DOCSLIB.ORG

Ogasawara) Archipelago, Japan, and Its Identification Using Molecular Sequences from a Herbarium Specimen Collected More Than 100 Years Ago

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ogasawara) Archipelago, Japan, and Its Identification Using Molecular Sequences from a Herbarium Specimen Collected More Than 100 Years Ago ISSN 1346-7565 Acta Phytotax. Geobot. 70 (3): 149–158 (2019) doi: 10.18942/apg.201901 Rediscovery of Liparis hostifolia (Orchidaceae) on Minami-iwo-to Island in the Bonin (Ogasawara) Archipelago, Japan, and its Identification Using Molecular Sequences from a Herbarium Specimen Collected more than 100 Years Ago 1,† 2,† 3 4 Koji TaKayama , Chie TsuTsumi , Dairo KawaguChi , hiDeToshi KaTo anD 2,* Tomohisa yuKawa 1Department of Botany, Graduate School of Science, Kyoto University, Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan; 2 Department of Botany, National Museum of Nature and Science, 4-1-1 Amakubo, Tsukuba 305- 0005, Japan. *[email protected] (author for correspondence); 3 Ogasawara Islands Branch Office, Tokyo Metropolitan Government, Nishimachi, Chichi-jima, Ogasawara-mura, Tokyo 100-2101, Japan; 4 Department of Biological Sciences, Tokyo Metropolitan University, 1-1 Minami Osawa, Hachioji, Tokyo 192-0397, Japan. † These authors contributed equally to this work Liparis hostifolia (Orchidaceae) on Minami-iwo-to Island in the Bonin (Ogasawara) Archipelago was rediscovered for the first time in 79 years during a field survey in 2017. Its identity was confirmed by morphological comparison and DNA extractions from herbarium specimens collected between 1914 and 1938. Results from the molecular phylogenetic analyses demonstrated that L. hostifolia belongs to the L. makinoana complex. In comparison with other members of the L. makinoana complex, the broadly ovate labellum, short dormancy period, and flowering from November to March are unique characteristics of L. hostifolia. Results from the molecular phylogenetic analyses also suggested that L. hostifolia has had a long-isolated history in the Bonin Archipelago and probably migrated from temperate East Asia. Key words: Bonin Archipelago, chloroplast, endangered species, herbarium specimen, ITS, Liparis, oceanic islands, Orchidaceae, rediscovery, Volcano Islands Liparis Rich. (Orchidaceae) is a cosmopolitan since 1938. The species is treated as Critically genus consisting of about 320 species (Pridgeon Endangered (CR) in the Red List of Japanese vas- et al. 2005). In Japan, 17 species of Liparis are cular plants (Ministry of the Environment 2018). recognized (Yukawa 2015). Liparis hostifolia Minami-iwo-to Island, an oceanic island, is (Koidz.) Koidz. ex Nakai was originally proposed located ca. 1,300 km south of Tokyo (Fig. 1). The with a brief description as a variety of L. auricu- island belongs to the Volcano Islands group, lata Blume ex Miq. from Chichi-jima Island, one which consists of Kita-iwo-to Island, Iwo-to Is- of the Bonin (Ogasawara) Archipelago, Japan land, and Minami-iwo-to Island. The natural en- (Koidzumi 1916). Tuyama (1937) provided a vironment of Minami-iwo-to Island has been well more detailed description and reported a new lo- preserved because it remains uninhabited by hu- cality, Minami-iwo-to Island in the Volcano Is- mans. Of the 135 species of vascular plants re- lands group. No further collections of L. hostifo- ported from the island (Fujita et al. 2008, Takaya- lia, however, have been made on Minami-iwo-to ma et al. 2018), ca. 70 % of them are common on Island since 1936 and from Chichi-jima Island other islands in the Volcano Islands group and ca. 150 Acta Phytotax. Geobot. Vol. 70 70 % are on islands of the Bonin Islands group (Chichi-jima Islands, Haha-jima Islands, and Mu- ko-jima Islands) (Ohba 1983). Minami-iwo-to Is- land is relatively young compared to other islands of the Bonin Islands group. The Bonin Islands group was formed by submarine volcanic activity during the Paleogene and uplifted starting in the Pleistocene and rising above sea level before the Middle Pleistocene (Kaizuka 1977, Imaizumi & Tamura 1984). The islands of