Research in Biotechnology, 6(1): 54-58, 2015 ISSN: 2229-791X www.researchinbiotechnology.com Short Communication Genetic Structure of Cytochrome Oxidase Subunit II of Microcentrum rhombifolium Mashhoor, K., Swathi, R., Leya, T., Sebastian, C. D., Akhilesh, V.P., Tanuja, D., Rosy, P.A. and Lazar, K.V.* Molecular Biology Laboratory, Dept. of Zoology, University of Calicut, Kerala, 673635, India *Corresponding Author Email: [email protected], [email protected] The angle-wing katydid, Microcentrum rhombifolium is widely distributed in Asia- Pacific, Europe, Australia and America. The molecular genetic structure of katydid fauna of Indian subcontinent is not studied in detail. Here we report the partial sequence of cytochrome oxidase subunit II (COII) gene of M. rhombifolium collected from Calicut of North Kerala and its phylogenetic position in the family Tettigonidae. Genetically M. rhombifolium is closure to Elimaea cheni isolated from China with 81% identity in nucleotide sequence. Conceptual translation of its peptide sequence showed 87% similarity to that of the katydid Kawanaphila yarraga. Key words: Anglewing katydid, phylogeny, DNA barcoding, cytochrome oxidase The katydid fauna of the Indian Microcentrum rhombifolium is a broad subcontinent is not studied in detail. The winged katydid, with 2 to 2.5 inch size, family Tettigoniidae comprises approxi- widely distributed over Asia-Pacific, Europe, mately 1,070 genera and 6,000 species and Australia and America. This bright green widely distributed (Ferreira and Mesa, 2007). katydid has a long slender legs, which helps Ingrisch and Shishodia (1998) reported 8 new to jump when it get disturbed. Each year’s its species from India. Recently some studies produce several generations with largest described the phylogeny of different species population occurs during June through of Tettigonidae. Giannoulisi et al. (2011) September. They usually don’t cause any described the phylogeny of the genus Saga extensive damage; sometimes they feed on using cytochrome oxidase I (COI). Using the the foliage and can defoliate the young trees. AFLP analysis, sequence of nuclear DNA and M. rhombifolium is of major economic one mitochondrial locus Snyder et al. (2009) importance to citrus. They occasionally reconstructed phylogenetic relationship of damage citrus fruits by chewing on the peel. Genus Neoconocephalus. The phylogeny The foliage injury, particularly to young analysis of genus indicates the cryptic trees, can be extremely severe. Since number speciation on both Oahu and Hawai and high of eggs are laid on single leafs which leads to rate of nucleotide substitution (Shapiro et al., a fairly large population of katydids it will be 2006). Complete mitochondrial genome of present within a small area for food. The Elimaea cheni was used to interfere the damage by these rapidly growing nymphs phylogeny of Orthoptera (Zhou et al., 2010). will be occasionally severe. The angle wing katydid passes through four instars which Mashhoor et al. / Research in Biotechnology, 6(1): 54-58, 2015 takes a period of approximately three months product was sequenced from both ends using from egg to adult. The eggs of this katydid Sanger’s sequencing method at Xcelris commonly parasitized by Anastatus mirabilis a Laboratories Ltd., Ahmedabad. The member of the family Eupelmidae and that is sequences obtained were trimmed off the the normal control of this insect pest. Here primer sequences, assembled by using we report the partial coding sequence of COII ClustalW and the consensus was taken for gene and the conceptual peptide of partial the analysis. COII gene of M. rhombifolium from India, which can be used for barcoding and we Translation and Phylogenetic Analysis have explained its phylogeny status. The translation of the consensus sequences was done using Translation Table Materials and Methods 5. The nucleotide sequence and peptide PCR amplification of genomic DNA and sequence were searched for its similarity sequencing using BLAST programme of NCBI The genomic DNA was isolated from (www.ncbi.nlm.nih.gov/). The evolutionary one of its legs using GeNei Ultrapure relationship of M. rhombifolium was inferred Mammalian Genomic DNA Prep Kit using the Neighbor-joining method by (Bangalore GeNei, Bangalore) as per the MEGA4. Manufacturer’s instruction. About two nanogram of genomic DNA was amplified Results and Discussion for mitochondrial cytochrome oxidase The PCR of the COII gene fragment of subunit II (COII) gene using the forward M. rhombifolium yielded a single product of primer with DNA sequence 5′- 280 bp. The sequence is found to be novel ACCTTAAAAGCTATCGGTCATCAA- 3′ and the same has been deposited in the and reverse primer with DNA sequence 5′- GenBank (Accession Number HM996893.1). GATTAGCACCACAAATTTCTGAAC -3′. The COII hyper variable region of The PCR reaction mixture consisted of 2 DNA of M. rhombifolium is 81% similar to that nanogram of genomic DNA in 1 µl, 1 µl each of Elimaea cheni COII gene (GenBank forward and reverse primers at a Accession Number: GU 323368) and 78% concentration of 10 µM, 2.5 