DOCSLIB.ORG

Genetic Structure of Cytochrome Oxidase Subunit II of Microcentrum Rhombifolium

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Structure of Cytochrome Oxidase Subunit II of Microcentrum Rhombifolium Research in Biotechnology, 6(1): 54-58, 2015 ISSN: 2229-791X www.researchinbiotechnology.com Short Communication Genetic Structure of Cytochrome Oxidase Subunit II of Microcentrum rhombifolium Mashhoor, K., Swathi, R., Leya, T., Sebastian, C. D., Akhilesh, V.P., Tanuja, D., Rosy, P.A. and Lazar, K.V.* Molecular Biology Laboratory, Dept. of Zoology, University of Calicut, Kerala, 673635, India *Corresponding Author Email: [email protected], [email protected] The angle-wing katydid, Microcentrum rhombifolium is widely distributed in Asia- Pacific, Europe, Australia and America. The molecular genetic structure of katydid fauna of Indian subcontinent is not studied in detail. Here we report the partial sequence of cytochrome oxidase subunit II (COII) gene of M. rhombifolium collected from Calicut of North Kerala and its phylogenetic position in the family Tettigonidae. Genetically M. rhombifolium is closure to Elimaea cheni isolated from China with 81% identity in nucleotide sequence. Conceptual translation of its peptide sequence showed 87% similarity to that of the katydid Kawanaphila yarraga. Key words: Anglewing katydid, phylogeny, DNA barcoding, cytochrome oxidase The katydid fauna of the Indian Microcentrum rhombifolium is a broad subcontinent is not studied in detail. The winged katydid, with 2 to 2.5 inch size, family Tettigoniidae comprises approxi- widely distributed over Asia-Pacific, Europe, mately 1,070 genera and 6,000 species and Australia and America. This bright green widely distributed (Ferreira and Mesa, 2007). katydid has a long slender legs, which helps Ingrisch and Shishodia (1998) reported 8 new to jump when it get disturbed. Each year’s its species from India. Recently some studies produce several generations with largest described the phylogeny of different species population occurs during June through of Tettigonidae. Giannoulisi et al. (2011) September. They usually don’t cause any described the phylogeny of the genus Saga extensive damage; sometimes they feed on using cytochrome oxidase I (COI). Using the the foliage and can defoliate the young trees. AFLP analysis, sequence of nuclear DNA and M. rhombifolium is of major economic one mitochondrial locus Snyder et al. (2009) importance to citrus. They occasionally reconstructed phylogenetic relationship of damage citrus fruits by chewing on the peel. Genus Neoconocephalus. The phylogeny The foliage injury, particularly to young analysis of genus indicates the cryptic trees, can be extremely severe. Since number speciation on both Oahu and Hawai and high of eggs are laid on single leafs which leads to rate of nucleotide substitution (Shapiro et al., a fairly large population of katydids it will be 2006). Complete mitochondrial genome of present within a small area for food. The Elimaea cheni was used to interfere the damage by these rapidly growing nymphs phylogeny of Orthoptera (Zhou et al., 2010). will be occasionally severe. The angle wing katydid passes through four instars which Mashhoor et al. / Research in Biotechnology, 6(1): 54-58, 2015 takes a period of approximately three months product was sequenced from both ends using from egg to adult. The eggs of this katydid Sanger’s sequencing method at Xcelris commonly parasitized by Anastatus mirabilis a Laboratories Ltd., Ahmedabad. The member of the family Eupelmidae and that is sequences obtained were trimmed off the the normal control of this insect pest. Here primer sequences, assembled by using we report the partial coding sequence of COII ClustalW and the consensus was taken for gene and the conceptual peptide of partial the analysis. COII gene of M. rhombifolium from India, which can be used for barcoding and we Translation and Phylogenetic Analysis have explained its phylogeny status. The translation of the consensus sequences was done using Translation Table Materials and Methods 5. The nucleotide sequence and