University of Groningen the Role of Vitamin a in Bile Acid Synthesis And

University of Groningen

The role of vitamin A in bile acid synthesis and transport and the relevance for cholestatic liver disease Hoeke, Martijn Oscar

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record

Publication date: 2013

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA): Hoeke, M. O. (2013). The role of vitamin A in bile acid synthesis and transport and the relevance for cholestatic liver disease. s.n.

Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment.

Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

Download date: 07-10-2021 The role of vitamin A in bile acid synthesis and transport and the relevance for cholestatic liver disease

Martijn Oscar Hoeke The research described in this thesis was funded by the Dutch Digestive Founda- tion (MLDS) (MWO 03 – 38).

The printing of this thesis was financially supported by the following organizations:

Maag Lever Darm Stichting (MLDS)

Nederlandse Vereniging voor Hepatologie (NVH)

Groningen University Institute for Drug Exploration (GUIDE)

Life Sciences & Technology (Van Hall Larenstein & Noordelijke Hogeschool Leeuwarden)

Their contribution is gratefully acknowledged!

© copyright 2013 M.O. Hoeke All rights reserved. No part of this book may be reproduced or transmitted in any form or by any means without written permission of the author and the publisher holding the copyright of the published articles.

ISBN: 978-90-367-6496-4 (printed) 978-90-367-6495-7 (digital) Cover: Carrot liver photopgraph by M.O. Hoeke, design by R.J. Hoeke Lay-out by: M.O. Hoeke Printed by: Ipskamp Drukkers, Enschede, The Netherlands RIJKSUNIVERSITEIT GRONINGEN

The role of vitamin A in bile acid synthesis and transport and the relevance for cholestatic liver disease

Proefschrift

ter verkrijging van het doctoraat in de Medische Wetenschappen aan de Rijksuniversiteit Groningen op gezag van de Rector Magnificus, dr. E. Sterken, in het openbaar te verdedigen op maandag 28 oktober 2013 om 16.15 uur

door

Martijn Oscar Hoeke

geboren op 18 juni 1977 te Tilburg Promotores: Prof. dr. K.N. Faber Prof. dr. A.J. Moshage

Beoordelingscommissie: Prof. dr. M.H. Hofker Prof. dr. C. Housset Prof. dr. H.J. Verkade Voor mijn ouders

Voor Elona & Jurre Paranimfen: Janette Heegsma Rens Jurian Hoeke Table of contents

Chapter 1: The Interrelationship Between Bile Acid and Vitamin A 9 Homeostasis

Aim and outline of this thesis 43

Chapter 2: Low Retinol Levels Differentially Modulate Bile Salt-Induced 63 Expression of Human and Mouse Hepatic Bile Salt Transpor- ters Hepatology. 2009 Jan;49:151-159

Chapter 3: Human FXR Regulates SHP Expression Through Direct Bin- 83 ding to an LRH-1 Binding Site, Independent of an IR-1 and LRH-1 Submitted

Chapter 4: Vitamin A Deficiency Causes Mild Cholestasis in Rats 105 In preparation

Chapter 5: Vitamin A Deficiency Severely Aggravates Obstructive 119 Cholestasis Which Is Effectively Treated by Acute Vitamin A Supplementation In preparation

Chapter 6: General Discussion 143

Summary/Samenvatting 159 Dankwoord 167 Curriculum Vitae & List of Publications 173

Chapter 1

The Interrelationship Between Bile Acid and Vitamin A Homeostasis

Martijn O. Hoeke and Klaas Nico Faber

Department of Gastroenterology and Hepatology, University Medical Center Groningen, Groningen, University of Groningen, The Netherlands Chapter 1

Abstract

This thesis explores the regulatory interaction between vitamin A and bile salts. Bile salt homeostasis is of crucial importance to maintain vitamin A homeostasis. Bile salts are the emulsifying components of bile that are required for the effective absorption of the fat-soluble vitamin A in the intestine, most of which is stored in stellate cells in the liver. Dysregulation of bile salt homeostasis, for instance in patients with cholestasis, causes vitamin A malabsorption. At the same time cholestatic liver disease promotes the release of vitamin A from hepatic stellate cells, promoting depletion of vitamin A from the body. A functional relationship in the opposite direction, in which vitamin A influences bile salt homeostasis, has only recently emerged. Complex regulatory pathways ensure that bile salt homeostasis is maintained. These processes involve bile acid sensors, which are ligand-activated transcription factors. This way, bile salts regulate their own synthesis and transport at the transcriptional level. These bile acid sensors need to physically interact with a vitamin A sensor in order to regulate transcription. In this thesis, we show that vitamin A is required to maintain bile salt homeostasis and protects the liver during obstructive cholestasis. This chapter introduces the reader to the origin and function of bile salts and vitamin A and the signalling pathways they control.

1. The enterohepatic circulation of bile acids The liver is the largest solid organ of the human body and well-known for its regene- rative capacity. The liver consists of various cell types, including hepatocytes, stellate cells, cholangiocytes, endothelial cells, Kupffer cells (hepatic macrophages), and oval or progenitor cells, each with their specific role in the function of the liver. Hepato- cytes (the hepatic parenchymal cells) make up 80% of the liver mass and fulfil most of the primary functions of the liver. Hepatocytes are arranged in plates that form a physical barrier between the blood in the sinusoid and the bile in the canaliculus. Approximately 80% of the hepatic blood supply enters via the portal vein and is rich in nutrients originating from the intestine. Oxygen-rich blood enters via the hepatic artery, mixes with the portal blood and flows along the hepatic sinusoids and exits via the central vein. The sinusoids Figure( 1.1) are lined with a sheet of endothelial cells, that allows for the exchange of small molecules between blood and hepatocytes. Kupffer cells are integrated into the sheet of endothelial cells. Stellate cells reside in the space of Disse, the plasma-filled space between hepatocyte and sinusoid. Stellate cells (Ito cells, fat-storing or vitamin A-storing cells) are myofibroblast-like cells that contain large cytoplasmic lipid droplets. Cholangiocytes are the bile duct epithelial cells and form approximately 3% of the liver mass (1). In broad terms, the physiological functions of the liver can be described as, synthesis, storage, metabolism, catabolism and excretion. Proteins synthesized by the liver include serum proteins such as albumin, different coagulation factors (such as fibrinogen) and the retinol binding protein 4 (RBP4).

10 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

Cholesterol and triglycerides are synthesized by the liver. Moreover, it is the main storage site of glucose (in the form of glycogen), iron and vitamin A. Another important function of the liver is detoxification. Endogenous waste products (such as bilirubin) and exogenous harmful compounds (drugs and toxins) are metabolized by the liver. This makes them less toxic and increases water solubility, which enhances clearance of these compounds. The liver is also the largest gland of the human body, amongst others synthesizing and excreting the hormone insulin-like growth factor 1 (IGF-1) and producing bile. Bile aids in the digestion and absorption of nutrients and is the main route for the excretion of waste products via the intestine. Major components of bile are bile salts, phospholipids, cholesterol, bilirubin, alkaline hydrogen - carbonate ions (HCO3 ) and water. Bile salts are the components of the bile that give it its fat-emulsifying properties. Bile salts are synthesized by hepatocytes using cholesterol as substrate. The liver secretes bile via the bile ducts and the gallbladder into the intestinal lumen (duodenum). Here, bile fulfils its function in the digestion and absorption of fats and fat-soluble dietary compounds. In the terminal ileum, bile salts are reabsorbed and transported back to the liver via the portal vein. This shuttling of bile salts between liver and intestine is called the enterohepatic circulation of bile salts and is a very efficient process as per cycle only 5% of the bile salts are lost in the feces. De novo synthesis of bile salts in the liver compensates for this loss and maintains a balanced amount of bile salts in the enterohepatic cycle.

Figure 1.1. Structure of the liver sinusoid The liver possesses a dual blood supply. Nutrient-rich blood coming from the portal vein and oxygen-rich blood coming from the hepatic artery merge upon entering the sinusoid. The sinusoids are lined with endothelial cells and Kupffer cells. The plasma-filled space of Disse separates the endothelial cells from the hepatocytes. Bile produced by the hepatocytes is excreted into the bile canaliculi that empty into the bile ductule, which is formed by cholangiocytes. Vitamin A-storing stellate cells reside within the space of Disse. Reprinted from Frevert (2004) (361).

11 Chapter 1

1.1. Bile Acid/Salt Biosynthesis Bile acid synthesis produces two main types of primary bile acids: cholic acid (CA) and chenodeoxycholic acid (CDCA). These are conjugated to either glycine or taurine, yielding the bile salts taurocholic acid (TCA), glycocholic acid (GCA), tauroche- nodeoxycholic acid (TCDCA) and glycochenodeoxycholic acid (GCDCA). Bile salts that are not absorbed at the terminal ileum move to the colon where resident bacteria may convert them to secondary bile acids, such as lithocholic acid (LCA) and deoxycholic acid (DCA). A significant fraction of these secondary bile acid are also absorbed into the circulation. DCA accumulates in the bile acid pool, LCA to a much lesser extend as it is sulfated and subsequently excreted into bile (reviewed in (3)). The term bile “acid” refers to the protonated (-COOH) form, while bile “salt” refers to the deprotonated or ionized (-COO-) form. Bile acids conjugated to glycine or taurine are largely deprotonated at the physiological pH, and should thus be regarded as bile salts. The ionized conjugated bile salt is more hydrophilic when compared to the unconjugated bile acid. Conjugated bile acids are therefore more efficient in emulsifying fats than their unconjugated counterparts. Cholesterol is oxidized to bile acids through a cascade of enzymatic conversions involving at least 13 different enzymes (see for a review (4)). Although the first steps of the conversion from cholesterol to bile acids may take place at extra-hepatic locati- ons, the production of the end products, e.g. bile salts, is restricted to the hepatocytes in the liver. Two enzymes, cholesterol 7-alpha-hydroxylase (CYP7A1) and sterol 12-alpha-hydrolase (CYP8B1) are of particular relevance. CYP7A1 is considered the rate-limiting enzyme in bile acid synthesis (5), while CYP8B1 converts CDCA to CA and thus determines the relative hydrophobicity of the bile acid pool (6). The final step in bile acid synthesis is the conjugation of taurine or glycine and is exclusively performed by the peroxisomal enzyme bile acid coenzyme A: amino acid N-acyltransferase (BAAT) (7). Bile acid synthesis is increased following feeding and glucose and insulin are important factors that induce CYP7A1 gene expression (8, 9).

1.2. Transporter Proteins Involved in (Bile Formation and) Bile Salt Transport Once conjugated, membrane translocation of bile salts requires active transport by membrane-imbedded transporters. These transporters reside in the membranes of polarized hepatocytes, cholangiocytes and enterocytes and keep the bile salts in the enterohepatic circulation. The transporter proteins involved in the enterohepatic circulation have been the subject of multiple reviews (10-13). A schematic overview of the enterohepatic circulation of bile salts and the transporter proteins involved is depicted in Figure 1.2.

1.2.A. Hepatic Bile Salt Transport Mechanisms

Hepatic Basolateral Transport/Bile Salt Import Bile salts returning from the intestine via the blood circulation are absorbed into the hepatocyte by the sodium/taurocholate co-transporting polypeptide (NTCP) (15, 16)

12 The Interrelationship Between Bile Acid and Vitamin A Homeostasis and at least three members of the organic anion transporting polypeptide (OATP) family (17). A recent study showed that also unconjugated bile acids are subject to active transport via OATP1B2 rather than entering the cell by passive diffusion (18). NTCP (SLC10A1) belongs to the SLC10 family, which comprises transport proteins that transport organic salts in a sodium-dependent manner. The human NTCP protein consists of 349 amino acids with a molecular mass of 56 kDa. In the liver, NTCP is expressed exclusively at the basolateral membrane of the hepatocyte and preferentially transports taurine conjugated bile acids. (15, 19, 20). However, also various other physiological bile salts and the steroid conjugate estrone 3-sulfate are substrates of NTCP (21). Expression of NTCP in pancreatic acinar cells has also been reported (22). The superfamily of OATPs comprises a family of transporters with a broad spectrum of substrates. The substrate specificity of OATPs is reviewed in detail by Königet al. (23). While most of the OATP proteins are expressed in multiple tissues, OAT- P1B1 (OATP2/OATP-C/SLCO1B1/SLC21A6) and OATP1B3 (OATP8/SLCO1B3/ SLC21A8) are predominantly if not exclusively expressed in liver at the basolateral membrane of hepatocytes. OATP1B1 consists of 691 amino acids with a molecular mass of 84 kDa. OATP1B3 consists of 702 amino acids and represents a glycoprotein with a molecular mass of 120 kDa. Both of these OATPs were shown to transport tau- ro- and glyco-conjugated CA (10, 23-25). OATP1A2 (OATP-A/SLCO1A2) is mainly expressed in brain and liver. It has a molecular mass of 85 kDa and consists of 670 amino acids. The rodent ortholog is OATP1A1, which has 12 putative transmembrane spanning domains. OATP1A2 is localized to the basolateral membrane of the hepatocyte and is reported to transport both conjugated and unconjugated CDCA and CA (10, 26, 27).

Hepatic Intracellular Transport of Bile Acids The cytosolic liver fatty-acid-binding protein (L-FABP) is involved in fatty acid metabolism and transport. Moreover, L-FABP was found to bind bile acids in a 1:2 ratio and to be excreted into bile (28, 29). Although bile acid metabolism is altered in L-fabp-/- mice, the physiological role of L-FABP in bile acid trafficking remains to be determined (30). Part of the bile salt pool that enters the liver is deconjugated by intestinal flora when passing through the intestine. Before excretion into bile, de novo and recycled bile acids need to be (re-)conjugated. The enzyme responsible for bile acid conjugation (BAAT) resides solely in peroxisomes, which suggests the existence of intracellular bile acid/salt transporters. Although no intracellular transporter has been identified to date, recent data from our laboratory strongly supports the existence of such bile salt transporters in the peroxisomal membrane (4, 7, 31).

13 Chapter 1

Hepatocyte BSEP MDR1 NTCP OSTα/β BS- Na+ OC+ FIC1 - - BS BS PC PS BS- Liver - MDR3 BS OA- BS- - CH OA MRP3 OATPs MRP2 ABCG5/8 BS-

OSTα/β Cholangiocyte ASBT Na+ BS- BS- BS- MDR1 Bile duct - OA OC+ MRP3

ASBT Enterocyte Na+ OSTα/β OC+ MDR1 BS BS- BS- BA- MRP2 BS- OA- Intestine OA- IBABP CH ABCG5/8 MRP3

Figure 1.2. Transport mechanisms involved in the enterohepatic circulation of bile salts and formation of bile The enterohepatic circulation of bile salts (BSs) requires dedicated transporter proteins on both sides of polarized hepatocytes, cholangiocytes and enterocytes. Bile salts returning from the intestine via the blood circulation are absorbed into the hepatocyte by the sodium/taurocholate co-transporting polypeptide (NTCP) and at least three members of the organic anion transporting polypeptide (OATP) family. Conjugated monovalent BSs are excreted from the hepatocyte via the canalicular bile salt export pump (BSEP). Bivalent BSs, together with organic anions (OA-), are excreted via the canalicular multidrug resistance-associated protein 2 (MRP2). The ABC half-transporters ABCG5/G8 secrete cholesterol into bile. The multidrug resistance protein 3 (MDR3) and the familial intrahepatic cholestasis type 1 (FIC1) protein excrete phosphatidylcholine (PC) and phosphatidylserine (PS), respectively, which form mixed micelles in bile together with cholesterol and BS-. Organic cations (OC+) are excreted by the efflux pump for xenobiotic compounds (MDR1). Cholangiocytes and enterocytes use similar transport mechanisms for BS- shuttling. At the apical membrane, BS- are taken up by the ileal bile salt transporter (ASBT). Cellular transport of BS- in the enterocyte is facilitated by the ileal bile acid binding protein (IBABP). Excretion of BS- is primarily performed by the organic solute transporter dimer (OSTα/β). Besides excreting OA-, the multidrug resistance-associated protein 3 (MRP3) provides an alternative route for the elimination of BS-. Both OSTα/β and MRP3 are also expressed at

14 The Interrelationship Between Bile Acid and Vitamin A Homeostasis the basolateral membrane of hepatocytes, in particular in pathological conditions. Here they provide an alternative route for the elimination of BS- and other OA-. MDR1 is also present in the cholangiocytes and enterocytes at the apical membrane, while MRP2 is also expressed in ileum. BS- excreted by the enterocytes/cholangiocytes return to the liver via the blood, closing the enterohepatic circulation. Inspired by Trauner et al. ( 2003) (11) and Zollner et al. (2006) (276).

