n d J S a t s a n g i 1 Autophagy is a cellular pathway involved in protein and organelle degradation, which is likely to represent an innate adaptation to starvation. In times of nutrient deficiency, the cell can self-digest and recycle some nonessential components through nonselective autophagy, thus sustaining minimal growth requirements until a food source becomes available. Over recent years, autophagy has been implicated in an increasing number of clinical scenarios, notably infectious diseases, cancer, neurodegenerative diseases, and autoimmunity. The recent identification of the importance of autophagy genes in the genetic susceptibility to Crohn ’ s disease suggests that a selective autophagic response may play a crucial role in the pathogenesis of common complex immune-mediated diseases. In this review, we discuss the autophagic mechanisms, their molecular regulation, and summarize their clinical relevance. This progress has led to great interest in the therapeutic potential of manipulation of both selective and nonselective autophagy in established disease. INTRODUCTION The ability to adapt to environmental change is essential for sur- Autophagy encompasses several distinct processes involving vival. This is true for the organism as a whole and for individual the delivery of portions of the cytoplasm to the lysosome for cells alike.
  • Activated Peripheral-Blood-Derived Mononuclear Cells

    Activated Peripheral-Blood-Derived Mononuclear Cells

    Transcription factor expression in lipopolysaccharide- activated peripheral-blood-derived mononuclear cells Jared C. Roach*†, Kelly D. Smith*‡, Katie L. Strobe*, Stephanie M. Nissen*, Christian D. Haudenschild§, Daixing Zhou§, Thomas J. Vasicek¶, G. A. Heldʈ, Gustavo A. Stolovitzkyʈ, Leroy E. Hood*†, and Alan Aderem* *Institute for Systems Biology, 1441 North 34th Street, Seattle, WA 98103; ‡Department of Pathology, University of Washington, Seattle, WA 98195; §Illumina, 25861 Industrial Boulevard, Hayward, CA 94545; ¶Medtronic, 710 Medtronic Parkway, Minneapolis, MN 55432; and ʈIBM Computational Biology Center, P.O. Box 218, Yorktown Heights, NY 10598 Contributed by Leroy E. Hood, August 21, 2007 (sent for review January 7, 2007) Transcription factors play a key role in integrating and modulating system. In this model system, we activated peripheral-blood-derived biological information. In this study, we comprehensively measured mononuclear cells, which can be loosely termed ‘‘macrophages,’’ the changing abundances of mRNAs over a time course of activation with lipopolysaccharide (LPS). We focused on the precise mea- of human peripheral-blood-derived mononuclear cells (‘‘macro- surement of mRNA concentrations. There is currently no high- phages’’) with lipopolysaccharide. Global and dynamic analysis of throughput technology that can precisely and sensitively measure all transcription factors in response to a physiological stimulus has yet to mRNAs in a system, although such technologies are likely to be be achieved in a human system, and our efforts significantly available in the near future. To demonstrate the potential utility of advanced this goal. We used multiple global high-throughput tech- such technologies, and to motivate their development and encour- nologies for measuring mRNA levels, including massively parallel age their use, we produced data from a combination of two distinct signature sequencing and GeneChip microarrays.
  • IPC Accessibility Guide

    IPC Accessibility Guide

    2 TABLE OF CONTENTS FIGURES AND TABLES ................................................................................................................. 8 Foreword ........................................................................................................................................... 10 Introduction ................................................................................................................................. 10 Evolving content ......................................................................................................................... 10 Disclosure ...................................................................................................................................... 11 Structure and content of the IPC Accessibility Guide ...................................................... 11 Content ........................................................................................................................................... 11 Executive summary ......................................................................................................................... 12 Aim and purpose of the Guide ................................................................................................ 12 Key objectives of the Guide ..................................................................................................... 12 Target audience of the Guide ................................................................................................. 12 1 General information
  • Cell Type–Dependent Effects of Polo-Like Kinase 1 Inhibition Compared with Targeted Polo Box Interference in Cancer Cell Lines

    Cell Type–Dependent Effects of Polo-Like Kinase 1 Inhibition Compared with Targeted Polo Box Interference in Cancer Cell Lines

