ISSN 1346-7565 Acta Phytotax. Geobot. 70 (3): 149–158 (2019) doi: 10.18942/apg.201901
Rediscovery of Liparis hostifolia (Orchidaceae) on Minami-iwo-to Island in the Bonin (Ogasawara) Archipelago, Japan, and its Identification Using Molecular Sequences from a Herbarium Specimen Collected more than 100 Years Ago
1,† 2,† 3 4 Koji Takayama , Chie Tsutsumi , Dairo Kawaguchi , Hidetoshi Kato and 2,* Tomohisa Yukawa
1Department of Botany, Graduate School of Science, Kyoto University, Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan; 2 Department of Botany, National Museum of Nature and Science, 4-1-1 Amakubo, Tsukuba 305- 0005, Japan. *[email protected] (author for correspondence); 3 Ogasawara Islands Branch Office, Tokyo Metropolitan Government, Nishimachi, Chichi-jima, Ogasawara-mura, Tokyo 100-2101, Japan; 4 Department of Biological Sciences, Tokyo Metropolitan University, 1-1 Minami Osawa, Hachioji, Tokyo 192-0397, Japan. † These authors contributed equally to this work
Liparis hostifolia (Orchidaceae) on Minami-iwo-to Island in the Bonin (Ogasawara) Archipelago was rediscovered for the first time in 79 years during a field survey in 2017. Its identity was confirmed by morphological comparison and DNA extractions from herbarium specimens collected between 1914 and 1938. Results from the molecular phylogenetic analyses demonstrated that L. hostifolia belongs to the L. makinoana complex. In comparison with other members of the L. makinoana complex, the broadly ovate labellum, short dormancy period, and flowering from November to March are unique characteristics of L. hostifolia. Results from the molecular phylogenetic analyses also suggested that L. hostifolia has had a long-isolated history in the Bonin Archipelago and probably migrated from temperate East Asia.
Key words: Bonin Archipelago, chloroplast, endangered species, herbarium specimen, ITS, Liparis, oceanic islands, Orchidaceae, rediscovery, Volcano Islands
Liparis Rich. (Orchidaceae) is a cosmopolitan since 1938. The species is treated as Critically genus consisting of about 320 species (Pridgeon Endangered (CR) in the Red List of Japanese vas- et al. 2005). In Japan, 17 species of Liparis are cular plants (Ministry of the Environment 2018). recognized (Yukawa 2015). Liparis hostifolia Minami-iwo-to Island, an oceanic island, is (Koidz.) Koidz. ex Nakai was originally proposed located ca. 1,300 km south of Tokyo (Fig. 1). The with a brief description as a variety of L. auricu- island belongs to the Volcano Islands group, lata Blume ex Miq. from Chichi-jima Island, one which consists of Kita-iwo-to Island, Iwo-to Is- of the Bonin (Ogasawara) Archipelago, Japan land, and Minami-iwo-to Island. The natural en- (Koidzumi 1916). Tuyama (1937) provided a vironment of Minami-iwo-to Island has been well more detailed description and reported a new lo- preserved because it remains uninhabited by hu- cality, Minami-iwo-to Island in the Volcano Is- mans. Of the 135 species of vascular plants re- lands group. No further collections of L. hostifo- ported from the island (Fujita et al. 2008, Takaya- lia, however, have been made on Minami-iwo-to ma et al. 2018), ca. 70 % of them are common on Island since 1936 and from Chichi-jima Island other islands in the Volcano Islands group and ca. 150 Acta Phytotax. Geobot. Vol. 70
70 % are on islands of the Bonin Islands group (Chichi-jima Islands, Haha-jima Islands, and Mu- ko-jima Islands) (Ohba 1983). Minami-iwo-to Is- land is relatively young compared to other islands of the Bonin Islands group. The Bonin Islands group was formed by submarine volcanic activity during the Paleogene and uplifted starting in the Pleistocene and rising above sea level before the Middle Pleistocene (Kaizuka 1977, Imaizumi & Tamura 1984). The islands of the Volcano Islands group are considered to be younger, with approx- Fig. 1. Map of the Bonin (Ogasawara) Archipelago. imate ages of 140 thousand years for Kita-iwo-to Island and 30 thousand years for Minami-iwo-to Island (Nakano et al. 2009). Therefore, the flora for morphological analysis. of Minami-iwo-to Island is considered to have DNA from the plants collected from Minami- originated elsewhere and migrated to the island iwo-to Island was extracted from silica-gel-dried by recent long-distance dispersal. material with the DNeasy Plant Mini Kit (Qiagen, During a field survey from 13 to 26 June 2017 Valencia, California, USA) following the manu- we found plants of Liparis on Minami-iwo-to Is- facturer’s instructions. The