DOCSLIB.ORG

LEADING ARTICLE Constitutive Activation of Mitogen-Activated

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
LEADING ARTICLE Constitutive Activation of Mitogen-Activated Leukemia (1997) 11, 479–484 1997 Stockton Press All rights reserved 0887-6924/97 $12.00 LEADING ARTICLE Constitutive activation of mitogen-activated protein kinase pathway in acute leukemia cells M Towatari1, H Iida1, M Tanimoto1, H Iwata2, M Hamaguchi2 and H Saito1 1First Department of Internal Medicine, and 2Laboratory of Molecular Pathogenesis, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Japan Mitogen-activated protein (MAP) kinase appears to be one of c-Raf protein kinase; Raf has been shown to phosphorylate the key regulators of cell proliferation and differentiation. Very and activate MAPK kinase (MAPKK), also known as MEK, a little, however, has been revealed as to how MAP kinase is dual specificity kinase that phosphorylates MAPKs on both involved in leukemogenesis. We have studied the activation of 18 the MAP kinase pathway in 100 human primary leukemia cells threonine and tyrosine residues. Recently, it has been shown including 73 acute myelogenous leukemias (AMLs). Forty acute that the activation of MAPKK is necessary and sufficient for leukemia samples (40% of the total), including 37 AML samples PC12 differentiation and for transformation of NIH3T3 (51% of AML), showed activation of MAP kinase as revealed by cells.19,20 Although dysregulation of Ras gene has been the mobility shift of the phosphorylated form of the protein and reported in a variety of human cancers, including leuke- by in vitro kinase assay. This activation was correlated with 21–24 MAP kinase kinase activity in these cells. In contrast, none of mias, little is known concerning the role of this cascade 14 chronic myelogenous leukemia samples showed the acti- in primary human neoplasms. The possible involvement of the vation of MAP kinase. These results suggest that the MAP kin- abnormal activation of these components in the hematopo- ase pathway is constitutively activated in a subset of primary ietic cell transformation has been of interest. The kinases in acute leukemias, and thus indicate the possible role of the the cytoplasm, for example, may work not only as transporters constitutively activated MAP kinase in leukemogenesis. of the signal but also as so-called oncogenes. In the light of Keywords: MAP kinase; MAP kinase kinase; phosphorylation; human leukemia; AML these speculations, we examined the activation of one of the most important pathways for cell proliferation, the MAPK pathway. Here we show the constitutive activation of this pathway in a comparatively large proportion of patients with Introduction acute leukemia. Mitogen-activated protein kinases (MAPKs), also known as extracellular signal-regulated kinases (ERKs),1–5 are serine/ Materials and methods threonine kinases that appear to convert a variety of extra- cellular signals such as growth factors and cytokines to cell Leukemia cells growth or differentiation. MAPKs translocate to the nucleus upon activation6–8 and a number of transcription factors We used 40 fresh heparinized leukemia samples which were including c-jun,9 Elk-1,10 c-myc,11 and NF-IL612 have been separated by Ficoll–Hypaque, washed twice with phosphate- revealed to be phosphorylated and activated by MAPKs. buffered saline (PBS) followed by the extraction of whole cell MAPKs are therefore key kinases in the intracellular signal lysates. The other 60 samples, previously frozen by a con- transduction pathways. trolled-rate freezer to −80°C and stocked in liquid nitrogen, A large number of leukemia-specific cytogenetic abnormali- were subjected to quick thawing and extraction of whole cell ties have been identified and the genes involved cloned.13,14 lysate. The viability was assessed by the trypan blue exclusion Some of them, including receptor abnormalities, appear to test. All acute leukemia samples contained over 90% viable involve the signal transduction pathways, which