DOCSLIB.ORG

(Orchidaceae) Based on ITS, Trnl-F and Matk Sequences

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(Orchidaceae) Based on ITS, Trnl-F and Matk Sequences View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by RERO DOC Digital Library Plant Syst. Evol. 247: 203–213 (2004) DOI 10.1007/s00606-004-0133-3 A phylogenetic analysis of Apostasioideae (Orchidaceae) based on ITS, trnL-F and matK sequences A. Kocyan1, Y.-L. Qiu1,2, P. K. Endress1, and E. Conti1 1University of Zurich, Institute of Systematic Botany, Zurich, Switzerland 2University of Michigan, Department of Ecology and Evolutionary Biology, Ann Arbor, USA Received May 23, 2003; accepted January 24, 2004 Published online: May 10, 2004 Ó Springer-Verlag 2004 Abstract. The orchid subfamily Apostasioideae Introduction consists of two genera, Apostasia and Neuwiedia. To study the position of Apostasioideae within The genera Apostasia and Neuwiedia form the Orchidaceae and their intra- and intergeneric rela- subfamily Apostasioideae (Orchidaceae), with tionships, a molecular phylogenetic analysis has a total of 15 species mainly occurring in been conducted on the nuclear ITS region and the Southeast Asia. In contrast to all other two plastid DNA regions trnL-F intron and matK. orchids, they have a very simple gynostemium The two genera traditionally ascribed to Aposta- and three stamens, one of which may be a sioideae are each monophyletic. In Apostasia, staminode in Apostasia (Kocyan and Endress A. nuda, with two stamens and no staminode, is 2001). Traditionally, the subfamily is placed as sister to a clade comprising three species charac- sister to the rest of Orchidaceae (see Stern et al. terised by two stamens and one staminode. Within 1993, Kocyan and Endress 2001, Rudall and Neuwiedia, maximum parsimony analyses place Bateman 2002, for recent reviews of their N. zollingeri as sister to the clade formed by N. borneensis and N. veratrifolia. A family-wide taxonomic history). This placement is also phylogenetic analysis of matK sequences represent- supported by recent molecular (rbcL, 18S, ing all proposed subfamilies of Orchidaceae pro- nad1 b-c; Cameron et al. 1999, Cameron and duced five moderately to well-supported clades. One Chase 2000, Freudenstein et al. 2000) and non- of these clades, Apostasioideae, is sister to the clade molecular analyses (Freudenstein and Ras- formed by Vanilloideae, Cypripedioideae, Orchidoi- mussen 1999). However, little information deae and Epidendroideae. High transition-transver- has been available on the systematic structure sion ratio and the absence of stop codons in the of these two genera. De Vogel (1969) proposed individual sequences suggest that matK is at the two different sections in Apostasia based on the transition from a possibly functional gene to a presence or absence of the staminode, which pseudogene in Apostasioideae, contrary to what is represents the vestige of the median abaxial found in some other groups of Orchidaceae. stamen: sect. Apostasia, with a staminode, and Key words: Molecular phylogenetics, plastid DNA, sect. Adactylus without a staminode. This nrDNA, Orchidaceae, pseudogene, Apostasia, division was also confirmed by a recent study Neuwiedia. on floral structures and developmental pat- 204 A. Kocyan et al.: Phylogenetic analysis of Apostasioideae (Orchidaceae) terns of Apostasioideae (Kocyan and Endress increase the species sampling we also tried to 2001). The relationships among Neuwiedia extract DNA from herbarium material without species still remain to be resolved, because success. Non-apostasioid orchids were sampled in morphological results are somewhat ambigu- various botanical gardens. Nomenclature of Apos- ous (de Vogel 1969, Kocyan and Endress tasia and Neuwiedia follows that of de Vogel 2001). In