Vitamin K Deficiency Reduces Testosterone Production in the Testis

Biochimica et Biophysica Acta 1760 (2006) 1482–1488 www.elsevier.com/locate/bbagen

Vitamin K deficiency reduces testosterone production in the testis through down-regulation of the Cyp11a a cholesterol side chain cleavage enzyme in rats ⁎ Hitoshi Shirakawa a, ,1, Yusuke Ohsaki a,1, Yoshihiko Minegishi a, Naofumi Takumi a, Kousaku Ohinata a, Yuji Furukawa a, Takeo Mizutani b, Michio Komai a

a Laboratory of Nutrition, Graduate School of Agricultural Science, Tohoku University, Sendai 981-8555, Japan b ALA Research Center, Yokohama 246-0002, Japan Received 5 March 2006; received in revised form 17 May 2006; accepted 30 May 2006 Available online 6 June 2006

Abstract

Vitamin K (K) is an essential factor for the posttranslational modification of blood coagulation factors as well as proteins in the bone matrix (Gla proteins). It is known that K is not only distributed in the liver and bones but also abundantly distributed in the brain, kidney, and gonadal tissues. However, the role of K in these tissues is not well clarified. In this study, we used DNA microarray and identified the genes whose expression was affected in the testis under the K-deficient (K-def) state. The expression of genes involved in the biosynthesis of cholesterol and steroid hormones was decreased in the K-def group. The mRNA levels of Cyp11a – a rate-limiting enzyme in testosterone synthesis – positively correlated with the menaquinone-4 (MK-4) concentration in the testis. Moreover, as compared to the control (Cont) and K-supplemented (K-sup) groups, the K-def group had decreased testosterone concentrations in the plasma and testis. These results suggested that K is involved in steroid production in the testis through the regulation of Cyp11a. © 2006 Elsevier B.V. All rights reserved.

Keywords: Vitamin K; Testis; Testosterone; Steroidogenesis; Cyp11a

1. Introduction papers have reported that K is not only distributed in the liver and bone tissues but also distributed abundantly in the brain and Vitamin K (K) is an essential factor for maintaining blood gonadal tissues [3–5]. Some amount of the K present in the coagulation and bone metabolism in mammals [1,2]. There are brain and gonadal tissues may play a role in the process of two types of naturally occurring K, namely, phylloquinone (K1) protein γ-carboxylation. However, it has been suggested that K and menaquinone (MK-n or K2). K1 is synthesized in plants and might have some functions other than those known thus far has a phytyl side chain at position 3 of 2-methyl naphthoqui- because the GGCX enzymatic activity and the amount of none. K2 is mainly produced by microorganisms and has a long substrates for GGCX in the brain and gonadal tissues are isoprenyl side chain (n=4–15). It is well known that both K1 considerably lower than those in the liver and bones. Recently, and K2 function as cofactors of the K-dependent carboxylase K has been reported to have other functions that are not related (γ-glutamyl carboxylase, GGCX) that converts the glutamic to protein γ-carboxylation. For example, menaquinone-4 (MK- acid residues in the blood coagulation factors and proteins in the 4), which is one of the K2s, inhibits osteoclast differentiation bone matrix into γ-carboxyglutamic acid (Gla) [2]. Several [6–11] and induces apoptosis in osteoclasts [7,12] and tumor- derived cells [13–16]. On the other hand, it inhibits apoptosis in human osteoblasts [17] and neuronal cells induced by oxidative ⁎ Corresponding author. Tel.: +81 22 717 8812; fax: +81 22 717 8813. stress [18]. Furthermore, MK-4 functions as a ligand for the E-mail address: [email protected] (H. Shirakawa). nuclear receptor SXR and regulates the expression of certain 1 These authors have equally contributed to this work. genes [19].