µl of dNTPs (2 similar to that of Kawanaphila yarraga COII mM), 2.5 µl 10X reaction buffer, 0.20 µl Taq gene (GenBank Accession Number: AF polymerase (5 U/µl) and 16.8 µl H2O. The 455370). The majority of the insects under PCR profile consisted of an initial Order Tettigoniidae show 76- 78% similarity denaturation step of 5 min at 950C, followed to that of M. rhombifolium COII gene by 30 cycles of 10s at 950C, 10s at 550C and 1 sequences. The conceptual translation of min at 720C and ending with a final phase of partial COII gene of M. rhombifolium yielded a 720C for 3 min. The PCR products were novel 93 amino acids peptides. BLASTp of M. resolved on a 1% TAE- agarose gel, stained rhombifolium showed 87% of similarity to that with EtBr and photographed using a gel of Kawanaphila yarraga (GenBank Accession documentation system. After ascertaining the Number: AAL 65203) and 83- 85% similarity PCR amplification of the corresponding COII the insects under Order Tettigoniidae. The fragment, the remaining portion of the PCR average AT content in the coding region product was column purified using Mo Bio Orthopterans is around 70% (Kim et al., 2005; UltraClean PCR Clean-up Kit (Mo Bio Fenn et al., 2008; Zhou et al., 2007). Laboratories, Inc. California) as per the manufacturer’s instruction. The purified PCR 2 Mashhoor et al. / Research in Biotechnology, 6(1): 54-58, 2015 Figure 1. The phylogeny tree of M. rhombifolium was inferred using COII partial sequence by Neighbor-joining method. In the case of M. rhombifolium the AT Ephippiger terrestris and Anabrus simplex. The content is 61.4% which is closure to the difference in the nucleotide used in the codon Uromenus catalaunicus, Gampsocleis gratiosa, showed clear bias towards AT in the first Metrioptera japonica, Uromenus catalaunicus, codon position (87.8%). The nucleotides in 3 Mashhoor et al. / Research in Biotechnology, 6(1): 54-58, 2015 the second and third position also showed Giannoulisi, T., Dutrillaux, A. M., Darcemont, bias to AT but it is less compared to first M. L., Darcemont , C., Myrthianou, E., position and is 59% and 63.7% respectively. Stamatisi, C., Dutrillaux, B. and The increased AT content in the second Mamurisi, Z. (2011). Molecular position may be for the preference for non phylogeny of European Saga: comparison polar and hydrophobic amino acids in with chromosomal data. Bulletin of membrane associated proteins. The AT bias Insectology 64 (2): 263-267 in the third codone position may be due to Ingrisch, S. and Shishodia, M. S. (1998). New the mutational pressure observed in species and records of Tettigonidae from mitochondrial genome (Clayton, 1982 and India (Ensifera), Mitteilungend ER Foster et al., 1997). The phylogeny analysis Schweizeris Che Nen Tomologischeng using NJ method clearly depicts the Esellschaft Bulletin DE LA Societe evolutionary status of M. rhombifolium (Fig.1). Entomolgique Suisse 71: 355-371. Elimaea cheni is the most nearest relative of M. Kim I., Cha S. Y., Yoon M. H., Hwang J. S., rhombifolium in the phylogeny tree and both Lee S. M., Sohn H. D. and Jin B. R. (2005). share a common ancestor. Species in the The complete nucleotide sequence and Kawanaphila genus grouped as separate clad. gene organization of the mitochondrial The COII sequence of M. rhombifolium genome of the oriental mole cricket, showed considerable variation with all other Gryllotalpa orientalis (Orthoptera: insect species. The barcode generated for M. Gryllotalpidae). Gene 353: 155–168. rhombifolium in the present study can be used Shapiro, L.H., Strazanac, J.S. and Roderick, for its accurate taxonomic identification. G.K. (2006). Molecular phylogeny of Banza (Orthoptera: Tettigoniidae), the References endemic katydids of the Hawaiian Clayton D. A. (1982). Replication of animal Archipelago. Molecular Phylogenetics and mitochondrial DNA. Cell 28, 693–705. Evolution 41:53–63 Fenn J. D., Song H., Cameron S. L. and Snyder, R.L., Frederick-Hudson, K.H. and Whiting M. F. (2008). A preliminary Schul, J. (2009). Molecular Phylogenetics mitochondrial genome phylogeny of of the Genus Neoconocephalus Orthoptera (Insecta) and approaches to (Orthoptera, Tettigoniidae) and the maximizing phylogenetic signal found Evolution of Temperate Life Histories. within mitochondrial genome data. Mol. PLoS ONE 4(9): e7203. Phylogenet. Evol. 49: 59–68 Zhou , Z., Ye , H., Huang , Y., and Shi, F. Ferreira, A. and Mesa, A. (2007). Cytogenetics (2010). The phylogeny of Orthoptera Studies in Thirteen Brazilian Species of inferred from mtDNA and description of Phaneropterinae (Orthoptera: Tettigoni- Elimaea cheni (Tettigoniidae: oidea: Tettigoniidae): Main Evolutive Phaneropterinae) mitogenome. J. Genet. Trends Basedon their Karyological Traits, Genomics 37:315−324 Neotropical Entomol. 36: 503-509. Zhou Z. J., Huang Y. and Shi F. M. (2007). Foster P. G., Jermiin L. S. and Hickey D. A. The mitochondrial genome of Ruspolia (1997). Nucleotide composition bias dubia (Orthoptera: Conocephalidae) affects amino acid content in proteins contains a short A+T-rich region of 70 bp coded by animal mitochondria.