order to investigate inter- and (1969). Vouchers are deposited in the Zu¨rich herbarium [Z+ZT] or in the pickled collection of intrageneric relationships within Apostasioi- A. Kocyan. ITS and matK sequences of various deae, which are to date mainly based on orchid taxa were obtained from Genbank morphological observations, we have pro- (Table 1). duced sequences from three commonly used DNA extraction and sequencing. Leaf material DNA regions: 1) the internal transcribed was dried and preserved in silica gel. Total genomic spacer (ITS) of the nuclear ribosomal DNA DNA was extracted from dried material following (e.g. Baldwin 1992, Cox et al. 1997, Conti et al. the modified CTAB procedure of Doyle and Doyle 1999, von Balthazar et al. 2000, Whitten et al. (1987) or the SDS protocol after Eichenberger et al. 2000, Gravendeel et al. 2001); 2) the plastid (2000). Apostasia nipponica was extracted with the gene matK (e.g. Johnson and Soltis 1994, 1995; DNeasyä Plant Mini Kit (Qiagen, Basel, Switzer- Conti et al. 1999; Kores et al. 2000; Whitten land). The selected DNA regions were amplified with standard polymerase chain reactions (PCR). et al. 2000; Goldman et al. 2001; Gravendeel Newly designed primers (von Balthazar et al. 2000) et al. 2001; Scho¨nenberger and Conti 2003); were used to amplify the entire ITS1, 5.8S rDNA and 3) the non coding trnL-F intergenic spacer and ITS2 region in a single reaction (Baldwin of the plastid genome (e.g. Taberlet et al. 1991, 1992). Primers c and f of Taberlet et al. (1991) were Pfosser and Speta 1999, Whitten et al. 2000). used to amplify the trnL(UAA)5¢ exon and Furthermore, a matK-data matrix representing trnF(GAA) of the chloroplast genome in a single all major orchid clades has been produced to reaction. The matK gene was amplified in two test the monophyly and the phylogenetic overlapping parts using the -19F forward position of Apostasioideae within Orchi- (CGTTCTGACCATATTGCACTATG; Kores daceae. et al. 2000, Molvray et al. 2000) and 834R reverse (AAAGACTCCARAAGATRTTG) primers, and the 580F (ACTAATACCCYATCCCATMC) and Materials and methods R1(CATTTTTCATTGCACACGRC) primers. Primer R1 anneals slightly upstream of the often Taxon sampling. Our study comprises four (out of used trnK-2R primer. Primers 580F, 834R and R1 seven) Apostasia species, three (out of eight) were newly designed for this study. The PCR Neuwiedia species, 15 representatives of other protocol used to amplify ITS, trnL-F intron and major orchid clades, as well as Blandfordia punicea matK was as follows: 35 cycles of 30 sec at 95 °C (Blandfordiaceae) and Curculigo capitulata (Hyp- denaturation, 1 min annealing (50°C for ITS, 55 °C oxidaceae) as outgroups (Table 1). Blandfordiaceae for trnL-F, 49 °C for matK), 1 min 40 sec and Hypoxidaceae have been identified as close elongation at 72 °C. Three species appeared to relatives of Orchidaceae in broad analyses of contain multiple copies of ITS, and PCR products Asparagales (Rudall et al. 1997, Chase et al. 2000, were cloned with the TOPO TA cloningÒ kit Fay et al. 2000) (Table 1). With the exception of (Invitrogen). Several clones were sequenced and Apostasia nipponica (kindly offered by T. Yukawa, subjected to phylogenetic analyses. A putative Tsukuba Botanical Garden, Amakubo, Japan) the ortholog was identified based on branch length, material was collected during field trips to Sabah/ sequence characteristic, and phylogenetic place- Malaysia and Tasmania/Australia by the first ment, and was then used in final analyses. Prior to author. The sampling that represents less than 50 % cycle sequencing, PCR products were purified with of the known species diversity may be critizised. the Qiaquickä PCR Purification Kit (Qiagen, However, all Apostasioideae species are rare, none Basel, Switzerland). For cycle