In this study, we identified genes with altered expressions in K1 and MK-4 concentrations were determined by measuring the relative the K-deficient (K-def) state in the testis. In rats, the testis is one fluorescent intensity using menaquinone-3 (Eisai, Japan) as an internal standard [3]. of the organs that has almost the same K concentration as that in the liver [5]. Therefore, we hypothesized that the K-def state 2.3. RNA preparation and DNA microarray experiment directly influences gene expression in the testis. In the screening using the DNA microarray technique, the K-def group showed Total RNA was isolated from the whole testis by using the guanidine– decreased levels of mRNA encoding cholesterol and steroid isothiocyanate based-reagent Isogen (Nippon Gene, Japan) according to the synthesis enzymes. Furthermore, the mRNA levels of Cyp11a – instruction manual. In each dietary group, equivalent amounts of RNA from μ a rate-limiting enzyme in steroid hormone synthesis – positively individual animals were pooled, and 10 g of the pooled RNA was used as a template to synthesize cDNA that was then hybridized with probes on a DNA correlated with the K concentrations (MK-4 concentrations) in microarray. RNA was denatured with oligo-dT (2 μg, Amersham Biosciences, the testis. In addition, the testosterone concentration in the testis UK) at 65 °C for 5 min and then incubated in 50 mM Tris–HCl (pH 8.3); 75 mM and plasma was significantly decreased in the K-def group when KCl; 2.5 mM MgCl2; 10 mM dithiothreitol (DTT) containing 1 mM dATP, compared with those in the control (Cont) and MK-4- dGTP, and TTP; 200 units of SuperscriptII reverse transcriptase (Invitrogen, α 33 supplemented (MK-4-sup) groups. These results suggest that Carlsbad, CA); 60 units of RNaseOUT RNase inhibitor (Invitrogen); and - P dCTP (1.85 MBq, 110 TBq/mmol, Amersham Biosciences) at 42 °C for 50 min. K could participate in normal steroid hormone production in the After the cDNA synthesis, free nucleotides were separated using a BioRad gel testis and that K has additional functions that are not related to filtration spin column (Hercules, CA). Labeled cDNAs were hybridized to the protein γ-carboxylation. GeneFilter membrane (Research Genetics, Huntsville, AL) in the ExpressHyb hybridization solution (Clontech, Palo Alto, CA) containing mouse Cot-1 DNA 2. Materials and methods (1 μg/ml, Invitrogen) for 16 h at 65 °C. Following hybridization, the filters were washed according to GeneFilter's instruction manual, exposed to a Fuji imaging 2.1. Animals and diets plate (Fuji Photo Film, Japan), and then analyzed using a Bioimage analyzer FLA-2000 (Fuji Photo Film). K-def diet was obtained from Harlan-Teklad (Madison, WI, CAT

#TD97053). Cont and K1-supplemented (K1-sup) diets were prepared by 2.4. Quantitative RT-PCR adding K1 (Eisai, Japan) to the K-def diet (final concentrations of 0.75 and 75 mg/kg diet, respectively). In addition, MK-4-sup diet was prepared by adding For cDNA synthesis, 2 μg of total RNA was used as a template. RNA was MK-4 (Eisai, Japan) to the K-def diet (final concentration of 75 mg/kg diet). All incubated in RT buffer (50 mM Tris–HCl pH 8.3, 75 mM KCl, and 5 mM DTT) diets were sterilized by irradiation with γ-rays (50 k Gy). containing 50 units of SuperscriptIII reverse transcriptase, 40 units of Germ-free rats were originally obtained from the ALA Research Center RNaseOUT RNase inhibitor, 1 mM dNTP, and 1 μg of oligo-dT at 50 °C for (Yokohama, Japan) and self bred. The animals (male, 10–12 weeks of age) were 50 min. An aliquot of cDNA was used as a template for quantitative PCR using housed at 23 °C±2 °C under a 12:12 light:dark cycle (lights switched on at Applied Biosystems Sequence Detection System 7000 (Foster City, CA). The 8:00 AM) in a sterilized plastic isolator and fed the experimental diets for 9 days. gene specific primers that are listed in Table 1 were used for the amplification of Stool examinations for aerobic and anaerobic bacteria, parasites, and fungi were certain cDNAs using the Syber Premix Ex Taq solution (Takara Bio, Japan). The negative both before and after the experiment. DNA fragments amplified by each primer set were confirmed by DNA The experimental plan of the present study was approved by the Animal sequencing. The relative expression level of each mRNA was normalized by Research-Animal Care Committee of the Graduate School of Agricultural using the glyceraldeyde-3-phosphate dehydrogenase mRNA level. Science, Tohoku University. The entire experiment was performed under the guidelines framed by this committee in accordance with the Japanese 2.5. Western blot analysis governmental legislation (1980). The same committee supervised the care and use of the rats in this study. The testis was homogenized in 5 volumes of phosphate-buffered saline and centrifuged at 12,000×g at 4 °C for 5 min. The collected supernatant was 2.2. HPLC measurement of the K content in the testis denatured in sodium dodecyl sulfate (SDS) gel loading buffer (62.5 mM Tris–HCl pH 6.8, 2% SDS, 50 mM DTT, and 6% glycerol, final) and Tissue samples were homogenized in 5 volumes of 66% 2-propanol. K electrophoresed on a 12.5% SDS-polyacrylamide gel. The protein bands were was extracted from the homogenate by using 6 volumes of n-hexane, as transferred onto Immobilon-P membranes (Millipore, Billerica, MA). After previously described [3], and measured using a fluorescence-HPLC system blocking in TBS-T (10 mM Tris–HCl pH 7.4, 150 mM NaCl, and 0.1% (Waters 600E system; Puresil 5C18 column, Waters, Milford, MA; RC 10-3 Tween 20) containing 5% dried milk, the membranes were reacted with anti-

PtO2 column, IRICA, Japan; Hitachi F-1000 fluorescence detector, excitation rat Cyp11a antibody (1/5000 dilution in TBS-T containing 5% dried milk, at 240 nm, emission at 430 nm; Hitachi D-2000 data processor, Japan). The Chemicon, Temecula, CA) for 1 h at room temperature, washed, and