have drawn blast cells. Hematological malignancies analyzed included 73 attention as another possible mechanism for leukemogenesis; acute myelogenous leukemias (AMLs) (five M0, 16 M1, 20 one such pathway is the receptor tyrosine kinase-mediated M2, 10 M3, 11 M4, 10 M5 and one M6 in the French–Amer- pathway. Mutations of c-fms,15 M-CSF receptor, or c-kit recep- ican-British classification), 13 acute lymphoblastic leukemias tor tyrosine kinase16 have been revealed to activate hemato- (ALLs) (four T-ALL and nine B-lineage ALL), and 14 chronic poietic cell proliferation. A frameshift mutation in the erythro- myelogenous leukemias (CML) (six chronic phase and four poietin receptor was reported in primary familial myeloid/four lymphoid blastic crisis). Whole cell lysates were polycythemia.17 Continuous activation of these cytokine extracted as reported previously.25 Concisely, the cells were receptors activates the shared signal transduction pathways lysed in RIPA buffer (10 mM Tris-HCl, pH 7.5, 0.4 M NaCl, 1% resulting in the constitutive activation of the downstream Nonidet P-40, 0.1% sodium deoxycholate, 0.1% sodium lau- components. The upstream components of MAPK pathway ryl sulfate (SDS), 1 mM EDTA) containing 20 mg/ml aprotinin, contain the GTP-binding protein p21Ras which binds to the 20 mg/ml leupeptin, 1mM benzamidine, 1 mM phenylmethyl- sulfonyl fluoride (PMSF), 3 mM sodium vanadate and 40 mM sodium pyrophosphate. After incubating for 1 h at 4°C, an Correspondence: M Towatari, First Department of Internal Medicine, Nagoya University School of Medicine, Tsurumai-cho 65, Showa-ku, equal volume of RIPA buffer without NaCl was added to the Nagoya 466, Japan extracts followed by centrifugation at 17 000 g for 20 min. The Received 30 September 1996; accepted 11 December 1996 concentration of the lysates was examined by a commercial MAP kinase activation in leukemia M Towatari et al 480 kit (Bio-Rad Protein Assay; Bio-Rad, CA, USA). Equal amount samples examined by comparing freshly prepared with frozen- of the protein was used for Western blotting. thawed MAPK (data not shown). MAPKs (ERKs) are activated when they are phosphorylated at both threonine and tyrosine residues by MEKs,18 and the phosphorylated form of MAPK Western blot analysis migrates slower than its unphosphorylated form due to this gel system.19,25 The activity in each sample was measured by the The SDS polyacrylamide gel for resolving the mobility shift relative intensity of each band estimated by a phosphoimage between the phosphorylated form and unphosphorylated form analyzer (BAS2000, FUJIX, Tokyo, Japan). The relative ratio of of MAPK contained low bisacrylamide as we described pre- the intensity of the phosphorylated form to the total intensity viously.19,25 The bands were detected by either polyclonal of the phosphorylated and unphosphorylated forms was calcu- anti-ERK2 antibody or anti-ERK1 antibody (Santa Cruz lated; samples with more than 5% phosphorylation were arbi- Biotechnology, Santa Cruz, CA, USA) which is not cross- trarily defined as positive, because a large portion of the sam- reactive with ERK1 p44 or ERK2 p42, respectively, followed ple with visible phosphorylated band showed a much higher by ECL kit (Amersham International, Buckinghamshire, UK). number, while the negative sample always showed a much smaller one. Normal bone marrow samples invariably exhib- ited less than 1% ERK2 phosphorylation. Representative data MAPK activity assay were shown in Figure 1a. In 18 of 40 freshly extracted samples and 22 of 60 frozen-thawed samples, the phosphorylated form Activity of MAPK was assessed by the kinase activity for the of MAPK was enhanced by more than 5%. A summary of the synthesized peptide using a commercial kit (BIOTRAK MAP results were presented in Table 1. In AMLs, all subtypes of the kinase assay; Amersham). The peptide contains the sequence FAB classification, except M0 and M6, contained a relatively PLS/TP, a recognition sequence for p42/p44 MAPK,26 and no high percentage of the