Hepatic Canalicular Bile Salt Export Conjugated recycled and de novo synthesized bile salts are excreted into bile by the bile salt export pump (BSEP/ABCB11). The 160 kDa BSEP-protein is exclusively expressed at the canilicular membrane of hepatocytes and belongs to the B subfamily of ATP-binding cassette (ABC) transporters. A total of 48 ABC type transporters have been identified in the human genome. BSEP contains 12 membrane spanning domains and two intracellular loops that contain nucleotide/ATP binding motifs, which is the typical build-up of an ABC transporter. Mutations in the BSEP gene are associated with progressive familial intrahepatic cholestasis type 2 (PFIC2), which is characterized by severe and progressive liver disease. In addition, mutations in BSEP may cause benign recurrent intrahepatic cholestasis (BRIC) that is characterized by intermittent attacks of cholestasis without permanent liver damage (32-37). The multidrug resistance-associated protein 2 (MRP2/ABCC2) transports a variety of organic anions at the canalicular membrane into bile, including conjugated bilirubin (38). MRP2 belongs to the C subfamily of ABC transporters (MRPs), of which ten members (MRP1 to 9 and pseudo gene ABCC13) have been identified (39). Besides the liver, MRP2 is expressed in the intestine (duodenum) and kidney (40). MRP2 is capable of transporting bivalent glucuronidated and sulfated bile salts, and was recently also shown to transport tauroursodeoxycholate (41). The role of MRP2 in maintaining bile salt homeostasis may differ between species. Mutations in MRP2 lead to Dubin-Johnson syndrome in humans (42), a benign form of jaundice (43, 44), transport of bile salts into bile is not disturbed in these patients. However, Groningen yellow (GR/TR-) rats, which lack a functional MRP2 protein, display an impaired bile flow (45).

Additional Hepatic Canalicular Transporter Proteins That Contribute to Bile For- mation The multidrug resistance protein 3 (MDR3/ABCB4; the rodent ortholog is MDR2) and the ABCG5/ABCG8 dimer transport phospholipids and cholesterol, respectively, from the inner to the outer leaflet of the canalicular membrane. Bile salts excreted into the canaliculus interact with the outer leaflet of the hepatocyte’s apical membrane and extract cholesterol and phospholipids thereby forming mixed micelles (46). Like BSEP, MDR3 belongs to the B subfamily of the ABC transporter family and shares the 12 membrane spanning domain structure. Defects in the MDR3 gene cause progressive familial intrahepatic cholestasis type 3 (PFIC3). In this disease, phospholipid transfer to bile is disturbed. Lack of phospholipids hampers the formation of the mixed micelles, increasing the concentration of pure micelles in bile, resulting in damage to the bile duct epithelium and cholestasis (47, 48).

15 Chapter 1

Another member of the B subfamily of ABC transporters is ATP8B1, it encodes FIC1, named after the associated disease familial intrahepatic cholestasis type 1 that is caused by mutation in the ATP8B1 gene (reviewed in (49)). The FIC1 protein acts as a flippase for phosphatidylserine. Although FIC1 does not transport bile salts, mutations in the ATP8B1 gene cause cholestasis. The proposed mechanism for this observation is that in the absence of functional FIC1 protein the membrane gets depleted of lipids (including cholesterol) in the process of bile formation. Lack of cholesterol in the membrane limits the function of BSEP resulting in intracellular bile salt accumulation (49). ABCG5 and ABCG8 are members of the G subfamily of the ABC-transporters. They are so-called half-transporters that form a heterodimer to become a functional cholesterol transporter. ABCG5/G8 is localised to the apical membrane of hepatocytes, and cholangiocytes and enterocyte (50, 51). Defects in either the murine Abcg5 or Abcg8 gene are associated with decreased excretion of cholesterol in bile and an increased absorption of cholesterol in the intestine (52). The multidrug resistance-1 P-glycoprotein (MDR1/ABCB1) is an efflux pump for xenobiotic compounds and has a broad substrate specificity. It is associated with the resistance of tumor cells against chemotherapeutic drugs. MDR1 is expressed at the canalicular membrane of hepatocytes and the apical side of the bile ductural and intestinal epithelium (53). Apart from metabolites of LCA, bile salts do not seem to be substrates for MDR1 and malfunctioning of MDR1 does not result in cholestatic liver disease (54). However, accumulation of certain drugs and substrates for MDR1 may inhibit the function of BSEP (12, 55). Unlike human PFIC2 patients, Bsep-/- mice do not suffer from severe cholestasis and have substantial bile salt secretion (56). In- terestingly these mice have increased MDR1A expression while expression of MDR2, MRP2, and MRP3 (the latter will be discussed later) was only slightly increased (57). This suggests that MDR1A in mice might be involved in bile salt transport in the absence of BSEP.

1.2.B. Bile Ductular and Intestinal Bile Transport Mechanisms After hepatobiliary secretion, bile salts travel through the bile ducts and are stored in the gallbladder. Triggered by food ingestion, the gallbladder contracts and bile is released into the duodenum where bile salts fulfil their function in the digestion and absorption of fat-soluble nutrients. At the terminal ileum, they are efficiently reabsorbed to the circulation and returned to the liver via the portal tract. The bile ductular and distal ileum epithelial cells, cholangiocytes and enterocytes, contain highly similar bile salt transport mechanisms (Figure 1.2).

Apical Sodium-dependent Bile Salt Import The apical sodium-dependent bile salt transporting protein (ASBT/SLC10A2) was initially identified as the intestinal analogue of NTCP, belonging to the same SLC10 family of sodium-dependent organic ion transporters. Subsequently, ASBT was also shown to facilitate bile salt absorption at the apical domain of rat cholangiocytes.

16 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

The membrane topology and transport characteristics are similar to NTCP. The ASBT glycoprotein consists of 348 amino acids and has a molecular mass of 48 kDa (12, 19, 58-60). Mutation in the SLC10A2 gene have been associated with primary bile salt malabsorption and patients suffer from diarrhea and fat malabsorption (61).

Intracellular Bile Salt Transport The intestinal bile acid binding protein (IBABP/FABP6) is expressed in enterocytes and cholangiocytes. IBABP represents a protein of 128 amino acids with a molecular mass of 14-15 kDa. IBABP is proposed to be the most important protein for transcellular bile salt movement in enterocytes. However, its physiological function remains elusive, as the absence of IBABP, as observed in Fxr-/- mice, does not affect the turnover rate and cycling time of the cholate pool (62). Recent data obtained with Fabp6-/-mice show that IBABP is not prerequisite for ileal bile acid absorption but that it does contribute to efficient shuttling of bile acids through the enterocyte (63). Additionally, binding of bile salts by IBABP has also been suggested to prevent intracellular toxicity (12, 64, 65).

Basolateral Bile Salt Efflux Mechanisms The identity of the transporter that facilitates the efflux of bile salts from ileal enterocytes across the basolateral membrane to the circulation has long been unclear. Ini- tially, it was proposed that this activity was performed by a truncated form of ASBT (t-ASBT) that is a product of alternatively splicing of the corresponding transcript. T-ASBT was shown to be capable of transporting TCA in vitro and to be expressed at the basolateral membrane. T-ASBT was identified in ileum, kidney, and bile ductural epithelial cells but not in hepatocytes (12, 66). A second transporter that was proposed to export bile salts from enterocytes was the multidrug resistance-associated protein 3 (MRP3/ABCC3). MRP3 is expressed in various tissues of the gastrointestinal tract, including liver and ileum, where it was shown to be expressed at the basolateral membrane of cholangiocytes and enterocytes, respectively. MRP3 was shown to be capable of transporting various endogenous bile salts. However, mice lacking Mrp3 do not show altered bile salt physiology. This is in line with the observation that MRP3 expression is rather low in human liver under healthy conditions (39, 67-71). With the identification in 2005 of the organic solute transporter alpha/beta (OSTα/β) as the main functional basolateral bile salt transporter in the mouse ileum, the missing link in bile salt circulation was identified (72, 73). OSTα/β consists of an α- and a β-subunit that together form a functional transporter at the basolateral membrane. OSTα/β was initially identified as an organic solute and steroid transporter in the marine vertebrate little skate (74). OSTα is a 340 amino acid protein, and is predicted to contain seven transmembrane domains. The β-subunit is a much smaller protein of 128 amino acids predicted to have a single transmembrane domain (75). The human/rodent homologs were found to export various endogenous bile salts. OSTα/β is predominantly expressed at the basolateral membrane of intestinal epithelium and cholangiocytes in liver, with less but detectable amounts also in renal proximal tubu-

17 Chapter 1 lar cells in kidney and hepatocytes in the liver (76). Interaction between the α- and β-subunits is essential for protein stability and efficient trafficking through the Golgi apparatus to the plasma membrane. Ostα-/- mice have normal Ostβ mRNA levels, but the OSTβ protein is absent (77). Emerging evidence suggests a pleiotropic function of OSTα/β that is not limited to bile salt transport (78). Bile salts that are excreted to the circulation by the enterocytes are transported back to the liver, closing the circle of the enterohepatic circulation.

1.3. The Adaptive Response to Bile Salt Accumulation Bile salt homeostasis is maintained by coordinated regulation of bile salt synthesis and transport. When bile acid concentrations increase, for instance when mice are fed a bile salt-containing diet, expression of both Cyp7a1 and Cyp8b1 is reduced, which represses bile acid synthesis. At the same time expression of Ntcp is lowered and Bsep expression is increased (79). In obstructive cholestasis, as in patients with primary biliary cirrhosis (PBC) and in bile duct-ligated rodents, hepatic expression of OSTα, OSTβ, MRP3 and multidrug resistance-associated protein 4 (MRP4/ABCC4) is increased (80-83). Intestinal expression of ASBT mRNA is lowered by elevated bile salt levels (84). The fact thatMrp4 -/- mice have an impaired cytoprotective response in obstructive cholestasis exemplifies that these adaptive responses are crucial to prevent excessive liver damage when bile salt flow from the liver is impaired (83). Alt- hough MRP3 was shown to transport (secondary) bile salts in vitro, bile duct-ligated Mrp3-/- mice do not suffer more liver damage than wild type mice (69). In this case MRP4 may be sufficient to prevent excessive liver damage. These mechanisms protect the hepatocyte and enterocyte from cytotoxic accumulation of bile acids. Regulation of these adaptive mechanisms will be discussed later.

2. Vitamins, essential micronutrients In 1916, vitamin A was one of the first vitamins that was discovered (85). Historical- ly, the word “vitamine” was used to describe a growth factor that is present in food and that is essential for life. The combination of the words “vital” and “amine” yiel- ded “vitamine”. As it became apparent that there were multiple vitamins, McCollum divided them into two classes: “fat-soluble factor A” and “water-soluble factor B”. Following the discovery that not all of these micronutrients shared the amine-group in their molecular structure, Drummond changed the name to “vitamin”, dropping the final “e”. He renamed McCollum’s compounds into vitamin A and vitamin B and new members of these series of factors were named vitamin C, vitamin D etc. (85, 86). Water-soluble vitamins are readily expelled from the body, hence, regular (daily) intake is required. In contrast, fat-soluble vitamins are stored in the liver and adipose tissues. Stable levels of these vitamins can therefore be maintained for a longer time period. The downside of this is that excessive intake of the fat-soluble vitamins A, D, E and K poses a greater risk of vitamin intoxication than vitamins B and C. The uptake of fat-soluble vitamins requires the presence of bile salts in the intestinal lumen. Cholestatic liver diseases, such as PBC, primary sclerosing cholangitis (PSC), bilary

18 The Interrelationship Between Bile Acid and Vitamin A Homeostasis atresia and gallstone disease, which dysregulate the flow of bile to the intestine, may lead to malabsorption of fat-soluble vitamins and associated clinical symptoms of hypovitaminosis. The primary focus of this thesis is the fat-soluble vitamin A, but also the other fat-soluble vitamins will be briefly discussed.

2.1. Vitamin A In 1930, Moore proved that the yellow plant pigment beta-carotene is converted to colourless retinol in the mammalian body (87). In 1931, Karrer deduced the molecular structure of retinol and beta-carotene (85, 86) (Figure 1.3A-B). Nowadays, the term vitamin A is used as the generic descriptor for retinoids exhibiting the biological activity of retinol. Retinoids are a class of compounds consisting of four isoprene (2-methyl-1,3-butadiene) units joined in a head-to-tail manner. (86). Vitamin A-derivatives fulfil numerous important functions in the mammalian body, including roles in vision, maintenance of epithelial surfaces, immune competence, reproduction and embryonic growth and development (88). Dietary sources of vitamin A are provitamin A carotenoids (mainly β-carotene, from plant sources), preformed vitamin A (retinyl esters from animal sources) and precursors of retinol (88). The recommended daily intake of vitamin A is approximately 700 and 900 µg for adult women and men, respectively. Dietary intake of solely β-carotene may be inadequate to maintain normal levels of vitamin A, retinyl esters should therefore be considered an essential component of a healthy diet (89). Approximately 80% of the total body pool of vitamin A is stored in the liver as retinyl esters (90). Some of vitamin A’s numerous biological functions are related to its antioxidant properties. Especially carotenoids, such as lycopene and β-carotene, are potent antioxidants (91, 92), but also retinol, retinyl esters and retinoic acid (RA) have been shown to prevent lipid peroxidation in vitro (93, 94). Another well-known function of vitamin A is its role in the visual cycle by photoisomerization. Rhodopsin, the visual pigment of the rod photoreceptor cell, contains 11-cis retinal as its light-sensitive cofactor. Light activation is achieved by 11-cis to all-trans isomerisation, followed by the release of all-trans retinaldehyde (95). However, most of the biological functions of vitamin A involve the activation of ligand-dependent transcription factors. This hormonal function of vitamin A gained tremendous scientific interest with the discovery of two vitamin A receptors that are members of the nuclear receptor superfamily (96). All-trans retinoic acid (atRA) and 9-cis retinoic acid (9cRA) (Figure 1.3C-D) are the two biologically active isomers of RA that regulate gene transcription via the retinoic acid receptor (RAR) and the retinoid X receptor (RXR). These nuclear receptors will be discussed in section 4.

19 Chapter 1

β-carotene B D

retinol

C O

OH O OH

all-trans retinoic acid 9-cis retinoic acid O E G

3 OH

O phylloquinone O H

HO OH calcitriol O menaquinones

F HO

O α-tocopherol

Figure 1.3. Fat soluble vitamins A, D, E and K Beta- (β-) carotene (A) is the primary source of vitamin A in plant-derived foods, which can be clea- ved into two molecules of retinol (B). Retinol and its esters are the main transport and storage forms of vitamin A. The 2 predominant biologically active forms of vitamin A are all-trans and 9-cis retinoic acid (C and D). The biologically active compound of vitamin D is calcitriol (1,25-dihydroxycholecalci- ferol or 1,25-dihydroxyvitamin D3) (E). Alpha- (α-) tocopherol (F) is the most abundant form of vitamin E in nature, it also has the highest biological activity. Phylloquinones (G) are the primary dietary source of vitamin K, while menaquinones (H) are produced by bacteria in the gastro-intestinal tract.

2.2. Vitamin D, Important Micronutrient But Not Really a Vitamin Vitamin D was discovered as an essential nutrient to prevent rickets, e.g. softening of bones leading to skeletal deformations in children and an increased risk of fractures later in life. Vitamin D deficiency can result in osteoporosis (decreased bone mine- ral density) in adults, causing osteomalacia (softening of bone), muscle weakness and increased risk of fractures (97). Vitamin D is required for optimal absorption of dietary calcium and phosphate and plays an essential role in calcium homeostasis

20 The Interrelationship Between Bile Acid and Vitamin A Homeostasis and bone metabolism. UV-light irradiation of the skin was found to prevent rickets as this stimulates formation of vitamin D3 in the skin. The ability to produce sufficient amounts of vitamin D3 with adequate sunlight exposure indicates that vitamin D is actually not a vitamin (98). The name “vitamin D” refers to a group of steroids that exhibit the biological activity of cholecalciferol. The two physiologically relevant forms are vitamin D2 (ergocalciferol) and vitamin D3 (cholecalciferol). Very few foods contain significant amounts of vitamin D. 2D is plant derived and is present in mushrooms that are exposed to UV-light. The animal-derived 3D is present in, amongst others, fish oil, egg yolk and liver. (97, 99).

In the liver, vitamin D3 is metabolized to 25-hydroxycholecalciferol (calcidiol, 25- (OH)D), which is subsequently metabolized by the kidney into the biologically active steroid hormone 1,25-dihydroxyvitamin D [1,25(OH)2D] (Figure 1.3E) (97). Vitamin D is stored in adipose tissues as calcidiol. Hypovitaminosis D may develop through a combination of inadequate vitamin D intake and insufficient exposure to sun light in otherwise healthy people (97, 100). In addition, vitamin D deficiency may develop as a result of multiple disease conditions, including impaired synthesis in the skin, impaired intestinal absorption as well as acquired and heritable disorders of vitamin D metabolism and responsiveness.