sequencing BigDye is available in cultivation, and some are known Terminator Ready Reaction Kit (Applied Biosys- only from very few (old) herbarium collections. To tems) was used. Additional primers were used for A. Kocyan et al.: Phylogenetic analysis of Apostasioideae (Orchidaceae) 205 Table 1. Species analysed in this study. Subfamily names according to Pridgeon et al. (1999). Taxa Voucher number / GenBank Accession Number DNA number (AK = A. Kocyan) matK trnL-F ITS Ingroup Apostasioideae Apostasia nipponica Masam. Yukawa 99-92 / AK92 AY557215 AY557222 AY557231 Apostasia nuda R.Br. AK971126-3-01 / AK44 AY557214 AY557221 AY557230 Apostasia odorata Blume AK971109-1-01 / AK15 AY557213 AY557220 AY557229 Apostasia wallichii R.Br AK981023-1-02 / AK14 AY557212 AY557219 AY557228 Neuwiedia borneensis de Vogel AK971114-1-01 / AK19 AY557209 AY557216 AY557225 Neuwiedia veratrifolia Blume AK971115-1-01 / AK21 AY557211 AY557218 AY557227 Neuwiedia zollingeri Reichenb.f. AK971114-1-04 / AK20 AY557210 AY557217 AY557226 var. javanica (J.J.Sm.) de Vogel Cypripedioideae Cypripedium calceolus L. AK990519-1-02 / AK56 AY557208 AY557224 AY557232 Paphiopedilum glaucophyllum AK990525-1-25 / AK75 AY557205 J. J. Smith Phragmipedium longifolium Rolfe AK990525-1-02 / AK71 AY557204 Vanilloideae Cleistes rosea Lindl. AJ310006* Pogonia ophioglossoides (L.) Jussieu AJ310055* Vanilla planifolia Andr. s.n. / AK49 AJ310079* AY557223 U66819* Orchidoideae Disa glandulosa Burch. ex Lindl. AF263654* Ophrys apifera Hudson AJ310049* Lower Epidendroideae Corymborkis veratrifolia AK981020-1-01 / AK06 AY557203 (Reinw.) Blume Nervilia cf. aragoana Gaud. AJ310048* Palmorchis trilobata L.O. PTR310052* Williams in Woodson & Schery Higher Epidendroideae Aerides multiflora Roxb. 920432 # / AP02 AY557201 Calanthe vestita Lindl. AF263634* Collabium simplex Rchb.f. AK991017-1-04 / AK95a AY557200 Rhynchostylis gigantea 913013 # / AP07 AY557202 (Lindl.) Ridl. Outgroup Blandfordia punicea Sweet AK981013-1-01 / AK01 AY557206 (Blandfordiaceae) Curculigo capitulata Kuntze AK981228-1-01 / AK05 AY557207 (Hypoxidaceae) * Sequence taken from GenBank
Load more

Recommended publications
  • Sp09-For Web.Pub
    Spring 2009 Page 1 Botanic Garden News The Botanic Garden Volume 12, No. 1 of Smith College Spring 2009 Madelaine Zadik “T he tulip is the sexiest, most capricious, the most various, subtle, powerful, and intriguing Room. Many thanks to the Museum of flower on Earth.” These are the words of Anna Art for framing them for us. Pavord, opening speaker for this year’s Spring In our display case are other tulip- Bulb Show. A mainstay of flower shows and related books lent to us by the garden displays, the tulip has come a long way Mortimer Rare Book Room. Flora’s from its humble origins in central Asia to Feast: A Masque of Flowers (1889) is Tulipa ‘Carmen Rio’ becoming a beloved spring icon. Could you opened to the tulip and hyacinth, two of Photograph by Madelaine Zadik imagine spring without tulips? forty full color lithographs in the book Horticulturist and writer extraordinaire Anna Pavord dazzled everyone with her by Walter Crane. Each page presents an talk, The Tulip: The Flower That Made Men Mad. It was more performance than allegory of a popular flower as human, lecture and demonstrated that although tulipmania might have taken over Europe in clad in flowery garments with a short the early seventeenth century, passions today still run quite strong as far as the tulip whimsical verse. Reproductions of is concerned. (For more about Anna Pavord’s visit, see page 7.) During the several of these (see page 6) were tulipmania period in Europe, fortunes rose to soaring heights and then were quickly scattered through the bulb show, to lost, perhaps similar to the Wall Street turbulence we are everyone’s delight.