the Volcano Islands group are considered to be younger, with approx- Fig. 1. Map of the Bonin (Ogasawara) Archipelago. imate ages of 140 thousand years for Kita-iwo-to Island and 30 thousand years for Minami-iwo-to Island (Nakano et al. 2009). Therefore, the flora for morphological analysis. of Minami-iwo-to Island is considered to have DNA from the plants collected from Minami- originated elsewhere and migrated to the island iwo-to Island was extracted from silica-gel-dried by recent long-distance dispersal. material with the DNeasy Plant Mini Kit (Qiagen, During a field survey from 13 to 26 June 2017 Valencia, California, USA) following the manu- we found plants of Liparis on Minami-iwo-to Is- facturer’s instructions. The internal transcribed land. To identify them and to clarify their charac- spacer regions of 18S–26S nuclear ribosomal teristics, we studied their morphology, phenology, DNA (ITS) and three chloroplast regions (part of and molecular phylogeny and compared them to matK, trnL with trnL-trnF spacer, trnS-trnG closely related species. Molecular analyses were spacer) were analyzed. Procedures for amplifica- also conducted using DNA from herbarium spec- tion and sequencing followed those in Tsutsumi imens collected on Chichi-jima Island and Mina- et al. (2007). mi-iwo-to Island before 1938. DNA from herbarium specimens was extract- ed with the modified CTAB method of Doyle & Doyle (1987). Three specimens in the herbarium of the University of Tokyo (TI) were used for Materials and Methods DNA extraction; Chichi-jima Island, 15 Novem- ber 1914, collector unknown s.n. (TI06460); Chi- We conducted a scientific expedition to Mina- chi-jima Island, 1 March 1938, T. Tuyama s.n. mi-iwo-to Island from 13 to 26 June 2017, to in- (TI06457); Minami-iwo-to Island, 31 March vestigate the vegetation and flora of the island. 1936, T. Tuyama s.n. (TI06456). The ITS regions The only route to the island’s summit (altitude were amplified with newly developed primers de- 916 m) was blazed by climbing specialists. It was signed for product sizes of ca. 150 bp (Table 1) from along this route that we collected plant ma- because fragmentations were estimated in DNA terials. Six individuals of Liparis were collected extractions from herbarium specimens. For the from the edge of a scrub-forest at 700 m eleva- sample TI06460, PCR was performed with EX tion. Three individuals had old scapes without Taq DNA polymerase (TaKaRa Biomedical, To- flowers or fruits. Two mature plants and one juve- kyo) with Ampdirect (Shimadzu, Kyoto) follow- nile cultivated in Tsukuba Botanical Garden, Na- ing the manufacturer’s instruction. For the sam- tional Museum of Nature and Science, were used ples TI06456 and TI06457, PCR was performed for the phylogenetic analyses. The other three in- with EX Taq DNA polymerase with 5% dimethyl dividuals were used for voucher specimens. sulfoxide (DMSO). The GenBank accession Flowers on these plants opened from November numbers are shown in Table 1. 2017 to January 2018 in the garden were collected Phylogenetic analyses were performed by October 2019 TaKayama & al. – Rediscovery of Liparis hostifolia 151 Table 1. Primers for DNA analyses from herbarium specimens of Liparis hostifolia in the University of Tokyo (TI) and Gen- Bank accession numbers. Region Primers Product Genbank accession numbers Forward (5->3) Reverse (5->3) Size Collector T. Tuyama s.n T. Tuyama s.n (bp) unknown (TI06456) (TI06457) (TI06460) ITS_La GTTCGCCGCCTGTGACTC TGAAGGCATGTGCCAACACT 169 LC431213 no success no success ITS_Lb TGGCACATGCCTTCATAAAA AACCCAATAYAAGGCTCACG 144 LC431214 LC431217 LC431217 ITS_Lc TTGAAAACACGTGAGCCTTR TTGCGTTCAAAGACTCGATG 180 LC431215 no success no success ITS_Ld CCGTGAACCATCGAGTCTTT GAGGAGCCACTCTACGCATC 154 LC431216 LC431218 LC431218 Table 2. Comparison of floral characters inLiparis hostifolia, L. makinoana complex (see Tsutsumi et al. 2019) and, L. yong- noana. L. hostifolia L. makinoana complex L. yongnoana L. suzumushi L. makinoana L. longiracemosa Material used Description in Herbarium in this study Tuyama (1937) specimens inflorescence 10–17 –20 8–20 10–25 