2.3. Vitamin E, Solely Antioxidant or More In 1922, vitamin E was first described as an essential nutrient for reproduction in rats. Vitamin E is the generic description for α-, β-, γ-, and δ- tocopherols and the corresponding four tocotrienols. Alpha-tocopherol is the most abundant form in nature, which has the highest biological activity and reverses symptoms of vitamin E deficiency in humans (Figure 1.3F) (101-103). Nuts, seeds, and vegetable oils are among the richest sources of alpha-tocopherol and significant amounts are present in green leafy vegetables. Tocopherol is a potent antioxidant that prevents lipid peroxidation of polyunsaturated fatty acids in cellular membranes. In addition to its antioxidant activities, vitamin E is reported to be involved in cell signalling, immunity, gene expression and metabolic processes (104). However, others believe that all vitamin E actions arise from its antioxidant protection of polyunsaturated fatty acids in the plasma membrane, and that vitamin E is nothing more than an antioxidant (105). The liver plays a central role in α-tocopherol homeostasis. Vitamin E travels the body as a component of lipoproteins that are taken up (chylomicrons, low density lipoprotein (LDL) and high density lipoprotein (HDL)) and excreted (very low density lipoprotein (VLDL)) by the liver. One third of the body content of vitamin E is stored in the liver, mainly in hepatocytes (106).

2.4. Vitamin K Vitamin K refers to a group of chemically similar compounds called naphthoqui- nones. The naturally occurring forms of vitamin K are 1K - (phylloquinone) and the

K2-compounds (menaquinones) that contain unsaturated side chains of varying length (Figure 1.3G-H). Phytonadione is found in plants and is the primary

21 Chapter 1 dietary source of vitamin K for humans. Menaquinones are produced by bacteria in the gastrointestinal tract and contribute to the intake of vitamin K (107-109). Vitamin K is required for normal blood clotting. In fact, the name vitamin K is derived from “Koagulations-Vitamin” in German and Scandinavian languages (110). It acts as a cofactor for γ-glutamyl carboxylase. This enzyme is responsible for post-translational modification of specific glutamate residues in proteins to γ-carboxyglutamate. The majority of γ-carboxylated proteins function in blood coagulation, while others play a role in calcium homeostasis and normal bone metabolism (111, 112). Green vegetables, such as Brussels sprouts, spinach, cauliflower and broccoli, as well as certain vegetable oils, including soybean oil, rapeseed oil and olive oil, are rich dietary sources of vitamin K. Animal-derived foods contain limited amounts of vitamin K (109). Vitamin K deficiency occurs when intake is inadequate or when the intestinal flora is altered. Clinical symptoms of vitamin K deficiency include clotting disorders (e.g. vitamin K deficiency bleeding (VKDB)) and increased risk of bone fractures. Toxicity of excess vitamin K has not been reported (108, 113).

2.5. Liver Disease and Occurrence of Fat-soluble Vitamin Deficiency Fat-soluble vitamin deficiency is observed in patients suffering from liver diseases of various etiologies. A recent study reported deficiencies of vitamin A (29%), vitamin D (71%), vitamin E (6%) and up to 68% showed signs of subclinical vitamin K deficiency, in a group of 31 patients suffering from cholestatic liver disease (114). Similarly, a prevalence of fat-soluble vitamin A, D, E and K deficiency is reported to be 33.5%, 13.2%, 1.9% and 7.8%, respectively, in a group of over 150 PBC patients (115). In PSC patients a prevalence of vitamin A, D and E deficiency was found of respectively 40%, 14% and 2%. In pre-transplant patients prevalence was increased to 82%, 57% and 43%, respectively (116, 117). A recent study by De Paula et al. reports 60% of patients (35 out of 58) suffering from liver cirrhosis have lowered plasma retinol levels, 23 of these patients were diagnosed as vitamin A deficient (VAD) (118). More than half (54.3% out of n = 140) of patients suffering from hepatitis C virus-related chronic liver disease were VAD (119). The vast majority (85%) of patients (n = 147) with alcoholic liver cirrhosis have a compromised vitamin D status, 37% of these patients were vitamin D deficient (VDD). In the same study, 47% of PBC patients (n = 58), had lowered vitamin D serum levels, 18% of these patients were VDD (120). Sokol et al. reported that 17% of PBC patients (7 out of 42) suffered from vitamin E deficiency. In multiple studies, patients suffering from PBC, biliary atresia and autoimmune hepatitis presented lower serum levels of vitamins A, D, E and K when compared to controls, without reaching deficiency (120-123). The prevalence of fat-soluble vitamin deficiencies varies between studies because of differences in disease etiology, group size, patient age and the definition of “deficiency”. Collectively, these studies identify vitamin A deficiency as the most frequent deficiency of all fat-soluble vitamins in (cholestatic) liver diseases.

22 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

2.6. Supplementation of Fat-soluble Vitamins and Liver Disease Guidelines for supplementation of fat-soluble vitamins to patients suffering from liver disease differ per country. In literature, fat-soluble vitamin supplementation is recommended in patients suffering from cholestatic liver disease, especially in ne- onates and infants, as stores of fat-soluble vitamins are low at birth (124, 125). Vita- min A supplementation is recommended as a single 50.000 IU dose every 15 days for adults and every month for children. However, no clear guidelines exist for vitamin A supplementation for patients with liver disease in The Netherlands. Administration of vitamin E, 100-200-400 IU/day, is recommended for all patients with cholestasis and neurological symptoms of unknown etiology. Vitamin K malabsorption is rapidly corrected by subcutaneous administering of vitamin K, 10 mg/day for 3 days, followed by long-term oral supplements of vitamin K, 5-10 mg/day or 10 mg/month subcutaneously (126, 127). When fat-soluble vitamin supplements are given attention should be paid to the route of administering fat-soluble vitamin supplements. Oral supplementation of fat-soluble vitamins to (obstructive) cholestatic patients may not be as efficient as subcutaneous supplementation, since fat absorption is disturbed in these patients because of limited bile flow to the intestine.

3. Vitamin A metabolism

3.1. Ileal Vitamin A Absorption Requires Bile Salts Various forms of -precursors of- vitamin A are entering the digestive tract depending on the composition of the diet. Plant carotenoids are thought to be absorbed into the intestinal epithelium by passive diffusion after being incorporated into micelles that mainly consist of bile salts and dietary fats. However, recent studies in Caco-2 mo- nolayers suggest a facilitated uptake mechanism of carotenoids that involves scavenger receptor class B member 1 (SR-BI) (128, 129). Retinyl esters are first converted to retinol within the intestinal lumen, followed by uptake in the enterocyte (87). Unes- terified retinol enters the cell by diffusion, but the efflux of retinol may be partially facilitated by the ABC transporter ABCA1 (128). The pancreatic triglyceride lipase (PTL) and the intestinal brush border membrane enzyme phospholipase B are responsible for the hydrolysis of retinyl esters. The enzymatic activity of PTL depends on the presence of bile. Lipases, such as PTL, act on a water-lipid interface and bile aids in the formation of such interfaces. The emulsifying properties of bile salts stabilize the interface and bile phospholipids are part of the interface (130). Administration of bile salt sequestering agents to humans lowers the total carotenoid levels in serum (131), while administration of the bile salt TCA enhanced vitamin A absorption in rats (132), further underscoring the role of bile salts in vitamin A absorption.

3.2. Vitamin A Transport Beta-carotene can be converted to retinoids inside the enterocyte (87). Symmetric cleavage of one molecule β-carotene by beta-carotene 15,15’-monooxygenase 1

23 Chapter 1

(BCMO1) yields two molecules of retinal (133). Alternatively, via a series of asymmetric cleavages one molecule of β-carotene can be converted to one molecule of retinal. Subsequently, retinal is reduced in a reversible process to retinol. Several enzymes are capable of catalysing this conversion, including members of the short- and medium-chain alcohol dehydrogenase/reductase superfamily that will be discussed later. The intestinal reductase activity, however, remains to be identified (134). Free retinol is bound by the cellular retinol-binding protein type II (CRBP-II/RBP2). Most of the retinol absorbed by the enterocyte is re-esterified to saturated long-chain fatty acids, mainly palmitic acid. Binding of retinol to CRBP-II facilitates the esteri- fication of retinol by lecithin:retinol acyl tranferase (LRAT). Uncleaved carotenoids and newly-synthesized retinyl esters, but not the ingested retinyl esters, are incorporated into chylomicrons (CMs) and secreted into lymph (128, 135, 136). Chylomicrons are very heterogeneously-sized particles that consist of a core of triglycerides and cholesterol esters and a monolayer of phospholipids, cholesterol and proteins. CMs are excreted by the enterocyte in the postprandial state after fat ingestion. CM excretion is impaired in the absence of bile salts (137). Two clinical manifestations of impaired CM assembly are abetalipoproteinemia and CM retention disease. Patients suffer from neurologic disorders and visual impairment. In a mouse model for CM retention disease it was observed that the absorption of fat, vitamin A and E was severely impaired and the mice showed significantly reduced growth rates (135), underscoring the importance of CM in the efficient absorption of fat and fat-soluble vitamins, such as vitamin A. Although most retinoids leave the enterocyte as retinyl esters, also a considerable amount of free retinol is released into the portal circulation (130).

3.3 Vitamin A Storage and Distribution Chylomicrons distribute nutrients to the various tissues and the chylomicron remnants are subsequently cleared by the hepatocyte. Most of the retinyl esters are still present in these remnants. Within the hepatocyte, retinyl esters are again hydrolysed to retinol. The trafficking of vitamin A throughout the body is depicted Figurein 1.4. Free hepatic retinol is now either used directly for distribution to tissues or stored in the liver. For distribution throughout the organism, retinol associates with RBP4, followed by secretion into the blood circulation. Approximately 95 % of plasma retinol-RBP4 is complexed with transthyretin (TTR) in a 1:1 ratio. This interaction reduces glomerular filtration of retinol (88, 138). Extrahepatic tissues take up retinol by means of the RBP4-receptor “Stimulated by Retinoic Acid gene 6 homolog” (STRA6). The retinol-RBP4-TTR complex dissociates at the receptor and free retinol is taken up by the cell. Free RBP4 in the circulation is catabolized in the kidney tubules. The second direction is transport of retinol to, and storage in, the hepatic stellate cell. Here, free retinol is esterified with long chain fatty acids, again predominantly palmitate, for storage in cytosolic lipid droplets. Retinol esters make up 30-50% of the lipid content of the lipid droplets in stellate cells (90).

24 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

hepatocyte RE

blood capilary RBP1 ROH

stellate cell CMR-RE ROH CM-RE RBP4 RE RE RE

RBP4-ROH CMR-RE β-carotene β-carotene TTR TTR RE RBP4 RBP4-ROH-TTR ROH ROH TTR TTR CM-RE RBP4-ROH RE RBP4 CM RBP- lipoprotein enterocyte receptor receptor lymph duct Intestinal lumen ROH RE

RARs/RXRs kidney RA DNA 9cRA nucleus extra hepatic target cell Figure 1.4. Major pathways for retinoid transport throughout the body Prior to absorption, dietary retinyl esters (RE) are hydrolysed to retinol (ROH) in the intestinal lumen, while carotenoids are absorbed and converted intracellularly to retinol by the enterocyte. In the enterocyte, retinol reacts with fatty acids to form retinyl esters, which are incorporated into chylomicrons (CM). Via the intestinal lymph chylomicrons reach the general circulation. Chylomicron remnants (CMR), which still contain most of the retinyl esters, are formed within the blood capilla- ries. These are cleared by the liver parenchymal cells and to some extend by extrahepatic tissues. In the hepatocytes, retinyl esters are hydrolysed to retinol, which then binds to cellular retinol binding protein 1 (CRBP1/RBP1). The retinol-RBP1 complex is secreted and transported into hepatic stellate cells. Retinol entering the stellate cell is either stored in lipid droplets as retinol palmitate or bound by plasma retinol-binding protein 4 (RBP4) and secreted into blood. In the bloodstream most retinol-RBP4 is reversibly complexed with transthyretin (TTR). Uncomplexed retinol is taken up by cells via a receptor mediated mechanism. Free RBP4 in the circulation is catabolized in the kidney tubules. Based on Senoo (2004) (85) and Blomhoff et al. (2006) (83).

Although the mechanism for retinol storage in, and mobilization from, stellate cells has not been fully elucidated, the factor shuttling retinol between different liver cell types is the cellular retinol-binding protein (CRBP-I/RBP1). The involvement and recycling of RBP4 (139) has been ruled out, since mice lacking Rbp4 accumulate excess of vitamin A in the liver. While still able to store vitamin A, these mice were unable to mobilise it to plasma. Moreover, extrahepatic expression of RBP4 does not restore vitamin A mobilisation in these animals, indicating that circulating RBP4 is not re-used by the liver. STRA6 is not expressed in the liver, ruling out a role of this receptor in hepatic storage of retinoids (140, 141). Under vitamin A sufficient conditions, most of the retinyl esters absorbed from the chylomicron remnants are transferred as retinol to the stellate cells, where over 80%

25 Chapter 1 of the body supply of vitamin A is stored (88). Smaller amounts are also stored in lipid droplets in the hepatocytes and in stellate cells residing in extrahepatic organs and tissues, such as kidneys, digestive tract, adrenal gland, lung, testis, uterus, bone marrow and thymus (90, 142-144). Extrahepatic storage sites of retinyl esters may provide a local supply of vitamin A to tissues with a high demand, such as the retina. The importance of extrahepatic vitamin A pools is demonstrated by the observation that storage of retinyl esters in retinal pigment epithelial cells is prerequisite for normal visual function (144). The stores of vitamin A are sufficient to maintain a steady physiological concentration of 1-2 µM retinol in plasma, despite strong fluctuation in daily intake of vitamin A (144).

3.4. Vitamin A Metabolism The three main circulating metabolites of vitamin A in the body differ in their oxidation state: the hydroxyl/alcohol form (retinol), the aldehyde form (retinal) and the carboxylic form (retinoic acid, RA) (96) (Figure 1.5). As described above, vitamin A is distributed throughout the body as retinol. It is generally believed that conversion of retinol into the biologically active retinal and retinoic acid occurs locally (88, 145). Retinol is converted into retinoic acid in a two-step process (reviewed in (145, 146)). Three enzyme families are capable of catalysing the first step in which retinol is -re versibly converted into retinal: the cytosolic medium-chain alcohol dehydrogenases (ADH), the (membrane-associated) short chain dehydrogenases (SDR) and the cytochrome P450s (CYPs) (88, 147-149). In the second step, retinal is converted into RA in an irreversible reaction. Multiple enzymes contain the retinaldehyde dehydrogenase (RALDH) activity. Best characterized are the mouse and human RALDH1, RALDH2 and RALDH3 that have been shown to be involved in RA synthesis in vivo (145). Of these three enzymes, only RALDH1 prefers cis-retinaldehyde over all-trans retinal with the highest activity towards 9-cis retinal (150). Also various enzymes belonging to the human cytochrome P-450 family have been shown to be capable of metabolizing retinals to retinoic acids. These include CYP1A1, CYP1A2 and CY- P3A4, of which CYP1A2 shows the highest activity for 9-cis retinal (151). The expression levels of the metabolic enzymes involved in RA synthesis may affect the ratio between atRA and the cis-RAs, since these enzymes differ in their substrate specificity. In vivo isomerization between atRA and 9cRA has been described and may contribute in fine-tuning individual retinoic acid levels (152). Although produced locally, RA may act everywhere in the organism. The circulation contains low levels of atRA (0.2 to 0.7 % of plasma retinol). The plasma atRA contributes to variable extend to the tissue pool of RA, depending on the tissue/organ. In liver and brain, the retinoic acid pool originates primarily from the circulation rather than from local synthesis (153). RA concentrations in tissue are very low, on average 3-15 µg per kilogram (88). Therefore, its contribution to dietary intake of vitamin A is negligible. Still, it has been shown that animals grow normally on retinoic acid as the sole source of vitamin A-derivatives indicating that RA is the main bioactive derivative of vitamin A (142).

26 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

Liver Ileum Retinyl ester β-carotene Gene

LRAT REH AKRs BCMO1 regulation SDRs Retinol Retinal Retinoic acid RALDHs ADHs; SDRs CYPs CYPs Degradation

Figure 1.5. Retinol is converted into retinoic acid in a two-step process The three main pools of vitamin A in the body differ in their oxidation state: the hydroxyl/alcohol form (retinol), the aldehyde form (retinal) and the carboxylic form (retinoic acid). Vitamin A is distributed throughout the body as (RBP4 bound-) retinol. Conversion of retinol into retinoic acid is believed to occur locally within the target cell. In a two-step process, retinol is first reversibly converted into retinal by members of the cytosolic medium-chain alcohol dehydrogenases (ADH), the (membrane- associated) short chain dehydrogenases (SDR) families and various cytochrome P450 enzymes (CYPs). In the second step retinal is irreversibly converted into retinoic acid by retinaldehyde dehydrogenases (RALDHs). Retinoic acid regulates gene transcription via the retinoic acid and retinoid X receptor. Degradation of retinoic acid is facilitated by various CYPs. Beta-carotene is converted to retinal by beta-carotene 15,15’-monooxygenase 1 (BCMO1) and subsequently converted to retinol and stored as retinylesters in the liver. AKP = aldo-keto reductase (AKR) superfamily; LRAT = lecithin:retinol acyl transferase; REH = retinyl ester hydrolase Based on Pares et al. (2008) (143).