    [Show full text]
  • Edition 2 from Forest to Fjaeldmark the Vegetation Communities Highland Treeless Vegetation
    Edition 2 From Forest to Fjaeldmark The Vegetation Communities Highland treeless vegetation Richea scoparia Edition 2 From Forest to Fjaeldmark 1 Highland treeless vegetation Community (Code) Page Alpine coniferous heathland (HCH) 4 Cushion moorland (HCM) 6 Eastern alpine heathland (HHE) 8 Eastern alpine sedgeland (HSE) 10 Eastern alpine vegetation (undifferentiated) (HUE) 12 Western alpine heathland (HHW) 13 Western alpine sedgeland/herbland (HSW) 15 General description Rainforest and related scrub, Dry eucalypt forest and woodland, Scrub, heathland and coastal complexes. Highland treeless vegetation communities occur Likewise, some non-forest communities with wide within the alpine zone where the growth of trees is environmental amplitudes, such as wetlands, may be impeded by climatic factors. The altitude above found in alpine areas. which trees cannot survive varies between approximately 700 m in the south-west to over The boundaries between alpine vegetation communities are usually well defined, but 1 400 m in the north-east highlands; its exact location depends on a number of factors. In many communities may occur in a tight mosaic. In these parts of Tasmania the boundary is not well defined. situations, mapping community boundaries at Sometimes tree lines are inverted due to exposure 1:25 000 may not be feasible. This is particularly the or frost hollows. problem in the eastern highlands; the class Eastern alpine vegetation (undifferentiated) (HUE) is used in There are seven specific highland heathland, those areas where remote sensing does not provide sedgeland and moorland mapping communities, sufficient resolution. including one undifferentiated class. Other highland treeless vegetation such as grasslands, herbfields, A minor revision in 2017 added information on the grassy sedgelands and wetlands are described in occurrence of peatland pool complexes, and other sections.
    [Show full text]
  • Pogonia Subalpina (Orchidaceae): a New Species from Japan
    Bull. Natl. Mus. Nat. Sci., Ser. B, 43(3), pp. 79–86, August 22, 2017 Pogonia subalpina (Orchidaceae): a new species from Japan Tomohisa Yukawa* and Yumi Yamashita Tsukuba Botanical Garden, National Museum of Nature and Science, Amakubo 4–1–1, Tsukuba, Ibaraki 305–0005, Japan *E-mail: [email protected] (Received 11 May 2017; accepted 28 June 2017) Abstract Pogonia subalpina T. Yukawa & Y. Yamashita (Orchidaceae) is newly described from marshy, subalpine grasslands of central and northern parts in Honshu, Japan. This species is simi- lar to Pogonia japonica Rchb. f. and P. minor (Makino) Makino, but can be distinguished in flower by its short hairy crests on the disk of the labellum mid-lobe, by its glabrous abaxial surface of the labellum, and by its single, broad, purplish pink band along the mid-vein of the petals. Nucleotide sequence divergences among the three entities in the nuclear ribosomal DNA ITS and the plastid trnK 5’ intron regions warrant independent species status of the new entity. Key words : Japan, new species, Orchidaceae, Pogonia, taxonomy. Introduction ica and P. minor has been generally recognised (Yukawa, 2015). However, another entity that The genus Pogonia Juss. is a small orchid does not match morphologically with either of genus in which four species, i.e., P. japonica them was tentatively designated a Japanese name Rchb. f., P. minor (Makino) Makino, P. ophio- “Miyama-tokiso” (Takahashi, 1987). In this study glossoides (L.) Ker Gawl., and P. yunnanensis we evaluate the taxonomic status of this Finet, are currently accepted (Pridgeon et al., neglected entity.
