DOCSLIB.ORG

Final Thesis Version-20101220

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Final Thesis Version-20101220 STUDY OF OSTEOSARCOMA DEVELOPMENT, PROGRESSION AND TREATMENT 1. Gene Profiling and Tumorigenesis 2. IGF-1R/MEK/ERK Signalling and Malignant Potential 3. IGF-1R Targeted Therapy Enhances Chemotherapy Using Doxorubicin CHEUK FAI FREDERICK LUK A thesis presented in fulfilment of the requirements for the degree of Doctor of Philosophy Prince of Wales Clinical School Faculty of Medicine University of New South Wales Sydney, Australia August, 2010 i Copyright Statement ‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.' Signed: _______________________________________ 14th December 2010 Dated: _______________________________________ Authenticity Statement ‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’ Signed: _______________________________________ 14th December 2010 Dated: _______________________________________ ii Original Statement ‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’ Signed: _______________________________________ 14th December 2010 Dated: _______________________________________ iii Abstract Understanding of osteosarcoma progression and molecular pathogenesis remains limited due to the complex genetic changes. Recently, osteosarcoma is redefined as a differentiation disease due to the disruption of osteoblast differentiation, opening up a new direction for investigations. The type I insulin-like growth factor receptor (IGF-1R) participates in promoting malignant potential in osteosarcoma, but the effectiveness of its inhibition has not been fully elucidated. Gene expression profile analysis of the two osteosarcoma cell lines showed that genes of cell-adhesion and nervous system were expressed differentially. These genes are known to participate in controlling osteoblast differentiation. Other genes known to be involved in osteoblast differentiation were also found in the analysis. This study suggests that the cell-adhesion and nervous system signalling pathways may involve in the disruption of osteoblast differentiation leading to the development of osteosarcoma. The detection of protein expression of IGF-1R downstream signal mediators in the primary and secondary xenograft tumour tissues showed for the first time that IGF- 1R/MEK/ERK signalling is involved in the malignant potential and lung metastasis of osteosarcoma. In addition, the in vitro invasive ability of the osteosarcoma cell line was reduced after inhibition of MEK/ERK signalling. These results signify that MEK/ERK could be potential therapeutic targets for the treatment of metastatic osteosarcoma. Furthermore, it is also the first time that enhancement of growth inhibition and increased Doxorubicin sensitivity were shown after IGF-1R inhibitor and Doxorubicin combination treatment in a panel of 6 human osteosarcoma cell lines and a self- established resistant sub-clone. Mechanism studies in osteosarcoma cell lines showed that the combination therapy has advantages over mono drug treatment in terms of enhances apoptosis, maintains clonogenic inhibition and improves cytotoxicity in iv therapeutic efficacy without addition of individual drug doses. This study indicates that inhibition of IGF-1R signalling and together with Doxorubicin chemotherapy is a potential effective strategy to improve the treatment of both Doxorubicin sensitive and resistant osteosarcoma. v Acknowledgments First of all acknowledgements go to Prof. William R. Walsh, Director of the Surgical & Orthopaedic Research Laboratories (S&ORL) facility, for providing scholarship, support and acceptance to work in his laboratory. I would also like to thank my supervisors, A/Prof. Jia-Lin Yang and Dr. Yan Yu for their guidance, patience, feedback and motivation. Their enormous and generous contribution throughout the PhD is greatly appreciated. In addition, I would like to thank all the staff and students from S&ORL, who have helped me. Especially thanks to Dr. Rema Oliver, Dr. Abe Lau and Ms Joy Francisco for their understanding, motivation and listening to my countless problems, I would not have been able to complete this PhD without their assistance. Special thanks for A/Prof. Hai-tao Dong (Institute of Biotechnology, Zhejiang University, China) for his help and teachings, which showed me the future again. Thanks to my “coffee buddies” from the university, Moonsun Jung, Dr. Brooke