Total RA levels are regulated by an interplay between RA synthesizing and cataboli- sing enzymes. Retinoic acid is metabolized in a two-step process. In the first step, phase I enzymes of the CYP450 superfamily catabolise the different isomers of RA. One of these enzymes is retinoic acid-inactivating cytochrome P450 (P450RAI/CYP26). This metabolizes atRA, but does not appreciably metabolize cis-RA isomers (9-cis and 13-cis). AtRA induces expression of CYP26, thereby controlling its own catabolism (154, 155). While numerous CYP enzymes have been identified that catabolize atRA and/or 13-cis RA, only a few 9cRA-metabolising enzymes have been identified. Of the CYPs that are dominantly expressed in the adult human liver, CYP2C9, -2C8 and -3A4 are the major ones involved in 9-cis RA metabolism. The efficiency of these CYPs to metabolize 9cRA is higher than that for atRA, which may explain why the concentrations of 9cRA in vivo are low. In the second step, phase II enzymes facilitate the conjugation of phase I metabolites. All trans-RA and its phase I metabolites 4-oxo-RA, 5,6-epoxy-RA, and 4-OH-RA were found to be glucuronidated by the human glucuronyl transferase UGT2B7 (147, 156).

4. Nuclear receptors/metabolic sensors in control of bile salt homeostasis In the past decade, bile salts have been shown to be key signalling molecules in various biological pathways, in addition to their long-known fat-emulsifying actions. With the discovery of the bile acid-activated Farnesoid X Receptor (FXR) and its

27 Chapter 1 transcriptional regulation of specific target genes, it has become clear how bile acids control their own synthesis and transport. FXR belongs to the superfamily of nuclear receptors (NRs). Many metabolic processes, including glucose, lipid and cholesterol/ bile acid metabolism are regulated by NRs. These are ligand-activated transcription factors. Ligands to these NRs are often small lipophilic molecules including hormones, metabolites and food-derived compounds.

4.1 Nuclear Receptor Superfamily At present, 49 members of the nuclear receptor (NR) superfamily have been identified (reviewed by Franciset al. (157)). The superfamily of NRs is divided into seven subfamilies (NR0 to NR6) based on sequence homology. The nomenclature of nuclear receptors has been standardized per subfamily (reviewed by Germain et al. (158)). An in depth overview of the seven subclasses and their members is beyond the scope of this review (see review by Aranda et al. (159)). The relevant subfamilies for this thesis will be briefly discussed. Members of the NR1 thyroid hormone receptor-like subfamily include the thyroid hormone receptor (TR), retinoic acid receptor (RAR), peroxisome proliferator-activated receptor (PPAR), constitutive androstane receptor (CAR), liver X receptor (LXR), vitamin D receptor (VDR), pregnane X receptor (PXR) and FXR. The NR2 subfamily, or retinoid X receptor-like nuclear receptors, include hepatocyte nuclear factor-4 (HNF-4) and retinoid X receptor-alpha (RXRα). In general, members of the NR1 subfamily need to form a heterodimer with RXRα to become transcriptionally active (160, 161). In several cases, NRs were identified before their ligands were known. These receptors were therefore designated “orphan receptors”. As their natural and synthetic ligands became known, some of these orphan receptors have been “adopted” (162). Two nuclear receptors that remain orphan to date are the liver receptor homolog-1 (LRH-1) belonging to the NR5 subfamily of steroidogenic factor-like receptors and the small heterodimer partner (SHP), belonging to the NR0 family of miscellaneous NRs. NRs have a modular structure consisting of multiple functional domains. A typical nuclear receptor consists of a variable N-terminal region (region A/B), a conserved DNA-binding domain (DBD) (region C), a linker (region D), and a conserved E region that contains the ligand binding domain (LBD). Some receptors contain also a C-terminal region (F) with unknown function. Isotypes (alpha, beta, gamma) originate from homologous genes and isoforms (alpha 1, alpha 2) of nuclear receptors are generated via alternative translation initiation sites and/or alternative mRNA splicing. The ligand-independent transcriptional activation domain (AF-1) is contained within the A/B region, and the ligand-dependent transactivation domain (AF-2) is located within the C-terminal portion of the LBD (159). Nuclear receptors regulate gene transcription by binding to specific DNA sequences, so-called hormone responsive elements (HREs), in the promoter region of specific genes. NR/RXRα heterodimers bind to a variety of tandem repeats of the hexamers AGGTCA or AGTTCA typically spaced by 1 or more base pairs (163, 164). The orientation of these hexamers, or so-called half-sites, may vary giving rise to a direct

28 The Interrelationship Between Bile Acid and Vitamin A Homeostasis repeat (DR) (AGGTCAnAGGTCA), a palindromic everted repeat (ER) (TGACCT- nAGGTCA) or a palindromic inverted repeat (IR) (AGGTCAnTGACCT) (Figure 1.6). It should be noted that these HREs are consensus sequences and that the actual genomic HREs may slightly differ from the consensus. Gene regulation by NRs is, however, far more complex than just receptor binding to a responsive element in a promoter. Competition between agonists and antagonists, RXRα availability, heterodimerization efficiency, cofactor recruitment and NR protein modification, together determine the ultimate transcriptional efficiency (165).

Figure 1.6. NR1 class nuclear receptors co-repressors interact as a dimer with RXRα with hormone response element RXRα is the obligate heterodimer partner of most members of the NR1 thyroid hor- co-activators mone receptor like subfamily, including the thyroid hormone receptor (TR), retinoic acid receptor (RAR), peroxisome proliferator-activated receptor (PPAR), constitutive NR RXRα androstane receptor (CAR), liver X receptor transcription (LXR) pregnane X receptor (PXR), farnesoid X receptor (FXR) and vitamin D receptor (VDR). The NR/RXRα heterodimer HRE interacts with so called hormone responsive elements (HREs), in the promoter region of DR AGGTCAnAGGTCA certain genes. These HREs typically consists of tandem repeat of the hexamers AGGT- ER TGACCTnAGGTCA CA or AGTTCA spaced by 1 or more bases, IR AGGTCAnTGACCT giving rise to a direct repeat (DR), a palindromic everted repeat (ER) or a palindromic inverted repeat (IR). Based on Baranowski. (2008) (362). 4.2. Vitamin A Receptors RXR and RAR, both activated by vitamin A metabolites, were among the first nuclear receptors that were characterized.

4.2.A. Retinoid X Receptor The retinoid X receptor (RXR) was identified by Mangelsdorf et al. in 1990 (167). Three isotypes of RXR exist, -alpha (RXRα/NR2B1), -beta (RXRβ/NR2B2) and -gamma (RXRγ/NR2B3). For each isotype two isoforms have been identified: RXRα (α1 and α2), RXRβ (β1 and β2), and RXRγ (γ1 and γ2) (168). RXRα is highly expressed in liver and to a lesser extend in lung, muscle, kidney and spleen. RXRγ is expressed in spleen, adrenal gland, heart, intestine and kidney. RXRβ is rather ubiquitously expressed, but relatively low in liver and intestine (169). The natural ligand of RXR is the vitamin A-derivative 9cRA (169-173). Physiological levels of 9cRA have proven difficult to detect in mammalian tissue (153, 174-176), but have been reported (177, 178). This has triggered some scepticism to whether 9cRA is the main endogenous ligand of RXR (179). Other ligands that have been

29 Chapter 1 shown to modulate RXR activity include poly unsaturated fatty acids (PUFAs), such as docosahexaenoic acid, arachidonic acid and oleic acid (180, 181). Even though 9cRA may not be the only endogenous ligand for RXR, various studies showed that vitamin A signalling (or lack of vitamin A signalling) via RXR affects expression of NR/RXR target genes, supporting that vitamin A-derivatives are physiological ligands for RXR (Chapters 2 and 3 of this thesis). Homodimeric RXR interacts with DR-1 sequences (182). More importantly though, RXR is the obligate heterodimer partner of most nuclear receptors belonging to the NR1 subfamily. As such, RXR is a key factor in a multitude of metabolic processes, including bile salt homeostasis.

4.2.B. Retinoic Acid Receptor As for RXR, also three isotypes of the retinoic acid receptor (RAR) exist, -alpha (RARα/NR1B1), -beta (RARβ/NR1B2) and -gamma (RARγ/NR1B3) (183). Each isotype has several isoforms, of which the expression has been extensively studied in mouse embryonic development. RARα is ubiquitously expressed, while RARβ and RARγ show a more tissue- and cell type-specific distribution. RARβ is present in the liver capsule as well as in the epithelium and outer mesenchyme of the intestine. RARγ is largely absent from the gastrointestinal tract, with the exception of the squa- mous epithelium of the stomach (184). RAR forms heterodimers with RXR (185). RAR/RXR typically interacts with retinoic acid response elements (RAREs) consisting of a direct repeat of AGGTCA inters- paced by 5 nucleotides (DR-5) (186). The main natural ligand of RAR is atRA. RARs also bind 9cRA, but with lower affinity than atRA (187, 188). Target genes of RAR are numerous and include genes involved in vitamin A metabolism, such as RBP4 and RBP2 (189, 190). RAR/RXR target genes involved in bile acid homeostasis include Ntcp (191, 192) and ASBT (84). Also rat Cyp7a1 is reported to be an RAR/RXR target gene (193). Furthermore, RAR/RXR represses MRP3 transcription (194).

4.3. Bile Acid Receptors Three members of the nuclear receptor family have been identified as bile acid sensors. FXR is regarded the primary bile acid receptor, regulating transcription of key genes involved in bile acid synthesis and transport. The other two bile acid sensing NRs are PXR and VDR. These are mainly involved in the adaptive response to prevent bile acid hepatoxicity. In addition, CAR is also activated by increased levels of bile salts. Although CAR is not a bile acid sensor by itself, bile salts and bilirubin induces nuclear translocation of CAR, thereby indirectly activating this NR. Like PXR and VDR, CAR is involved in the detoxification of bile salts. These receptors are extensively reviewed by Moore et al. 2006 (195). An additional bile acid receptor is the G protein-coupled receptor TGR5. Unlike the intracellular NRs, TGR5 is a cell surface receptor, responding to extracellular bile acids (196, 197). TGR5 signalling is involved in energy expenditure (198) and does not seem to play a role in bile

30 The Interrelationship Between Bile Acid and Vitamin A Homeostasis acid synthesis. Therefore, functions of TGR5 will be not discussed in this chapter. An overview of bile acid receptor-mediated gene expression of genes involved in bile salt synthesis, transport and metabolism is depicted in Figure 1.7.

UGT2B4 BAAT CYP3A4 CAR BACS SULT2A1 BA synthesis BSEP OSTα/β MDR3 FXR OATP1B3 BA MRP2 IBABP UGT1A1

BA transport BA detoxification PXR BA MDR1 VDR MRP3 BA

Bile formation Figure 1.7. Bile sensors promote bile acid transport and detoxification Bile acid-activated nuclear receptors promote transport, conjugation and detoxification of bile salts. While FXR primarily dictates the cellular efflux of bile salt, PXR and VDR mainly regulate the detoxification of bile salts. Dotted lines represent VDR/PXR signalling in general, meaning not restricted to bile salt-induced signalling. 4.3.A. Farnesoid X Receptor Is the Mammalian Bile Salt Sensor The farnesoid X receptor (FXR/NR1H4) was originally identified in 1995 as a retinoid receptor-interacting protein (RIP14, (199)) and found to be activated by farnesol (200), retinoic acid and TTNPB (4-[E-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramet- hyl-2-naphthalenyl)-1-propenyl] benzoic acid) (201). FXR was named after its first identified ligand, although a direct interaction with any of the above compounds was never established. A few years later, it was established that bile acids are highly potent physiological activators of FXR. The strongest activating bile acid is CDCA (202-204). With the discovery of its endogenous ligands FXR was renamed bile acid receptor (BAR) (202), but the name FXR is still commonly used today. Other endogenous ligands of FXR include androsterone (205), PUFAs (206) and oxysterol 22(R)-hydroxycholesterol (207). Synthetic ligands include GW4064 (208) and 6-Ethyl-CDCA (6-ECDCA) (209). Plant-derived guggulsterone can function as an FXR agonist (210), but also as an FXR antagonist (211). FXR is profoundly expressed in tissues that are exposed to bile salts, such as liver and intestine, but also in kidney and adrenal glands (200, 212). Four isoforms of FXR have been identified in rodents and humans, designated Fxrα1, Fxrα2, Fxrβ1, and Fxrβ2

31 Chapter 1

(213). To complicate matters, a homolog of NR1H4 was identified, NR1H5, which was named FXRβ. FXRβ encodes a functional receptor for lanosterol in rodents and other mammals but is a pseudogene in humans (214, 215). The conservedFXRα (generally termed FXR/NR1H4) gene encodes four protein products. Because of differential translation initiation sites, FXRα3 (formerly “Fxrβ1”) and FXRα4 (formerly “Fxrβ2”) differ at their N-terminus. As a result of differential transcript splicing, FXRα1 (“Fxrα1”) and FXRα3 contain a four amino acid-insert in the hinge region that is not present in FXRα2 (“Fxrα2”) and FXRα4 (195). The FXR isoforms are differentially expressed. In adult humans, FXRα1/2 mRNA is predominant in liver and adrenal gland. Expression of FXRα3/4 mRNA is most abundant in colon, duodenum, and kidney. FXRα3/4 mRNA levels are generally lower than that of FXRα1/2 (213). For most transcriptional targets, FXR needs to form a heterodimer with RXRα to be transcriptionally active (201). The typical FXR responsive element (FXRE) is an inverted repeat spaced by one base pair (IR-1), with the consensus sequence AG- GTCAnTGACCT (200). FXREs have been identified in the promoter regions of genes involved in bile acid homeostasis, including BSEP (216, 217), OSTα/β (218, 219), IBABP (204, 220), BAAT/BAT (221), bile acid-CoA synthetase (BACS) (221), OATP1B3 (222), SHP (223-225) and within the second intron of fibroblast growth factor 19 (FGF19) in humans (226) and its rodent ortholog Fgf15 (227). Alterna- tive FXR binding sequences were detected in the promoter elements of MRP2 (an everted repeat spaced by 8 base pairs; ER-8) (228), sulfotransferase 2A1 (SULT2A1/ STD) (an inverted repeat without spacing; IR-0) (229), UDP glucuronosyltransfera- se 2B4 (UGT2B4) and the insulin-responsive glucose transporter 4 (GLUT4) (both a hexamer half-site) (230, 231). In the latter two, FXR induces transcription in the absence of RXRα. FXR-mediated transcriptional suppression has been described for apolipoprotein A-I (Apo-AI) and C-III (Apo-CIII) (232, 233). An overview of FXR target genes is given in Table 1.1. FXR appears to be a multipurpose nuclear receptor (234), as it regulates expression of numerous target genes beyond bile acid synthesis and transport. Target genes of FXR are involved in processes such as blood clotting (fibrinogen (FBG) (235, 236) and complement factor 3 (C3) (227)), inflammation/adhesion (kininogen KNG( ) (237) and intercellular adhesion molecule 1 (ICAM-1/CD54) (238)) and lipid and cholesterol homeostasis (fatty acid synthase (FAS) (239), phospholipid transfer protein (PLTP) (240) and apolipoprotein C-II (Apo-CII) (241)). Furthermore, FXR has been associated with liver regeneration and regrowth, (242) with glucose metabolism (reviewed in (243, 244)) and differentiation of bone marrow stromal cells into osteoblasts (245). Studies with Fxr-/- mice revealed the central role of FXR in bile salt homeostasis. Wild type mice tolerate CA-feeding by reducing bile acid synthesis (Cyp7a1) and hepatic bile salt import (Ntcp), while simultaneously increasing bile salt excretion via BSEP. This regulation is strongly impaired inFxr -/- mice that maintain bile acid synthesis and import upon CA-feeding with consistently low Bsep levels. As a consequence, CA-fed Fxr-/- mice develop significant bile acid-induced liver damage (79).