peptide PCR amplification of genomic DNA and sequence were searched for its similarity sequencing using BLAST programme of NCBI The genomic DNA was isolated from (www.ncbi.nlm.nih.gov/). The evolutionary one of its legs using GeNei Ultrapure relationship of M. rhombifolium was inferred Mammalian Genomic DNA Prep Kit using the Neighbor-joining method by (Bangalore GeNei, Bangalore) as per the MEGA4. Manufacturer’s instruction. About two nanogram of genomic DNA was amplified Results and Discussion for mitochondrial cytochrome oxidase The PCR of the COII gene fragment of subunit II (COII) gene using the forward M. rhombifolium yielded a single product of primer with DNA sequence 5′- 280 bp. The sequence is found to be novel ACCTTAAAAGCTATCGGTCATCAA- 3′ and the same has been deposited in the and reverse primer with DNA sequence 5′- GenBank (Accession Number HM996893.1). GATTAGCACCACAAATTTCTGAAC -3′. The COII hyper variable region of The PCR reaction mixture consisted of 2 DNA of M. rhombifolium is 81% similar to that nanogram of genomic DNA in 1 µl, 1 µl each of Elimaea cheni COII gene (GenBank forward and reverse primers at a Accession Number: GU 323368) and 78% concentration of 10 µM, 2.5 µl of dNTPs (2 similar to that of Kawanaphila yarraga COII mM), 2.5 µl 10X reaction buffer, 0.20 µl Taq gene (GenBank Accession Number: AF polymerase (5 U/µl) and 16.8 µl H2O. The 455370). The majority of the insects under PCR profile consisted of an initial Order Tettigoniidae show 76- 78% similarity denaturation step of 5 min at 950C, followed to that of M. rhombifolium COII gene by 30 cycles of 10s at 950C, 10s at 550C and 1 sequences. The conceptual translation of min at 720C and ending with a final phase of partial COII gene of M. rhombifolium yielded a 720C for 3 min. The PCR products were novel 93 amino acids peptides. BLASTp of M. resolved on a 1% TAE- agarose gel, stained rhombifolium showed 87% of similarity to that with EtBr and photographed using a gel of Kawanaphila yarraga (GenBank Accession documentation system. After ascertaining the Number: AAL 65203) and 83- 85% similarity PCR amplification of the corresponding COII the insects under Order Tettigoniidae. The fragment, the remaining portion of the PCR average AT content in the coding region product was column purified using Mo Bio Orthopterans is around 70% (Kim et al., 2005; UltraClean PCR Clean-up Kit (Mo Bio Fenn et al., 2008; Zhou et al., 2007). Laboratories, Inc. California) as per the manufacturer’s instruction. The purified PCR 2 Mashhoor et al. / Research in Biotechnology, 6(1): 54-58, 2015 Figure 1. The phylogeny tree of M. rhombifolium was inferred using COII partial sequence by Neighbor-joining method. In the case of M. rhombifolium the AT Ephippiger terrestris and Anabrus simplex. The content is 61.4% which is closure to the difference in the nucleotide used in the codon Uromenus catalaunicus, Gampsocleis gratiosa, showed clear bias towards AT in the first Metrioptera japonica, Uromenus catalaunicus, codon position (87.8%). The nucleotides in 3 Mashhoor et al. / Research in Biotechnology, 6(1): 54-58, 2015 the second and third position also showed Giannoulisi, T., Dutrillaux, A. M., Darcemont, bias to AT but it is less compared to first M. L., Darcemont , C., Myrthianou, E., position and is 59% and 63.7% respectively. Stamatisi, C., Dutrillaux, B. and The increased AT content in the second Mamurisi, Z. (2011). Molecular position may be for the preference for non phylogeny of European Saga: comparison polar and hydrophobic amino acids in with chromosomal data. Bulletin of membrane associated proteins. The AT bias Insectology 64 (2): 263-267 in the third codone position may be due to Ingrisch, S. and Shishodia, M. S. (1998). New the mutational pressure observed in species and records of Tettigonidae from mitochondrial genome (Clayton, 1982 and India (Ensifera), Mitteilungend ER Foster et al., 1997). The phylogeny analysis Schweizeris Che Nen Tomologischeng using NJ method clearly depicts the Esellschaft Bulletin DE LA Societe evolutionary status of M. rhombifolium (Fig.1). Entomolgique Suisse 71: 