Farrugia and others for their friendship and support, daily sharing of the caffeine addiction brightened up my days. Also, I would like to say thank you to all of my friends from within and outside of UNSW for their understanding and support, especially to Dr. David Chin and Gilbert Poon for their mental support throughout the PhD when I am in the stage of madness. Special thanks to Dr. Christine Chuang for her unconditional love, support and putting up with my insanity. Finally and most importantly, acknowledgments go to my parents, sister and her family. I would not have been able to finish this study and staying alive without their endless love, support and reassurance. vi Table of contents Copyright Statement ...................................................................................................... i Authenticity Statement ................................................................................................... i Original Statement ........................................................................................................ ii Abstract ....................................................................................................................... iii Acknowledgments ......................................................................................................... v Table of contents ......................................................................................................... vi List of figures .............................................................................................................. xii List of tables ................................................................................................................ xv Abbreviation ................................................................................................................xvi List of publications ......................................................................................................xix Chapter 1. Introduction .......................................................................................... 1 1.1. Introduction ..................................................................................................... 1 1.2. Hypotheses and aims ...................................................................................... 2 Chapter 2. Literature Review ................................................................................. 4 2.1. Clinical features of osteosarcoma .................................................................... 4 2.1.1. Incidence and mortality .......................................................................... 4 2.1.2. Classification .......................................................................................... 5 2.1.3. Current diagnosis, treatment and management ...................................... 8 2.2. Molecular pathogenesis of osteosarcoma ..................................................... 14 2.2.1. Tumour suppressor genes ................................................................... 15 2.2.2. Oncogenes ........................................................................................... 18 2.2.3. Other factors and pathways.................................................................. 22 2.3. Osteogenic and tumourigenic properties of osteosarcoma ............................ 25 2.4. Differentiation disruption and osteosarcoma .................................................. 26 vii 2.5. Advance technology for osteosarcoma
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • To Study Mutant P53 Gain of Function, Various Tumor-Derived P53 Mutants
    Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Shama K Khokhar M.Sc., Bilaspur University, 2004 B.Sc., Bhopal University, 2002 2007 1 COPYRIGHT SHAMA K KHOKHAR 2007 2 WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES Date of Defense: 12-03-07 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY SHAMA KHAN KHOKHAR ENTITLED Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science Madhavi P. Kadakia, Ph.D. Thesis Director Daniel Organisciak , Ph.D. Department Chair Committee on Final Examination Madhavi P. Kadakia, Ph.D. Steven J. Berberich, Ph.D. Michael Leffak, Ph.D. Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies 3 Abstract Khokhar, Shama K. M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2007 Differential effect of TAp63γ mutants on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. p63, a member of the p53 gene family, known to play a role in development, has more recently also been implicated in cancer progression. Mice lacking p63 exhibit severe developmental defects such as limb truncations, abnormal skin, and absence of hair follicles, teeth, and mammary glands. Germline missense mutations of p63 have been shown to be responsible for several human developmental syndromes including SHFM, EEC and ADULT syndromes and are associated with anomalies in the development of organs of epithelial origin.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Supp Table 1.Pdf