10–35 15–40 9–12 length (cm) flower number 6–7 no description 3–14(–20) 4–16 4–30 4–40 4–5 lateral sepal 11–14 10 10–12 13–16 8–11 8–11 7–8 length (mm) lateral sepal 2.5–4 1.5 not measured 3.5–4 2–3 2.5–3.5 2.5 width (mm) * labellum shape broadly ovate, broadly ovate broadly ovate broadly ovate to ovate, slightly ovate, slightly ovate, slightly strongly ovate, slightly recurved recurved recurved recurved recurved labellum 11–15 11 10–14 14–17 9–12 8–10 9–10 length (mm) labellum 10–14 9 10–13 11–15 6–9 5–7 7–8 width (mm) column 5–6 5 5–6 5.5–7 4–5 4–5 3–3.5 length (mm) labellum color pale green to no description obscure pale green, pale green to pale green, light pale green light purple light to dark light purple to dark purple with dark with dark purple with with purple with purple veins purple central purple veins purple veins veins groove flowering Nov. to Jan. no description Nov. to Mar. Mar. to Jun. Jun. to Jul. Jun. to Jul. Jun. to Jul. season * Lateral sepal margins are strongly revolute. Our measurements were made from flattened sepals; Tuyama (1937) possibly measured sepals in their original posture. Bayesian analysis using MrBayes 3.1.2 (Huelsen- Liparis liliifolia (L.) Rich. ex Lindl. and L. lo- beck & Ronquist 2001, Ronquist & Huelsenbeck eselii (L.) Rich. were set as outgroups based on 2003) and by maximum parsimony (MP) using the results of Tsutsumi et al. (2007) and Perazza PAUP 4.0a157 (Swofford 2002). The results from & Tsutsumi (2015). The ITS sequence data of the preliminary molecular and morphological L. hawaiensis H. Mann from GenBank were also analyses showed a close affinity of the plants included in the dataset. from Minami-iwo-to Island to members of the Li- We constructed trees deduced from ITS, chlo- paris makinoana complex in which three mor- roplast, and the combined datasets, independent- phologically distinct species, L. suzumushi Tsut- ly.
Load more

Recommended publications
  • Guide to the Flora of the Carolinas, Virginia, and Georgia, Working Draft of 17 March 2004 -- LILIACEAE
    Guide to the Flora of the Carolinas, Virginia, and Georgia, Working Draft of 17 March 2004 -- LILIACEAE LILIACEAE de Jussieu 1789 (Lily Family) (also see AGAVACEAE, ALLIACEAE, ALSTROEMERIACEAE, AMARYLLIDACEAE, ASPARAGACEAE, COLCHICACEAE, HEMEROCALLIDACEAE, HOSTACEAE, HYACINTHACEAE, HYPOXIDACEAE, MELANTHIACEAE, NARTHECIACEAE, RUSCACEAE, SMILACACEAE, THEMIDACEAE, TOFIELDIACEAE) As here interpreted narrowly, the Liliaceae constitutes about 11 genera and 550 species, of the Northern Hemisphere. There has been much recent investigation and re-interpretation of evidence regarding the upper-level taxonomy of the Liliales, with strong suggestions that the broad Liliaceae recognized by Cronquist (1981) is artificial and polyphyletic. Cronquist (1993) himself concurs, at least to a degree: "we still await a comprehensive reorganization of the lilies into several families more comparable to other recognized families of angiosperms." Dahlgren & Clifford (1982) and Dahlgren, Clifford, & Yeo (1985) synthesized an early phase in the modern revolution of monocot taxonomy. Since then, additional research, especially molecular (Duvall et al. 1993, Chase et al. 1993, Bogler & Simpson 1995, and many others), has strongly validated the general lines (and many details) of Dahlgren's arrangement. The most recent synthesis (Kubitzki 1998a) is followed as the basis for familial and generic taxonomy of the lilies and their relatives (see summary below). References: Angiosperm Phylogeny Group (1998, 2003); Tamura in Kubitzki (1998a). Our “liliaceous” genera (members of orders placed in the Lilianae) are therefore divided as shown below, largely following Kubitzki (1998a) and some more recent molecular analyses. ALISMATALES TOFIELDIACEAE: Pleea, Tofieldia. LILIALES ALSTROEMERIACEAE: Alstroemeria COLCHICACEAE: Colchicum, Uvularia. LILIACEAE: Clintonia, Erythronium, Lilium, Medeola, Prosartes, Streptopus, Tricyrtis, Tulipa. MELANTHIACEAE: Amianthium, Anticlea, Chamaelirium, Helonias, Melanthium, Schoenocaulon, Stenanthium, Veratrum, Toxicoscordion, Trillium, Xerophyllum, Zigadenus.