    [Show full text]
  • Seidenfaden Malaysia: 0.65 These Figures Are Surprisingly High, They Apply to Single Only. T
    BIOGEOGRAPHY OF MALESIAN ORCHIDACEAE 273 VIII. Biogeographyof Malesian Orchidaceae A. Schuiteman Rijksherbarium/Hortus Botanicus, P.O. Box 9514, 2300 RA Leiden, The Netherlands INTRODUCTION The Orchidaceae outnumber far other in Malesia. At how- by any plant family present, accurate estimate of the of Malesian orchid is difficult to make. ever, an number species Subtracting the numberofestablishedsynonyms from the numberof names attributed to Malesian orchid species results in the staggering figure of 6414 species, with a retention of 0.74. This is ratio (ratio of ‘accepted’ species to heterotypic names) undoubtedly a overestimate, of the 209 Malesian orchid have been revised gross as most genera never their entire from availablerevisions estimate realis- over range. Extrapolating to a more tic retention ratio is problematic due to the small number of modern revisions and the different of treated. If look for Malesian of nature the groups we comparison at species wide ofretention ratios: some recently revised groups, we encounter a range Bulbophylluw sect. Uncifera (Vermeulen, 1993): 0.24 Dendrobium sect. Oxyglossum (Reeve & Woods, 1989): 0.24 Mediocalcar (Schuiteman, 1997): 0.29 Pholidota (De Vogel, 1988): 0.29 Bulbophyllum sect. Pelma (Vermeulen, 1993): 0.50 Paphiopedilum (Cribb, 1987, modified): 0.57 Dendrobium sect. Spatulata (Cribb, 1986, modified): 0.60. Correspondingly, we find a wide rangeof estimates for the ‘real’ numberof known Male- sian orchid species: from 2050 to 5125. Another approach would be to look at a single area, and to compute the retention ratio for the orchid flora of that area. If we do this for Java (mainly based on Comber, 1990), Peninsular Malaysia & Singapore (Seidenfaden & Wood, 1992) and Sumatra (J.J.
    [Show full text]
  • GENOME EVOLUTION in MONOCOTS a Dissertation
    GENOME EVOLUTION IN MONOCOTS A Dissertation Presented to The Faculty of the Graduate School At the University of Missouri In Partial Fulfillment Of the Requirements for the Degree Doctor of Philosophy By Kate L. Hertweck Dr. J. Chris Pires, Dissertation Advisor JULY 2011 The undersigned, appointed by the dean of the Graduate School, have examined the dissertation entitled GENOME EVOLUTION IN MONOCOTS Presented by Kate L. Hertweck A candidate for the degree of Doctor of Philosophy And hereby certify that, in their opinion, it is worthy of acceptance. Dr. J. Chris Pires Dr. Lori Eggert Dr. Candace Galen Dr. Rose‐Marie Muzika ACKNOWLEDGEMENTS I am indebted to many people for their assistance during the course of my graduate education. I would not have derived such a keen understanding of the learning process without the tutelage of Dr. Sandi Abell. Members of the Pires lab provided prolific support in improving lab techniques, computational analysis, greenhouse maintenance, and writing support. Team Monocot, including Dr. Mike Kinney, Dr. Roxi Steele, and Erica Wheeler were particularly helpful, but other lab members working on Brassicaceae (Dr. Zhiyong Xiong, Dr. Maqsood Rehman, Pat Edger, Tatiana Arias, Dustin Mayfield) all provided vital support as well. I am also grateful for the support of a high school student, Cady Anderson, and an undergraduate, Tori Docktor, for their assistance in laboratory procedures. Many people, scientist and otherwise, helped with field collections: Dr. Travis Columbus, Hester Bell, Doug and Judy McGoon, Julie Ketner, Katy Klymus, and William Alexander. Many thanks to Barb Sonderman for taking care of my greenhouse collection of many odd plants brought back from the field.