    Upregulated genes in Hdac8 null cranial neural crest cells fold change Gene Symbol Gene Title 134.39 Stmn4 stathmin-like 4 46.05 Lhx1 LIM homeobox protein 1 31.45 Lect2 leukocyte cell-derived chemotaxin 2 31.09 Zfp108 zinc finger protein 108 27.74 0710007G10Rik RIKEN cDNA 0710007G10 gene 26.31 1700019O17Rik RIKEN cDNA 1700019O17 gene 25.72 Cyb561 Cytochrome b-561 25.35 Tsc22d1 TSC22 domain family, member 1 25.27 4921513I08Rik RIKEN cDNA 4921513I08 gene 24.58 Ofa oncofetal antigen 24.47 B230112I24Rik RIKEN cDNA B230112I24 gene 23.86 Uty ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome 22.84 D8Ertd268e DNA segment, Chr 8, ERATO Doi 268, expressed 19.78 Dag1 Dystroglycan 1 19.74 Pkn1 protein kinase N1 18.64 Cts8 cathepsin 8 18.23 1500012D20Rik RIKEN cDNA 1500012D20 gene 18.09 Slc43a2 solute carrier family 43, member 2 17.17 Pcm1 Pericentriolar material 1 17.17 Prg2 proteoglycan 2, bone marrow 17.11 LOC671579 hypothetical protein LOC671579 17.11 Slco1a5 solute carrier organic anion transporter family, member 1a5 17.02 Fbxl7 F-box and leucine-rich repeat protein 7 17.02 Kcns2 K+ voltage-gated channel, subfamily S, 2 16.93 AW493845 Expressed sequence AW493845 16.12 1600014K23Rik RIKEN cDNA 1600014K23 gene 15.71 Cst8 cystatin 8 (cystatin-related epididymal spermatogenic) 15.68 4922502D21Rik RIKEN cDNA 4922502D21 gene 15.32 2810011L19Rik RIKEN cDNA 2810011L19 gene 15.08 Btbd9 BTB (POZ) domain containing 9 14.77 Hoxa11os homeo box A11, opposite strand transcript 14.74 Obp1a odorant binding protein Ia 14.72 ORF28 open reading
    [Show full text]
  • Htra1 Is a Novel Transcriptional Target of RUNX2 That Promotes Osteogenic Differentiation
    Cellular Physiology Cell Physiol Biochem 2019;53:832-850 DOI: 10.33594/00000017610.33594/000000176 © 2019 The Author(s).© 2019 Published The Author(s) by and Biochemistry Published online: online: 9 9November November 2019 2019 Cell Physiol BiochemPublished Press GmbH&Co. by Cell Physiol KG Biochem 832 Press GmbH&Co. KG, Duesseldorf IyyanarAccepted: et 7al.: November Runx2 Regulates 2019 Htra1 During Osteogenesiswww.cellphysiolbiochem.com This article is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 Interna- tional License (CC BY-NC-ND). Usage and distribution for commercial purposes as well as any distribution of modified material requires written permission. Original Paper Htra1 is a Novel Transcriptional Target of RUNX2 That Promotes Osteogenic Differentiation Paul P.R. Iyyanara,b Merlin P. Thangaraja B. Frank Eamesc Adil J. Nazaralia aLaboratory of Molecular Cell Biology, College of Pharmacy and Nutrition and Neuroscience Research Cluster, University of Saskatchewan, Saskatoon, SK, Canada, bDivision of Developmental Biology, Cincinnati Children’s Hospital Medical Center, Cincinnati, OH, USA, cDepartment of Anatomy and Cell Biology, University of Saskatchewan, Saskatoon, SK, Canada Key Words Runx2 • Htra1 • Osteoblast differentiation • Matrix mineralization Abstract Background/Aims: Runt-related transcription factor 2 (Runx2) is a master regulator of osteogenic differentiation, but most of the direct downstream targets of RUNX2 during osteogenesis are unknown. Likewise, High-temperature requirement factor A1 (HTRA1) is a serine protease expressed in bone, yet the role of Htra1 during osteoblast differentiation remains elusive. We investigated the role of Htra1 in osteogenic differentiation and the transcriptional regulation of Htra1 by RUNX2 in primary mouse mesenchymal progenitor cells. Methods: Overexpression of Htra1 was carried out in primary mouse mesenchymal progenitor cells to evaluate the extent of osteoblast differentiation.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Aberrant Sialylation in Cancer: Biomarker and Potential Target for Therapeutic Intervention?