355-371. Elimaea cheni is the most nearest relative of M. Kim I., Cha S. Y., Yoon M. H., Hwang J. S., rhombifolium in the phylogeny tree and both Lee S. M., Sohn H. D. and Jin B. R. (2005). share a common ancestor. Species in the The complete nucleotide sequence and Kawanaphila genus grouped as separate clad. gene organization of the mitochondrial The COII sequence of M. rhombifolium genome of the oriental mole cricket, showed considerable variation with all other Gryllotalpa orientalis (Orthoptera: insect species. The barcode generated for M. Gryllotalpidae). Gene 353: 155–168. rhombifolium in the present study can be used Shapiro, L.H., Strazanac, J.S. and Roderick, for its accurate taxonomic identification. G.K. (2006). Molecular phylogeny of Banza (Orthoptera: Tettigoniidae), the References endemic katydids of the Hawaiian Clayton D. A. (1982). Replication of animal Archipelago. Molecular Phylogenetics and mitochondrial DNA. Cell 28, 693–705. Evolution 41:53–63 Fenn J. D., Song H., Cameron S. L. and Snyder, R.L., Frederick-Hudson, K.H. and Whiting M. F. (2008). A preliminary Schul, J. (2009). Molecular Phylogenetics mitochondrial genome phylogeny of of the Genus Neoconocephalus Orthoptera (Insecta) and approaches to (Orthoptera, Tettigoniidae) and the maximizing phylogenetic signal found Evolution of Temperate Life Histories. within mitochondrial genome data. Mol. PLoS ONE 4(9): e7203. Phylogenet. Evol. 49: 59–68 Zhou , Z., Ye , H., Huang , Y., and Shi, F. Ferreira, A. and Mesa, A. (2007). Cytogenetics (2010). The phylogeny of Orthoptera Studies in Thirteen Brazilian Species of inferred from mtDNA and description of Phaneropterinae (Orthoptera: Tettigoni- Elimaea cheni (Tettigoniidae: oidea: Tettigoniidae): Main Evolutive Phaneropterinae) mitogenome. J. Genet. Trends Basedon their Karyological Traits, Genomics 37:315−324 Neotropical Entomol. 36: 503-509. Zhou Z. J., Huang Y. and Shi F. M. (2007). Foster P. G., Jermiin L. S. and Hickey D. A. The mitochondrial genome of Ruspolia (1997). Nucleotide composition bias dubia (Orthoptera: Conocephalidae) affects amino acid content in proteins contains a short A+T-rich region of 70 bp coded by animal mitochondria.
Load more

Recommended publications
  • Singleton Molecular Species Delimitation Based on COI-5P
    Zhou et al. BMC Evolutionary Biology (2019) 19:79 https://doi.org/10.1186/s12862-019-1404-5 RESEARCHARTICLE Open Access Singleton molecular species delimitation based on COI-5P barcode sequences revealed high cryptic/undescribed diversity for Chinese katydids (Orthoptera: Tettigoniidae) Zhijun Zhou*, Huifang Guo, Li Han, Jinyan Chai, Xuting Che and Fuming Shi* Abstract Background: DNA barcoding has been developed as a useful tool for species discrimination. Several sequence- based species delimitation methods, such as Barcode Index Number (BIN), REfined Single Linkage (RESL), Automatic Barcode Gap Discovery (ABGD), a Java program uses an explicit, determinate algorithm to define Molecular Operational Taxonomic Unit (jMOTU), Generalized Mixed Yule Coalescent (GMYC), and Bayesian implementation of the Poisson Tree Processes model (bPTP), were used. Our aim was to estimate Chinese katydid biodiversity using standard DNA barcode cytochrome c oxidase subunit I (COI-5P) sequences. Results: Detection of a barcoding gap by similarity-based analyses and clustering-base analyses indicated that 131 identified morphological species (morphospecies) were assigned to 196 BINs and were divided into four categories: (i) MATCH (83/131 = 64.89%), morphospecies were a perfect match between morphospecies and BINs (including 61 concordant BINs and 22 singleton BINs); (ii) MERGE (14/131 = 10.69%), morphospecies shared its unique BIN with other species; (iii) SPLIT (33/131 = 25.19%, when 22 singleton species were excluded, it rose to 33/109 = 30.28%), morphospecies were placed in more than one BIN; (iv) MIXTURE (4/131 = 5.34%), morphospecies showed a more complex partition involving both a merge and a split. Neighbor-joining (NJ) analyses showed that nearly all BINs and most morphospecies formed monophyletic cluster with little variation.