    [Show full text]
  • International Agenda for Botanic Gardens in Conservation
    Journal of Botanic Gardens Conservation International BGjournalVolume 3 • Number 1 • January 2006 The International Agenda – five years on Forthcoming APPLIED PLANT CONSERVATION Meetings March 20 – 31, 2006 CURITIBA, BRAZIL 8th Ordinary Meeting of the Conference of the Parties to the Convention on Biological Diversity Issues for in-depth consideration are island biodiversity, biological diversity of dry and sub- 2nd ANNUAL humid lands, the Global Taxonomy Initiative, access and benefit-sharing and communication, TRAINING PROGRAM AND INTERNSHIP education and public awareness. For more information, visit the http://www.biodiv.org/doc/ meeting.aspx?mtg=COP-08 PRESENTED BY: DENVER BOTANIC GARDENS, CENTER FOR PLANT CONSERVATION June 19 - 25, 2006 SANTO DOMINGO, DOMINICAN REPUBLIC and UNITED STATES BOTANIC GARDEN IX Congress of the Latin American Botanical Society (IX Congreso Latinoamericano de Botánica) Contribuyendo al conocimiento global de la flora nativa latinoamericana (Contributing to the global knowledge of the native flora of Latin America) The objectives of this Congress are to spread JUNE 6-10, 2006: JUNE 12-16, 2006: JUNE 6 – AUGUST 5, 2006: information about the flora of Latin America and bring CPC APPLIED PLANT PLANT CONSERVATION IN NINE-WEEK PAID together the botanical community to develop plans for the conservation and sustainable use of its flora. CONSERVATION TRAINING BOTANIC GARDENS SUMMER INTERNSHIP Seminar registration is due Application deadline is For further information, please contact Sonia April 21, 2006. March 1, 2006. Lagos-Witte, President Asociación Latinoamericano Admission is competitive. de Botánica - ALB and Coordinator, IX Congreso Latinoamericano de Botánica, Jardín Botánico Nacional, Apartado Postal 21-9, Santo Domingo, Dominican Republic.
    [Show full text]
  • Vanilla Montana Ridl.: a NEW LOCALITY RECORD in PENINSULAR MALAYSIA and ITS AMENDED DESCRIPTION
    Journal of Sustainability Science and Management eISSN: 2672-7226 Volume 15 Number 7, October 2020: 49-55 © Penerbit UMT Vanilla montana Ridl.: A NEW LOCALITY RECORD IN PENINSULAR MALAYSIA AND ITS AMENDED DESCRIPTION AKMAL RAFFI1,2, FARAH ALIA NORDIN*3, JAMILAH MOHD SALIM1,4 AND HARDY ADRIAN A. CHIN5 1Institute of Tropical Biodiversity and Sustainable Development, Universiti Malaysia Terengganu, 21030, Kuala Nerus, Terengganu. 2Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, 94300, Kota Samarahan, Sarawak. 3School of Biological Sciences, Universiti Sains Malaysia, 11800 USM, Pulau Pinang. 4Faculty of Science and Marine Environment Universiti Malaysia Terengganu, 21030, Kuala Nerus, Terengganu. 5698, Persiaran Merak, Taman Paroi Jaya, 70400, Seremban, Negeri Sembilan. *Corresponding author: [email protected] Submitted final draft: 25 April 2020 Accepted: 11 May 2020 http://doi.org/10.46754/jssm.2020.10.006 Abstract: Among the seven Vanilla species native to Peninsular Malaysia, Vanilla montana was the first species to be described. But due to its rarity, it took more than 100 years for the species to be rediscovered in two other localities. This paper describes the first record of V. montana in Negeri Sembilan with preliminary notes on its floral development and some highlights on the ecological influences. We also proposed a conservation status for the species. The data obtained will serve as an important botanical profile of the species, and it will add to our knowledge gaps on the distribution of this distinctive orchid in Malaysia. Keywords: Biodiversity, florivory, endangeredVanilla , Orchidaceae, Negeri Sembilan. Introduction the peninsula (Go et al., 2015a). Surprisingly, In Peninsular Malaysia, the genus Vanilla Plum.