    [Show full text]
  • Seabirds in the Stomach Contents of Black Rats Rattus Rattus on Higashijima, the Ogasawara (Bonin) Islands, Japan
    Yabe et al.: Seabirds in stomachs of Black Rats 293 SEABIRDS IN THE STOMACH CONTENTS OF BLACK RATS RATTUS RATTUS ON HIGASHIJIMA, THE OGASAWARA (BONIN) ISLANDS, JAPAN TATSUO YABE1,2, TAKUMA HASHIMOTO3, MASAAKI TAKIGUCHI3, MASANARI AOKI3 & KAZUTO KAWAKAMI4 1Rat Control Consulting, 1380–6 Fukuda, Yamato, Kanagawa, 242-0024, Japan ([email protected]) 2Tropical Rat Control Committee, c/o Overseas Agricultural Development Association, 8-10-32 Akasaka, Minato-Ku, Tokyo, 107-0052, Japan 3Japan Wildlife Research Center, 3-10-10 Shitaya, Taito-Ku, Tokyo, 110-8676, Japan 4Forestry and Forest Products Research Institute, 1 Matsunosato, Tsukuba, Ibaraki, 305-8687, Japan Received 11 September 2008, accepted 7 July 2009 Eradication programs for invasive rodents have accelerated since On Higashijima, Ogasawara Islands, rats are threatening the island pioneering efforts by New Zealand biologists in the 1970s to species. Seabirds such as Bulwer’s Petrels Bulweria bulwerii conserve not only seabird populations but also island ecosystems and Tristram’s Storm-Petrels are threatened by Black Rats. Ten (Howald et al. 2007, Rauzon 2007). In Japan, Black Rat Rattus carcasses of Bulwer’s Petrels were found for the first time on the rattus eradication programs have been carried out recently in the island in July 2005 (K. Horikoshi pers. comm.). Pictures taken Ogasawara (Bonin) Islands (Hashimoto 2009, Makino 2009). The during the period between June and October 2006 with automatic Ogasawara Islands are known to be a sanctuary for birds, including cameras (and the amount of rat tooth marks on bones) suggested several indigenous or endangered species such as Columba janthina that Black Rats preyed on more than 1000 Bulwer’s Petrels and their nitens, Apalopteron familiare, Tristram’s Storm-Petrel Oceanodroma eggs, and that they also ate Tristram’s Storm-Petrels (Horikoshi et tristrami, Matsudaira’s Storm-Petrel O.
    [Show full text]
  • Sp09-For Web.Pub
    Spring 2009 Page 1 Botanic Garden News The Botanic Garden Volume 12, No. 1 of Smith College Spring 2009 Madelaine Zadik “T he tulip is the sexiest, most capricious, the most various, subtle, powerful, and intriguing Room. Many thanks to the Museum of flower on Earth.” These are the words of Anna Art for framing them for us. Pavord, opening speaker for this year’s Spring In our display case are other tulip- Bulb Show. A mainstay of flower shows and related books lent to us by the garden displays, the tulip has come a long way Mortimer Rare Book Room. Flora’s from its humble origins in central Asia to Feast: A Masque of Flowers (1889) is Tulipa ‘Carmen Rio’ becoming a beloved spring icon. Could you opened to the tulip and hyacinth, two of Photograph by Madelaine Zadik imagine spring without tulips? forty full color lithographs in the book Horticulturist and writer extraordinaire Anna Pavord dazzled everyone with her by Walter Crane. Each page presents an talk, The Tulip: The Flower That Made Men Mad. It was more performance than allegory of a popular flower as human, lecture and demonstrated that although tulipmania might have taken over Europe in clad in flowery garments with a short the early seventeenth century, passions today still run quite strong as far as the tulip whimsical verse. Reproductions of is concerned. (For more about Anna Pavord’s visit, see page 7.) During the several of these (see page 6) were tulipmania period in Europe, fortunes rose to soaring heights and then were quickly scattered through the bulb show, to lost, perhaps similar to the Wall Street turbulence we are everyone’s delight.