    [Show full text]
  • Insects That Feed on Trees and Shrubs
    INSECTS THAT FEED ON COLORADO TREES AND SHRUBS1 Whitney Cranshaw David Leatherman Boris Kondratieff Bulletin 506A TABLE OF CONTENTS DEFOLIATORS .................................................... 8 Leaf Feeding Caterpillars .............................................. 8 Cecropia Moth ................................................ 8 Polyphemus Moth ............................................. 9 Nevada Buck Moth ............................................. 9 Pandora Moth ............................................... 10 Io Moth .................................................... 10 Fall Webworm ............................................... 11 Tiger Moth ................................................. 12 American Dagger Moth ......................................... 13 Redhumped Caterpillar ......................................... 13 Achemon Sphinx ............................................. 14 Table 1. Common sphinx moths of Colorado .......................... 14 Douglas-fir Tussock Moth ....................................... 15 1. Whitney Cranshaw, Colorado State University Cooperative Extension etnomologist and associate professor, entomology; David Leatherman, entomologist, Colorado State Forest Service; Boris Kondratieff, associate professor, entomology. 8/93. ©Colorado State University Cooperative Extension. 1994. For more information, contact your county Cooperative Extension office. Issued in furtherance of Cooperative Extension work, Acts of May 8 and June 30, 1914, in cooperation with the U.S. Department of Agriculture,
    [Show full text]
  • Katydid (Orthoptera: Tettigoniidae) Bio-Ecology in Western Cape Vineyards
    Katydid (Orthoptera: Tettigoniidae) bio-ecology in Western Cape vineyards by Marcé Doubell Thesis presented in partial fulfilment of the requirements for the degree of Master of Agricultural Sciences at Stellenbosch University Department of Conservation Ecology and Entomology, Faculty of AgriSciences Supervisor: Dr P. Addison Co-supervisors: Dr C. S. Bazelet and Prof J. S. Terblanche December 2017 Stellenbosch University https://scholar.sun.ac.za Declaration By submitting this thesis electronically, I declare that the entirety of the work contained therein is my own, original work, that I am the sole author thereof (save to the extent explicitly otherwise stated), that reproduction and publication thereof by Stellenbosch University will not infringe any third party rights and that I have not previously in its entirety or in part submitted it for obtaining any qualification. Date: December 2017 Copyright © 2017 Stellenbosch University All rights reserved Stellenbosch University https://scholar.sun.ac.za Summary Many orthopterans are associated with large scale destruction of crops, rangeland and pastures. Plangia graminea (Serville) (Orthoptera: Tettigoniidae) is considered a minor sporadic pest in vineyards of the Western Cape Province, South Africa, and was the focus of this study. In the past few seasons (since 2012) P. graminea appeared to have caused a substantial amount of damage leading to great concern among the wine farmers of the Western Cape Province. Very little was known about the biology and ecology of this species, and no monitoring method was available for this pest. The overall aim of the present study was, therefore, to investigate the biology and ecology of P. graminea in vineyards of the Western Cape to contribute knowledge towards the formulation of a sustainable integrated pest management program, as well as to establish an appropriate monitoring system.