internal transcribed land. To identify them and to clarify their charac- spacer regions of 18S–26S nuclear ribosomal teristics, we studied their morphology, phenology, DNA (ITS) and three chloroplast regions (part of and molecular phylogeny and compared them to matK, trnL with trnL-trnF spacer, trnS-trnG closely related species. Molecular analyses were spacer) were analyzed. Procedures for amplifica- also conducted using DNA from herbarium spec- tion and sequencing followed those in Tsutsumi imens collected on Chichi-jima Island and Mina- et al. (2007). mi-iwo-to Island before 1938. DNA from herbarium specimens was extract- ed with the modified CTAB method of Doyle & Doyle (1987). Three specimens in the herbarium of the University of Tokyo (TI) were used for Materials and Methods DNA extraction; Chichi-jima Island, 15 Novem- ber 1914, collector unknown s.n. (TI06460); Chi- We conducted a scientific expedition to Mina- chi-jima Island, 1 March 1938, T. Tuyama s.n. mi-iwo-to Island from 13 to 26 June 2017, to in- (TI06457); Minami-iwo-to Island, 31 March vestigate the vegetation and flora of the island. 1936, T. Tuyama s.n. (TI06456). The ITS regions The only route to the island’s summit (altitude were amplified with newly developed primers de- 916 m) was blazed by climbing specialists. It was signed for product sizes of ca. 150 bp (Table 1) from along this route that we collected plant ma- because fragmentations were estimated in DNA terials. Six individuals of Liparis were collected extractions from herbarium specimens. For the from the edge of a scrub-forest at 700 m eleva- sample TI06460, PCR was performed with EX tion. Three individuals had old scapes without Taq DNA polymerase (TaKaRa Biomedical, To- flowers or fruits. Two mature plants and one juve- kyo) with Ampdirect (Shimadzu, Kyoto) follow- nile cultivated in Tsukuba Botanical Garden, Na- ing the manufacturer’s instruction. For the sam- tional Museum of Nature and Science, were used ples TI06456 and TI06457, PCR was performed for the phylogenetic analyses. The other three in- with EX Taq DNA polymerase with 5% dimethyl dividuals were used for voucher specimens. sulfoxide (DMSO). The GenBank accession Flowers on these plants opened from November numbers are shown in Table 1. 2017 to January 2018 in the garden were collected Phylogenetic analyses were performed by October 2019 Takayama & al. – Rediscovery of Liparis hostifolia 151
Table 1. Primers for DNA analyses from herbarium specimens of Liparis hostifolia in the University of Tokyo (TI) and Gen- Bank accession numbers. Region Primers Product Genbank accession numbers Forward (5->3) Reverse (5->3) Size Collector T. Tuyama s.n T. Tuyama s.n (bp) unknown (TI06456) (TI06457) (TI06460) ITS_La GTTCGCCGCCTGTGACTC TGAAGGCATGTGCCAACACT 169 LC431213 no success no success ITS_Lb TGGCACATGCCTTCATAAAA AACCCAATAYAAGGCTCACG 144 LC431214 LC431217 LC431217 ITS_Lc TTGAAAACACGTGAGCCTTR TTGCGTTCAAAGACTCGATG 180 LC431215 no success no success ITS_Ld CCGTGAACCATCGAGTCTTT GAGGAGCCACTCTACGCATC 154 LC431216 LC431218 LC431218
Table 2. Comparison of floral characters inLiparis hostifolia, L. makinoana complex (see Tsutsumi et al. 2019) and, L. yong- noana. L. hostifolia L. makinoana complex L. yongnoana L. suzumushi L. makinoana L. longiracemosa Material used Description in Herbarium in this study Tuyama (1937) specimens inflorescence 10–17 –20 8–20 10–25 10–35 15–40 9–12 length (cm) flower number 6–7 no description 3–14(–20) 4–16 4–30 4–40 4–5 lateral sepal 11–14 10 10–12 13–16 8–11 8–11 7–8 length (mm) lateral sepal 2.5–4 1.5 not measured 3.5–4 2–3 2.5–3.5 2.5 width (mm) * labellum shape broadly ovate, broadly ovate broadly ovate broadly ovate to ovate, slightly ovate, slightly ovate, slightly strongly ovate, slightly recurved recurved recurved recurved recurved labellum 11–15 11 10–14 14–17 9–12 8–10 9–10 length (mm) labellum 10–14 9 10–13 11–15 6–9 5–7 7–8 width (mm) column 5–6 5 5–6 5.5–7 4–5 4–5 3–3.5 length (mm) labellum color pale green to no description obscure pale green, pale green to pale green, light pale green light purple light to dark light purple to dark purple with dark with dark purple with with purple with purple veins purple central purple veins purple veins veins groove flowering Nov. to Jan. no description Nov. to Mar. Mar. to Jun. Jun. to Jul. Jun. to Jul. Jun. to Jul. season * Lateral sepal margins are strongly revolute. Our measurements were made from flattened sepals; Tuyama (1937) possibly measured sepals in their original posture.