    [Show full text]
  • 75. LIPARIS Richard, De Orchid. Eur. 21, 30, 38. 1817, Nom. Cons. 羊耳蒜属 Yang Er Suan Shu Chen Xinqi (陈心启 Chen Sing-Chi); Paul Ormerod, Jeffrey J
    Flora of China 25: 211–228. 2009. 75. LIPARIS Richard, De Orchid. Eur. 21, 30, 38. 1817, nom. cons. 羊耳蒜属 yang er suan shu Chen Xinqi (陈心启 Chen Sing-chi); Paul Ormerod, Jeffrey J. Wood Alipsa Hoffmannsegg; Anistylis Rafinesque; Diteilis Rafinesque; Dituilis Rafinesque; Empusa Lindley; Empusaria Reichen- bach; Iebine Rafinesque; Leptorkis Thouars; Malaxis sect. Platystylis Blume; Mesoptera Rafinesque; Paliris Dumortier; Platystylis (Blume) Lindley (1830), not Sweet (1828); Pseudorchis Gray (1821), not Séguier (1754); Sturmia Reichenbach (1826), not Hoppe (1799). Herbs, terrestrial, lithophytic, or epiphytic, rhizomatous, rarely mycotrophic and leaves reduced to scales. Stems pseudobulbous, sometimes appearing as a many-noded, fleshy stem, clustered or not, when young covered by sterile bracts. Leaves 1 to several, linear to ovate or elliptic, plicate or not, thinly textured to leathery, basal or cauline (terrestrial species), or arising from apex or sub- terminal nodes of pseudobulbs (epiphytic species), articulate or not at base. Inflorescences erect to pendulous, racemose, laxly or densely many flowered; floral bracts persistent, small. Flowers small or medium-sized, yellow, green, orange, or purple, often translucent, usually resupinate. Sepals spreading, dorsal sepal free, lateral sepals sometimes fused for part or all of their length. Petals free, often reflexed, often linear and unlike sepals; lip often reflexed, ovate, oblong, or flabellate, entire or lobed, usually with a basal callus, lacking a spur. Column incurved-arcuate, clavate, long, winged at apex and sometimes at base; anther cap attached by a slen- der filament, 2-locular; pollinia 4 in 2 pairs, waxy, ovoid, bilaterally flattened, each pair with a small viscidium; rostellum thinly textured, blunt.
    [Show full text]
  • Pogonia Subalpina (Orchidaceae): a New Species from Japan
    Bull. Natl. Mus. Nat. Sci., Ser. B, 43(3), pp. 79–86, August 22, 2017 Pogonia subalpina (Orchidaceae): a new species from Japan Tomohisa Yukawa* and Yumi Yamashita Tsukuba Botanical Garden, National Museum of Nature and Science, Amakubo 4–1–1, Tsukuba, Ibaraki 305–0005, Japan *E-mail: [email protected] (Received 11 May 2017; accepted 28 June 2017) Abstract Pogonia subalpina T. Yukawa & Y. Yamashita (Orchidaceae) is newly described from marshy, subalpine grasslands of central and northern parts in Honshu, Japan. This species is simi- lar to Pogonia japonica Rchb. f. and P. minor (Makino) Makino, but can be distinguished in flower by its short hairy crests on the disk of the labellum mid-lobe, by its glabrous abaxial surface of the labellum, and by its single, broad, purplish pink band along the mid-vein of the petals. Nucleotide sequence divergences among the three entities in the nuclear ribosomal DNA ITS and the plastid trnK 5’ intron regions warrant independent species status of the new entity. Key words : Japan, new species, Orchidaceae, Pogonia, taxonomy. Introduction ica and P. minor has been generally recognised (Yukawa, 2015). However, another entity that The genus Pogonia Juss. is a small orchid does not match morphologically with either of genus in which four species, i.e., P. japonica them was tentatively designated a Japanese name Rchb. f., P. minor (Makino) Makino, P. ophio- “Miyama-tokiso” (Takahashi, 1987). In this study glossoides (L.) Ker Gawl., and P. yunnanensis we evaluate the taxonomic status of this Finet, are currently accepted (Pridgeon et al., neglected entity.