positive samples: 37 out of 73 samples other phosphorylation sites. Therefore, this assay reflects the were positive in AMLs in total (average of phosphorylated MAPK activity more specifically than a standard MBP phos- form ratio, 22%). Three of nine B-lineage ALL and none of phorylation assay. three CLL had positive phosphorylation of MAPK. Interest- ingly, neither the chronic phase nor the acute (blastic) phase of CML showed any detectable phosphorylated form of ERK2. Kinase activity for GST-ERK2 The marrow cells in complete remission showed minimal ERK2 phosphorylation even at the recovery phase after con- Full-length human ERK2 cDNA was cloned into the pGEX-2T solidation chemotherapy (Figure 1a, lanes 7 and 13). Phos- vector (Pharmacia Biotechnology, Uppsala, Sweden) and phorylation of ERK1, an isoform of ERK2, was also examined GST-ERK2 was generated bacterially as recommended by the in 20 leukemia samples by the same gel shift assay, and the manufacturer (Pharmacia). The reaction mixture contained representative data are shown in Figure 1b. All 10 ERK2-phos- 10 mg of glutathione-S-transferase (GST)-ERK2 coupled with phorylated samples exhibited enhanced phosphorylation glutathione agarose, 1 mg of whole cell lysate, 10 mM HEPES (average of phosphorylated form ratio, 17%), while the other g32 (pH 7.6), 10 mM MgCl2,1mM DTT, and 370 kBq of P-ATP. ° The reaction was censored after incubation at 30 C for Table 1 Summary of patient characteristics and elevated phos- 30 min. The precipitant was washed five times by RIPA buffer phorylation of ERK2 and subjected to 8% SDS-PAGE. Phenotype No. of Elevated phosphorylation of patients ERK2a DNA preparation and Southern blotting No. % Extraction of genomic DNA from the mononuclear cells and Southern blotting were performed by the standard methods.27 AML M0 5 0 0 The regions centering on codon 12 of K-ras and N-ras, and M1 16 5 31 codons 13 and 61 of n-ras gene were amplified selectively M2 20 16 80 M3 10 3 30 using PCR. Ras mutations were detected by an algorithm M4 11 5 45 based on allele-specific oligonucleotide hybridization.
Load more

Recommended publications
  • Galectin-4 Interaction with CD14 Triggers the Differentiation of Monocytes Into Macrophage-Like Cells Via the MAPK Signaling Pathway
    Immune Netw. 2019 Jun;19(3):e17 https://doi.org/10.4110/in.2019.19.e17 pISSN 1598-2629·eISSN 2092-6685 Original Article Galectin-4 Interaction with CD14 Triggers the Differentiation of Monocytes into Macrophage-like Cells via the MAPK Signaling Pathway So-Hee Hong 1,2,3,4,5, Jun-Seop Shin 1,2,3,5, Hyunwoo Chung 1,2,4,5, Chung-Gyu Park 1,2,3,4,5,* 1Xenotransplantation Research Center, Seoul National University College of Medicine, Seoul 03080, Korea 2Institute of Endemic Diseases, Seoul National University College of Medicine, Seoul 03080, Korea 3Cancer Research Institute, Seoul National University College of Medicine, Seoul 03080, Korea 4Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul 03080, Korea 5Department of Microbiology and Immunology, Seoul National University College of Medicine, Seoul 03080, Korea Received: Jan 28, 2019 ABSTRACT Revised: May 13, 2019 Accepted: May 19, 2019 Galectin-4 (Gal-4) is a β-galactoside-binding protein mostly expressed in the gastrointestinal *Correspondence to tract of animals. Although intensive functional studies have been done for other galectin Chung-Gyu Park isoforms, the immunoregulatory function of Gal-4 still remains ambiguous. Here, we Department of Microbiology and Immunology, Seoul National University College of Medicine, demonstrated that Gal-4 could bind to CD14 on monocytes and induce their differentiation 103 Daehak-ro, Jongno-gu, Seoul 03080, into macrophage-like cells through the MAPK signaling pathway. Gal-4 induced the phenotypic Korea. changes on monocytes by altering the expression of various surface molecules, and induced E-mail: [email protected] functional changes such as increased cytokine production and matrix metalloproteinase expression and reduced phagocytic capacity.
