ISSN 1346-7565 Acta Phytotax. Geobot. 70 (3): 149–158 (2019) doi: 10.18942/apg.201901 Rediscovery of Liparis hostifolia (Orchidaceae) on Minami-iwo-to Island in the Bonin (Ogasawara) Archipelago, Japan, and its Identification Using Molecular Sequences from a Herbarium Specimen Collected more than 100 Years Ago 1,† 2,† 3 4 Koji TaKayama , Chie TsuTsumi , Dairo KawaguChi , hiDeToshi KaTo anD 2,* Tomohisa yuKawa 1Department of Botany, Graduate School of Science, Kyoto University, Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan; 2 Department of Botany, National Museum of Nature and Science, 4-1-1 Amakubo, Tsukuba 305- 0005, Japan. *[email protected] (author for correspondence); 3 Ogasawara Islands Branch Office, Tokyo Metropolitan Government, Nishimachi, Chichi-jima, Ogasawara-mura, Tokyo 100-2101, Japan; 4 Department of Biological Sciences, Tokyo Metropolitan University, 1-1 Minami Osawa, Hachioji, Tokyo 192-0397, Japan. † These authors contributed equally to this work Liparis hostifolia (Orchidaceae) on Minami-iwo-to Island in the Bonin (Ogasawara) Archipelago was rediscovered for the first time in 79 years during a field survey in 2017. Its identity was confirmed by morphological comparison and DNA extractions from herbarium specimens collected between 1914 and 1938. Results from the molecular phylogenetic analyses demonstrated that L. hostifolia belongs to the L. makinoana complex. In comparison with other members of the L. makinoana complex, the broadly ovate labellum, short dormancy period, and flowering from November to March are unique characteristics of L. hostifolia. Results from the molecular phylogenetic analyses also suggested that L. hostifolia has had a long-isolated history in the Bonin Archipelago and probably migrated from temperate East Asia. Key words: Bonin Archipelago, chloroplast, endangered species, herbarium specimen, ITS, Liparis, oceanic islands, Orchidaceae, rediscovery, Volcano Islands Liparis Rich. (Orchidaceae) is a cosmopolitan since 1938. The species is treated as Critically genus consisting of about 320 species (Pridgeon Endangered (CR) in the Red List of Japanese vas- et al. 2005). In Japan, 17 species of Liparis are cular plants (Ministry of the Environment 2018). recognized (Yukawa 2015). Liparis hostifolia Minami-iwo-to Island, an oceanic island, is (Koidz.) Koidz. ex Nakai was originally proposed located ca. 1,300 km south of Tokyo (Fig. 1). The with a brief description as a variety of L. auricu- island belongs to the Volcano Islands group, lata Blume ex Miq. from Chichi-jima Island, one which consists of Kita-iwo-to Island, Iwo-to Is- of the Bonin (Ogasawara) Archipelago, Japan land, and Minami-iwo-to Island. The natural en- (Koidzumi 1916). Tuyama (1937) provided a vironment of Minami-iwo-to Island has been well more detailed description and reported a new lo- preserved because it remains uninhabited by hu- cality, Minami-iwo-to Island in the Volcano Is- mans. Of the 135 species of vascular plants re- lands group. No further collections of L. hostifo- ported from the island (Fujita et al. 2008, Takaya- lia, however, have been made on Minami-iwo-to ma et al. 2018), ca. 70 % of them are common on Island since 1936 and from Chichi-jima Island other islands in the Volcano Islands group and ca. 150 Acta Phytotax. Geobot. Vol. 70 70 % are on islands of the Bonin Islands group (Chichi-jima Islands, Haha-jima Islands, and Mu- ko-jima Islands) (Ohba 1983). Minami-iwo-to Is- land is relatively young compared to other islands of the Bonin Islands group. The Bonin Islands group was formed by submarine volcanic activity during the Paleogene and uplifted starting in the Pleistocene and rising above sea level before the Middle Pleistocene (Kaizuka 1977, Imaizumi & Tamura 1984). The islands of the Volcano Islands group are considered to be younger, with approx- Fig. 1. Map of the Bonin (Ogasawara) Archipelago. imate ages of 140 thousand years for Kita-iwo-to Island and 30 thousand years for Minami-iwo-to Island (Nakano et al. 2009). Therefore, the flora for morphological analysis. of Minami-iwo-to Island is considered to have DNA from the plants collected from Minami- originated elsewhere and migrated to the island iwo-to Island was extracted from silica-gel-dried by recent long-distance dispersal. material with the DNeasy Plant Mini Kit (Qiagen, During a field survey from 13 to 26 June 2017 Valencia, California, USA) following the manu- we found plants of Liparis on Minami-iwo-to Is- facturer’s instructions. The internal transcribed land. To identify them and to clarify their charac- spacer regions of 18S–26S nuclear ribosomal teristics, we studied their morphology, phenology, DNA (ITS) and three chloroplast regions (part of and molecular phylogeny and compared them to matK, trnL with trnL-trnF spacer, trnS-trnG closely related species. Molecular analyses were spacer) were analyzed. Procedures for amplifica- also conducted using DNA from herbarium spec- tion and sequencing followed those in Tsutsumi imens collected on Chichi-jima Island and Mina- et al. (2007). mi-iwo-to Island before 1938. DNA from herbarium specimens was extract- ed with the modified CTAB method of Doyle & Doyle (1987). Three specimens in the herbarium of the University of Tokyo (TI) were used for Materials and Methods DNA extraction; Chichi-jima Island, 15 Novem- ber 1914, collector unknown s.n. (TI06460); Chi- We conducted a scientific expedition to Mina- chi-jima Island, 1 March 1938, T. Tuyama s.n. mi-iwo-to Island from 13 to 26 June 2017, to in- (TI06457); Minami-iwo-to Island, 31 March vestigate the vegetation and flora of the island. 