Bayesian analysis using MrBayes 3.1.2 (Huelsen- Liparis liliifolia (L.) Rich. ex Lindl. and L. lo- beck & Ronquist 2001, Ronquist & Huelsenbeck eselii (L.) Rich. were set as outgroups based on 2003) and by maximum parsimony (MP) using the results of Tsutsumi et al. (2007) and Perazza PAUP 4.0a157 (Swofford 2002). The results from & Tsutsumi (2015). The ITS sequence data of the preliminary molecular and morphological L. hawaiensis H. Mann from GenBank were also analyses showed a close affinity of the plants included in the dataset. from Minami-iwo-to Island to members of the Li- We constructed trees deduced from ITS, chlo- paris makinoana complex in which three mor- roplast, and the combined datasets, independent- phologically distinct species, L. suzumushi Tsut- ly. MrModeltest 2.0 (Nylander 2004) was used to sumi, T. Yukawa & M. Kato, L. makinoana Schl- determine the nucleotide substitution model. tr., and L. longiracemosa Tsutsumi, T. Yukawa & Bayesian searches were conducted by MCMC M. Kato, are included (Tsutsumi et al. 2019). We with two independent sets of four chains, each used the sequence data of the L. makinoana com- run for 10 million generations, sampling every plex and close relatives as the ingroup (Appendix ). 100 generations. Tracer (Rambaut & Drummond 152 Acta Phytotax. Geobot. Vol. 70
2009) was used to check that the runs had reached share undulating leaf margins and a beaked an- stationarity, and that effective sample size of all ther cap. Liparis hostifolia can be distinguished the parameters was high (>100). The first 2.5 mil- from the other members of the L. makinoana lion generations, before sufficient stationary gen- complex by its broadly ovate, strongly recurved erations, were discarded as burn-in periods; the labellum (vs. an ovate, slightly revolute label- remaining trees were used to calculate posterior lum), and dark purple veins and staining on the probabilities. In the MP method, all the charac- labellum (vs. inconspicuous purple veins and ters were equally weighted and heuristic searches staining on the labellum). were conducted with 1,000 random addition rep- licates involving TBR branch swapping. Boot- Phylogeny strap values were calculated with 1,000 replicates All three plants from Minami-iwo-to Island of 100 random replications. To assess tree incon- collected in 2017 and examined in this study had gruence between ITS and chloroplast datasets, identical sequences in their ITS and chloroplast the parsimony-based ILD test (Farris et al. 1995) regions. Parts of the ITS regions were success- was performed using the partition homogeneity fully amplified from the herbarium specimens test in PAUP* with 100 random taxon addition, (Table 1). The ITS sequences (781 bp) from the TBR branch swapping, and heuristic searches of 2017 Minami-iwo-to collections were the same as 1,000 replications. those from the following specimens: TI06457 from Chichi-jima Island collected in 1938 (211 bp), TI06456 from Minami-iwo-to Island collect- Results and Discussion ed in 1936 (211 bp), and TI06460 from Chichi-ji- ma Island collected in 1914 (384 bp) except for a Habitat single heterosite. These results support our con- The Liparis population on Minami-iwo-to Is- clusion that the 2017 Minami-iwo-to specimens land was at the edge of scrub forest comprising are identical to previously collected specimens of Eurya japonica Thunb., Boehmeria nivea (L.) Liparis hostifolia from Chichi-jima Island and Gaudich. var. nivea, and Melastoma candidum Minami-iwo-to Island. D. Don, with several species of orchids, such as The topologies of the phylogenetic trees