Table 1 Oligonucleotide sequences that were used as PCR primers in this study Gene name Genbank Forward Reverse accession no. Farnesyltransferase α-subunit M81225 CGGCTGGAAGAAGTGGACAA ACCTGGACAACGTTAGCTCACA Rab geranylgeranyl transferase α-subunit L10415 ACCTGGCTCACAAGGATCTCA GGCCTGCAGCACCTCAAG HMG-CoA reductase M29249 AATTGTGTGTGGCACTGTGATG GATCTGTTGTGAACCATGTGACTTCT Mevalonate diphosphate decarboxylase U53706 CTGCTGCGAATGGAGACAAG GCTCCGTAGCCAGCGAAGT Oxidosqualene cyclase U31352 TGATGGCTGTCAGGCATCC GTGTAGCTGATGGCACAGGACTT Cyp11a AH002151 GAGAAGCCTATCTTCTTCAACTTCCA TGCAGCCTGCAATTCATACAGT γ-Glutamyl carboxylase BC060553 CTGCTCCCGCCTCAGATAAAG GGATAAATCTGCCCATTCAAACC Vitamin K epoxide reductase complex, NM203335 GCTGGTGGAGCATGTGTTAGG ACGTCCCCTCAAGCAACCT subunit 1 1484 H. Shirakawa et al. / Biochimica et Biophysica Acta 1760 (2006) 1482–1488 incubated with anti-rabbit IgG peroxidase conjugate (0.16 μg/ml in TBS-T containing 5% dried milk, Pierce, Rockford, IL) for another 1 h. The bound antibodies were detected using the ECL Plus western blotting detection reagent (Amersham Bioscience).

2.6. Measurement of testosterone and luteinizing hormone

The testosterone concentrations in the plasma and the whole testis were determined by using an ELISA kit purchased from Cayman Chemical (Ann Arbor, MI). The sample was prepared according to the manufacturer's instruction manual. In brief, testosterone from the plasma and testis lysate was extracted twice in 5 volumes of diethyl ether. After extraction, the organic phase was collected by centrifugation at 1500×g for 5 min and evaporated in a vacuum centrifugal evaporator. The extract was resuspended in an adequate volume of EIA buffer that was supplied in the kit. The luteinizing hormone (LH) γ concentration in the plasma was determined by using a rodent LH ELISA test kit Fig. 1. Comparison of the mRNA levels of -glutamyl carboxylase (GGCX) and purchased from Endocrine Technologies (Newark, CA). vitamin K epoxide reductase complex 1 (VKORC1) in different tissues. Total RNA was isolated from the liver, testis, and brain of conventional Wistar male 2.7. Statistical analysis rats fed with a commercial chow diet. The mRNA levels of GGCX and VKORC1 were measured using the quantitative RT-PCR method, as described in Materials and methods, and expressed as a fold of liver values. The data are The results are expressed as mean±SD (Table 2) or mean±SEM (Figs. 1, 2, expressed as mean±SEM, n=3. Values with different superscript letters are and 4–6). The data were analyzed statistically by one-way ANOVA, and significantly different at P < 0.05. multiple comparisons were performed by using Scheffé's test. The correlation between the Cyp11a mRNA level and the MK-4 concentration in the testis was analyzed by using Spearman's rank correlation test (Fig. 3). (VKORC1), one of the K cycle enzymes, in conventional Wistar rats that were fed a commercial chow diet. Both the GGCX and VKORC1 mRNAs were detected; however, the 3. Results and discussion expression levels of these mRNAs in the testis as well as the brain were considerably lower than those in the liver (Fig. 1). It 3.1. Influence of K-def diet on the K level in the testis has been reported that although the K levels (particularly MK-4) in the brain are as high as those in the liver, the enzyme After the rats were fed with experimental diets for 9 days, activities of GGCX and VKOR in the brain are extremely low as they were sacrificed and their tissue samples were collected. compared to those in the liver [18]. Therefore, testicular K could Symptoms of K deficiency were observed in the K-def group be mainly involved in some of the cellular functions of the animals; their blood coagulation time (prothrombin time and testis, for example, regulation of gene expression [19] or activated partial thromboplastin time) was significantly pro- stimulation of cAMP dependent kinase [20], rather than protein longed [36]. No differences in the weight of the organs, γ-glutamyl carboxylation. including the testis, were observed among the groups (data not Although K1 was the major source of dietary K in the K-def, shown). To analyze the influence of the dietary K content on the in the Cont and K1-sup groups, MK-4 was the most abundant K level in the testis, we measured the testicular K content by type of K found in the testis (K-def group, 99.4%; Cont group, using fluorescence HPLC. The result obtained is shown in Table 99.5%; and K1-sup group, 94.7%). Several studies, including 2. No menaquinone analogues, with the exception of MK-4, our previous research, have demonstrated that orally admini- were detected in the testis because all the rats that were fed with strated K1 is a source of MK-4 distributed in the testis, brain, the semi-purified experimental diets lacked intestinal flora. No pancreas, and kidney. Conversion of K1 into MK-4 was menaquinone analogues were detected in the commercially observed not only in animals but also in humans [3,21–28]. purchased K-def diet (data not shown). Since the total MK-4 appears to be an activated form of K, similar to the concentration of K (K1 and MK-4) was the lowest in the K- activated forms found in the metabolism of other vitamins (A def group, it was evident that the dietary K content strongly and D); however, the physiological significance of MK-4 influenced the testicular K level. In order to prove the conversion has not been elucidated thus far. hypothesis that a large amount of K may function as a cofactor for GGCX in the testis, we measured the mRNA levels of 3.2. Reduced expression of genes involved in cholesterol GGCX and vitamin K epoxide reductase complex subunit 1 synthesis and steroidogenesis in the testis in the K-def state