    [Show full text]
  • Phosphorylation of Chicken Protein Tyrosine Phosphatase 1 by Casein Kinase II in Vitro
    EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 29, No 4, 229-233, December 1997 Phosphorylation of chicken protein tyrosine phosphatase 1 by casein kinase II in vitro Eun Joo Jung,1 Kee Ryeon Kang1 and Introduction Yoon-Se Kang1,2 The phosphorylation of protein tyrosine residues is an early event in signal transduction initiated by binding of 1 Department of Biochemistry and Gyeongsang Institute of Cancer growth factors and hormones to their cognate receptors Research, College of Medicine, Gyeongsang National University, and it leads to regulation of cellular activities which include Chinju 660-280, Korea proliferation, differentiation, and also malignant transfor- 2 Corresponding author mation of cells (Hunter, 1989; Ullirich and Schlessinger, Accepted 17 November 1997 1990; Cantley et al., 1991). Under normal conditions, the level of tyrosine phosphorylation within a cell is determined by a balance between the actions of protein tyrosine Abbreviations: CPTP, chicken protein tyrosine phosphatase; HPTP1B, human placenta kinases (PTKs) and protein tyrosine phosphatases (PTPs) protein tyrosine phosphatase 1B; CKII, casein kinase II; MAP kinase, mitogen-activated (Hunter, 1989; Fischer et al., 1991; Trowbridge, 1991). protein kinase; GST, glutathione S-transferase; pNPP, p-nitrophenyl phosphate; EGF, PTPs do not simply reverse the action of tyrosine kinases, epidermal growth factor but rather, PTP itself may play a central role in cellular regulation. PTPs are generally classified as transmem- brane (receptor-type) and nontransmembrane (nonrecep- tor-type) enzymes based on the presence or absence of extracellular and transmembrane portions of their predicted sequence (Fischer et al., 1991). Because the activity of Abstract tyrosine kinase can be controlled by phosphorylation, it has been postulated that PTP activity may be regulated The phosphorylation and dephosphorylation of by phosphorylation as well.
    [Show full text]
  • Targeting the Mitogen-Activated Protein Kinase Pathway: Physiological Feedback and Drug Response
    Published OnlineFirst May 14, 2010; DOI: 10.1158/1078-0432.CCR-09-3064 Molecular Pathways Clinical Cancer Research Targeting the Mitogen-Activated Protein Kinase Pathway: Physiological Feedback and Drug Response Christine A. Pratilas1,2 and David B. Solit3,4 Abstract Mitogen-activated protein kinase (MAPK) pathway activation is a frequent event in human cancer and is often the result of activating mutations in the BRAF and RAS oncogenes. Targeted inhibitors of BRAF and its downstream effectors are in various stages of preclinical and clinical development. These agents offer the possibility of greater efficacy and less toxicity than current therapies for tumors driven by oncogenic mutations in the MAPK pathway. Early clinical results with the BRAF-selective in- hibitor PLX4032 suggest that this strategy will prove successful in a select group of patients whose tu- mors are driven by V600E BRAF. Relief of physiologic feedback upon pathway inhibition may, however, attenuate drug response and contribute to the development of acquired resistance. An im- proved understanding of the adaptive response of cancer cells to MAPK pathway inhibition may thus aid in the identification of those patients most likely to respond to targeted pathway inhibitors and provide a rational basis for tailored combination strategies. Clin Cancer Res; 16(13); 3329–34. ©2010 AACR. Background these genetic alterations activate common downstream effectors of transformation. One of the central regulators of growth factor-induced Activating BRAF mutations are found clustered within cell proliferation and survival in both normal and cancer the P-loop (exon 11) and activation segment (exon 15) cells is the RAS protein.
    [Show full text]
  • Plant Mitogen-Activated Protein Kinase Signaling Cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§
    392 Plant mitogen-activated protein kinase signaling cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§ Mitogen-activated protein kinase (MAPK) cascades have components that link sensors/receptors to target genes emerged as a universal signal transduction mechanism that and other cellular responses. connects diverse receptors/sensors to cellular and nuclear responses in eukaryotes. Recent studies in plants indicate that In the past few years, it has become apparent that mitogen- MAPK cascades are vital to fundamental physiological functions activated protein kinase (MAPK) cascades play some of the involved in hormonal responses, cell cycle regulation, abiotic most essential roles in plant signal transduction pathways stress signaling, and defense mechanisms. New findings have from cell division to cell death (Figure 1). MAPK cascades revealed the complexity and redundancy of the signaling are evolutionarily conserved signaling modules with essen- components, the antagonistic nature of distinct pathways, and tial regulatory functions in eukaryotes, including yeasts, the use of both positive and negative regulatory mechanisms. worms, flies, frogs, mammals and plants. The recent enthu- siasm for plant MAPK cascades is backed by numerous Addresses studies showing that plant MAPKs are activated by hor- Department of Molecular Biology, Massachusetts General Hospital, mones, abiotic stresses, pathogens and pathogen-derived Department of Genetics, Harvard Medical School, Wellman 11, elicitors, and are also activated at specific stages during the 50 Blossom Street, Boston, Massachusetts 02114, USA cell cycle [2]. Until recently, studies of MAPK cascades in *e-mail: [email protected] †e-mail: [email protected] plants were focused on cDNA cloning [3,4] and used a ‡e-mail: [email protected] MAPK in-gel assay, MAPK and tyrosine-phosphate anti- §e-mail: [email protected] bodies, and kinase inhibitors to connect signals to MAPKs Current Opinion in Plant Biology 2001, 4:392–400 [2].