    [Show full text]
  • The Evolution of Complex Calls in Meadow
    THE EVOLUTION OF COMPLEX CALLS IN MEADOW KATYDIDS _______________________________________ A Dissertation presented to the Faculty of the Graduate School at the University of Missouri-Columbia _______________________________________________________ In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy _____________________________________________________ by NATHAN HARNESS Dr. Johannes Schul, Dissertation Supervisor July 2018 The undersigned, appointed by the dean of the Graduate School, have examined the dissertation entitled THE EVOLUTION OF COMPLEX CALLS IN MEADOW KATYDIDS presented by Nathan Harness, a candidate for the degree of doctor of philosophy, and hereby certify that, in their opinion, it is worthy of acceptance. Professor Johannes Schul Professor Sarah Bush Professor Lori Eggert Professor Patricia Friedrichsen For my family Rachel and Mayr have given me so much. They show me unselfish affection, endless support, and generosity that seems to only grow. Without them the work here, and the adventure we’ve all three gone on surrounding it, would not have been possible. They have sacrificed birthdays, anniversaries, holidays, and countless weekends and evenings. They’ve happily seen me off to weeks of field work and conference visits. I am thankful to them for being so generous, and completely lacking in resentment at all the things that pull their husband and dad in so many directions. They have both necessarily become adept at melting away anxiety; I will forever be indebted to the hugs of a two-year-old and the kind words of his mom. Rachel and Mayr both deserve far more recognition than is possible here. I also want to thank my parents and brother and sisters.
    [Show full text]
  • A NEW SPECIES of EPHIPPIGER BERTHOLD, 1827 from the NORTHERN APENNINES in ITALY (Insecta Orthoptera Bradyporidae)
    P. FONTANA & B. ODÉ: A new species of Ephippiger Berthold, 1827... 81 PAOLO FONTANA (*) & BAUDEWIJN ODÉ A NEW SPECIES OF EPHIPPIGER BERTHOLD, 1827 FROM THE NORTHERN APENNINES IN ITALY (Insecta Orthoptera Bradyporidae) ABSTRACT - FONTANA P. & ODÉ B., 2003 - A new species of Ephippiger Berthold, 1827 from the Northern Apennines in Italy (Insecta Orthoptera Bradyporidae). Atti Acc. Rov. Agiati, a. 253, 2003, ser. VIII, vol. III, B: 81-103. Ephippiger carlottae n. sp. from Northern Apennine is described. The authors briefly present the status of the knowledge in Italy concerning the genus Ephippiger and in particular of the taxa of the Ephippiger ephippiger group. The new species is characterised by the subrectangular supragenital plate, the stout and short cerci and the medium length of titillators. Ephippiger carlottae n. sp. at present is known from the Emilia Romagna region and Tuscany only; it is a submontane to montane species and lives on bushes especially of Rubus sp. The bioacoustics of the species is de- scribed and illustrated by oscillograms. Several photos and drawings illustrate the main morphological characters and their variability, the habitat in the locus typicus restrictus and the distribution of the new species. KEY WORDS - Ephippiger carlottae n. sp., Ephippiger ephippiger group, Morpho- logy, Bioacoustics. RIASSUNTO - FONTANA P. & ODÉ B., 2003 - Una nuova specie di Ephippiger Berthold, 1827 dell’Appennino settentrionale in Italia (Insecta Orthoptera Bradyporidae). Viene descritto Ephippiger carlottae n. sp. dell’Appennino settentrionale. Gli au- tori presentano una breve rassegna sulle conoscenze relative al genere Ephippiger in Italia ed in particolare sui taxa del gruppo dell’Ephippiger ephippiger.