Table 2 We analyzed gene expression in the testis by using DNA Vitamin K1 (K1) and menaquinone-4 (MK-4) concentrations in the testis microarray to clarify the physiological significance of MK-4

K-def Cont K1-sup MK-4-sup synthesis in the testis. On comparing the gene expression a a b a profiles of the K-def and K1-sup groups, the K-def group was K1 0.2±0.3 0.6±0.8 40.9±13.6 1.7±2.0 MK-4 107.8±31.0a 136.6±9.5a 722.8±106.3b 658.9±151.9b found to have decreased expression of genes involved in Total K 108.0±31.3a 137.2±10.2a 763.7±117.3b 660.7±153.9b cholesterol/steroid synthesis and isoprenoid metabolism (Table Mean±SD (pmol/g tissue), n=5–15. Means in rows with different superscript 3). In order to confirm the differences in the expression levels, letters are significantly different at P<0.01. we measured the mRNA levels of these genes in all experimental H. Shirakawa et al. / Biochimica et Biophysica Acta 1760 (2006) 1482–1488 1485

Fig. 2. Decreased levels of mRNAs encoding enzymes involved in steroidogenesis and isoprenoid metabolism in the testis of the K-def group. Each mRNA level was measured using the quantitative RT-PCR method, as described in Materials and methods, and expressed as a fold of the Cont group values. Panel A: HMG-CoA reductase (Hmgcr), mevalonate diphosphate decarboxylase (Mvd), and oxidosqualene cyclase (Osc); panel B: farnesyltransferase α-subunit (Fnta), Rab geranylgeranyltransferase α-subunit (Rabggta); and panel C: Cyp11a (cholesterol side chain cleavage enzyme). The data are expressed as mean±SEM, n=4–10. Values with different superscript letters are significantly different at P<0.05. groups by using the quantitative RT-PCR method. When Protein prenylation is one of the mechanisms for membrane compared with the Cont and both the K-sup groups, the K-def association of cytoplasmic proteins. The modification is group had decreased levels of mRNA encoding mevalonate catalyzed by protein prenyltransferases; farnesyltransferase diphosphate decarboxylase (Mvd), oxidosqualene cyclase (Fnt), geranylgeranyltransferase type I (Ggt), and Rab ger- (Osc), farnesyltransferase α-subunit (Fnta), and Rab geranyl- anylgeranyltransferase (Rabggt) [29]. These enzymes are geranyltransferase α-subunit (Rabggta) (Fig. 2A and B); these heterodimers consisting of an α- and a β-subunit. Fnt and Ggt results corresponded with that of the DNA microarray analyses. share a common α-subunit and modify proteins that are In addition, the K-def group had decreased levels of mRNA involved in intracellular signaling, cell proliferation, and the encoding HMG-CoA reductase (Hmgcr), a rate-limiting enzyme cell cycle. On the other hand, the substrates of Rabggt (Rab in cholesterol synthesis. Therefore, it appears that the K-def state GTPases) participate in vesicle formation and movement. Lau et affects the cholesterol synthesis and isoprenoid metabolism in al. demonstrated that Rab8b, a Rab GTPase, associated with the the testis. cadherin–catenin complex, which is an adherence junction

Table 3

Downregulated genes in the K-def group when compared with the K1-sup group

Accession no. Gene name K1-sup/K-def AA998854 Acyl-coenzyme A: Cholesterol acyltransferase 3.73 AA818329 Cyp11a (cholesterol side chain cleavage 1.94 enzyme) AI070588 Farnesyltransferase α-subunit 1.77 AI058569 Mevalonate diphosphate decarboxylase 3.08 AA997956 Oxidosqualene cyclase (Lanosterol synthase) 1.76 AI071807 Rab geranylgeranyltransferase α-subunit 17.65 AI029123 Rab geranylgeranyltransferase β-subunit 2.53 AA957963 Rab GDIβ 5.17 Fig. 3. A positive relationship between the menaquinone-4 concentrations and AI072276 Ras-related protein (rad) 9.17 the relative expression levels of Cyp11a mRNA in the testis of the K-def (open AA964948 Steroid 3α-dehydrogenase 1.94 circle) and Cont (closed circle) groups. 1486 H. Shirakawa et al. / Biochimica et Biophysica Acta 1760 (2006) 1482–1488

activated NFκB was likely to be the result of competition between NFκB subunit p65 and the coactivators for binding to Nur77 in rat Leydig cells [34]. The signal transduction pathway leading to the NFκB activation is inhibited by protein kinase A. Otsuka et al. showed that MK-4 inhibits the proliferation and invasiveness of hepatocellular carcinoma via the stimulation of protein kinase A [20]. Therefore, MK-4 might contribute to the maintenance of Cyp11a mRNA levels by inhibiting the NFκB pathway in the testis. A similar inhibitory effect might be found in other studies that have reported that K could suppress the expression of the inflammatory cytokine interleukine-6 (IL-6) induced by lipopolysaccharide (LPS) administration in human fibroblasts [35], macrophagic cells, and rats [36]. Stimulation of IL-6 expression in LPS-treated cells is due to the activation of NFκB.