    [Show full text]
  • Mechanism of Insulin Receptor Kinase Inhibition in Non-Insulin- Dependent Diabetes Mellitus Patients
    Mechanism of insulin receptor kinase inhibition in non-insulin- dependent diabetes mellitus patients. Phosphorylation of serine 1327 or threonine 1348 is unaltered. M Kellerer, … , K Siddle, H U Häring J Clin Invest. 1995;96(1):6-11. https://doi.org/10.1172/JCI118073. Research Article The tyrosine kinase activity of insulin receptor isolated from the skeletal muscle of NIDDM patients has previously been found to be decreased compared with the activity of receptor from nondiabetic subjects but the mechanism underlying this defect is unknown. Phosphorylation of receptor serine/threonine residues has been proposed to exert an inhibitory influence on receptor tyrosine kinase activity and Ser 1327 and Thr 1348 have been identified as specific sites of phosphorylation in the insulin receptor COOH terminal domain. To address the potential negative regulatory role of phosphorylation of these residues in vivo, we assessed the extent of phosphorylation of each site in insulin receptor isolated from the skeletal muscle of 12 NIDDM patients and 13 nondiabetic, control subjects. Phosphorylation of Ser 1327 and Thr 1348 was determined using antibodies that specifically recognize insulin receptor phosphorylated at these sites. In addition, a phosphotyrosine-specific antibody was used to monitor receptor tyrosine phosphorylation. The extent of insulin-induced tyrosine autophosphorylation was decreased in receptor isolated from diabetic versus nondiabetic muscle, thus confirming earlier reports. In contrast, there was no significant difference in the extent of phosphorylation of either Ser 1327 or Thr 1348 in receptor isolated from diabetic or nondiabetic muscle as assessed by immunoprecipitation (Ser 1327: 5.6 +/- 1.6% diabetics vs. 4.7 +/- 2.0% control; Thr 1348: 3.8 +/- 1.0% diabetics vs.
    [Show full text]
  • Diverse Physiological Functions for Dual-Specificity MAP Kinase
    Commentary 4607 Diverse physiological functions for dual-specificity MAP kinase phosphatases Robin J. Dickinson and Stephen M. Keyse* Cancer Research UK Stress Response Laboratory, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK *Author for correspondence (e-mail: [email protected]) Accepted 19 September 2006 Journal of Cell Science 119, 4607-4615 Published by The Company of Biologists 2006 doi:10.1242/jcs.03266 Summary A structurally distinct subfamily of ten dual-specificity functions in mammalian cells and tissues. However, recent (Thr/Tyr) protein phosphatases is responsible for the studies employing a range of model systems have begun to regulated dephosphorylation and inactivation of mitogen- reveal essential non-redundant roles for the MKPs in activated protein kinase (MAPK) family members in determining the outcome of MAPK signalling in a variety mammals. These MAPK phosphatases (MKPs) interact of physiological contexts. These include development, specifically with their substrates through a modular kinase- immune system function, metabolic homeostasis and the interaction motif (KIM) located within the N-terminal non- regulation of cellular stress responses. Interestingly, these catalytic domain of the protein. In addition, MAPK binding functions may reflect both restricted subcellular MKP is often accompanied by enzymatic activation of the C- activity and changes in the levels of signalling through terminal catalytic domain, thus ensuring specificity of multiple MAPK pathways. action. Despite our knowledge of the biochemical and structural basis for the catalytic mechanism of the MKPs, we know much less about their regulation and physiological Key words: MAPK, MKP, Signal transduction, Phosphorylation Introduction the activation motif is required for MAPK activity, Mitogen-activated protein kinases (MAPKs) constitute a dephosphorylation of either residue inactivates these enzymes.