    [Show full text]
  • Orthoptera: Tettigonioidea)
    See discussions, stats, and author profiles for this publication at: http://www.researchgate.net/publication/268037110 Acoustic and Molecular Differentiation between Macropters and Brachypters of Eobiana engelhardti engelhardti (Orthoptera: Tettigonioidea) ARTICLE · MAY 2011 READS 19 1 AUTHOR: Yinliang Wang Northeast Normal University 9 PUBLICATIONS 4 CITATIONS SEE PROFILE All in-text references underlined in blue are linked to publications on ResearchGate, Available from: Yinliang Wang letting you access and read them immediately. Retrieved on: 25 November 2015 Zoological Studies 50(5): 636-644 (2011) Acoustic and Molecular Differentiation between Macropters and Brachypters of Eobiana engelhardti engelhardti (Orthoptera: Tettigonioidea) Yin-Liang Wang, Jian Zhang, Xiao-Qiang Li, and Bing-Zhong Ren* Jilin Key Laboratory of Animal Resource Conservation and Utilization, School of Life Sciences, Northeast Normal Univ., 5268 Renmin St., Changchun CO130024, China (Accepted May 20, 2011) Yin-Liang Wang, Jian Zhang, Xiao-Qiang Li, and Bing-Zhong Ren (2011) Acoustic and molecular differentiation between macropters and brachypters of Eobiana engelhardti engelhardti (Orthoptera: Tettigonioidea). Zoological Studies 50(5): 636-644. This study focused on the wing dimorphism of Eobiana engelhardti engelhardti (Uvarov 1926). To examine acoustic differences between macropters and brachypters, we recorded and analyzed the calling songs of the 2 forms. Moreover, the vocal organs of E. e. engelhardti were also observed under optical and scanning electric microscopy. As a result, there were 3 “dynamic” song traits which had significant differences between the 2 forms, but no obvious differences were observed in vocal organs. For macropters, we assumed that differentiation of these calling songs showed compensation for a reproductive disadvantage.
    [Show full text]
  • Research Paper RARITY, and PRIORITIZATION of TETTIGONIID
    Journal of Global Biosciences ISSN 2320-1355 Volume 8, Number 10, 2019, pp. 6481-6499 Website: www.mutagens.co.in Research Paper RARITY, AND PRIORITIZATION OF TETTIGONIID SPECIES AND SELECTION OF SITES FOR CONSERVATION OF TETTIGONIIDAE IN TAMILNADU Govindaraj Divya and Natchiappan Senthilkumar Institute of Forest Genetics and Tree Breeding, Coimbatore – 641 002, Tamilnadu, India. Abstract The present study documents the distribution; occurrence and faunal richness of Tettigoniids in Tamil Nadu, from four different vegetation types viz forest ecosystem, open grassland ecosystem, wasteland ecosystem, and agroecosystems. A total of twenty-six species in five different subfamilies, were recorded. Three faunal properties, viz., species richness, complementarity and taxonomic difference were calculated as a measure of diversity. Root weighting is a fixed weight index where species are valued for differences according to their position in the taxonomic hierarchy. Following this, the tettigoniid species were weighed as per their rarity in Tamil Nadu and their taxonomic distinctness, which provided the necessary pointer for habitats prioritized for conservation. This method gave a higher priority to lowland forest habitats for conserving tettigoniids, followed by the upland forests, grasslands, arablelands and finally the wastelands. Key words: Conservation, Orthoptera, Tettigoniids, Site selection, and Root weighting. INTRODUCTION The burgeoning human population demands has resulted in tremendous loss of biodiversity globally and scientists are pondering on ways to protect if not prevent species extinction. Site selection for conservation of ecologically functional species is gaining momentum and it has been accepted that while the more visible species are protected at a site, many umbrella species automatically get covered. However there are many other species which does great ecological functions, but do not fall under the umbrella species category.