3.3. Influence of hepatic gene expression involved in Fig. 4. Decrease in the Cyp11a protein level in the testis of the K-def group. cholesterol synthesis Testicular Cyp11a protein was measured by western blot analysis, as described in Materials and methods. The whole testis lysate (10 μg) was separated on a 12.5% SDS-polyacrylamide gel and blotted on a PVDF membrane, and Cyp11a Hmgcr, Osc, Mvd, and prenyltransferase play fairly was then detected using anti-rat Cyp11a antibody (panel A). β-Actin was used important roles in hepatic metabolism. As mentioned above, as the loading control. Panel B: the data are expressed as mean±SEM, n=3–5. the expression of these genes was downregulated in the testis of Values with different superscript letters are significantly different at P<0.05. the K-def group. However, no difference was observed among the groups with regard to the mRNA levels in the liver (Fig. 5). functional unit of Sertoli cells in the testis. They suggested that This suggests that K does not directly affect the change in the this interaction could be involved in the deassembly and expression level of these genes in the testis. The expression of reassembly of adherence junctions during the movement of genes encoding enzymes involved in cholesterol synthesis is germ cells across the seminiferous epithelium [30]. Compared to the other groups, the K-def group showed decreased levels of mRNAs encoding both the Fnt and Raggt α-subunits (Fig. 2B). Therefore, lowering of these mRNA levels in the K-def state may result in the inactivation of prenyltransferase and affect testis maturation and spermatogenesis. In the microarray experiment, no differences were observed between the K-def and K1-sup groups with regard to expression of genes involved in testosterone synthesis, with the exception of Cyp11a. The mitochondrial enzyme Cyp11a, also referred to as the cholesterol side chain cleavage enzyme, is a rate-limiting enzyme in testosterone synthesis; it catalyzes the production of pregnenolone from cholesterol. Compared with both the K-sup groups, the K-def group showed a significantly decreased Cyp11a mRNA level (Fig. 2C). In the testis of the K-def and Cont groups, the relative expression of Cyp11a mRNA correlated with the MK-4 levels (R2 =0.7413, P<0.01, Fig. 3). Furthermore, when compared with the Cont and both the K- sup groups, the K-def group had a significantly decreased Cyp11a protein level (Fig. 4). Cyp11a expression in the testis is stimulated by the nuclear receptor steroidogenic factor-1 (SF-1), the orphan receptor Nur77, and the cAMP signal cascade via the luteinizing hormone receptor (LHR). SF-1 is an essential factor for steroid hormone synthesis [31–33]. No difference was Fig. 5. Measurement of the levels of mRNAs encoding enzymes involved in observed among the groups with respect to the levels of mRNAs steroidogenesis and isoprenoid metabolism in the liver. Each mRNA level was encoding SF-1, Nur77, LHR, and tumor necrosis factor (TNF) measured using the quantitative RT-PCR method, as described in Materials and receptor in the testis (data not shown). On the other hand, the methods, and expressed as a fold of the Cont group values. Panel A: HMG-CoA α reductase (Hmgcr), mevalonate diphosphate decarboxylase (Mvd), and proinflammatory cytokine TNF represses the expression of oxidosqualene cyclase (Osc); panel B: farnesyltransferase α-subunit (Fnta) Cyp11a mRNA through the activation of the NFκB signal and Rab geranylgeranyltransferase α-subunit (Rabggta). The data are expressed cascade [34]. The inhibition of Nur77 transactivation by as mean±SEM, n=4–10. H. Shirakawa et al. / Biochimica et Biophysica Acta 1760 (2006) 1482–1488 1487