32 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

Table 1.1. Bile salt sensor FXR is a multipurpose transcription factor Direct target gene of FXR FXRE Reference Transport of bile acids and BSEP/ABCB11 IR-1 (216, 217) other bile components IBABP IR-1 (204, 220 MDR3/ABCB4 IR-1 (246) MRP2/ABCB2 ER-8 (228) OATP1B3/OATP8 IR-1 (222) OSTα and OSTβ IR-1 (218, 219) Bile acid metabolism BAAT IR-1 (221) BACS IR-1 (221) CYP3A4 IR-1/DR-3, ER-8 (247) CYP8B1 IR-1 (248) SULT2A1 (STD) IR-0 (229) UGT2B4 Half-site (230) UGT2B7 negFXRE (249) Negative feedback on bile FGF19/Fgf15 IR-1 (226, 227) acid transport/synthesis SHP IR-1 (223-225) Lipid/cholesterol metabo- Apo-CII IR-1 (250) lism Apo-CIII negFXRE (DR-1) (233) Apo-A1 negFXRE (232) FAS IR-1 (239) INSIG-2 IR-1 (251) PLTP IR-1 (240) SR-BI DR-8 (252) Blood clotting/ C3 IR-1 (227) inflammation/adhesion Fibrinogen (FBG) ND (235) ICAM-1/CD54 IR-1 (238) Kininogen (KNG) IR-1 (237) Miscellaneous ALAS1 IR-1 (253) alphaA-crystallin (CRYAA) IR-1 (254) ASCT2 IR-1 (255) AT2R IR-2 (256) DDAH1 IR-1 (257) eNOS IR-2 (258) Fetuin-B IR-1 (259) GLUT4 Half-site (231) NAGS ER-8 (260) NaS-1/Slc13a1 IR-1 (261) OAT2 negFXRE (DR-1) (262) PXR IR-1 (263) Syndecan-1 DR-1 (264) VPAC-1 IR-1 (265)

The farnesoid X receptor (FXR) is the primary mammalian bile acid receptor. By interacting with FXR, bile salts promote their own transport (e.g. bile salt export pump (BSEP)) and metabolism/clearance (cytochrome P450 3A4 (CYP3A4)). Via a negative feedback loop which involves the FXR target genes SHP and FGF19, bile acids suppress the synthesis of de novo bile acids. However, FXR signalling is not limited to bile salt synthesis and transport. FXR target genes are also involved in processes such as blood clotting (fibrinogen (FBG) and complement factor 3 (C3)), inflammation/adhesion (kininogen (KNG) and intercellular adhesion molecule 1 (ICAM-1/CD54)) and lipid and cholesterol homeostasis (fatty acid synthase (FAS), phospholipid transfer protein (PLTP) and apolipoprotein C-II (Apo-C2)) and glucose metabolism (insulin-responsive glucose transporter type 4 (GLUT4)).

33 Chapter 1

4.3.B. Pregnane X Receptor The pregnane X receptor (PXR/NR1I2), also called the steroid and xenobiotic receptor (SXR), is highly expressed in liver and intestine. PXR is activated by xenobiotic compounds, steroids and bile acids, including LCA, CDCA and DCA (266-271). The PXR/RXRα heterodimer binds to so-called xenobiotic response elements (XREs) present in the promoter region of genes encoding drug metabolizing enzymes and drug transport proteins. These XREs consist of specific repeats of AG(G/T)TCA orien- ted as either a direct repeat spaced by three to five nucleotides (DR-3, DR-4 or DR-5) or as an everted repeat spaced by six or eight nucleotides (ER- 6 and ER-8) (272). PXR is a master regulator of drugs and xenobiotics metabolism (273) and is involved in the protective response to bile salt hepatoxicity (270). PXR/RXRα induces transcription of CYP3A4/Cyp3a11 (267) and SULT2A1 (274) that respectively catalyse hydroxylation and sulfoconjugation of compounds such as drugs, xenobiotics and bile salts. Hydroxylation and sulfoconjugation makes these compounds more hydrophilic (polar, water-soluble), less toxic and more amenable for urinary excretion (82). Some of the membrane-embedded transport proteins that excrete these detoxified compounds are regulated by PXR and also transport (metabolites of) bile salts, including MRP3 (275), MRP2 (228) and MDR1 (273, 276). Expression of the organic anion transporter OATP1B1, which imports bile salts, is also regulated by PXR (272). LCA-activated PXR was shown to induce expression of murine Cyp3a11 and Atp1a4 (269). Besides bile salt transport, PXR activity influences bile acid synthesis. Studies with Pxr-/- mice showed that PXR represses Cyp7a1 expression (269), which include both SHP- and FGF15-dependent mechanisms. The humanSHP promoter contains a PXR/RXR binding site and LCA-activated PXR was shown to induce FGF19 promoter activity (277). Both SHP and FGF19 (278, 279) repress CYP7A1 expression (discussed in section 5.3). To make matters more complex, PXR expression itself is regulated by FXR (263). This may further potentiate the role of PXR to bile acid signalling. Thus, bile acid signalling through PXR likely contributes to the adaptive response to prevent bile acid toxicity.

4.3.C. Vitamin D Receptor

In addition to its main natural ligand 1,25-dihydroxy vitamin D3 (1,25-(OH)2D3), the vitamin D receptor (VDR; NR1I1) is also activated to the same extend by LCA and 3-keto-LCA (280, 281). VDR regulates calcium homeostasis and bone metabolism (reviewed by St-Arnaud (282)). The VDR/RXR heterodimer binds to vitamin D response elements (VDREs). The typical VDRE consists of a direct hexameric (GGTC- CA, AGGTCA, or GGGTGA) repeat spaced by 3 nucleotides (DR-3), although the number of spacing nucleotides may vary (283). Less frequent, everted repeats have also been found to act as VDREs (reviewed in (284)). With regard to bile acid metabolism, LCA-activated VDR was shown to induce expression of CYP3A4 (280, 281, 285), MDR1 (286) and MRP3 (287), while Cyp7a1 expression is repressed by LCA-activated VDR (286). In addition, VDR signalling

34 The Interrelationship Between Bile Acid and Vitamin A Homeostasis induces SULT2A1 (288, 289) expression and was reported to inhibit the CDCA-dependent transcription of the FXR target genes SHP, IBABP and BSEP (290). VDR thus actively participates in the detoxification and clearance of bile acids, fine-tunes expression of FXR target genes and inhibits bile acid biosynthesis.

4.3.D. Constitutive Androstane Receptor The constitutive androstane receptor (CAR; NR1I3) is highly expressed in liver and, as the name suggests, is a constitutive active receptor (291, 292). Transcriptional activity of CAR has different modes of action (review by Tzameliet al. (293)). Although CAR does not require a ligand to become transcriptionally active (294), ligands have been identified that modulate its constitutive activity. CAR plays a role in bilirubin clearance as is apparent from studies with Car-/- mice challenged with a single dose of bilirubin. Bilirubin itself was shown to activate CAR. However, bilirubin does not seem to be a direct agonist of CAR (295), but rather promotes its nuclear translocation. In a similar fashion certain bile acids are able to indirectly activate CAR by inducing nuclear translocation (296). The CAR/RXR heterodimer interacts with RAREs (291). CAR protects against bile acid toxicity in CA-fed Fxr and Pxr double knockout mice. Pretreatment with CAR activators resulted in decreased bile acid and bilirubin serum levels, through upregulation of hepatic genes involved in bile acid and/or bilirubin metabolism and excretion (297). Similar results were obtained comparing LCA-fed Car-/- and WT mice (298). Target genes of CAR involved in bile acid detoxification and clearance include cytosolic sulfotransferases SULTs( ) (299), 3’-phospho- adenosine 5’-phosphosulfate synthetase 2 (Pappss2) (299), Cyp3a11 (300), Mrp3 and Mrp4 (reviewed in (14)).

4.3.E. Additional Nuclear Receptors Involved in Bile Acid Metabolism Two orphan NRs have a prominent role in the transcriptional regulation of bile acid homeostasis. The liver receptor homolog-1 (LRH-1) induces transcription of various genes involved in bile acid transport and synthesis, while the small heterodimer partner (SHP) is involved in a negative feedback loop, counteracting the activity of LRH- 1 and various other NR/RXR heterodimers. The interplay between LRH-1 and SHP is one of the main mechanisms that fine-tunes bile salt synthesis and transport.

LRH-1 induces bile salt synthesis and transport The liver receptor homolog-1 (LRH-1/NR5A2), also known as fetoprotein transcription factor (FTF), is expressed in liver, intestine, pancreas, ovary and adrenal glands (301-303). It has also been named CYP7A promoter-binding factor, as it is well-known as a positive regulator of expression of hepatic Cyp7A1 (301). Unlike most NRs, LRH-1 does not form a heterodimer with RXR, but instead binds DNA as a monomer to an extended nuclear receptor half-site YCAAGGYCR (where Y is any pyrimidine and R is any purine) (302, 304). No endogenous (or synthetic) ligand has been identified to date that is associated with the constitutive activity of LRH-1. Although in silico modelling studies pre-

35 Chapter 1 dict that phospholipids may directly bind to LRH-1 (reviewed by Forman (305)), the biological relevance of this putative interaction remains elusive. Murine LRH-1 was shown to exist as a stable monomer in the absence of a ligand, suggesting that it might not need a ligand at all to be transcriptionally active (306). LRH-1 responsive elements (LRE) have been identified in the promoter regions of Cyp7a1, Cyp8b1, ASBT, MRP3, BSEP, OSTα/OSTβ, ABCG5/ABCG8 and SHP (84, 301, 307-313). LRH-1 facilitates the LXRα-mediated expression of rodent Cyp7A1 (225, 314) and Fas (315) in vitro. Hepatic Lrh-1-/- mice showed that Cyp8b1, but not Cyp7a1 transcription critically depends on LRH-1 in vivo (316, 317). Also murine hepatic and intestinal Shp transcription depends largely on LRH-1 (316, 317). Transactivation by LRH-1 seems to be required for maximal induction of FXR target genes in response to bile salts, as was shown for BSEP (311) and MRP3. For the latter, two adjacent LREs were identified within its promoter. Mutating either of these responsive elements resulted in loss of CDCA-induced MRP3 promoter activity (318). Additionally, a recent study demonstrated that LRH-1 recruits FXR to the promoter of genes involved in lipid metabolism (319). Bile acid-induced transcription of LRH-1/Lrh-1 is observed in human hepatic and intestinal cell lines and in rat liver (224, 310, 318, 320). However, involvement of FXR in LRH-1 expression has not been established. Interestingly, bile acid-regulated expression of LRH-1 was not observed in mice (225). Taken together, current know- ledge establishes LRH-1 as a general positive regulator of bile acid and cholesterol homeostasis and in some species bile salts may increase LRH-1 expression.

Small Heterodimer Partner Is a Repressor of Bile Salt Homeostasis The small heterodimer partner (SHP/NR0B2) is an atypical member of the NR-family, as it lacks a DNA-binding domain and a natural ligand has not been identified to date. However, recent evidence suggests that SHP activity can be modulated in a ligand-dependent fashion, albeit by synthetic compounds (e.g. 4-[3-(1-adamanty- l)-4-hydroxyphenyl]-3-chlorocinnamic acid (3-Cl-AHPC)) (321). SHP is expressed in liver, small intestine, adrenal gland and spleen (322). SHP is a general negative transcription factor of signalling pathways involving nuclear receptors and plays an important role in the negative feedback on bile salt synthesis and transport. However, functions of SHP extend far beyond bile salt homeostasis, including control of viral replication (323), tumor suppression (324), sexual maturation (325), obesity and (type 2) diabetes (326, 327). Transcription of SHP/Shp is induced by FXR (223-225) and LXRα (in humans) (328). As a consequence, Shp transcription is low in Fxr-/- mice and CA-feeding does not alter Shp transcription in these animals (79). SHP represses gene transcription by directly interacting with other NRs, cofactors or chromatin-modifying enzymes (322, 329). An important SHP-target involved in positive regulation of bile acid synthesis and transport is LRH-1. The role of SHP in the negative feedback of bile salt homeostasis will be discussed in section 5.

36 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

Liver X Receptor Two isoforms of the liver X receptor (LXR) are described; LXRα (NR1H3) and LXRβ (NR1H2) (330). LXRα is profoundly expressed in liver, intestine, kidney, adipose tissue and spleen (330, 331), while LXRβ is ubiquitously expressed (332). The typical LXR/RXR responsive element (LXRE) is a hexanucleotide sequence (AGGTCA) separated by four nucleotides (DR-4) (330, 331). LXRs are activated by cholesterol-derivatives and intermediates of cholesterol metabolism, including the oxysterols 22(R)-hydroxycholesterol, and 24(S)-hydroxycholesterol, but also 6-α-hydroxy bile acids (333-336). LXR signalling controls cholesterol, fatty acid and carbohydrate metabolism (reviewed in (337, 338)). Lxrα-/- mice suffer from impaired cholesterol and bile acid metabolism (339), indicating the interconnected regulation of bile acid, cholesterol, and lipid metabolism (162, 302, 340). Target genes of LXR that are involved in bile acid and cholesterol metabolism include Cyp7a1 (334, 339), ABCG5 and ABCG8 (341), SHP (328) and LRH-1 (342). Notably, expression of rodent, but not human CYP7A1, is regulated via LXR (328). LXR and FXR share, or compete for, responsive elements in the promoter regions of hIBABP and mOstα/β (343, 344). FXR signalling has been suggested to affect cholesterol transport via ABCG5 and ABCG8 (345). CA feeding of mice resulted in increased expression of hepatic Lxrα, but FXR does not seem to control Lxr expression directly (346). LXR signalling thus influences bile acid synthesis and co-regulates transcription of certain FXR-target genes involved in bile salt transport.

4.4. Permissive Versus Nonpermissive Functioning of RXR/9cRA Within the NR/RXR-Heterodimer In NR/RXR heterodimers, 2 different ligands play a role in modulating the transcriptional activity of the protein complex. The presence of 9cRA as the RXR ligand may have different effects on the NR/RXR activity depending on the specific NR and/ or target gene studied and have been subclassified as permissive and nonpermissive NR/RXR complexes (159, 347). In permissive NR/RXR heterodimers, RXR is both a structural and functional component allowing for 9cRA signalling through such a NR/RXR heterodimer. Ligands of RXR and its NR partner can independently and synergistically activate gene transcription. This has been described for PPARs (348, 349), LXR (330) and also FXR (220, 240). In nonpermissive NHR/RXR heterodimers RXR is merely a structural component of the heterodimer required for DNA-binding, but not necessarily acting as a receptor. Moreover, 9cRA may even repress expression of the target genes (347). RXR is nonpermissive in heterodimers with RAR (350), TR (351) and VDR (352, 353). However, a given NR/RXR combination is not strictly permissive or nonpermissive, as this also depends on the specific target gene. For instance, RXR is a permissive partner to TR in prolactin gene regulation (354). While RXR/CAR heterodimers seem to be neither strictly permissive nor nonpermissive, as the contribution of RXR/9cRA depends on the experimental approach. Tzameli et al. therefore argue that classifying a particular NR/RXR complex as either permissive or nonpermissive is an oversimplification (355).

37 Chapter 1

The RXR/FXR heterodimer has been described as permissive, based on the regulation of IBABP and PLTP (220, 240). We and others have shown that RXRα acts as a nonpermissive partner to FXR in the regulation of human and mouse BSEP (Chapter 2, Kassam et al. (356)).

5. Feedback regulation on bile salt synthesis and transport Increased levels of circulating bile salts repress de novo synthesis of bile acids, hepatic and intestinal bile salt uptake and promote bile salt export, detoxification and clearance. Both FXR-dependent and -independent mechanisms have been identified in this process. A schematic overview of this feedback regulation on synthesis and transport is depicted in Figures 1.8 and 1.9.

5.1. The FXR-SHP(-LRH-1) Cascade Bile acid-activated FXR/RXRα enhances the expression of SHP (223, 224), which in turn represses the expression of hepatic CYP7A1 (223, 224), CYP8B1 (357), Ntcp (191) and ileal ASBT (84, 358), thereby reducing biosynthesis and cellular import of bile salts. Many genes that are transcriptionally repressed by SHP are LRH-1 target genes. In- teraction of SHP with LRH-1 prevents LRH-1-dependent gene transcription. SHP interacts with the AF-2 domain of LRH-1 and competes with co-activators for binding to this domain. Once bound to its target receptor and recruited to DNA, the in- herent repression function of SHP further contributes to the overall inhibitory effect (359, 360). SHP also represses the LRH-1-enhanced LXRα-dependent transcription of rodent Cyp7a1 (223, 225). Cyp7a1 and Cyp8b1 levels are only slightly elevated in Shp-/- mice compared to WT animals (346, 361-363) under normal conditions. However, these animals are more susceptible to bile duct-ligation-induced cholestasis, as Cyp7a1 (and Cyp8b1) transcription is not efficiently repressed in the absence of SHP (363). Transcriptional regulation of rodent Cyp7a1 differs from humanCYP7A1 as the LXRE is not conserved in the human CYP7A1 promoter (364, 365). Activated LXRα represses CYP7A1 transcription in primary human hepatocytes (328). Moreover, human CYP7A1 is repressed by bile acids and this mechanism may still include SHP, as CYP7A1 is repressed by SHP in primary human hepatocytes (328) as well. Thus, SHP is of key importance in the adaptive response to increasing hepatic bile acid concentrations. Expression of hepatic and ileal bile salt import proteins is also repressed in response to rising bile salt concentrations. Expression of rat Ntcp is regulated by hepatocyte nuclear factor 1 (HNF1) (366, 367), hepatocyte nuclear factor 4 alpha (HNF4α) (368) and RAR/RXR (192). SHP represses transcription of rat Ntcp by interfering with RAR/RXR-dependent transcription (191) and by lowering the HNF4α-dependent transcription of Hnf1α (369). Not much is known about the bile acid-dependent repression mechanism on human NTCP expression.