    [Show full text]
  • A Monograph of the Genus Liparis
    245% MR. H. N. EIDLEY’S MONOQEAPB A Monograph of‘the Genus Liparis. By H. N. RIDLEY,M.A., F.L.S. [Read 3rd June, 1886.1 ALTHOUQH the literature treating of Orchids is very extensive, and is still very largely on the increase, the number of Mono- graphs of genera is remarkably small, and, indeed, it seems that there is no Order of equal size and importance now so meagrely provided ‘for in this respect. Species innumerable have been described as they were discovered or introduced into cultivation, often several species of different genera together, and that with- out correlation or comparison with other species. The result of this is that the species of many genera are inextricably confused, and it, is by no means easy, even with a great deal of labour, to collate all the described species of any large genus. It not un- frequently happens also that plants are introduced, perhaps almost accidentally, into cultivation, and shortly after dying out are entirely lost, no specimens having been preserved, and only a description, often, especially among the older writers, of an in- sufficient character, by which the species can be identified. I have therefore thought it may be useful to those interested in this group of plants to collect what information I could glean concerning the genus Liparis into a single paper. No list has been published of the genus since the publication of the ‘ Cfenera and Species of the Orchidaceous Plants,’ by Lindley in 1840, in which thirty-three species are described, while the number of species at present known is above 100.
    [Show full text]
  • International Agenda for Botanic Gardens in Conservation
    Journal of Botanic Gardens Conservation International BGjournalVolume 3 • Number 1 • January 2006 The International Agenda – five years on Forthcoming APPLIED PLANT CONSERVATION Meetings March 20 – 31, 2006 CURITIBA, BRAZIL 8th Ordinary Meeting of the Conference of the Parties to the Convention on Biological Diversity Issues for in-depth consideration are island biodiversity, biological diversity of dry and sub- 2nd ANNUAL humid lands, the Global Taxonomy Initiative, access and benefit-sharing and communication, TRAINING PROGRAM AND INTERNSHIP education and public awareness. For more information, visit the http://www.biodiv.org/doc/ meeting.aspx?mtg=COP-08 PRESENTED BY: DENVER BOTANIC GARDENS, CENTER FOR PLANT CONSERVATION June 19 - 25, 2006 SANTO DOMINGO, DOMINICAN REPUBLIC and UNITED STATES BOTANIC GARDEN IX Congress of the Latin American Botanical Society (IX Congreso Latinoamericano de Botánica) Contribuyendo al conocimiento global de la flora nativa latinoamericana (Contributing to the global knowledge of the native flora of Latin America) The objectives of this Congress are to spread JUNE 6-10, 2006: JUNE 12-16, 2006: JUNE 6 – AUGUST 5, 2006: information about the flora of Latin America and bring CPC APPLIED PLANT PLANT CONSERVATION IN NINE-WEEK PAID together the botanical community to develop plans for the conservation and sustainable use of its flora. CONSERVATION TRAINING BOTANIC GARDENS SUMMER INTERNSHIP Seminar registration is due Application deadline is For further information, please contact Sonia April 21, 2006. March 1, 2006. Lagos-Witte, President Asociación Latinoamericano Admission is competitive. de Botánica - ALB and Coordinator, IX Congreso Latinoamericano de Botánica, Jardín Botánico Nacional, Apartado Postal 21-9, Santo Domingo, Dominican Republic.