    cancers Review Aberrant Sialylation in Cancer: Biomarker and Potential Target for Therapeutic Intervention? Silvia Pietrobono * and Barbara Stecca * Tumor Cell Biology Unit, Core Research Laboratory, Institute for Cancer Research and Prevention (ISPRO), Viale Pieraccini 6, 50139 Florence, Italy * Correspondence: [email protected] (S.P.); [email protected] (B.S.); Tel.: +39-055-7944568 (S.P.); +39-055-7944567 (B.S.) Simple Summary: Sialylation is a post-translational modification that consists in the addition of sialic acid to growing glycan chains on glycoproteins and glycolipids. Aberrant sialylation is an established hallmark of several types of cancer, including breast, ovarian, pancreatic, prostate, colorectal and lung cancers, melanoma and hepatocellular carcinoma. Hypersialylation can be the effect of increased activity of sialyltransferases and results in an excess of negatively charged sialic acid on the surface of cancer cells. Sialic acid accumulation contributes to tumor progression by several paths, including stimulation of tumor invasion and migration, and enhancing immune evasion and tumor cell survival. In this review we explore the mechanisms by which sialyltransferases promote cancer progression. In addition, we provide insights into the possible use of sialyltransferases as biomarkers for cancer and summarize findings on the development of sialyltransferase inhibitors as potential anti-cancer treatments. Abstract: Sialylation is an integral part of cellular function, governing many biological processes Citation: Pietrobono, S.; Stecca, B. including cellular recognition, adhesion, molecular trafficking, signal transduction and endocytosis. Aberrant Sialylation in Cancer: Sialylation is controlled by the levels and the activities of sialyltransferases on glycoproteins and Biomarker and Potential Target for lipids. Altered gene expression of these enzymes in cancer yields to cancer-specific alterations of Therapeutic Intervention? Cancers glycoprotein sialylation.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2017/0029891 A1 SHARP Et Al
    US 2017.0029891A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2017/0029891 A1 SHARP et al. (43) Pub. Date: Feb. 2, 2017 (54) BOMARKERS FOR DAGNOSING (60) Provisional application No. 61/584.232, filed on Jan. SCHEMA 7, 2012. (71) Applicant: The Regents of the University of California, Oakland, CA (US) Publication Classification (51) Int. C. (72) Inventors: Frank SHARP, Davis, CA (US); Glen CI2O I/68 (2006.01) C. JICKLING, Sacramento, CA (US) (52) U.S. C. (73) Assignee: The Regents of the University of CPC ....... CI2O 1/6883 (2013.01); C12O 2600/158 California, Oakland, CA (US) (2013.01); C12O 2600/118 (2013.01) (21) Appl. No.: 15/226,844 (57) ABSTRACT (22) Filed: Aug. 2, 2016 The present invention provides methods and compositions for diagnosing and predicting the occurrence of ischemia. Related U.S. Application Data For example, the present invention provides methods and (63) Continuation of application No. 14/370.709, filed on compositions for diagnosing and predicting the risk and Jul. 3, 2014, now Pat. No. 9,410,204, filed as appli cause of transient neurological events (TNE) as ischemic or cation No. PCT/US2013/020240 on Jan. 4, 2013. non-ischemic. Patent Application Publication Feb. 2, 2017. Sheet 1 of 3 US 2017/0029891 A1 TA (n=263 WS schemic Stroke (n=94) VRF Contro ra.) vs WRF Control (n=44) Fig. 1 A. Derivation Cross-Walidation 26 Gene 10-fold leave-one-out DA Prediction Model TA-DW+f Minor Stroke (n=17) Fia. 1 B. Validation g Nonischemic TNE {n=13) Fig.
    [Show full text]
  • Quantigene Flowrna Probe Sets Currently Available
    QuantiGene FlowRNA Probe Sets Currently Available Accession No. Species Symbol Gene Name Catalog No. NM_003452 Human ZNF189 zinc finger protein 189 VA1-10009 NM_000057 Human BLM Bloom syndrome VA1-10010 NM_005269 Human GLI glioma-associated oncogene homolog (zinc finger protein) VA1-10011 NM_002614 Human PDZK1 PDZ domain containing 1 VA1-10015 NM_003225 Human TFF1 Trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in) VA1-10016 NM_002276 Human KRT19 keratin 19 VA1-10022 NM_002659 Human PLAUR plasminogen activator, urokinase receptor VA1-10025 NM_017669 Human ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like VA1-10029 NM_017699 Human SIDT1 SID1 transmembrane family, member 1 VA1-10032 NM_000077 Human CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) VA1-10040 NM_003150 Human STAT3 signal transducer and activator of transcripton 3 (acute-phase response factor) VA1-10046 NM_004707 Human ATG12 ATG12 autophagy related 12 homolog (S. cerevisiae) VA1-10047 NM_000737 Human CGB chorionic gonadotropin, beta polypeptide VA1-10048 NM_001017420 Human ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) VA1-10050 NM_197978 Human HEMGN hemogen VA1-10051 NM_001738 Human CA1 Carbonic anhydrase I VA1-10052 NM_000184 Human HBG2 Hemoglobin, gamma G VA1-10053 NM_005330 Human HBE1 Hemoglobin, epsilon 1 VA1-10054 NR_003367 Human PVT1 Pvt1 oncogene homolog (mouse) VA1-10061 NM_000454 Human SOD1 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))
    [Show full text]