38 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

NTCP Na+ FXR RXR

P JNK FGFR4 SHP BSEP

CYP7A1 CYP7A1

Bile salts FGF15

FGF15

ASBT

FXR RXR SHP FXR RXR Na+ OSTα/β

Figure 1.8. Bile salts transport and synthesis is regulated by bile salts themselves The farnesoid X receptor (FXR) is the primary mammalian bile acid receptor. FXR acts as a heterodimer with the retinoid X receptor (RXR). By interacting with FXR, bile salts promote their own transport (e.g. bile salt export pump (BSEP)) and organic solute transporter α/β (OSTα/β)). Via a negative feedback loop that involves the FXR target genes small heterodimer partner (SHP) and fibroblast growth factor (FGF19), bile salts suppress the de novo synthesis of bile acids. Both SHP and FGF19 inhibit expression of cholesterol 7-alpha-hydroxylase (CYP7A1). SHP inhibits transcription by interfering with binding of the transcription factor liver receptor homolog-1 (LRH-1) to its responsive element within the promoter region of CYP7A1, while ileal expressed FGF19 interacts with the hepatic fibroblast growth factor receptor 4 (FGFR4). This leads in a multi-step signalling pathway to phosphorylation of c-Jun N-terminal kinase (JNK), which in turn inhibits CYP7A1 expression. Hepatic and ileal uptake of bile salts by the sodium/taurocholate co-transporting polypeptide (NTCP) and ileal bile salt transporter (ASBT), respectively, is repressed by SHP. Both NTCP and ASBT are RAR/RXRα target genes. SHP interferes with the RAR/RXRα-dependent transcription of these genes. Notably, the human liver also expresses FGF19, while expression of the rodent ortholog fibroblast growth factor 15 (FGF15) seems limited to the ileum.

Human and mouse, but not rat ASBT expression is repressed by bile acids. This species difference is explained by the absence of an LRE in the ratAsbt promoter. Mo- reover, LRH-1 seems not to be expressed in rat ileal epithelial cells (84, 309). ASBT expression in Fxr-/- mice is unresponsive to bile acid feeding (309). Both LRH-1 and RAR/RXR responsive elements have been identified in the humanASBT promoter region. Mutating either of these two sequences was found to reduce ASBT promoter activity, but only the RARE appeared to be required for bile acid-dependent inhibiti-

39 Chapter 1 on of ABST expression (84). Expression of both human NTCP and ASBT is strongly increased by the nuclear receptor glucocorticoid receptor (GR/NR3C1). ASBT/NTCP activation by GR can be inhibited by SHP (370, 371). Inhibition of BSEP, OST α/β and MRP3 expression via LRH-1 and SHP does not seem to contribute to the cytoprotective mechanisms activated by increasing intracellular bile acid levels, as it prevents the clearance of bile acids.

5.2. Questioning the Role of LRH-1 In Negative Feedback Regulation Interestingly, studies with liver- and intestine-specificLrh-1 deficient mice showed that LRH-1 is not required for the negative feedback regulation of bile acid synthesis, irrespective of its established role in bile acid homeostasis (316, 317). Cyp7a1 and Cyp8b1 transcription is higher in Lrh-1+/- heterozygote mice than in WT mice, which is accompanied by an increased bile salt concentration in bile. Overexpression of LRH-1 in mice repressed both Cyp7a1 and Cyp8b1 transcription, suggesting that LRH-1 might also act as a repressor of bile acid biosynthesis (372). Shp-/- mice have slightly elevated Cyp7a1, Cyp8b1 and Bsep mRNA levels (346, 361). The increase in Bsep is probably the result of the increased bile acid pool size in these animals (346). However, lack of SHP may also increase Bsep expression by lack of inhibition of LRH- 1, like observed for Cyp7a1 and Cyp8b1 (311). Together, these studies indicate that both the basal levels of the constitutive active LRH-1 and its interaction with SHP determine its effect on bile acid homeostasis.

5.3. Redundant Pathways of Bile Acid Synthesis Repression In contrast to what would be expected from the feedback control mechanisms described above, Cyp7a1 expression is strongly increased in bile duct-ligated rodents, despite high concentrations of bile salts in the liver and blood. Feeding these bile duct-ligated mice the FXR ligand GW4064 decreased hepatic Cyp7a1 expression (279). Also CA feeding of Shp-/- mice repressed Cyp7a1 and Cyp8b1 transcription (361, 362). These finding stipulate the existence of FXR-SHP-independent feedback mechanisms to repress bile acid biosynthesis.

5.3.A. FXR - FGF19 - JNK Mediated Repression of CYP7A1 Expression An alternative mode of CYP7A1 repression is provided by FGF19 (Fgf15 in rodents) (226). Bile acids from the intestinal lumen activate ileal FXR/RXRα and increase expression of Fgf15. Ileal FGF15 is released in the blood and signals to the liver via the hepatic fibroblast growth factor receptor 4 (FGFR4), which leads to phosphorylation of JNK (226, 279). Activated JNK represses CYP7A1 expression (226, 346, 373). Consequently, both Fgf15-/- and Fgfr4-/- mice display higher Cyp7a1 mRNA expression than WT mice and an inability to repress Cyp7a1 in response to feeding of FXR ligands. Asbt-/- mice have lower Fgf15 transcription and higher Cyp7a1 and Cyp8b1 transcription levels than WT mice (374), indicating that reabsorbed bile acids in the ileum determine the rate of de novo bile acid biosynthesis.

40 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

VDR PXR FXR BA sensors BA BA BA

FGF-19 SHP Negative regulators

CYP7A1 CYP8B1 BA synthesis

Intracellular bile acids

ASBT NTCP BA importers

Figure 1.9. Bile acid sensors engage in negative feedback on bile acid biosynthesis and cellular import Bile salt-activated FXR suppresses bile acid synthesis (CYP7A1) via SHP and FGF19. Inhibiti- on of CYP7A1 via FGF19 involves the phosphorylation of JNK. SHP also limits cellular uptake of bile salts by inhibiting NTCP and ASBT expression. In addition to FXR signalling, bile acid signalling via PXR and VDR also contribute to the negative feedback regulation on bile acid synthesis. PXR signalling promotes expression of FGF19 and SHP. Furthermore, interaction between the ligand-activated PXR and SHP proteins enhances inhibition of CYP7A1 (dotted line). Moreover, PXR is an FXR-target gene itself. Bile acid signalling via VDR inhibits CYP7A1 by com- peting with other transcription factors at the CYP7A1 promoter. FXR-independent CYP7A1 repression mechanisms may converge the FXR-dependent mechanism on JNK phosphorylation.

Additionally, FGF15/FGF19 was recently shown to inhibit ASBT expression (375), expending FXR-FGF15/FGF19 signalling to bile acid transport. Thus, the FXR-SHP and the FXR-FGF19 signalling cascades are both involved in feedback mechanisms that control bile salt synthesis and transport.

5.3.B. SHP and FGF19 Pathways Overlap SHP-independent mechanisms of CYP7A1 repression seem to dominate over SHP dependent mechanisms, as Cyp7a1 repression prevails in the absence of Shp (362), but not in the absence of Fgf15 (279). However, SHP does not seem to be fully dispensable in the negative feedback loop of bile acid biosynthesis. Activation of either FXR or RXR by feeding mice synthetic ligands GW4064 or LG100268, respectively, was found to repress Cyp7A1 transcription, but this was dependent on SHP (346,

41 Chapter 1

361). However, CA-feeding reduced Cyp7a1 (and Cyp8b1) mRNA levels in Shp-/- mice, but this seems to depend on hepatoxicity rather than on FXR signalling (361). Moreover, the FGF15- and SHP-dependent repression of Cyp7a1 overlap, since SHP significantly enhances the FGF15 mediated repression of Cyp7a1 mRNA (279).

5.3.C. FXR Independent Repression The negative feedback loop on bile acid biosynthesis also includes FXR-independent mechanisms. LCA-activated PXR (269) or VDR (376) represses Cyp7a1 gene expression. This mode of repression may involve FGF19/FGF15, as it has been shown that the FGF19 promoter is activated by LCA-activated PXR in intestinal cells (277). Alternatively, LCA-activated PXR is suggested to bind to the bile acid response element (BARE)-I in the CYP7A1 promoter and inhibits CYP7A1 transcription by both SHP-dependent and -independent pathways. PXR strongly interacts which SHP in a ligand-dependent manner (377). FXR-SHP-independent bile acid-induced expression of inflammatory cytokines (e.g., tumor necrosis factor alpha (TNFα) and interleukin beta (IL-1β)) by Kupffer cells may mediate CYP7A1 repression as well (378, 379). Ito and co-workers reported that mice lacking the membrane protein beta-klotho (KLB) have increased Cyp7a1 and Cyp8b1 mRNA expression, while bile acid-dependent repression of these genes was still largely intact. Recently, KLB has been shown to modulate FGF19/FGF15 signalling via FGFR4 (380, 381). This links the observation that KLB inhibits ASBT expression, to the repression of ABST by FGF19/FGF15 (375).

5.3.D. FXR Dependent and Independent Repression of CYP7A1 Converges at JNK Bile acid signalling via FGF15/19, TNFα, IL-1β and protein kinase C (PKC) (377, 382) all activate JNK. Activated JNK in turn activates jun proto-oncogene (JUN), which inhibits the HNF4α-dependent transcription of CYP7A1 (383), and induces Shp expression (373). Additionally, phosphorylation of FXR by PKC promotes its transcriptional activity (384). This way, signalling via both FXR dependent and independent pathways may converge and amplify each other in the effort to repress CYP7A1 expression.

42 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

6. Aim and outline of this thesis Vitamin A and bile acid homeostasis are interrelated at various levels. Bile salts are required for hydrolysis of retinyl esters in the intestinal lumen and the absorption of vitamin A into the intestinal epithelium. Consequently, patients suffering from obstructive cholestasis suffer from malabsorption of vitamin A. Synthesis of bile acids takes place in the liver, which also serves as the primary site of vitamin A storage in the mammalian body. Liver disease may progress to liver fibrosis and affect the hepatic stellate cells that contain the vitamin A in intracellular lipid droplets. Du- ring fibrosis, stellate cells become activated and differentiate to proliferative and contractile myofibroblasts that overproduce extracellular matrix proteins leading to the characteristic scar tissue formation. In this process they lose their retinoid content. Thus cholestasis effectively promotes depletion of vitamin A from the organism by emptying the stores and preventing uptake. Bile acids and vitamin A-derivatives like 9-cis retinoic acid (9cRA) co-regulate bile acid synthesis in the liver and transport between the liver and intestine. They act mainly by activating transcription factors of the nuclear receptor family, in particular the farnesoid X receptor (FXR) and the retinoid X receptor-alpha (RXRα). FXR is activated by bile acids and RXRα by 9cRA and they act together as a heterodimer in regulating expression of genes involved in bile acid synthesis and transport. The role of bile acid-activated FXR in regulating bile acid homeostasis has been well established. However, the role of its heterodimer partner RXR remains largely illusi- ve. As many chronic liver diseases may develop to vitamin A deficiency, the putative role of vitamin A in bile salt homeostasis is therefore highly relevant. In this thesis, we aim to determine the role of vitamin A in the FXR/RXRα-mediated regulation of bile acid homeostasis both in vitro and in vivo models. In chapter 2, we performed in vitro and in vivo experiments to analyse the effect of vitamin A on the bile acid-induced expression of the transporter that is responsible for secretion of bile salts from the liver, the bile salt export pump (BSEP). In chapter 3, we analysed the effect of vitamin A on the bile acid-induced expression of the small heterodimer partner (SHP), which is a transcriptional repressor of several genes in bile acid synthesis and transport. Even though expression of both BSEP and SHP is induced by FXR, we observed opposite effects of 9cRA on their expression, repressing BSEP and super-inducing SHP. Chapter 2 and 3 include a detailed analysis of the molecular mechanisms that cause this opposite effect of 9cRA on BSEP and SHP expression. Given the fact that vitamin A-derivatives indeed directly affect expression of genes involved in bile salt biosynthesis and transport, we analysed in chapter 4 whether vitamin A deficiency in laboratory animals leads to changes in bile salt homeostasis. Finally, in chapter 5 we analysed whether the combination of vitamin A deficiency and obstructive cholestasis in laboratory animals leads to uncontrolled bile salt regulation and putatively to aggravation of liver damage. In chapter 6 an integrated discussion of all our data is presented.

43 Chapter 1

References

1. Esteller A. Physiology of bile secretion. World J Gastroenterol 2008 Oct 7;14(37):5641-5649. 2. Frevert U. Sneaking in through the back entrance: the biology of malaria liver stages. Trends Parasitol 2004 Sep;20(9):417-424. 3. Ridlon JM, Kang DJ, Hylemon PB. Bile salt biotransformations by human intestinal bacteria. J Lipid Res 2006 Feb;47(2):241-259. 4. Pellicoro A, Faber KN. Review article: The function and regulation of proteins involved in bile salt biosynthesis and transport. Aliment Pharmacol Ther 2007 Dec;26 Suppl 2:149-160. 5. Shefer S, Hauser S, Bekersky I, Mosbach EH. Biochemical site of regulation of bile acid biosynthesis in the rat. J Lipid Res 1970 Sep;11(5):404-411. 6. Russell DW. The enzymes, regulation, and genetics of bile acid synthesis. Annu Rev Biochem 2003;72:137- 174. 7. Pellicoro A, van den Heuvel FA, Geuken M, Moshage H, Jansen PL, Faber KN. Human and rat bile acid-CoA:amino acid N-acyltransferase are liver-specific peroxisomal enzymes: implications for intracellular bile salt transport. Hepatology 2007 Feb;45(2):340-348. 8. Matysik S, Martin J, Bala M, Scherer M, Schaffler A, Schmitz G. Bile acid signaling after an oral glucose tolerance test. Chem Phys Lipids 2011 Sep;164(6):525-529. 9. Li T, Francl JM, Boehme S, Ochoa A, Zhang Y, Klaassen CD, et al. Glucose and insulin induction of bile acid synthesis: mechanisms and implication in diabetes and obesity. J Biol Chem 2012 Jan 13;287(3):1861- 1873. 10. Alrefai WA, Gill RK. Bile acid transporters: structure, function, regulation and pathophysiological implications. Pharm Res 2007 Oct;24(10):1803-1823. 11. Kullak-Ublick GA, Stieger B, Meier PJ. Enterohepatic bile salt transporters in normal physiology and liver disease. Gastroenterology 2004 Jan;126(1):322-342. 12. Trauner M, Boyer JL. Bile salt transporters: molecular characterization, function, and regulation. Physiol Rev 2003 Apr;83(2):633-671. 13. Meier PJ, Stieger B. Bile salt transporters. Annu Rev Physiol 2002;64:635-661. 14. Zollner G, Marschall HU, Wagner M, Trauner M. Role of nuclear receptors in the adaptive response to bile acids and cholestasis: pathogenetic and therapeutic considerations. Mol Pharm 2006 May;3(3):231-251. 15. Hagenbuch B, Meier PJ. Molecular cloning, chromosomal localization, and functional characterization of a human liver Na+/bile acid cotransporter. J Clin Invest 1994 Mar;93(3):1326-1331. 16. Hagenbuch B, Stieger B, Foguet M, Lubbert H, Meier PJ. Functional expression cloning and characterization of the hepatocyte Na+/bile acid cotransport system. Proc Natl Acad Sci U S A 1991 Dec 1;88(23):10629- 10633. 17. Meier PJ. Molecular mechanisms of hepatic bile salt transport from sinusoidal blood into bile. Am J Physiol 1995 Dec;269(6 Pt 1):G801-G812. 18. Csanaky IL, Lu H, Zhang Y, Ogura K, Choudhuri S, Klaassen CD. Organic anion-transporting polypeptide 1b2 (Oatp1b2) is important for the hepatic uptake of unconjugated bile acids: Studies in Oatp1b2-null mice. Hepatology 2011 Jan;53(1):272-281. 19. Hagenbuch B, Dawson P. The sodium bile salt cotransport family SLC10. Pflugers Arch 2004 Feb;447(5):566- 570. 20. Geyer J, Wilke T, Petzinger E. The solute carrier family SLC10: more than a family of bile acid transporters regarding function and phylogenetic relationships. Naunyn Schmiedebergs Arch Pharmacol 2006 Mar;372(6):413-431. 21. Schroeder A, Eckhardt U, Stieger B, Tynes R, Schteingart CD, Hofmann AF, et al. Substrate specificity of the rat liver Na+-bile salt cotransporter in Xenopus laevis oocytes and in CHO cells. Am J Physiol 1998 Feb;274(2 Pt 1):G370-G375.