This is the first study that has demonstrated reduced testosterone production in the K-def state. The change in the production level of the sex hormone is one of the pathogenic factors of age-related diseases such as cancer, osteoporosis, and atherosclerosis. Osteoporosis occurs due to a decrease in the estrogen production in postmenopausal women. However, decreased testosterone level in the blood is frequently observed in older males and is considered as one of the pathogenic markers of osteoporosis [39,40]. Furthermore, it has been reported that some elderly individuals were in a subclinical state of K deficiency when their K status was evaluated using the level of serum undercarboxylated osteocalcin [41]. MK-4 is prescribed as a therapeutic and preventive agent against osteoporosis because it increases the bone mass by acting directly on both osteoblasts and osteoclasts. In addition to this fact, K can maintain normal testosterone production in the testis thereby preventing osteoporosis in older males. Recently, it has been reported that MK-4 binds and enhances the enzymatic activity of 17β- hydroxysteroid dehydrogenase 4 (17β-HSD4) in the human hepatoma cell line HepG2 [42]. The expression of the 17β- HSD4 gene is found in not only the liver but also the kidney, ovary, and testis. 17β-HSD4 catalyzes the conversion of estradiol and 5-androstene-3β,17β-diol to estrone and dehy- droepiandrosterone, respectively. On the other hand, testoster- Fig. 6. Reduction in the plasma and testis testosterone levels in K-def rats. Testosterone in the plasma and testis was extracted using diethyl ether and one and other androgens are not the substrates for this measured by ELISA (panel A). Plasma luteinizing hormone was measured by enzyme [43]. Although 17β-HSD4 does not directly partici- ELISA (panel B). The data are expressed as mean±SEM, n=5–12, plasma; pate in the inactivation process of testosterone, the alteration n=5, testis. Values with different superscript letters are significantly different of the enzymatic activity of 17β-HSD4 by MK-4 may at P<0.05. influence the entire process of steroidogenesis in the testis. Therefore, by combining our present results, we conclude that mainly regulated by the sterol responsive element binding K has the potential to modulate the steroid hormone levels in proteins (SREBPs) [37,38]. SREBPs interact with the intracel- cells and organs. lular cholesterol sensor protein SREBP cleavage-activating In conclusion, we found that the testosterone production in protein (SCAP) and are activated by low cholesterol levels. the testis decreases in the K-def state through decreased Cyp11a Since testosterone production is decreased by the down- expression. K, particularly MK-4 (one of the K2 analogues that regulation of Cyp11a activity in the K-def state, the consump- was abundantly detected in the testis) contributes to the tion of cholesterol is restrained in the testis. Therefore, surplus maintenance of the normal testosterone production in the rat cholesterol may inhibit SREBP activation and reduce the testis. This mechanism is still unclear; however, further expression of genes involved in cholesterol synthesis (Hmgcr). experiments would increase our understanding of the relationship between the K status and diseases, particularly lifestyle- 3.4. Reduced testosterone concentration in the testis and related diseases such as osteoporosis. plasma in the K-def state Acknowledgements We measured the plasma and testis testosterone concentrations because the Cyp11a mRNA and protein levels had This work was partially supported by a Grant-in-Aid for significantly decreased in the K-def group when compared with Scientific Research from the Japan Society for the Promotion of those in the Cont and MK-4-sup groups. The testosterone Science and by the Mishimakaiun Foundation. concentrationinboththetestis and plasma was also significantly decreased in the K-def group when compared References with that in the MK-4-sup group (Fig. 6A). Testosterone synthesis in the testis is mainly regulated by pituitary luteinizing [1] J.W. Suttie, Synthesis of vitamin K-dependent proteins, FASEB J. 7 (1993) hormone (LH). However, no significant difference was 445–452. observed in the plasma LH level among the groups (Fig. 6B). [2] S.M. Wu, T.B. Stanley, V.P. Mutucumarana, D.W. Stafford, Characteriza- tion of the γ-glutamyl carboxylase, Thromb. Haemostasis 78 (1997) These results suggest that testosterone production is directly 599–604. influenced by the testicular K (MK-4) levels, and K participates [3] R. Yamamoto, M. Komai, K. Kojima, Y. Furukawa, S. Kimura, in the regulation of Cyp11a gene expression. Menaquinone-4 accumulation in various tissues after an oral administration 1488 H. Shirakawa et al. / Biochimica et Biophysica Acta 1760 (2006) 1482–1488

of phylloquinone in Wistar rats, J. Nutr. Sci. Vitaminol. (Tokyo) 43 (1997) [21] M. Billeter, C. Martius, About the conversion of phylloquinone (vitamin 133–143. K1) in to vitamin K2(20) in animal tissue, Biochem. Z. 333 (1960) 430–439. [4] J.E. Ronden, H.H. Thijssen, C. Vermeer, Tissue distribution of K-vitamers [22] S. Kimura, H. Satoh, M. Komai, The roles of intestinal flora and intestinal under different nutritional regimens in the rat, Biochim. Biophys. Acta function on vitamin K metabolism, J. Nutr. Sci. Vitaminol. (Tokyo) Suppl. 1379 (1998) 16–22. (1992) 425–428. [5] A.M. Huber, K.W. Davidson, M.E. O'Brien-Morse, J.A. Sadowski, [23] B.H. Will, Y. Usui, J.W. Suttie, Comparative metabolism and requirement Tissue phylloquinone and menaquinones in rats are affected by age and of vitamin K in chicks and rats, J. Nutr. 122 (1992) 2354–2360. gender, J. Nutr. 129 (1999) 1039–1044. [24] H.H. Thijssen, M.J. Drittij-Reijnders, Vitamin K distribution in rat tissues: [6] Y. Akiyama, K. Hara, T. Tajima, S. Murota, I. Morita, Effect of vitamin K2 dietary phylloquinone is a source of tissue menaquinone-4, Br. J. Nutr. 72 (menatetrenone) on osteoclast-like cell formation in mouse bone marrow (1994) 415–425. cultures, Eur. J. Pharmacol. 263 (1994) 181–185. [25] H.H. Thijssen, M.J. Drittij-Reijnders, M.A. Fischer, Phylloquinone and [7] T. Kawata, J.H. Zernik, T. Fujita, C. Tokimasa, K. Tanne, Mechanism in menaquinone-4 distribution in rats: synthesis rather than uptake determines inhibitory effects of vitamin K2 on osteoclastic bone resorption: in vivo menaquinone-4 organ concentrations, J. Nutr. 126 (1996) 537–543. study in osteopetrotic (op/op) mice, J. Nutr. Sci. Vitaminol. (Tokyo) 45 [26] J.E. Ronden, M.J. Drittij-Reijunders, C. Vermeer, H.H. Thijssen, Intestinal (1999) 501–507. flora is not an intermediate in the phylloquinone–menaquinone-4