    [Show full text]
  • Surveying for Terrestrial Arthropods (Insects and Relatives) Occurring Within the Kahului Airport Environs, Maui, Hawai‘I: Synthesis Report
    Surveying for Terrestrial Arthropods (Insects and Relatives) Occurring within the Kahului Airport Environs, Maui, Hawai‘i: Synthesis Report Prepared by Francis G. Howarth, David J. Preston, and Richard Pyle Honolulu, Hawaii January 2012 Surveying for Terrestrial Arthropods (Insects and Relatives) Occurring within the Kahului Airport Environs, Maui, Hawai‘i: Synthesis Report Francis G. Howarth, David J. Preston, and Richard Pyle Hawaii Biological Survey Bishop Museum Honolulu, Hawai‘i 96817 USA Prepared for EKNA Services Inc. 615 Pi‘ikoi Street, Suite 300 Honolulu, Hawai‘i 96814 and State of Hawaii, Department of Transportation, Airports Division Bishop Museum Technical Report 58 Honolulu, Hawaii January 2012 Bishop Museum Press 1525 Bernice Street Honolulu, Hawai‘i Copyright 2012 Bishop Museum All Rights Reserved Printed in the United States of America ISSN 1085-455X Contribution No. 2012 001 to the Hawaii Biological Survey COVER Adult male Hawaiian long-horned wood-borer, Plagithmysus kahului, on its host plant Chenopodium oahuense. This species is endemic to lowland Maui and was discovered during the arthropod surveys. Photograph by Forest and Kim Starr, Makawao, Maui. Used with permission. Hawaii Biological Report on Monitoring Arthropods within Kahului Airport Environs, Synthesis TABLE OF CONTENTS Table of Contents …………….......................................................……………...........……………..…..….i. Executive Summary …….....................................................…………………...........……………..…..….1 Introduction ..................................................................………………………...........……………..…..….4
    [Show full text]
  • Colonization, Speciation, and Conservation
    30 Oct 2001 16:31 AR AR147-20.tex AR147-20.SGM ARv2(2001/05/10) P1: GJC Annu. Rev. Entomol. 2002. 47:595–632 Copyright c 2002 by Annual Reviews. All rights reserved ARTHROPODS ON ISLANDS: Colonization, Speciation, and Conservation Rosemary G. Gillespie and George K. Roderick Environmental Science, Policy, and Management, Division of Insect Biology, University of California, Berkeley, California 94720-3112; e-mail: [email protected]; [email protected] Key Words adaptive radiation, fragments, oceanic, endemism, disharmony, isolation ■ Abstract Islands have traditionally been considered to be any relatively small body of land completely surrounded by water. However, their primary biological char- acteristic, an extended period of isolation from a source of colonists, is common also to many situations on continents. Accordingly, theories and predictions developed for true islands have been applied to a huge array of systems, from rock pools, to single tree species in forests, to oceanic islands. Here, we examine the literature on islands in the broadest sense (i.e., whether surrounded by water or any other uninhabitable matrix) as it pertains to terrestrial arthropods. We categorize islands according to the features they share. The primary distinction between different island systems is “darwinian” islands (formed de novo) and “fragment” islands. In the former, the islands have never been in contact with the source of colonists and have abundant “empty” ecological niche space. On these islands, species numbers will initially increase through immigration, the rate depending on the degree of isolation. If isolation persists, over time species formation will result in “neo-endemics.” When isolation is extreme, the ecological space will gradually be filled through speciation (rather than immigration) and adaptive radiation of neo-endemics.
    [Show full text]
  • Indiana Ensifera (Orthopera)
    The Great Lakes Entomologist Volume 9 Number 1 - Spring 1976 Number 1 - Spring 1976 Article 2 April 1976 Indiana Ensifera (Orthopera) W. P. McCafferty J. L. Stein Purdue University Follow this and additional works at: https://scholar.valpo.edu/tgle Part of the Entomology Commons Recommended Citation McCafferty, W. P. and Stein, J. L. 1976. "Indiana Ensifera (Orthopera)," The Great Lakes Entomologist, vol 9 (1) Available at: https://scholar.valpo.edu/tgle/vol9/iss1/2 This Peer-Review Article is brought to you for free and open access by the Department of Biology at ValpoScholar. It has been accepted for inclusion in The Great Lakes Entomologist by an authorized administrator of ValpoScholar. For more information, please contact a ValpoScholar staff member at [email protected]. McCafferty and Stein: Indiana Ensifera (Orthopera) INDIANA ENSIFERA (ORTHOPERA) and J. L. Stein Department of Entomology Purdue University West Lafayette, Indiana 47907 Published by ValpoScholar, 1976 1 The Great Lakes Entomologist, Vol. 9, No. 1 [1976], Art. 2 https://scholar.valpo.edu/tgle/vol9/iss1/2 2 McCafferty and Stein: Indiana Ensifera (Orthopera) THE GREAT LAKES ENTOMOLOGIST INDIANA ENSIFERA (ORTHOPERA)' W. P. McCafferty and J. L. Stein2 A total of 67 species of long-horned grasshoppers and crickets were reported to occur in Indiana by Blatchley (1903) in his "Orthoptera of Indiana." Distributional information concerning thek species was sparse and has not been significantly supplemented since that time. Subsequent works which have dealt either heavily or exclusively with the Indiana fauna include Fox (1915), Blatchley (1920), Cantrall and Young (1954), and Young and Cantrall(1956).