    3189 Cell type–dependent effects of Polo-like kinase 1 inhibition compared with targeted polo box interference in cancer cell lines Jenny Fink, Karl Sanders, Alexandra Rippl, certain cell lines but highly contrasting effects in others. Sylvia Finkernagel, Thomas L. Beckers, This may point to subtle differences in the molecular and Mathias Schmidt machinery of mitosis regulation in cancer cells. [Mol Cancer Ther 2007;6(12):3189–97] Nycomed GmbH, Konstanz, Germany Introduction Abstract Polo-like kinase 1 (Plk1) has been identified as key player Multiple critical roles within mitosis have been assigned for G2-M transition and mitotic progression in both normal to Polo-like kinase 1 (Plk1), making it an attractive and tumor cells (1). Multiple roles have been assigned to candidate for mitotic targeting of cancer cells. Plk1 Plk1 at the entry into M phase, mitotic spindle formation, contains two domains amenable for targeted interference: condensation and separation of chromosomes, exit from a kinase domain responsible for the enzymatic function mitosis by activation of the anaphase-promoting complex, and a polo box domain necessary for substrate recogni- and in cytokinesis (reviewed in ref. 2). Moreover, recent tion and subcellular localization. Here, we compare two reports implicated an involvement of Plk1 in the resump- approaches for targeted interference with Plk1 function, tion of cell cycle reentry after checkpoint activation through either by a Plk1 small-molecule enzyme inhibitor or by DNA-damaging agents (3). It is therefore not surprising inducible overexpression of the polo box in human cancer that targeted interference with Plk1, primarily by anti- cell lines.
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
  • Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells

    Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells

    The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells.
  • A Core Program of Gene Expression Characterizes Cancer Metastases

    A Core Program of Gene Expression Characterizes Cancer Metastases

    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 60), pp: 102161-102175 Research Paper A core program of gene expression characterizes cancer metastases Franz Hartung1, Yunguan Wang2, Bruce Aronow2 and Georg F. Weber1 1University of Cincinnati Academic Health Center, Cincinnati, OH, USA 2Computational Medicine Center, Cincinnati Children’s Hospital, Cincinnati, OH, USA Correspondence to: Georg F. Weber, email: [email protected] Keywords: metastasis; metabolism; vascularization; extracellular matrix; ion homeostasis Received: July 28, 2017 Accepted: August 31, 2017 Published: November 02, 2017 Copyright: Hartung et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT While aberrant expression or splicing of metastasis genes conveys to cancers the ability to break through tissue barriers and disseminate, the genetic basis for organ preference in metastasis formation has remained incompletely understood. Utilizing the gene expression profiles from 653 GEO datasets, we investigate whether the signatures by diverse cancers in various metastatic sites display common features. We corroborate the meta-analysis in a murine model. Metastases are generally characterized by a core program of gene expression that induces the oxidative metabolism, activates vascularization/tissue remodeling, silences extracellular matrix interactions, and alters ion homeostasis. This program distinguishes metastases from their originating primary tumors as well as from their target host tissues. Site- selectivity is accomplished through specific components that adjust to the target micro-environment. The same functional groups of gene expression programs are activated in the metastases of B16-F10 cells to various target organs.
  • Characterization of Gf a Drosophila Trimeric G Protein Alpha Subunit

    Characterization of Gf a Drosophila Trimeric G Protein Alpha Subunit

    Characterization of Gf a Drosophila trimeric G protein alpha subunit Naureen Quibria Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2012 © 2012 Naureen Quibria All rights reserved Abstract Characterization of Gf a Drosophila trimeric G-protein alpha subunit Naureen Quibria In the morphogenesis of tissue development, how coordination of patterning and growth achieve the correct organ size and shape is a principal question in biology. Efficient orchestrating mechanisms are required to achieve this and cells have developed sophisticated systems for reception and interpretation of the multitude of extracellular stimuli to which they are exposed. Plasma membrane receptors play a key role in the transmission of such signals. G-protein coupled receptors (GPCRs) are the largest class of cell surface receptors that respond to an enormous diversity of extracellular stimuli, and are critical mediators of cellular signal transduction in eukaryotic organisms. Signaling through GPCRs has been well characterized in many biological contexts. While they are a major class of signal transducers, there are not many defined instances where GPCRs have been implicated in the process of development to date. The Drosophila wing provides an ideal model system to elucidate and address the role of GPCRs in development, as its growth is regulated by a small number of conserved signaling pathways. In my thesis work, I address the role of a trimeric G alpha protein in Drosophila, Gαf, and what part it may play in development. In particular, I explore the role of Gαf as an alpha subunit of a trimeric complex, to determine what heptahelical receptors might act as its cognate receptor.
  • Review Article Mitotic Kinases and P53 Signaling