    [Show full text]
  • Orchid Historical Biogeography, Diversification, Antarctica and The
    Journal of Biogeography (J. Biogeogr.) (2016) ORIGINAL Orchid historical biogeography, ARTICLE diversification, Antarctica and the paradox of orchid dispersal Thomas J. Givnish1*, Daniel Spalink1, Mercedes Ames1, Stephanie P. Lyon1, Steven J. Hunter1, Alejandro Zuluaga1,2, Alfonso Doucette1, Giovanny Giraldo Caro1, James McDaniel1, Mark A. Clements3, Mary T. K. Arroyo4, Lorena Endara5, Ricardo Kriebel1, Norris H. Williams5 and Kenneth M. Cameron1 1Department of Botany, University of ABSTRACT Wisconsin-Madison, Madison, WI 53706, Aim Orchidaceae is the most species-rich angiosperm family and has one of USA, 2Departamento de Biologıa, the broadest distributions. Until now, the lack of a well-resolved phylogeny has Universidad del Valle, Cali, Colombia, 3Centre for Australian National Biodiversity prevented analyses of orchid historical biogeography. In this study, we use such Research, Canberra, ACT 2601, Australia, a phylogeny to estimate the geographical spread of orchids, evaluate the impor- 4Institute of Ecology and Biodiversity, tance of different regions in their diversification and assess the role of long-dis- Facultad de Ciencias, Universidad de Chile, tance dispersal (LDD) in generating orchid diversity. 5 Santiago, Chile, Department of Biology, Location Global. University of Florida, Gainesville, FL 32611, USA Methods Analyses use a phylogeny including species representing all five orchid subfamilies and almost all tribes and subtribes, calibrated against 17 angiosperm fossils. We estimated historical biogeography and assessed the
    [Show full text]
  • The Genus Liparis Len Field 64
    Journal of the Native Orchid Society of South Australia Inc Urochilus (Pterostylis) sanguineus Print Post Approved Volume 28 Nº 6 PP 543662/00018 July 2004 NATIVE ORCHID SOCIETY OF SOUTH AUSTRALIA POST OFFICE BOX 565 UNLEY SOUTH AUSTRALIA 5061 The Native Orchid Society of South Australia promotes the conservation of orchids through the preservation of natural habitat and through cultivation. Except with the documented official representation of the management committee, no person may represent the Society on any matter. All native orchids are protected in the wild; their collection without written Government permit is illegal. PRESIDENT SECRETARY Bodo Jensen: Cathy Houston telephone 8243 0251 work 8347 2005 telephone 8356 7356 VICE PRESIDENT Bob Bates COMMITTEE Peter McCauley Brendan Killen Malcolm Guy David Pettifor EDITOR TREASURER David Hirst Iris Freeman 14 Beaverdale Avenue ASSISTANT TREASURER Windsor Gardens SA 5087 Bill Dear Telephone 8261 7998 telephone 8296 2111 Email [email protected] mobile 0414 633941 LIFE MEMBERS Mr R. Hargreaves† Mr D. Wells Mr H. Goldsack† Mr G. Carne Mr R. Robjohns† Mr R Bates Mr J. Simmons† Mr R Shooter Mr. L. Nesbitt Registrar of Judges: Reg Shooter Trading Table: Judy Penney Field Trips and Conservation: Thelma Bridle telephone 8384 4174 Tuber bank Coordinator: Malcolm Guy telephone 8276 7350 New Members Coordinator: David Pettifor telephone 0416 095095 PATRON Mr T. R. N. Lothian The Native Orchid Society of South Australia, while taking all due care, take no responsibility for loss or damage to any plants whether at shows, meetings or exhibits. Views or opinions expressed by authors of articles within this Journal do not necessarily reflect the views or opinions of the management committee.
    [Show full text]
  • Forest Structures, Composition, and Distribution on a Pacific Island, with Reference to Ecological Release and Speciation!
    Pacific Science (1991), vol. 45, no. 1: 28-49 © 1991 by University of Hawaii Press. All rights reserved Forest Structures, Composition, and Distribution on a Pacific Island, with Reference to Ecological Release and Speciation! YOSHIKAZU SHIMIZU2 AND HIDEO TABATA 3 ABSTRACT: Native forest and scrub of Chichijima, the largest island in the Bonins, were classified into five types based on structural features: Elaeocarpus­ Ardisia mesic forest, 13-16 m high, dominated by Elaeocarpus photiniaefolius and Ardisia sieboldii; Pinus-Schima mesic forest, 12-16 m high, consisting of Schima mertensiana and an introduced pine , Pinus lutchuensis; Rhaphiolepis­ Livistonia dry forest, 2-6 m high, mainly occupied by Rhaphiolepis indica v. integerrima; Distylium-Schima dry forest, 3-8 m high, dominated by Distylium lepidotum and Schima mertensiana; and Distylium-Pouteria dry scrub, 0.3­ 1.5 m high, mainly composed of Distylium lepidotum. A vegetation map based on this classification was developed. Species composition and structural features of each type were analyzed in terms of habitat condition and mechanisms of regeneration. A group of species such as Pouteria obovata, Syzgygium buxifo­ lium, Hibiscus glaber, Rhaphiolepis indica v. integerrima, and Pandanus boninen­ sis, all with different growth forms from large trees to stunted shrubs, was subdominant in all vegetation types. Schima mertensiana , an endemic pioneer tree, occurred in both secondary forests and climax forests as a dominant canopy species and may be an indication of "ecological release," a characteristic of oceanic islands with poor floras and little competitive pressure. Some taxonomic groups (Callicarpa, Symplocos, Pittosporum, etc.) have speciated in the under­ story of Distylium-Schima dry forest and Distylium-Pouteria dry scrub.