[8] Y. Takeuchi, M. Suzawa, S. Fukumoto, T. Fujita, Vitamin K2 inhibits conversion in the rat, Biochim. Biophys. Acta 1379 (1998) 69–75. adipogenesis, osteoclastogenesis, and ODF/RANK ligand expression in [27] R.T. Davidson, A.L. Foley, J.A. Engelke, J.W. Suttie, Conversion of murine bone marrow cell cultures, Bone 27 (2000) 769–776. dietary phylloquinone to tissue menaquinone-4 in rats is not dependent on [9] Y. Koshihara, K. Hoshi, R. Okawara, H. Ishibashi, S. Yamamoto, Vitamin gut bacteria, J. Nutr. 128 (1998) 220–223. K stimulates osteoblastogenesis and inhibits osteoclastogenesis in human [28] H.H. Thijssen, H.J. Drittij, C. Vermeer, E. Schoffelen, Menaquinone-4 in bone marrow cell culture, J. Endocrinol. 176 (2003) 339–348. breast milk is derived from dietary phylloquinone, Br. J. Nutr. 87 (2002) [10] H. Taira, Y. Fujikawa, O. Kudo, I. Itonaga, T. Torisu, Menatetrenone 219–226. (vitamin K2) acts directly on circulating human osteoclast precursors, [29] S. Maurer-Stroh, S. Washietl, F. Eisenhaber, Protein prenyltransferases, Calcif. Tissue Int. 73 (2003) 78–85. Genome Biol. 4 (2003) 212. [11] Y. Hiruma, K. Nakahama, H. Fujita, I. Morita, Vitamin K2 and [30] A.S. Lau, D.D. Mruk, Rab8B GTPase and junction dynamics in the testis, geranylgeraniol, its side chain component, inhibited osteoclast formation Endocrinology 144 (2003) 1549–1563. in a different manner, Biochem. Biophys. Res. Commun. 314 (2004) [31] KL. Parker, Y. Ikeda, X. Luo, The roles of steroidogenic factor-1 in 24–30. reproductive function, Steroids 61 (1996) 161–165. [12] T. Kameda, K. Miyazawa, Y. Mori, T. Yuasa, M. Shiokawa, Y. Nakamaru, [32] X. Luo, Y. Ikeda, D. Lala, D. Rice, M. Wong, KL. Parker, Steroidogenic H. Mano, Y. Hakeda, A. Kameda, M. Kumegawa, Vitamin K2 inhibits factor 1 (SF-1) is essential for endocrine development and function, osteoclastic bone resorption by inducing osteoclast apoptosis, Biochem. J. Steroid Biochem. Mol. Biol. 69 (1999) 13–18. Biophys. Res. Commun. 220 (1996) 515–519. [33] P. Jeyasuria, Y. Ikeda, S.P. Jamin, L. Zhao, D.G. De Rooij, A.P. Themmen, [13] M. Yaguchi, K. Miyazawa, M. Otawa, T. Katagiri, J. Nishimaki, Y. Uchida, R.R. Behringer, K.L. Parker, Cell-specific knockout of steroidogenic factor O. Iwase, A. Gotoh, Y. Kawanishi, K. Toyama, Vitamin K2 selectively 1 reveals its essential roles in gonadal function, Mol. Endocrinol. 18 (2004) induces apoptosis of blastic cells in myelodysplastic syndrome: flow 1610–1619. cytometric detection of apoptotic cells using APO2.7 monoclonal [34] C.Y. Hong, J.H. Park, R.S. Ahn, S.Y. Im, H.S. Choi, J. Soh, S.H. Mellon, antibody, Leukemia 12 (1998) 1392–1397. K. Lee, Molecular mechanism of suppression of testicular steroidogenesis [14] K. Miyazawa, M. Yaguchi, K. Funato, A. Gotoh, Y. Kawanishi, Y. by proinflammatory cytokine tumor necrosis factor alpha, Mol. Cell. Biol. Nishizawa, A. You, K. Ohyashiki, Apoptosis/differentiation-inducing 24 (2004) 2593–2604. effects of vitamin K2 on HL-60 cells: dichotomous nature of vitamin K2 in [35] K. Reddi, B. Henderson, S. Meghji, M. Wilson, S. Poole, C. Hopper, M. leukemia cells, Leukemia 15 (2001) 1111–1117. Harris, S.J. Hodges, Interleukin 6 production by lipopolysaccharide- [15] T. Shibayama-Imazu, S. Sakairi, A. Watanabe, T. Aiuchi, S. Nakajo, K. stimulated human fibroblasts is potently inhibited by naphthoquinone