44 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

22. Kim JY, Kim KH, Lee JA, Namkung W, Sun AQ, Ananthanarayanan M, et al. Transporter-mediated bile acid uptake causes Ca2+-dependent cell death in rat pancreatic acinar cells. Gastroenterology 2002 Jun;122(7):1941-1953. 23. Konig J, Seithel A, Gradhand U, Fromm MF. Pharmacogenomics of human OATP transporters. Naunyn Schmiedebergs Arch Pharmacol 2006 Mar;372(6):432-443. 24. Konig J, Cui Y, Nies AT, Keppler D. A novel human organic anion transporting polypeptide localized to the basolateral hepatocyte membrane. Am J Physiol Gastrointest Liver Physiol 2000 Jan;278(1):G156-G164. 25. Konig J, Cui Y, Nies AT, Keppler D. Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J Biol Chem 2000 Jul 28;275(30):23161-23168. 26. Kullak-Ublick GA, Hagenbuch B, Stieger B, Schteingart CD, Hofmann AF, Wolkoff AW,et al. Molecular and functional characterization of an organic anion transporting polypeptide cloned from human liver. Gastroenterology 1995 Oct;109(4):1274-1282. 27. Jacquemin E, Hagenbuch B, Stieger B, Wolkoff AW, Meier PJ. Expression cloning of a rat liver Na+-independent organic anion transporter. Proc Natl Acad Sci U S A 1994 Jan 4;91(1):133-137. 28. Foucaud L, Grillasca J, Niot I, Domingo N, Lafont H, Planells R, et al. Output of liver fatty acid-binding protein (L-FABP) in bile. Biochim Biophys Acta 1999 Jan 4;1436(3):593-599. 29. Monaco HL. Review: the liver bile acid-binding proteins. Biopolymers 2009 Dec;91(12):1196-1202. 30. Martin GG, Atshaves BP, McIntosh AL, Mackie JT, Kier AB, Schroeder F. Liver fatty-acid-binding protein (L-FABP) gene ablation alters liver bile acid metabolism in male mice. Biochem J 2005 Nov 1;391(Pt 3):549-560. 31. Rembacz KP, Woudenberg J, Hoekstra M, Jonkers EZ, van den Heuvel FA, Buist-Homan M, et al. Un- conjugated bile salts shuttle through hepatocyte peroxisomes for taurine conjugation. Hepatology 2010 Dec;52(6):2167-2176. 32. Suchy FJ, Ananthanarayanan M. Bile salt excretory pump: biology and pathobiology. J Pediatr Gastroen- terol Nutr 2006 Jul;43 Suppl 1:S10-S16. 33. Gerloff T, Stieger B, Hagenbuch B, Madon J, Landmann L, Roth J,et al. The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver. J Biol Chem 1998 Apr 17;273(16):10046- 10050. 34. van Mil SW, van der Woerd WL, van der BG, Sturm E, Jansen PL, Bull LN, et al. Benign recurrent intrahepatic cholestasis type 2 is caused by mutations in ABCB11. Gastroenterology 2004 Aug;127(2):379-384. 35. Strautnieks SS, Bull LN, Knisely AS, Kocoshis SA, Dahl N, Arnell H, et al. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nat Genet 1998 Nov;20(3):233- 238. 36. Jansen PL, Strautnieks SS, Jacquemin E, Hadchouel M, Sokal EM, Hooiveld GJ, et al. Hepatocanalicular bile salt export pump deficiency in patients with progressive familial intrahepatic cholestasis. Gastroen- terology 1999 Dec;117(6):1370-1379. 37. Dean M, Rzhetsky A, Allikmets R. The human ATP-binding cassette (ABC) transporter superfamily. Ge- nome Res 2001 Jul;11(7):1156-1166. 38. Akita H, Suzuki H, Ito K, Kinoshita S, Sato N, Takikawa H, et al. Characterization of bile acid transport mediated by multidrug resistance associated protein 2 and bile salt export pump. Biochim Biophys Acta 2001 Mar 9;1511(1):7-16. 39. Toyoda Y, Hagiya Y, Adachi T, Hoshijima K, Kuo MT, Ishikawa T. MRP class of human ATP binding cassette (ABC) transporters: historical background and new research directions. Xenobiotica 2008 Jul;38(7- 8):833-862. 40. Kool M, de HM, Scheffer GL, Scheper RJ, van Eijk MJ, Juijn JA,et al. Analysis of expression of cMOAT (MRP2), MRP3, MRP4, and MRP5, homologues of the multidrug resistance-associated protein gene (MRP1), in human cancer cell lines. Cancer Res 1997 Aug 15;57(16):3537-3547. 41. Gerk PM, Li W, Megaraj V, Vore M. Human multidrug resistance protein 2 transports the therapeutic bile salt tauroursodeoxycholate. J Pharmacol Exp Ther 2007 Feb;320(2):893-899.

45 Chapter 1

42. Dubin IN, Johnson FB. Chronic idiopathic jaundice with unidentified pigment in liver cells; a new clinico- pathologic entity with a report of 12 cases. Medicine (Baltimore) 1954 Sep;33(3):155-197. 43. Kartenbeck J, Leuschner U, Mayer R, Keppler D. Absence of the canalicular isoform of the MRP gene-encoded conjugate export pump from the hepatocytes in Dubin-Johnson syndrome. Hepatology 1996 May;23(5):1061-1066. 44. Paulusma CC, Kool M, Bosma PJ, Scheffer GL, ter BF, Scheper RJ,et al. A mutation in the human canalicular multispecific organic anion transporter gene causes the Dubin-Johnson syndrome. Hepatology 1997 Jun;25(6):1539-1542. 45. Kuipers F, Enserink M, Havinga R, van der Steen AB, Hardonk MJ, Fevery J, et al. Separate transport systems for biliary secretion of sulfated and unsulfated bile acids in the rat. J Clin Invest 1988 May;81(5):1593- 1599. 46. Crawford AR, Smith AJ, Hatch VC, Oude Elferink RP, Borst P, Crawford JM. Hepatic secretion of phospholipid vesicles in the mouse critically depends on mdr2 or MDR3 P-glycoprotein expression. Visualization by electron microscopy. J Clin Invest 1997 Nov 15;100(10):2562-2567. 47. de Vree JM, Jacquemin E, Sturm E, Cresteil D, Bosma PJ, Aten J, et al. Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis. Proc Natl Acad Sci U S A 1998 Jan 6;95(1):282-287. 48. Oude Elferink RP, Ottenhoff R, van WM, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995 Jan;95(1):31-38. 49. Paulusma CC, Elferink RP, Jansen PL. Progressive familial intrahepatic cholestasis type 1. Semin Liver Dis 2010 May;30(2):117-124. 50. Tauscher A, Kuver R. ABCG5 and ABCG8 are expressed in gallbladder epithelial cells. Biochem Biophys Res Commun 2003 Aug 8;307(4):1021-1028. 51. Graf GA, Yu L, Li WP, Gerard R, Tuma PL, Cohen JC, et al. ABCG5 and ABCG8 are obligate heterodimers for protein trafficking and biliary cholesterol excretion. J Biol Chem 2003 Nov 28;278(48):48275-48282. 52. Yu L, Hammer RE, Li-Hawkins J, Von BK, Lutjohann D, Cohen JC, et al. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002 Dec 10;99(25):16237-16242. 53. Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan I, Willingham MC. Cellular localization of the multidrug-resistance gene product P-glycoprotein in normal human tissues. Proc Natl Acad Sci U S A 1987 Nov;84(21):7735-7738. 54. Elias E, Mills CO. Coordinated defence and the liver. Clin Med 2007 Apr;7(2):180-184. 55. Stieger B, Fattinger K, Madon J, Kullak-Ublick GA, Meier PJ. Drug- and estrogen-induced cholestasis through inhibition of the hepatocellular bile salt export pump (Bsep) of rat liver. Gastroenterology 2000 Feb;118(2):422-430. 56. Wang R, Salem M, Yousef IM, Tuchweber B, Lam P, Childs SJ, et al. Targeted inactivation of sister of P-glycoprotein gene (spgp) in mice results in nonprogressive but persistent intrahepatic cholestasis. Proc Natl Acad Sci U S A 2001 Feb 13;98(4):2011-2016. 57. Lam P, Wang R, Ling V. Bile acid transport in sister of P-glycoprotein (ABCB11) knockout mice. Bioche- mistry 2005 Sep 20;44(37):12598-12605. 58. Wong MH, Oelkers P, Craddock AL, Dawson PA. Expression cloning and characterization of the hamster ileal sodium-dependent bile acid transporter. J Biol Chem 1994 Jan 14;269(2):1340-1347. 59. Wong MH, Oelkers P, Dawson PA. Identification of a mutation in the ileal sodium-dependent bile acid transporter gene that abolishes transport activity. J Biol Chem 1995 Nov 10;270(45):27228-27234. 60. Lazaridis KN, Pham L, Tietz P, Marinelli RA, deGroen PC, Levine S, et al. Rat cholangiocytes absorb bile acids at their apical domain via the ileal sodium-dependent bile acid transporter. J Clin Invest 1997 Dec 1;100(11):2714-2721. 61. Oelkers P, Kirby LC, Heubi JE, Dawson PA. Primary bile acid malabsorption caused by mutations in the ileal sodium-dependent bile acid transporter gene (SLC10A2). J Clin Invest 1997 Apr 15;99(8):1880-1887.

46 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

62. Kok T, Hulzebos CV, Wolters H, Havinga R, Agellon LB, Stellaard F, et al. Enterohepatic circulation of bile salts in farnesoid X receptor-deficient mice: efficient intestinal bile salt absorption in the absence of ileal bile acid-binding protein. J Biol Chem 2003 Oct 24;278(43):41930-41937. 63. Praslickova D, Torchia EC, Sugiyama MG, Magrane EJ, Zwicker BL, Kolodzieyski L, et al. The ileal lipid binding protein is required for efficient absorption and transport of bile acids in the distal portion of the murine small intestine. PLoS ONE 2012;7(12):e50810. 64. Xia X, Francis H, Glaser S, Alpini G, LeSage G. Bile acid interactions with cholangiocytes. World J Gastroenterol 2006 Jun 14;12(22):3553-3563. 65. Alpini G, Glaser SS, Rodgers R, Phinizy JL, Robertson WE, Lasater J, et al. Functional expression of the apical Na+-dependent bile acid transporter in large but not small rat cholangiocytes. Gastroenterology 1997 Nov;113(5):1734-1740. 66. Lazaridis KN, Tietz P, Wu T, Kip S, Dawson PA, LaRusso NF. Alternative splicing of the rat sodium/bile acid transporter changes its cellular localization and transport properties. Proc Natl Acad Sci U S A 2000 Sep 26;97(20):11092-11097. 67. Hirohashi T, Suzuki H, Takikawa H, Sugiyama Y. ATP-dependent transport of bile salts by rat multidrug resistance-associated protein 3 (Mrp3). J Biol Chem 2000 Jan 28;275(4):2905-2910. 68. Scheffer GL, Kool M, de HM, de Vree JM, Pijnenborg AC, Bosman DK,et al. Tissue distribution and induction of human multidrug resistant protein 3. Lab Invest 2002 Feb;82(2):193-201. 69. Zelcer N, van de WK, de WR, Scheffer GL, Marschall HU, Wielinga PR, et al. Mice lacking Mrp3 (Abcc3) have normal bile salt transport, but altered hepatic transport of endogenous glucuronides. J Hepatol 2006 Apr;44(4):768-775. 70. Rost D, Mahner S, Sugiyama Y, Stremmel W. Expression and localization of the multidrug resistance-associated protein 3 in rat small and large intestine. Am J Physiol Gastrointest Liver Physiol 2002 Apr;282(4):G720-G726. 71. Kool M, van der LM, de HM, Scheffer GL, de Vree JM, Smith AJ, et al. MRP3, an organic anion transporter able to transport anti-cancer drugs. Proc Natl Acad Sci U S A 1999 Jun 8;96(12):6914-6919. 72. Gerk PM, Vore M. The Ileocyte Basolateral Organic Solute Transporter (OSTα-OSTβ) Complex: Finding The Missing Link in Enterohepatic Circulation. Mol Interv 2005 Feb;5(1):8-10. 73. Dawson PA, Hubbert M, Haywood J, Craddock AL, Zerangue N, Christian WV, et al. The heteromeric organic solute transporter alpha-beta, Ostα-Ostβ, is an ileal basolateral bile acid transporter. J Biol Chem 2005 Feb 25;280(8):6960-6968. 74. Wang W, Seward DJ, Li L, Boyer JL, Ballatori N. Expression cloning of two genes that together mediate organic solute and steroid transport in the liver of a marine vertebrate. Proc Natl Acad Sci U S A 2001 Jul 31;98(16):9431-9436. 75. Seward DJ, Koh AS, Boyer JL, Ballatori N. Functional complementation between a novel mammalian po- lygenic transport complex and an evolutionarily ancient organic solute transporter, OSTα-OSTβ. J Biol Chem 2003 Jul 25;278(30):27473-27482. 76. Ballatori N, Christian WV, Lee JY, Dawson PA, Soroka CJ, Boyer JL, et al. OSTα-OSTβ: a major basolateral bile acid and steroid transporter in human intestinal, renal, and biliary epithelia. Hepatology 2005 Dec;42(6):1270-1279. 77. Rao A, Haywood J, Craddock AL, Belinsky MG, Kruh GD, Dawson PA. The organic solute transporter alpha-beta, Ostα-Ostβ, is essential for intestinal bile acid transport and homeostasis. Proc Natl Acad Sci U S A 2008 Mar 11;105(10):3891-3896. 78. Ballatori N. Pleiotropic functions of the organic solute transporter Ostα-Ostβ. Dig Dis 2011;29(1):13-17. 79. Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ. Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000 Sep 15;102(6):731-744. 80. Ros JE, Libbrecht L, Geuken M, Jansen PL, Roskams TA. High expression of MDR1, MRP1, and MRP3 in the hepatic progenitor cell compartment and hepatocytes in severe human liver disease. J Pathol 2003 Aug;200(5):553-560.

47 Chapter 1

81. Boyer JL, Trauner M, Mennone A, Soroka CJ, Cai SY, Moustafa T, et al. Upregulation of a basolateral FXR-dependent bile acid efflux transporter OSTα-OSTβ in cholestasis in humans and rodents. Am J Physiol Gastrointest Liver Physiol 2006 Jun;290(6):G1124-G1130. 82. Zollner G, Wagner M, Fickert P, Silbert D, Gumhold J, Zatloukal K, et al. Expression of bile acid synthesis and detoxification enzymes and the alternative bile acid efflux pump MRP4 in patients with primary biliary cirrhosis. Liver Int 2007 Sep;27(7):920-929. 83. Mennone A, Soroka CJ, Cai SY, Harry K, Adachi M, Hagey L, et al. Mrp4-/- mice have an impaired cytoprotective response in obstructive cholestasis. Hepatology 2006 May;43(5):1013-1021. 84. Neimark E, Chen F, Li X, Shneider BL. Bile acid-induced negative feedback regulation of the human ileal bile acid transporter. Hepatology 2004 Jul;40(1):149-156. 85. Wolf G. A history of vitamin A and retinoids. FASEB J 1996 Jul;10(9):1102-1107. 86. Nomenclature of retinoids: recommendations 1981. IUPAC-IUB Joint Commission on Biochemical No- menclature (JCBN). Arch Biochem Biophys 1983 Jul 15;224(2):728-731. 87. Moore T. Vitamin A and carotene: The absence of the liver oil vitamin A from carotene. VI. The conversion of carotene to vitamin A in vivo. Biochem J 1930;24(3):692-702. 88. Blomhoff R, Blomhoff HK. Overview of retinoid metabolism and function. J Neurobiol 2006 Jun;66(7):606- 630. 89. Weber D, Grune T. The contribution of beta-carotene to vitamin A supply of humans. Mol Nutr Food Res 2012 Feb;56(2):251-258. 90. Senoo H. Structure and function of hepatic stellate cells. Med Electron Microsc 2004 Mar;37(1):3-15. 91. Hix LM, Lockwood SF, Bertram JS. Bioactive carotenoids: potent antioxidants and regulators of gene expression. Redox Rep 2004;9(4):181-191. 92. Paiva SA, Russell RM. Beta-carotene and other carotenoids as antioxidants. J Am Coll Nutr 1999 Oct;18(5):426-433. 93. Samokyszyn VM, Marnett LJ. Inhibition of liver microsomal lipid peroxidation by 13-cis-retinoic acid. Free Radic Biol Med 1990;8(5):491-496. 94. Livrea MA, Tesoriere L, Bongiorno A, Pintaudi AM, Ciaccio M, Riccio A. Contribution of vitamin A to the oxidation resistance of human low density lipoproteins. Free Radic Biol Med 1995 Mar;18(3):401-409. 95. Ritter E, Elgeti M, Bartl FJ. Activity switches of rhodopsin. Photochem Photobiol 2008 Jul;84(4):911-920. 96. Bonet ML, Ribot J, Felipe F, Palou A. Vitamin A and the regulation of fat reserves. Cell Mol Life Sci 2003 Jul;60(7):1311-1321. 97. Holick MF. Vitamin D deficiency. N Engl J Med 2007 Jul 19;357(3):266-281. 98. Dusso AS, Brown AJ, Slatopolsky E. Vitamin D. Am J Physiol Renal Physiol 2005 Jul;289(1):F8-28. 99. Brown AJ, Dusso A, Slatopolsky E. Vitamin D. Am J Physiol 1999 Aug;277(2 Pt 2):F157-F175.