    [Show full text]
  • Is Glyphis Cicatricosa an Indicator for 'Global Warming'
    The Lichenologist 49(3): 291–296 (2017) © British Lichen Society, 2017 doi:10.1017/S0024282917000111 Is Glyphis cicatricosa an indicator for ‘global warming’ or an ‘urban heat island’ effect in Japan? During the course of floristic studies of Japa- which are 6–12-locular with lenticular cells, nese lichens, Glyphis cicatricosa Ach. (Graphi- 30–55 × 7–12 μm; and absence of specific daceae, Ascomycota), a pantropical species chemical substances (Nakanishi 1966; (Galloway 2007), was found on the bark of Archer 2009). The specimen collected from Phellodendron amurense Rupr. in a suburban Tsukuba-city agrees with the morphological area of Tsukuba-city (36°06'03''N, 140° and chemical features mentioned above, with 06'43''E). This is on the Pacificsideofeastern spore sizes ((min.–) mean ± 1SD (–max.)) as Honshu, with a warm-temperate climate and follows: (31·7–)35·1 ± 3·8(–45·1) × (6·7–) is the northernmost locality of G. cicatricosa in 7·8 ± 0·7(–9·2) μm(n = 10). Japan. The sapling tree was planted in the Glyphis cicatricosa is widely distributed Tsukuba Botanical Garden (c. 14 ha, 20 m in tropical to warm-temperate regions such elev.) in 1984 when the mean annual as south-eastern USA, Central and South temperature was 12 °C, but this has gradually America, South, South-East and East Asia, increased since then to almost 15 °C in 2015 Australia, New Zealand and the Pacific (e.g. when G. cicatricosa was discovered (Fig. 1). Archer 2009; Moon et al. 2015). In Japan, it Does an increase in annual temperature at this is reported from warm-temperate and sub- site plausibly explain the unexpected phyto- tropical regions in the south and the Bonin geographical distribution of this lichen in Islands (Nakanishi 1966; Kurokawa 1969).
    [Show full text]
  • 9:00 Am PLACE
    CARTY S. CHANG INTERIM CHAIRPERSON DAVID Y. IGE BOARD OF LAND AND NATURAL RESOURCES GOVERNOR OF HAWAII COMMISSION ON WATER RESOURCE MANAGEMENT KEKOA KALUHIWA FIRST DEPUTY W. ROY HARDY ACTING DEPUTY DIRECTOR – WATER AQUATIC RESOURCES BOATING AND OCEAN RECREATION BUREAU OF CONVEYANCES COMMISSION ON WATER RESOURCE MANAGEMENT STATE OF HAWAII CONSERVATION AND COASTAL LANDS CONSERVATION AND RESOURCES ENFORCEMENT DEPARTMENT OF LAND AND NATURAL RESOURCES ENGINEERING FORESTRY AND WILDLIFE HISTORIC PRESERVATION POST OFFICE BOX 621 KAHOOLAWE ISLAND RESERVE COMMISSION LAND HONOLULU, HAWAII 96809 STATE PARKS NATURAL AREA RESERVES SYSTEM COMMISSION MEETING DATE: April 27, 2015 TIME: 9:00 a.m. PLACE: Department of Land and Natural Resources Boardroom, Kalanimoku Building, 1151 Punchbowl Street, Room 132, Honolulu. AGENDA ITEM 1. Call to order, introductions, move-ups. ITEM 2. Approval of the Minutes of the June 9, 2014 N atural Area Reserves System Commission Meeting. ITEM 3. Natural Area Partnership Program (NAPP). ITEM 3.a. Recommendation to the Board of Land and Natural Resources approval for authorization of funding for The Nature Conservancy of Hawaii for $663,600 during FY 16-21 for continued enrollment in the natural area partnership program and acceptance and approval of the Kapunakea Preserve Long Range Management Plan, TMK 4-4-7:01, 4-4-7:03, Lahaina, Maui. ITEM 3.b. Recommendation to the Board of Land and Natural Resources approval for authorization of funding for The Nature Conservancy of Hawaii for $470,802 during FY 16-21 for continued enrollment in the natural area partnership program and acceptance and approval of the Pelekunu Long Range Management Plan, TMK 5-4- 3:32, 5-9-6:11, Molokai.
    [Show full text]