    Review Article Mitotic Kinases and P53 Signaling

    Hindawi Publishing Corporation Biochemistry Research International Volume 2012, Article ID 195903, 14 pages doi:10.1155/2012/195903 Review Article Mitotic Kinases and p53 Signaling Geun-Hyoung Ha1 and Eun-Kyoung Yim Breuer1, 2 1 Department of Radiation Oncology, Stritch School of Medicine, Loyola University Chicago, Maywood, IL 60153, USA 2 Department of Molecular Pharmacology and Therapeutics, Stritch School of Medicine, Loyola University Chicago, Maywood, IL 60153, USA Correspondence should be addressed to Eun-Kyoung Yim Breuer, [email protected] Received 6 April 2012; Accepted 18 May 2012 Academic Editor: Mandi M. Murph Copyright © 2012 G.-H. Ha and E.-K. Y. Breuer. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Mitosis is tightly regulated and any errors in this process often lead to aneuploidy, genomic instability, and tumorigenesis. Deregulation of mitotic kinases is significantly associated with improper cell division and aneuploidy. Because of their importance during mitosis and the relevance to cancer, mitotic kinase signaling has been extensively studied over the past few decades and, as a result, several mitotic kinase inhibitors have been developed. Despite promising preclinical results, targeting mitotic kinases for cancer therapy faces numerous challenges, including safety and patient selection issues. Therefore, there is an urgent need to better understand the molecular mechanisms underlying mitotic kinase signaling and its interactive network. Increasing evidence suggests that tumor suppressor p53 functions at the center of the mitotic kinase signaling network. In response to mitotic spindle damage, multiple mitotic kinases phosphorylate p53 to either activate or deactivate p53-mediated signaling.
  • The HHS-HCC Risk Adjustment Model for Individual and Small Group Markets Under the Affordable Care Act John Kautter,1 Gregory C

    The HHS-HCC Risk Adjustment Model for Individual and Small Group Markets Under the Affordable Care Act John Kautter,1 Gregory C

    2014: Volume 4, Number 3 A publication of the Centers for Medicare & Medicaid Services, Office of Information Products & Data Analytics The HHS-HCC Risk Adjustment Model for Individual and Small Group Markets under the Affordable Care Act John Kautter,1 Gregory C. Pope,1 Melvin Ingber,1 Sara Freeman,1 Lindsey Patterson,1 Michael Cohen,2 and Patricia Keenan2 1RTI International 2Centers for Medicare & Medicaid Services Abstract: Beginning in 2014, individuals and HHS-HCC diagnostic classification, which is the small businesses are able to purchase private health key element of the risk adjustment model. Then insurance through competitive Marketplaces. The the data and methods, results, and evaluation of Affordable Care Act (ACA) provides for a program the risk adjustment model are presented. Fifteen of risk adjustment in the individual and small group separate models are developed. For each age group markets in 2014 as Marketplaces are implemented (adult, child, and infant), a model is developed for and new market reforms take effect. The purpose each cost sharing level (platinum, gold, silver, and of risk adjustment is to lessen or eliminate the bronze metal levels, as well as catastrophic plans). influence of risk selection on the premiums that Evaluation of the risk adjustment models shows plans charge. The risk adjustment methodology good predictive accuracy, both for individuals and includes the risk adjustment model and the risk for groups. Lastly, this article provides examples transfer formula. of how the model output is used to calculate risk This article is the second of three in this scores, which are an input into the risk transfer issue of the Review that describe the Department formula.