were Zeuxine boninensis Tuyama (Yukawa et al. 2018), consistent between the Bayesian and MP meth- Goodyera procera (Ker Gawl.) Hook., and ods. In the MP analyses, we obtained 60 most Calanthe triplicata (Willem.) Ames. The habitat, parsimonious trees from the ITS dataset (tree an open, south-facing, rocky slope with shallow length = 76, CI = 0.9342, HI = 0.0658, RI = soil at an elevation of 700 m, is often covered by 0.9383), 42 from the chloroplast dataset (tree clouds (Fig. 2A, B). length = 139, CI = 0.9640, HI = 0.0360, RI = 0.9746), and 20 from the ITS and chloroplast Morphology combined dataset (tree length = 215, CI = 0.9488, The morphological characteristics of the HI = 0.0512, RI = 0.9641), respectively. specimens we collected matched the published Phylogenetic analysis of the ITS regions description and herbarium specimens of Liparis showed that Liparis hostifolia forms a monophy- hostifolia, except for the slightly shorter inflores- letic clade and that it forms a clade with members cence and larger sepals and labellum than de- of the L. makinoana complex and the Korean L. scribed by Tuyama (1937) (Fig. 2C, Table 2). We, yongnoana N. S. Lee, C. S. Lee & K. S. Lee with thus, identified our material as L. hostifolia. Li- moderately high support (Fig. 3). The results de- paris hostifolia is morphologically similar to L. duced from the chloroplast regions (part of matK, suzumushi, L. makinoana, L. longiracemosa, and trnL-F, and trnS-G) did not provide strong evi- other taxa in the L. makinoana complex (Tsutsu- dence on the aforementioned relationships (Fig. mi & Yukawa 2008, Tsutsumi et al. 2019); they 4). The results of the ILD test, however, suggest October 2019 Takayama & al. – Rediscovery of Liparis hostifolia 153
Fig. 2. Liparis hostifolia. A–B. Natural habitat on Minami-iwo-to Island. C. Flowering in Tsukuba Botanical Garden on 2 De- cember 2017. no inconsistencies between the ITS and chloro- level. plast regions (p = 0.31). Thus, it was reasonable to combine the two datasets. The results obtained Phenology from the combined dataset showed that Liparis The leaves withered from September to No- hostifolia forms a sister group with a clade com- vember in the three plants of Liparis hostifolia prising three taxa in the L. makinoana complex cultivated since the end of June 2017 in Tsukuba and with L. yongnoana with high support (Fig. Botanical Garden. One to two months after the 5). leaves withered, an axillary bud developed from Sequence identities of Liparis hostifolia were the previous year’s pseudobulb. We found a scape 99.2% and 97.1% from the closely related L. maki- in the two folded leaves in two of the three indi- noana complex, and 98.8% and 97.7 % from L. viduals. There were no flowers on the other indi- kumokiri F. Maek. in the ITS and the chloroplast vidual, presumably owing to its immaturity. In regions, respectively. These results suggest that the first individual, the basal-most flower opened L. hostifolia is genetically differentiated from on 16 November and seven flowers opened by 5 closely related species. Further, L. yongnoana, a December. In the second individual, the basal- morphologically distinct species from the Korean most flower opened on 17 December and six flow- Peninsula, occupies a nested phylogenetic posi- ers bloomed by 7 January. Flowers on the herbar- tion between L. hostifolia and the L. makinoana ium specimens of L. hostifolia were produced complex. All of the above evidence supports the from November to March (Table 2). independent status of L. hostifolia at the species Close relatives to Liparis hostifolia, such as Fig. 3