Nakaya, Vitamin K2 selectively induced apoptosis in ovarian TYK-nu and (vitamin K) compounds, Cytokine 7 (1995) 287–290. pancreatic MIA PaCa-2 cells out of eight solid tumor cell lines through a [36] Y. Ohsaki, H. Shirakawa, K. Hiwatashi, Y. Furukawa, T. Mizutani, M. mechanism different from geranylgeraniol, J. Cancer Res. Clin. Oncol. 129 Komai, Vitamin K suppresses lipopolysaccharide-induced inflammation in (2003) 1–11. the rat, Biosci. Biotechnol. Biochem. 70 (2006) 926–932. [16] T. Yoshida, K. Miyazawa, I. Kasuga, T. Yokoyama, K. Minemura, K. [37] R.G. Anderson, Joe Goldstein and Mike Brown: from cholesterol Ustumi, M. Aoshima, K. Ohyashiki, Apoptosis induction of vitamin K2 in homeostasis to new paradigms in membrane biology, Trends Cell Biol. lung carcinoma cell lines: the possibility of vitamin K2 therapy for lung 13 (2003) 534–539. cancer, Int. J. Oncol. 23 (2003) 627–632. [38] L.W. Weber, M. Boll, A. Stampfl, Maintaining cholesterol homeostasis: [17] S. Urayama, A. Kawakami, T. Nakashima, M. Tsuboi, S. Yamasaki, A. sterol regulatory element-binding proteins, World J. Gastroenterol. 10 Hida, Y. Ichinose, H. Nakamura, E. Ejima, T. Aoyagi, T. Nakamura, K. (2004) 3081–3087. Migita, Y. Kawabe, K. Eguchi, Effect of vitamin K2 on osteoblast [39] J.S. Finkelstein, A. Klibanski, R.M. Neer, S.L. Greenspan, D.I. Rosenthal, apoptosis: vitamin K2 inhibits apoptotic cell death of human osteoblasts W.F. Crowley Jr., Osteoporosis in men with idiopathic hypogonadotropic induced by Fas, proteasome inhibitor, etoposide, and staurosporine, J. Lab. hypogonadism, Ann. Intern. Med. 106 (1987) 354–361. Clin. Med. 136 (2000) 181–193. [40] C. Alexandre, Androgens and bone metabolism, Jt Bone Spine 72 (2005) [18] J. Li, J.C. Lin, H. Wang, J.W. Peterson, B.C. Furie, B. Furie, S.L. Booth, 202–206. J.J. Volpe, P.A. Rosenberg, Novel role of vitamin K in preventing oxidative [41] N.C. Binkley, D.C. Krueger, J.A. Engelke, A.L. Foley, J.W. Suttie, Vitamin injury to developing oligodendrocytes and neurons, J. Neurosci. 23 (2003) K supplementation reduces serum concentrations of under-gamma- 5816–5826. carboxylated osteocalcin in healthy young and elderly adults, Am. J. [19] M.M. Tabb, A. Sun, C. Zhou, F. Grun, J.L. Errandi, K.M. Romero, H. Clin. Nutr. 72 (2000) 1523–1528. Pham, S. Inoue, S. Mallick, M. Lin, B.M. Forman, B. Blumberg, Vitamin [42] M. Otsuka, N. Kato, T. Ichimura, S. Abe, Y. Tanaka, H. Taniguchi, Y.

K2 regulation of bone homeostasis is mediated by the steroid and Hoshida, M. Moriyama, Y. Wang, R.-X. Shao, D. Narayan, R. Muroyama, xonobiotic receptor, SXR, J. Biol. Chem. 278 (2003) 43919–43927. F. Kanai, T. Kawabe, T. Isobe, M. Omata, Vitamin K2 binds 17β- [20] M. Otsuka, N. Kato, R.X. Shao, Y. Hoshida, H. Ijichi, Y. Koike, H. hydroxysteroid dehydrogenase 4 and modulates estrogen metabolism, Life Taniguchi, M. Moriyama, Y. Shiratori, T. Kawabe, M. Omata, Vitamin K2 Sci. 76 (2005) 2473–2482. inhibits the growth and invasiveness of hepatocellular carcinoma cells via [43] R. Mindnich, G. Möller, J. Adamski, The role of 17 beta-hydroxysteroid protein kinase A activation, Hepatology 40 (2004) 243–251. dehydrogenases, Mol. Cell. Endocrinol. 218 (2004) 7–20.