    [Show full text]
  • G Protein Regulation of MAPK Networks
    Oncogene (2007) 26, 3122–3142 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW G Protein regulation of MAPK networks ZG Goldsmith and DN Dhanasekaran Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA, USA G proteins provide signal-coupling mechanisms to hepta- the a-subunits has been used as a basis for the helical cell surface receptors and are criticallyinvolved classification of G proteins into Gs,Gi,Gq and G12 in the regulation of different mitogen-activated protein families in which the a-subunits that show more than kinase (MAPK) networks. The four classes of G proteins, 50% homology are grouped together (Simon et al., defined bythe G s,Gi,Gq and G12 families, regulate 1991). In G-protein-coupled receptor (GPCR)-mediated ERK1/2, JNK, p38MAPK, ERK5 and ERK6 modules by signaling pathways, ligand-activated receptors catalyse different mechanisms. The a- as well as bc-subunits are the exchange of the bound GDP to GTP in the a-subunit involved in the regulation of these MAPK modules in a following which the GTP-bound a-subunit disassociate context-specific manner. While the a- and bc-subunits from the receptor as well as the bg-subunit. The GTP- primarilyregulate the MAPK pathwaysvia their respec- bound a-subunit and the bg-subunit stimulate distinct tive effector-mediated signaling pathways, recent studies downstream effectors including enzymes, ion channels have unraveled several novel signaling intermediates and small GTPase, thus regulating multiple signaling including receptor tyrosine kinases and small GTPases pathways including those involved in the activation of through which these G-protein subunits positivelyas well mitogen-activated protein kinase (MAPK) modules as negativelyregulate specific MAPK modules.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Phosphorylation of Protein 4.1 on Tyrosine-418 Modulates Its Function
    Proc. Nati. Acad. Sci. USA Vol. 88, pp. 5222-5226, June 1991 Biochemistry Phosphorylation of protein 4.1 on tyrosine-418 modulates its function in vitro (epidermal growth factor receptor/spectrin/actin assembly) GOSUKONDA SUBRAHMANYAM*, PAUL J. BERTICStt, AND RICHARD A. ANDERSON**§ Department of *Pharmacology and tPhysiological Chemistry, and the tCell and Molecular Biology Program, University of Wisconsin Medical School, 1300 University Avenue, Madison, WI 53706 Communicated by Vincent T. Marchesi, March IS, 1991 ABSTRACT Protein 4.1 was initially characterized as a actin/protein 4.1 complex (12). However, phosphorylation of protein that regulates cytoskeletal assembly in erythrocytes. protein 4.1 by protein kinase C also reduces protein 4.1 However, recent studies have shown that protein 4.1 is ubiq- binding to band 3 but not to glycophorin, while phosphory- uitous in mammalian cells. Here, we show that protein 4.1 is lation by cAMP-dependent kinase does not affect membrane phosphorylated on tyrosine by the epidermal growth factor interactions (12). These results suggest that protein 4.1 is receptor (EGFR) tyrosine kinase. The phosphorylation site has phosphorylated at multiple sites by different protein kinases, been localized to the 8-kDa domain, which has one tyrosine, and each phosphorylation event selectively modulates pro- tyrosine-418. The 8-kDa region is required for the assembly of tein 4.1 function. The phosphorylation sites by cAMP- the spectrin/actin complex, and phosphorylation by EGFR dependent protein kinase and protein kinase C are in the reduced the ability ofprotein 4.1 to promote the assembly ofthe 8-kDa and 16-kDa domains (10).
    [Show full text]
  • G Protein-Coupled Receptor Signalling in Neuroendocrine Systems
    117 G PROTEIN-COUPLED RECEPTOR SIGNALLING IN NEUROENDOCRINE SYSTEMS ‘Location, location, location’: activation and targeting of MAP kinases by G protein-coupled receptors L M Luttrell Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710, USA and The Geriatrics Research, Education and Clinical Center, Durham Veterans Affairs Medical Center, Durham, North Carolina 27705, USA (Requests for offprints should be addressed to L M Luttrell, N3019 The Geriatrics Research, Education and Clinical Center, Durham Veterans Affairs Medical Center, 508 Fulton Street, Durham, North Carolina 27710, USA; Email: [email protected]) Abstract A growing body of data supports the conclusion that G protein-coupled receptors can regulate cellular growth and differentiation by controlling the activity of MAP kinases. The activation of heterotrimeric G protein pools initiates a complex network of signals leading to MAP kinase activation that frequently involves cross-talk between G protein-coupled receptors and receptor tyrosine kinases or focal adhesions. The dominant mechanism of MAP kinase activation varies significantly between receptor and cell type. Moreover, the mechanism of MAP kinase activation has a substantial impact on MAP kinase function. Some signals lead to the targeting of activated MAP kinase to specific extranuclear locations, while others activate a MAP kinase pool that is free to translocate to the nucleus and contribute to a mitogenic response. Journal of Molecular Endocrinology (2003) 30, 117–126 Introduction between intracellular receptor domains and the GDP-bound G subunit of a heterotrimeric G The G protein-coupled receptors (GPCRs) make protein triggers GTP for GDP exchange on the G up the largest superfamily of cell surface receptors subunit and dissociation of the GTP-bound G in the human genome, where they are represented subunit from the G heterodimer.