154 Acta Phytotax. Geobot. Vol. 70
L. hostifolia 1 L. hostifolia TI6460 91 L. hostirolia TI6456, TI6457
L. longiracemosa 0.99 83 L. suzumushi
L. yongnoana
L. makinoana L2, L7
L. fujisaensis L1, L18 1 L. koreojaponica L3, L4, L41 100 L. hawaiensis
L. kumokiri L9, L15, L16, 99-60
L. pterosepala 1 100 1 L. kumokiri subsp. nemoralis L204 93 L. kumokiri subsp. nemoralis L201, L203 L. purpureovittata L24, L27 L. derchiensis
L. loeselii
L. liliifolia
0.0040
Fig. 3. Phylogenetic tree of Liparis sect. Liparis by Bayesian analysis based on nuclear ribosomal ITS sequences (860 bp). Numbers above and below branches indicate posterior probabilities (> 0.9) by Bayesian method and bootstrap values (> 70) by MP method, respectively. taxa in the Liparis makinoana complex and L. and characteristics of phenology in endemic spe- kumokiri, wilt and shed their leaves in autumn cies of the Bonin Archipelago and their progeni- (October and November). Following dormancy in tors. winter, an axillary bud develops in spring (April and May) and flowers open from May to July Evolution and Conservation (Chen et al. 2009, Yukawa 2015, Tsutsumi et al. The origin of the flora of the Bonin Archipel- 2019). Observations from the present study sug- ago is phytogeographically interesting because gest that L. hostifolia has early defoliation, short the islands are volcanic in origin and are geo- dormancy compared to congeneric species that graphically isolated from other landmasses. Ito have been investigated, and a flowering period (1998) suggested that plant species endemic to the from late autumn to early spring (November to Bonin Archipelago mostly originated either from March). Such leaf and flower phenology likely tropical and subtropical Southeast Asia or from evolved in the subtropical, oceanic Bonin Archi- mainland Japan, with some coming from the pelago and may be related to the dry summers Mariana Islands. Of the 135 vascular plant spe- and warm winters there. Defoliation after mid- cies recorded on Minami-iwo-to Island, only nine summer has also been noted in several Bonin en- are considered to be endemic to the Volcano Is- demics, such as Celtis boninensis Koidz., Morus lands group, and ca. 70% of them are commonly boninensis Koidz., and Wikstroemia pseudoretu- distributed throughout the Bonin Islands group. sa Koidz. on Chichi-jima Island (Shimizu 1983). Considering that Liparis hostifolia was nested in Further study is required to determine the evolu- the clade of the L. makinoana complex, L. ku- tionary connection between climatic conditions mokiri, and relatives, which are distributed in Fig. 4
October 2019 Takayama & al. – Rediscovery of Liparis hostifolia 155
L. fujisanensis L1 1 95 L. fujisanensis L18
L. kumokiri subsp. nemoralis L204 1 88 L. kumokiri subsp. nemoralis L201, L203 0.93 L. kumokiri 99-60 75 L. kumokiri L15 0.98 L. kumokiri L9, L16 -- L. koreojaponica L3 1 1 L. koreojaponica L4 96 95 1 L. koreojaponica L41 87 L. pterosepala
L. purpureovittata L24 1 100 L. purpureovittata L27 1 100 L. hostifolia
L. makinoana L2
L. makinoana L7 0.98 1 76 100 L. suzumushi 1 100 L. longiracemosa L. yongnoana
L. derchiensis
L. loeselii
L. liliifolia
0.0030