    [Show full text]
  • Phylogeny, Character Evolution and the Systematics of Psilochilus (Triphoreae)
    THE PRIMITIVE EPIDENDROIDEAE (ORCHIDACEAE): PHYLOGENY, CHARACTER EVOLUTION AND THE SYSTEMATICS OF PSILOCHILUS (TRIPHOREAE) A Dissertation Presented in Partial Fulfillment of the Requirements for The Degree Doctor of Philosophy in the Graduate School of the Ohio State University By Erik Paul Rothacker, M.Sc. ***** The Ohio State University 2007 Doctoral Dissertation Committee: Approved by Dr. John V. Freudenstein, Adviser Dr. John Wenzel ________________________________ Dr. Andrea Wolfe Adviser Evolution, Ecology and Organismal Biology Graduate Program COPYRIGHT ERIK PAUL ROTHACKER 2007 ABSTRACT Considering the significance of the basal Epidendroideae in understanding patterns of morphological evolution within the subfamily, it is surprising that no fully resolved hypothesis of historical relationships has been presented for these orchids. This is the first study to improve both taxon and character sampling. The phylogenetic study of the basal Epidendroideae consisted of two components, molecular and morphological. A molecular phylogeny using three loci representing each of the plant genomes including gap characters is presented for the basal Epidendroideae. Here we find Neottieae sister to Palmorchis at the base of the Epidendroideae, followed by Triphoreae. Tropidieae and Sobralieae form a clade, however the relationship between these, Nervilieae and the advanced Epidendroids has not been resolved. A morphological matrix of 40 taxa and 30 characters was constructed and a phylogenetic analysis was performed. The results support many of the traditional views of tribal composition, but do not fully resolve relationships among many of the tribes. A robust hypothesis of relationships is presented based on the results of a total evidence analysis using three molecular loci, gap characters and morphology. Palmorchis is placed at the base of the tree, sister to Neottieae, followed successively by Triphoreae sister to Epipogium, then Sobralieae.
    [Show full text]
  • Biogeography of the Monocotyledon Astelioid Clade (Asparagales): a History of Long-Distance Dispersal and Diversification with Emerging Habitats
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2021 Biogeography of the monocotyledon astelioid clade (Asparagales): A history of long-distance dispersal and diversification with emerging habitats Birch, Joanne L ; Kocyan, Alexander Abstract: The astelioid families (Asteliaceae, Blandfordiaceae, Boryaceae, Hypoxidaceae, and Lanari- aceae) have centers of diversity in Australasia and temperate Africa, with secondary centers of diversity in Afromontane Africa, Asia, and Pacific Islands. The global distribution of these families makes this an excellent lineage to test if current distribution patterns are the result of vicariance or long-distance dispersal and to evaluate the roles of tertiary climatic and geological drivers in lineage diversification. Sequence data were generated from five chloroplast regions (petL-psbE, rbcL, rps16-trnK, trnL-trnLF, trnS-trnSG) for 104 ingroup species sampled across global diversity. The astelioid phylogeny was inferred using maximum parsimony, maximum likelihood, and Bayesian inference methods. Divergence dates were estimated with a relaxed clock applied in BEAST. Ancestral ranges were reconstructed in ’BioGeoBEARS’ applying the corrected Akaike information criterion to test for the best-fit biogeographic model. Diver- sification rates were estimated in Bayesian Analysis of Macroevolutionary Mixtures [BAMM]. Astelioid relationships were inferred as Boryaceae(Blandfordiaceae(Asteliaceae(Hypoxidaceae plus Lanariaceae))). The crown astelioid node was dated to the Late Cretaceous (75.2 million years; 95% highest posterior densities interval 61.0-90.0 million years) with an inferred Eastern Gondwanan origin. However, aste- lioid speciation events have not been shaped by Gondwanan vicariance. Rather long-distance dispersal since the Eocene is inferred to account for current distributions.