    [Show full text]
  • Mitogen-Activated Protein Kinase and Its Activator Are Regulated by Hypertonic Stress in Madin-Darby Canine Kidney Cells
    Mitogen-activated protein kinase and its activator are regulated by hypertonic stress in Madin-Darby canine kidney cells. T Itoh, … , N Ueda, Y Fujiwara J Clin Invest. 1994;93(6):2387-2392. https://doi.org/10.1172/JCI117245. Research Article Madin-Darby canine kidney cells behave like the renal medulla and accumulate small organic solutes (osmolytes) in a hypertonic environment. The accumulation of osmolytes is primarily dependent on changes in gene expression of enzymes that synthesize osmolytes (sorbitol) or transporters that uptake them (myo-inositol, betaine, and taurine). The mechanism by which hypertonicity increases the transcription of these genes, however, remains unclear. Recently, it has been reported that yeast mitogen-activated protein (MAP) kinase and its activator, MAP kinase-kinase, are involved in osmosensing signal transduction and that mutants in these kinases fail to accumulate glycerol, a yeast osmolyte. No information is available in mammals regarding the role of MAP kinase in the cellular response to hypertonicity. We have examined whether MAP kinase and MAP kinase-kinase are regulated by extracellular osmolarity in Madin-Darby canine kidney cells. Both kinases were activated by hypertonic stress in a time- and osmolarity-dependent manner and reached their maximal activity within 10 min. Additionally, it was suggested that MAP kinase was activated in a protein kinase C- dependent manner. These results indicate that MAP kinase and MAP kinase-kinase(s) are regulated by extracellular osmolarity. Find the latest version:
    [Show full text]
  • Galectin-1 Promotes Lung Cancer Progression and Chemoresistance by Upregulating P38 MAPK, ERK, and Cyclooxygenase-2
    Published OnlineFirst June 13, 2012; DOI: 10.1158/1078-0432.CCR-11-3348 Clinical Cancer Human Cancer Biology Research Galectin-1 Promotes Lung Cancer Progression and Chemoresistance by Upregulating p38 MAPK, ERK, and Cyclooxygenase-2 Ling-Yen Chung1, Shye-Jye Tang6, Guang-Huan Sun3, Teh-Ying Chou4, Tien-Shun Yeh2, Sung-Liang Yu5, and Kuang-Hui Sun1 Abstract Purpose: This study is aimed at investigating the role and novel molecular mechanisms of galectin-1 in lung cancer progression. Experimental Design: The role of galectin-1 in lung cancer progression was evaluated both in vitro and in vivo by short hairpin RNA (shRNA)-mediated knockdown of galectin-1 in lung adenocarcinoma cell lines. To explore novel molecular mechanisms underlying galectin-1–mediated tumor progression, we analyzed gene expression profiles and signaling pathways using reverse transcription PCR and Western blotting. A tissue microarray containing samples from patients with lung cancer was used to examine the expression of galectin-1 in lung cancer. Results: We found overexpression of galectin-1 in non–small cell lung cancer (NSCLC) cell lines. Suppression of endogenous galectin-1 in lung adenocarcinoma resulted in reduction of the cell migration, invasion, and anchorage-independent growth in vitro and tumor growth in mice. In particular, COX-2 was downregulated in galectin-1–knockdown cells. The decreased tumor invasion and anchorage-independent growth abilities were rescued after reexpression of COX-2 in galectin-1–knockdown cells. Furthermore, we found that TGF-b1 promoted COX-2 expression through galectin-1 interaction with Ras and subsequent activation of p38 mitogen-activated protein kinase (MAPK), extracellular signal–regulated kinase (ERK), and NF-kB pathway.
    [Show full text]