Fig. 4. Phylogenetic tree of Liparis sect. Liparis by Bayesian analysis based on chloroplast regions of part of matK, trnL-F, and trnS-G sequences (2,778 bp). Numbers above and below branches indicate posterior probabilities (> 0.9) by Bayesian method and bootstrap values (> 70) by MP method, respectively. temperate to subarctic areas of Japan, the Korean in the Hawaiian Islands, another group of oceanic Peninsula, temperate and subarctic areas of Chi- islands in the Pacific Ocean. Liparis hawaiensis na, and Far East Russia, the ancestral stock of this is similar in morphology to the L. makinoana species likely dispersed from temperate East complex, L. kumokiri, and relatives. Molecular Asia. Substantial divergence of DNA sequences phylogeny of ITS regions (Fig. 3) suggest that L. and morphological characters of Liparis hostifo- hawaiensis is not phylogenetically close to L. lia from other closely related species suggest that hostifolia, but to L. kumokiri and its relatives, it has been isolated for a considerable period of which are mainly distributed in Japan, Korea, time in the Bonin Archipelago. Since the Volcano and Far East Russia. Those data suggest that L. Islands group, where we found L. hostifolia, was hawaiensis likely migrated from temperate East formed ca. 30 thousand years ago (Nakano et al. Asia and evolved in the Hawaiian Islands inde- 2009), we considered that it originally evolved on pendent from L. hostifolia in the Bonin Archipel- another island, probably, Chichi-jima Island, and ago. then migrated to Minami-iwo-to Island. Since Liparis hostifolia has not been found on It is interesting to note that Liparis hawaien- Chichi-jima Island since 1938, it may be extinct sis, a close relative of L. hostifolia, is distributed there due to excessive exploitation of the vegeta- Fig. 5
156 Acta Phytotax. Geobot. Vol. 70
L. makinoana L2 1 0.99 77 L. makinoana L7
0.96 L. suzumushi
1 L. longiracemosa 100 0.99 L. yongnoana 93 L. hostifolia
L. kumokiri L9
L. kumokiri 99-60 0.99 L. kumokiri L15
L. kumokiri L16 1 100 L. pterosepala
1 L. kumokiri subsp. nemoralis L201 90 1 L. kumokiri subsp. nemoralis L203 96 L. kumokiri subsp. nemoralis L204
L. koreojaponica L3
1 L. koreojaponica L4 1 1 98 100 100 L. koreojaponica L41
1 L. fujisanensis L1 97 L. fujisanensis L18
1 L. purpureovittata L24 100 L. purpureovittata L27
L. derchiensis
L. loeselii
L. liliifolia
0.0030
Fig. 5. Phylogenetic tree of Liparis sect. Liparis by Bayesian analysis based on concatenated nuclear ribosomal ITS and chloroplast regions (3638 bp). Numbers above and below branches indicate posterior probabilities (> 0.9) by Bayesian method and bootstrap values (> 70) by MP method, respectively. tion. Although further exploration of the habitat glabrous, ridged, green. Bract ovate, acute, 1–5 is necessary, the species as it is now known to oc- mm long, green. Ovary pedicellate, clavate, cur is critically endangered, and therefore its con- twisted, 7–14 mm long, green. Dorsal sepal lin- servation, ex-situ cultivation, and propagation ear-lanceolate, subacute, occasionally slightly should be prioritized. revolute, erect or somewhat recurved, 11–14 mm long, 2.5–3.5 mm wide, green. Lateral sepals Description obliquely ovate or obliquely lanceolate, subacute, Liparis hostifolia (Koidz.) Koidz. ex Nakai revolute, 10–14 mm long, 2.5–4 mm wide, green. Herbs, winter green, perennial. Pseudobulb Petals falcate, linear, obtuse, strongly revolute, oblong-ovoid, ca. 2 cm long. Leaves 2; petiole pendulous, sometimes slightly twisted, 10–13 3–11 cm long, winged; blade ovate-elliptic, mar- mm long, 0.5–1 mm wide, green. Labellum entire gin somewhat undulate, obtuse or subacute, 5–12 or minutely erose, broadly ovate, shortly clawed, cm long, 3–7 cm wide, conduplicate, glossy, gla- strongly recurved, base cordate and dilated above brous, green. Inflorescence terminal, racemose, the base, obtuse or apiculate, 10–15 mm long, 8–20 cm long, bearing 3–14(–20) flowers; axis 9–14 mm wide, pale green to light purple, dif- October 2019 Takayama & al. – Rediscovery of Liparis hostifolia 157 fused with dark purple on veins. Column terete, incurved, apically with rounded wings, base di- References lated, 5–6 mm long, pale green, dark purple at base and central dorsal surface; pollinia four, in Chen, X., P. Ormerod & J. J. Wood. 2009. Liparis. In: Wu, two pairs, waxy, yellow; anther cap ovoid, beaked Z. Y., P. H. Raven & D. Y. Hong (eds.), Flora of China, vol. 25, pp. 211–228. Science Press, Beijing & Mis- at apex, green. souri Botanical Garden, St. Louis. Doyle, J. J. & J. L. Doyle. 