    [Show full text]
  • E29695d2fc942b3642b5dc68ca
    ISSN 1409-3871 VOL. 9, No. 1—2 AUGUST 2009 Orchids and orchidology in Central America: 500 years of history CARLOS OSSENBACH INTERNATIONAL JOURNAL ON ORCHIDOLOGY LANKESTERIANA INTERNATIONAL JOURNAL ON ORCHIDOLOGY Copyright © 2009 Lankester Botanical Garden, University of Costa Rica Effective publication date: August 30, 2009 Layout: Jardín Botánico Lankester. Cover: Chichiltic tepetlauxochitl (Laelia speciosa), from Francisco Hernández, Rerum Medicarum Novae Hispaniae Thesaurus, Rome, Jacobus Mascardus, 1628. Printer: Litografía Ediciones Sanabria S.A. Printed copies: 500 Printed in Costa Rica / Impreso en Costa Rica R Lankesteriana / International Journal on Orchidology No. 1 (2001)-- . -- San José, Costa Rica: Editorial Universidad de Costa Rica, 2001-- v. ISSN-1409-3871 1. Botánica - Publicaciones periódicas, 2. Publicaciones periódicas costarricenses LANKESTERIANA i TABLE OF CONTENTS Introduction 1 Geographical and historical scope of this study 1 Political history of Central America 3 Central America: biodiversity and phytogeography 7 Orchids in the prehispanic period 10 The area of influence of the Chibcha culture 10 The northern region of Central America before the Spanish conquest 11 Orchids in the cultures of Mayas and Aztecs 15 The history of Vanilla 16 From the Codex Badianus to Carl von Linné 26 The Codex Badianus 26 The expedition of Francisco Hernández to New Spain (1570-1577) 26 A new dark age 28 The “English American” — the journey through Mexico and Central America of Thomas Gage (1625-1637) 31 The renaissance of science
    [Show full text]
  • Triphora Trianthophora (Swartz) Rydb. Three-Birds Orchid
    New England Plant Conservation Program Conservation and Research Plan Triphora trianthophora (Swartz) Rydb. Three-birds Orchid Prepared by: Jennifer M. Ramstetter Professor of Biology Marlboro College For: New England Wild Flower Society 180 Hemenway Road Framingham, MA 01701 508/877-7630 e-mail: [email protected] • website: www.newfs.org Approved, Regional Advisory Council, May 2001 SUMMARY Triphora trianthophora (Swartz) Rydberg (Ochidaceae), three-birds orchid or nodding pogonia, is represented by 24 current occurrences in New England. Triphora trianthophora is protected as a threatened (T) or endangered (E) species in Maine (T), Vermont (T), New Hampshire (T), and Massachusetts (E); it is thought to be extirpated in Connecticut. It is a Division 2a plant species according to the Flora Conservanda: New England of the New England Plant Conservation Program. There are also several undocumented occurrences in New Hampshire. Recent fieldwork indicates that three of the occurrences may be extirpated, and only ten occurrences had greater than 100 stems at the most recent survey. Current occurrences represent about half of all known current and historic occurrences. The orchid is also rare and threatened in much of its range in North America; it is an S1 or S2 species in 19 of the 30 states in which it occurs and in Ontario. In New England, the orchid typically occurs in moist hardwood forests dominated by beech in conditions of filtered light. Plants frequently grow in hollows filled with deep leaf litter with few or no other herbaceous plant species co-occurring. Triphora trianthophora is thought to depend upon mycorrhizal relationships and to act as a semi-saprophyte.
    [Show full text]
  • Networks in a Large-Scale Phylogenetic Analysis: Reconstructing Evolutionary History of Asparagales (Lilianae) Based on Four Plastid Genes
    Networks in a Large-Scale Phylogenetic Analysis: Reconstructing Evolutionary History of Asparagales (Lilianae) Based on Four Plastid Genes Shichao Chen1., Dong-Kap Kim2., Mark W. Chase3, Joo-Hwan Kim4* 1 College of Life Science and Technology, Tongji University, Shanghai, China, 2 Division of Forest Resource Conservation, Korea National Arboretum, Pocheon, Gyeonggi- do, Korea, 3 Jodrell Laboratory, Royal Botanic Gardens, Kew, Richmond, United Kingdom, 4 Department of Life Science, Gachon University, Seongnam, Gyeonggi-do, Korea Abstract Phylogenetic analysis aims to produce a bifurcating tree, which disregards conflicting signals and displays only those that are present in a large proportion of the data. However, any character (or tree) conflict in a dataset allows the exploration of support for various evolutionary hypotheses. Although data-display network approaches exist, biologists cannot easily and routinely use them to compute rooted phylogenetic networks on real datasets containing hundreds of taxa. Here, we constructed an original neighbour-net for a large dataset of Asparagales to highlight the aspects of the resulting network that will be important for interpreting phylogeny. The analyses were largely conducted with new data collected for the same loci as in previous studies, but from different species accessions and greater sampling in many cases than in published analyses. The network tree summarised the majority data pattern in the characters of plastid sequences before tree building, which largely confirmed the currently recognised phylogenetic relationships. Most conflicting signals are at the base of each group along the Asparagales backbone, which helps us to establish the expectancy and advance our understanding of some difficult taxa relationships and their phylogeny.
    [Show full text]