1936, T. Tuyama s.n. (TI06456). The ITS regions The only route to the island’s summit (altitude were amplified with newly developed primers de- 916 m) was blazed by climbing specialists. It was signed for product sizes of ca. 150 bp (Table 1) from along this route that we collected plant ma- because fragmentations were estimated in DNA terials. Six individuals of Liparis were collected extractions from herbarium specimens. For the from the edge of a scrub-forest at 700 m eleva- sample TI06460, PCR was performed with EX tion. Three individuals had old scapes without Taq DNA polymerase (TaKaRa Biomedical, To- flowers or fruits. Two mature plants and one juve- kyo) with Ampdirect (Shimadzu, Kyoto) follow- nile cultivated in Tsukuba Botanical Garden, Na- ing the manufacturer’s instruction. For the sam- tional Museum of Nature and Science, were used ples TI06456 and TI06457, PCR was performed for the phylogenetic analyses. The other three in- with EX Taq DNA polymerase with 5% dimethyl dividuals were used for voucher specimens. sulfoxide (DMSO). The GenBank accession Flowers on these plants opened from November numbers are shown in Table 1. 2017 to January 2018 in the garden were collected Phylogenetic analyses were performed by October 2019 TaKayama & al. – Rediscovery of Liparis hostifolia 151 Table 1. Primers for DNA analyses from herbarium specimens of Liparis hostifolia in the University of Tokyo (TI) and Gen- Bank accession numbers. Region Primers Product Genbank accession numbers Forward (5->3) Reverse (5->3) Size Collector T. Tuyama s.n T. Tuyama s.n (bp) unknown (TI06456) (TI06457) (TI06460) ITS_La GTTCGCCGCCTGTGACTC TGAAGGCATGTGCCAACACT 169 LC431213 no success no success ITS_Lb TGGCACATGCCTTCATAAAA AACCCAATAYAAGGCTCACG 144 LC431214 LC431217 LC431217 ITS_Lc TTGAAAACACGTGAGCCTTR TTGCGTTCAAAGACTCGATG 180 LC431215 no success no success ITS_Ld CCGTGAACCATCGAGTCTTT GAGGAGCCACTCTACGCATC 154 LC431216 LC431218 LC431218 Table 2. Comparison of floral characters inLiparis hostifolia, L. makinoana complex (see Tsutsumi et al. 2019) and, L. yong- noana. L. hostifolia L. makinoana complex L. yongnoana L. suzumushi L. makinoana L. longiracemosa Material used Description in Herbarium in this study Tuyama (1937) specimens inflorescence 10–17 –20 8–20 10–25 10–35 15–40 9–12 length (cm) flower number 6–7 no description 3–14(–20) 4–16 4–30 4–40 4–5 lateral sepal 11–14 10 10–12 13–16 8–11 8–11 7–8 length (mm) lateral sepal 2.5–4 1.5 not measured 3.5–4 2–3 2.5–3.5 2.5 width (mm) * labellum shape broadly ovate, broadly ovate broadly ovate broadly ovate to ovate, slightly ovate, slightly ovate, slightly strongly ovate, slightly recurved recurved recurved recurved recurved labellum 11–15 11 10–14 14–17 9–12 8–10 9–10 length (mm) labellum 10–14 9 10–13 11–15 6–9 5–7 7–8 width (mm) column 5–6 5 5–6 5.5–7 4–5 4–5 3–3.5 length (mm) labellum color pale green to no description obscure pale green, pale green to pale green, light pale green light purple light to dark light purple to dark purple with dark with dark purple with with purple with purple veins purple central purple veins purple veins veins groove flowering Nov. to Jan. no description Nov. to Mar. Mar. to Jun. Jun. to Jul. Jun. to Jul. Jun. to Jul. season * Lateral sepal margins are strongly revolute. Our measurements were made from flattened sepals; Tuyama (1937) possibly measured sepals in their original posture. Bayesian analysis using MrBayes 3.1.2 (Huelsen- Liparis liliifolia (L.) Rich. ex Lindl. and L. lo- beck & Ronquist 2001, Ronquist & Huelsenbeck eselii (L.) Rich. were set as outgroups based on 2003) and by maximum parsimony (MP) using the results of Tsutsumi et al. (2007) and Perazza PAUP 4.0a157 (Swofford 2002). The results from & Tsutsumi (2015). The ITS sequence data of the preliminary molecular and morphological L. hawaiensis H. Mann from GenBank were also analyses showed a close affinity of the plants included in the dataset. from Minami-iwo-to Island to members of the Li- We constructed trees deduced from ITS, chlo- paris makinoana complex in which three mor- roplast, and the combined datasets, independent- phologically distinct species, L. suzumushi Tsut- ly.