1987. A rapid DNA isolation Distribution. JAPAN. Bonin (Ogasawara) Ar- procedure for small quantities of fresh leaf tissue. chipelago: Chichi-jima Island (probably extinct), Phytochem. Bull. 19: 11–15. Minami-iwo-to Island. Farris, J. S., M. Källersjö, A. G. Kluge & C. Bult. 1995. Testing significance of incongruence. Cladistics 10: 315–319. Japanese name. Shima-kumokiri-so. Fujita, T., K. Takayama, T. Shumiya & H. Kato. 2008. Vascular flora of Minami-Iwo-To Island. Ogasawara Specimens examined. JAPAN. Tokyo. Bonin (Ogas- Res. 33: 49–62 (in Japanese). awara) Archipelago: Chichi-jima Island: Shigure-yama, 1 Huelsenbeck, J. P. & F. Ronquist. 2001. MrBayes: Bayes- October 1912, S. Nishimura 63 (TI00011335) (Lectotype: ian inference of phylogenetic trees. Bioinformatics designated by Tuyama, 1937); Shigure-yama, 1 October 17: 754–755. 1913, S. Nishimura s.n. (TI00011336) (Possibly an isolec- Imaizumi, T. & T. Tamura. 1984. Geomorphology of the totype: the locality and the collection date, except the Chichi-jima and Haha-jima lslands Ogasawara-Ken- year, are the same as on the lectotype. The year, 1913, kyu-Nenpo 7: 3–11 (in Japanese). may have been mistaken for 1912); Locality unknown, 15 Ito, M. 1998. Origin and evolution of endemic plants of November 1914, collector unknown (TI06460); Takeda- the Bonin (Ogasawara) Islands. Res. Populat. Ecol. bokujyo, 1 March 1938, T. Tuyama s.n. (TI06457). Mina- 40: 205–212. mi-iwo-to Island: close to the mountain summit, 800 m Kaizuka, S. 1977. Geology and geomorphology of the Bo- alt., 31 March 1936, T. Tuyama s.n. (TI06456); along the nin Islands. Ogasawara-Kenkyu-Nenpo 1: 29–34 (in route up to the mountain summit, 700 m alt., 21 June 2017, Japanese). K. Takayama et al. 17062125 (TNS1304743). Bonin Ar- Koidzumi, G. 1916. Decades Plantarum Novarum vel mi- chipelago: locality unknown, collector unknown s.n. nus Cognitarum. Bot. Mag. (Tokyo) 30: 325–333. (TI06461). Ministry of the Environment of Japan. 2018. Red List 2018.
Bayesian phylogenetic inference under mixed mod- preliminary report. Bull. Natl. Sci. Mus. Tokyo, B. els. Bioinformatics 19: 1572–1574. 34: 89–94. Shimizu, Y. 1983. Phenological studies of the subtropical Tsutsumi, C., T. Yukawa & M. Kato. 2019. Taxonomic re- broad-leaved evergreen forests at Chichijima Island appraisal of Liparis japonica and L. makinoana (Or- in the Bonin (Ogasawara) Islands. Jap. J. Ecol. 33: chidaceae). Bull. Natl. Sci. Mus. Tokyo, B. 45: 107– 135–147. 118. Swofford, D. L. 2002. PAUP*, Phylogenetic analysis us- Tuyama, T. 1937. Plantae Boninenses novae vel criticae 9. ing parsimony (* and other methods), Version 4.0b10. Bot. Mag. (Tokyo) 51: 125–132. Sinauer Associates, Sunderland, Massachusetts. Yukawa, T. 2015. Orchidaceae. In: Ohashi, H., Y. Kadota, Takayama, K., T. Shumiya, D. Kawaguchi & H. Kato. J. Murata, K. Yonekura & H. Kihara (eds.), Wild 2018. Vascular plants of Minami-Iwo-To Island. Oga- Flowers of Japan, vol. 1, pp. 178–231, pl. 125–164. sawara Res. 44: 125–135. Heibonsha, Tokyo (in Japanese). Tsutsumi, C., T. Yukawa, N. S. Lee, C. S. Lee & M. Kato. Yukawa, T., Y. Yamashita, K. Takayama, D. Kawaguchi, 2007. Phylogeny and comparative seed morphology C. Tsutsumi, T. Huai-Zhen & H. Kato. 2018. Discov- of epiphytic and terrestrial species of Liparis (Orchi- ery of Zeuxine sakagutii (Orchidaceae) from the Oga- daceae) in Japan. J. Plant Res. 120: 405–412. sawara (Bonin) Islands and taxonomic reappraisal of Tsutsumi, C. & T. Yukawa. 2008. Taxonomic status of Li- the species. Bull. Natl. Sci. Mus. Tokyo, B. 44: 1–8. paris japonica and L. makinoana (Orchidaceae): a