    [Show full text]
  • Coastal Sage Scrub at University of California, Los Angeles
    BIOLOGICAL ASSESSMENT: COASTAL SAGE SCRUB AT UNIVERSITY OF CALIFORNIA, LOS ANGELES Prepared by: Geography 123: Bioresource Management UCLA Department of Geography, Winter 1996 Dr. Rudi Mattoni Robert Hill Alberto Angulo Karl Hillway Josh Burnam Amanda Post John Chalekian Kris Pun Jean Chen Julien Scholnick Nathan Cortez David Sway Eric Duvernay Alyssa Varvel Christine Farris Greg Wilson Danny Fry Crystal Yancey Edited by: Travis Longcore with Dr. Rudi Mattoni, Invertebrates Jesus Maldonado, Mammals Dr. Fritz Hertel, Birds Jan Scow, Plants December 1, 1997 TABLE OF CONTENTS CHAPTER 1: INTRODUCTION ..........................................................................................................................1 CHAPTER 2: PHYSICAL DESCRIPTION ........................................................................................................2 GEOLOGICAL FRAMEWORK.....................................................................................................................................2 LANDFORMS AND SOILS ..........................................................................................................................................2 The West Terrace ...............................................................................................................................................3 Soil Tests.............................................................................................................................................................4 SLOPE, EROSION, AND RUNOFF ..............................................................................................................................4
    [Show full text]
  • Insects and Other Terrestrial Arthropods from the Leeward Hawaiian Islands1 Most Recent Immigrant Insects Now Known from The
    CORE Metadata, citation and similar papers at core.ac.uk Provided by ScholarSpace at University of Hawai'i at Manoa Vol. XIX, No. 2, September, 1966 157 Insects and Other Terrestrial Arthropods from the Leeward Hawaiian Islands1 John W. Beardsley UNIVERSITY OF HAWAII, HONOLULU, HAWAII INTRODUCTION The Leeward Hawaiian Islands comprise a chain of small rocky islets, and coral atolls which extend west-northwest of Kauai. Nihoa, the nearest, is about 150 miles from Kauai, while Kure, the furthermost, is some 1,150 miles away (see map, p. 158). All Leeward Islands except Midway and Kure are now a part of the Hawaiian Islands National Wildlife Refuge administered by the U.S. Fish and Wildlife Service. This paper summarizes results of recent entomological field work in these islands, and attempts to update the existing lists of insects and other terrestrial arthropods known. The terrestrial arthropod fauna of these islands is a mixture of endemic or indigenous elements and recently, adventive forms. The numbers of endemic species are greatest on the two relatively undisturbed southeastern volcanic islands of Nihoa and Necker, and apparently have disappeared largely from the more northwesterly atolls where, in most cases, the original vegetation has changed drastically in the past 100 years or so. Extinction of native plants and endemic insects has been documented fairly well for Laysan fChristophersen & Caum, 1931, Butler & Usinger, 1963a). Un fortunately, less is known about the original biota of the other atolls. Most recent immigrant insects now known from the Leeward Islands occur also on the larger inhabited islands of Hawaii; however, two species could become serious crop pests should they spread into agricultural areas of the state.
    [Show full text]