Received September 5, 2018; accepted January 11, 2019
Appendix. Materials used the molecular phylogenetic analysis. Information of each sample is shown in the following order: taxon, isolate code (if any), locality, herbarium code and number, and GenBank accession numbers in order ITS, trnL with trnL-trnF spacer, trnS-trnG spacer, and part of matK. Liparis hostifolia (Koidz.) ex Nakai; Minami-iwo-to Is- AB289529; AB289515. Liparis koreojaponica; L41; Ko- land, Tokyo, Japan; TNS1304743; LC431210; LC431857; rea; TNS8505331; AB289465; AB289491; AB289527; LC431863; LC431871. Liparis hostifolia; Chichi-jima Is- AB289513. Liparis hawaiensis H. Mann; retrieved from land, Tokyo, Japan; TI06460; LC431213–6. Liparis hos- GenBank; Hawaii, USA; AY907085. Liparis kumokiri F. tifolia; Minami-iwo-to Island, Tokyo, Japan; TI06456; Maek.; L9; Hokkaido, Japan; TNS8505382; AB289470; LC431217–8. Liparis hostifolia; Chichi-jima Island, To- AB289496; AB289530; AB289516. Liparis kumokiri; kyo, Japan; TI06457; LC431217–8. Liparis suzumushi L15; Yamanashi, Japan; TNS8505392; AB289471; Tsutsumi, T. Yukawa & M. Kato; L6; Kanagawa, Japan; AB289497; AB289531; AB289517. Liparis kumokiri; TNS8505372; AB289474; AB289500; AB289534; L16; Hokkaido, Japan; TNS8505394; AB289473; AB289520. Liparis makinoana Schltr.; L2; Hokkaido, AB289498; AB289533; AB289519. Liparis kumokiri; 99- Japan; TNS8505361; AB289462; AB289488; LC431864; 60; Nara, Japan; Yukawa99-60; AB289472; AB289499; LC431872. Liparis makinoana; L7; cult. Tsukuba Bot. AB289532; AB289518. Liparis kumokiri F. Maek. subsp. Gard.; TNS8505375; AB289463; AB289489; AB289526; nemoralis Perazza & Tsutsumi; L201, 203; Italy; AB289512. Liparis longiracemosa Tsutsumi, T. Yukawa LC088231; LC431859; LC431866; LC431874. Liparis ku- & M. Kato ; L8; Akita, Japan; TNS8505378; AB435655; mokiri subsp. nemoralis; L204; Udine, Italy; LC088232; AB435656; AB435657; AB435658. Liparis yongnoana LC431860; LC431867; LC431875. Liparis pterosepala N. N. S. Lee, C. S. Lee, & K. S. Lee; Cheju Is., Korea; S. Lee, C. S. Lee & K. S. Lee; Cheju Is., Korea; LC431212; TNS8505338; LC431211; LC431858; LC431865; LC431861; LC431868; LC431876. Liparis purpureovitta- LC431873. Liparis fujisanensis F. Maek. ex F. Konta & S. ta Tsutsumi, T. Yukawa & M. Kato; L24; cult. Tukuba Matsumoto; L1; Kochi, Japan; TNS8505357; AB289460; Bot. Gard.; TNS8505399; AB289480; AB289506; AB289486; AB289524; AB289510. Liparis fujisanensis; AB289536; AB289522. Liparis purpureovittata; L27; L18; cult. Tsukuba Bot. Gard.; AB289461; AB289487; Hokkaido, Japan; TNS8505400; AB289481; AB289507; AB289525; AB289511. Liparis koreojaponica Tsutsumi, AB289537; AB289523. Liparis derchiensis S. S. Ying; T. Yukawa, N. S. Lee, C. S. Lee & M. Kato; L3; Hok- Taiwan; AB289464; AB289490; LC431869; LC431877. kaido, Japan; TNS8505363; AB289466; AB289492; Liparis loeselii (L.) Rich.; Trento, Italy; LC088233; Li- AB289528; AB289514. Liparis koreojaponica; L4; Hok- paris liliifolia (L.) Rich. ex Lindl.; cult. Tsukuba Bot. kaido, Japan; TNS8505366; AB289467; AB289493; Gard.; AB289475; AB289501; AB289521; AB289535.