100. Lawson DE, Douglas J, Lean M, Sedrani S. Estimation of vitamin D3 and 25-hydroxyvitamin D3 in muscle and adipose tissue of rats and man. Clin Chim Acta 1986 Jun 15;157(2):175-181. 101. IUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN). Nomenclature of tocopherols and related compounds. Recommendations 1981. Eur J Biochem 1982 Apr;123(3):473-475. 102. Evans HM, Bishop KS. On the existence of a hitherto unrecognized dietary factor essential for reproduction. Science 1922 Dec 8;56(1458):650-651. 103. Assem M, Schuetz EG, Leggas M, Sun D, Yasuda K, Reid G, et al. Interactions between hepatic Mrp4 and Sult2a as revealed by the constitutive androstane receptor and Mrp4 knockout mice. J Biol Chem 2004 May 21;279(21):22250-22257. 104. Zingg JM, Azzi A. Non-antioxidant activities of vitamin E. Curr Med Chem 2004 May;11(9):1113-1133. 105. Traber MG, Atkinson J. Vitamin E, antioxidant and nothing more. Free Radic Biol Med 2007 Jul 1;43(1):4- 15.

48 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

106. Rigotti A. Absorption, transport, and tissue delivery of vitamin E. Mol Aspects Med 2007 Oct;28(5-6):423- 436. 107. Kayata S, Kindberg C, Greer FR, Suttie JW. Vitamin K1 and K2 in infant human liver. J Pediatr Gastroen- terol Nutr 1989 Apr;8(3):304-307. 108. Greer FR. Vitamin K the basics-What's new? Early Hum Dev 2010 Jul;86 Suppl 1:43-7. 109. Bolton-Smith C, Price RJ, Fenton ST, Harrington DJ, Shearer MJ. Compilation of a provisional UK database for the phylloquinone (vitamin K1) content of foods. Br J Nutr 2000 Apr;83(4):389-399. 110. Dam H. The antihaemorrhagic vitamin of the chick. Biochem J 1935 Jun;29(6):1273-1285. 111. Vermeer C, Jie KS, Knapen MH. Role of vitamin K in bone metabolism. Annu Rev Nutr 1995;15:1-22. 112. Van WM, De BR, Van d, V, Van BS. Vitamin K, an update for the paediatrician. Eur J Pediatr 2009 Feb;168(2):127-134. 113. Fairfield KM, Fletcher RH. Vitamins for chronic disease prevention in adults: scientific review. JAMA 2002 Jun 19;287(23):3116-3126. 114. Strople J, Lovell G, Heubi J. Prevalence of subclinical vitamin K deficiency in cholestatic liver disease. J Pediatr Gastroenterol Nutr 2009 Jul;49(1):78-84. 115. Phillips JR, Angulo P, Petterson T, Lindor KD. Fat-soluble vitamin levels in patients with primary biliary cirrhosis. Am J Gastroenterol 2001 Sep;96(9):2745-2750. 116. Jorgensen RA, Lindor KD, Sartin JS, LaRusso NF, Wiesner RH. Serum lipid and fat-soluble vitamin levels in primary sclerosing cholangitis. J Clin Gastroenterol 1995 Apr;20(3):215-219. 117. Sokol RJ, Balistreri WF, Hoofnagle JH, Jones EA. Vitamin E deficiency in adults with chronic liver disease. Am J Clin Nutr 1985 Jan;41(1):66-72. 118. de Paula TP, Ramalho A, Braulio VB. The effectiveness of relative dose response to retinol intake as an evaluation of vitamin A status of cirrhotic patients. J Hum Nutr Diet 2010 Dec;23(6):583-589. 119. Peres WA, Chaves GV, Goncalves JC, Ramalho A, Coelho HS. Vitamin A deficiency in patients with hepatitis C virus-related chronic liver disease. Br J Nutr 2011 Jun 8;1-8. 120. Malham M, Jorgensen SP, Ott P, Agnholt J, Vilstrup H, Borre M, et al. Vitamin D deficiency in cirrhosis relates to liver dysfunction rather than aetiology. World J Gastroenterol 2011 Feb 21;17(7):922-925. 121. Saron ML, Godoy HT, Hessel G. Nutritional status of patients with biliary atresia and autoimmune hepatitis related to serum levels of vitamins A, D and E. Arq Gastroenterol 2009 Jan;46(1):62-68. 122. Floreani A, Baragiotta A, Martines D, Naccarato R, D'odorico A. Plasma antioxidant levels in chronic cholestatic liver diseases. Aliment Pharmacol Ther 2000 Mar;14(3):353-358. 123. Kowdley KV, Emond MJ, Sadowski JA, Kaplan MM. Plasma vitamin K1 level is decreased in primary biliary cirrhosis. Am J Gastroenterol 1997 Nov;92(11):2059-2061. 124. EASL Clinical Practice Guidelines: management of cholestatic liver diseases. J Hepatol 2009 Aug;51(2):237- 267. 125. Chapman R, Fevery J, Kalloo A, Nagorney DM, Boberg KM, Shneider B, et al. Diagnosis and management of primary sclerosing cholangitis. Hepatology 2010 Feb;51(2):660-678. 126. Perez FT, Lopez SP, Tomas E, Gutierrez ML, Lledo JL, Cacho G, et al. Diagnostic and therapeutic approach to cholestatic liver disease. Rev Esp Enferm Dig 2004 Jan;96(1):60-73. 127. Amedee-Manesme O, Mourey MS, Therasse J, Couturier M, Alvarez F, Hanck A, et al. Short- and long- term vitamin A treatment in children with cholestasis. Am J Clin Nutr 1988 Apr;47(4):690-693. 128. During A, Harrison EH. Mechanisms of provitamin A (carotenoid) and vitamin A (retinol) transport into and out of intestinal Caco-2 cells. J Lipid Res 2007 Oct;48(10):2283-2294. 129. During A, Harrison EH. Intestinal absorption and metabolism of carotenoids: insights from cell culture. Arch Biochem Biophys 2004 Oct 1;430(1):77-88. 130. Harrison EH. Mechanisms of digestion and absorption of dietary vitamin A. Annu Rev Nutr 2005;25:87- 103.

49 Chapter 1

131. Probstfield JL, Lin TL, Peters J, Hunninghake DB. Carotenoids and vitamin A: the effect of hypocholestero- lemic agents on serum levels. Metabolism 1985 Jan;34(1):88-91. 132. Hollander D. Retinol lymphatic and portal transport: influence of pH, bile, and fatty acids. Am J Physiol 1980 Sep;239(3):G210-G214. 133. Von Lintig J, Wyss A. Molecular analysis of vitamin A formation: cloning and characterization of beta-carotene 15,15'-dioxygenases. Arch Biochem Biophys 2001 Jan 1;385(1):47-52. 134. Li E, Tso P. Vitamin A uptake from foods. Curr Opin Lipidol 2003 Jun;14(3):241-247. 135. Hussain MM. A proposed model for the assembly of chylomicrons. Atherosclerosis 2000 Jan;148(1):1-15. 136. Huang HS, Goodman DS. Vitamin A and carotenoids. I. Intestinal absorption and metabolism of 14c-la- belled vitamin A alcohol and beta-carotene in the rat. J Biol Chem 1965 Jul;240:2839-2844. 137. Davidson NO, Kollmer ME, Glickman RM. Apolipoprotein B synthesis in rat small intestine: regulation by dietary triglyceride and biliary lipid. J Lipid Res 1986 Jan;27(1):30-39. 138. Peterson PA. Studies on the interaction between prealbumin, retinol-binding protein, and vitamin A. J Biol Chem 1971 Jan 10;246(1):44-49. 139. Norum KR, Blomhoff R. McCollum Award Lecture, 1992: vitamin A absorption, transport, cellular uptake, and storage. Am J Clin Nutr 1992 Oct;56(4):735-744. 140. Quadro L, Blaner WS, Hamberger L, Novikoff PM, Vogel S, Piantedosi R,et al. The role of extrahepatic retinol binding protein in the mobilization of retinoid stores. J Lipid Res 2004 Nov;45(11):1975-1982. 141. Quadro L, Blaner WS, Salchow DJ, Vogel S, Piantedosi R, Gouras P, et al. Impaired retinal function and vitamin A availability in mice lacking retinol-binding protein. EMBO J 1999 Sep 1;18(17):4633-4644. 142. Erickson JM, Mawson AR. Possible role of endogenous retinoid (Vitamin A) toxicity in the pathophysio- logy of primary biliary cirrhosis. J Theor Biol 2000 Sep 7;206(1):47-54. 143. Nagy NE, Holven KB, Roos N, Senoo H, Kojima N, Norum KR, et al. Storage of vitamin A in extrahepatic stellate cells in normal rats. J Lipid Res 1997 Apr;38(4):645-658. 144. Blomhoff R, Green MH, Berg T, Norum KR. Transport and storage of vitamin A. Science 1990 Oct 19;250(4979):399-404. 145. Duester G, Mic FA, Molotkov A. Cytosolic retinoid dehydrogenases govern ubiquitous metabolism of retinol to retinaldehyde followed by tissue-specific metabolism to retinoic acid. Chem Biol Interact 2003 Feb 1;143-144:201-210. 146. Duester G. Families of retinoid dehydrogenases regulating vitamin A function: production of visual pigment and retinoic acid. Eur J Biochem 2000 Jul;267(14):4315-4324. 147. Marill J, Idres N, Capron CC, Nguyen E, Chabot GG. Retinoic acid metabolism and mechanism of action: a review. Curr Drug Metab 2003 Feb;4(1):1-10. 148. Pares X, Farres J, Kedishvili N, Duester G. Medium- and short-chain dehydrogenase/reductase gene and protein families : Medium-chain and short-chain dehydrogenases/reductases in retinoid metabolism. Cell Mol Life Sci 2008 Dec;65(24):3936-3949. 149. Chen H, Howald WN, Juchau MR. Biosynthesis of all-trans-retinoic acid from all-trans-retinol: catalysis of all-trans-retinol oxidation by human P-450 cytochromes. Drug Metab Dispos 2000 Mar;28(3):315-322. 150. Labrecque J, Dumas F, Lacroix A, Bhat PV. A novel isoenzyme of aldehyde dehydrogenase specifically involved in the biosynthesis of 9-cis and all-trans retinoic acid. Biochem J 1995 Jan 15;305 ( Pt 2):681-684. 151. Zhang QY, Dunbar D, Kaminsky L. Human cytochrome P-450 metabolism of retinals to retinoic acids. Drug Metab Dispos 2000 Mar;28(3):292-297. 152. Kojima R, Fujimori T, Kiyota N, Toriya Y, Fukuda T, Ohashi T, et al. In vivo isomerization of retinoic acids. Rapid isomer exchange and gene expression. J Biol Chem 1994 Dec 23;269(51):32700-32707. 153. Kurlandsky SB, Gamble MV, Ramakrishnan R, Blaner WS. Plasma delivery of retinoic acid to tissues in the rat. J Biol Chem 1995 Jul 28;270(30):17850-17857. 154. Petkovich PM. Retinoic acid metabolism. J Am Acad Dermatol 2001 Nov;45(5):S136-S142.

50 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

155. Idres N, Marill J, Chabot GG. Regulation of CYP26A1 expression by selective RAR and RXR agonists in human NB4 promyelocytic leukemia cells. Biochem Pharmacol 2005 Jun 1;69(11):1595-1601. 156. Marill J, Capron CC, Idres N, Chabot GG. Human cytochrome P450s involved in the metabolism of 9-cis- and 13-cis-retinoic acids. Biochem Pharmacol 2002 Mar 1;63(5):933-943. 157. Francis GA, Fayard E, Picard F, Auwerx J. Nuclear receptors and the control of metabolism. Annu Rev Physiol 2003;65:261-311. 158. Germain P, Staels B, Dacquet C, Spedding M, Laudet V. Overview of nomenclature of nuclear receptors. Pharmacol Rev 2006 Dec;58(4):685-704. 159. Aranda A, Pascual A. Nuclear hormone receptors and gene expression. Physiol Rev 2001 Jul;81(3):1269- 1304. 160. Zhang XK, Hoffmann B, Tran PB, Graupner G, Pfahl M. Retinoid X receptor is an auxiliary protein for thyroid hormone and retinoic acid receptors. Nature 1992 Jan 30;355(6359):441-446. 161. Dong D, Noy N. Heterodimer formation by retinoid X receptor: regulation by ligands and by the receptor's self-association properties. Biochemistry 1998 Jul 28;37(30):10691-10700. 162. Chawla A, Repa JJ, Evans RM, Mangelsdorf DJ. Nuclear receptors and lipid physiology: opening the X-files. Science 2001 Nov 30;294(5548):1866-1870. 163. Beato M, Herrlich P, Schutz G. Steroid hormone receptors: many actors in search of a plot. Cell 1995 Dec 15;83(6):851-857. 164. Forman BM, Evans RM. Nuclear hormone receptors activate direct, inverted, and everted repeats. Ann N Y Acad Sci 1995 Jun 12;761:29-37. 165. Karpen SJ. Nuclear receptor regulation of hepatic function. J Hepatol 2002 Jun;36(6):832-850. 166. Baranowski M. Biological role of liver X receptors. J Physiol Pharmacol 2008 Dec;59 Suppl 7:31-55. 167. Mangelsdorf DJ, Ong ES, Dyck JA, Evans RM. Nuclear receptor that identifies a novel retinoic acid response pathway. Nature 1990 May 17;345(6272):224-229. 168. Germain P, Chambon P, Eichele G, Evans RM, Lazar MA, Leid M, et al. International Union of Pharmaco- logy. LXIII. Retinoid X receptors. Pharmacol Rev 2006 Dec;58(4):760-772. 169. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, et al. Characterization of three RXR genes that mediate the action of 9-cis retinoic acid. Genes Dev 1992 Mar;6(3):329-344. 170. Heyman RA, Mangelsdorf DJ, Dyck JA, Stein RB, Eichele G, Evans RM, et al. 9-cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell 1992 Jan 24;68(2):397-406. 171. Levin AA, Sturzenbecker LJ, Kazmer S, Bosakowski T, Huselton C, Allenby G, et al. 9-cis retinoic acid stereoisomer binds and activates the nuclear receptor RXR alpha. Nature 1992 Jan 23;355(6358):359-361. 172. Tate BF, Levin AA, Grippo JF. The discovery of 9-cis retinoic acid a hormone that binds the retinoid-X receptor. Trends Endocrinol Metab 1994 Jul;5(5):189-194. 173. Allenby G, Bocquel MT, Saunders M, Kazmer S, Speck J, Rosenberger M, et al. Retinoic acid receptors and retinoid X receptors: interactions with endogenous retinoic acids. Proc Natl Acad Sci U S A 1993 Jan 1;90(1):30-34. 174. Ulven SM, Gundersen TE, Sakhi AK, Glover JC, Blomhoff R. Quantitative axial profiles of retinoic acid in the embryonic mouse spinal cord: 9-cis retinoic acid only detected after all-trans-retinoic acid levels are super-elevated experimentally. Dev Dyn 2001 Nov;222(3):341-353. 175. Werner EA, DeLuca HF. Metabolism of a physiological amount of all-trans-retinol in the vitamin A-deficient rat. Arch Biochem Biophys 2001 Sep 15;393(2):262-270. 176. Ulven SM, Gundersen TE, Weedon MS, Landaas VO, Sakhi AK, Fromm SH, et al. Identification of endogenous retinoids, enzymes, binding proteins, and receptors during early postimplantation development in mouse: important role of retinal dehydrogenase type 2 in synthesis of all-trans-retinoic acid. Dev Biol 2000 Apr 15;220(2):379-391.

51 Chapter 1

177. Arnhold T, Tzimas G, Wittfoht W, Plonait S, Nau H. Identification of 9-cis-retinoic acid, 9,13-di-cis-retinoic acid, and 14-hydroxy-4,14-retro-retinol in human plasma after liver consumption. Life Sci 1996;59(12):L169-L177. 178. Kane MA, Folias AE, Pingitore A, Perri M, Obrochta KM, Krois CR, et al. Identification of 9-cis-retinoic acid as a pancreas-specific autacoid that attenuates glucose-stimulated insulin secretion. Proc Natl Acad Sci U S A 2010 Dec 14;107(50):21884-21889. 179. Wolf G. Is 9-cis-retinoic acid the endogenous ligand for the retinoic acid-X receptor? Nutr Rev 2006 Dec;64(12):532-538. 180. de Urquiza AM, Liu S, Sjoberg M, Zetterstrom RH, Griffiths W, Sjovall J,et al. Docosahexaenoic acid, a ligand for the retinoid X receptor in mouse brain. Science 2000 Dec 15;290(5499):2140-2144. 181. Lengqvist J, Mata De UA, Bergman AC, Willson TM, Sjovall J, Perlmann T, et al. Polyunsaturated fatty acids including docosahexaenoic and arachidonic acid bind to the retinoid X receptor alpha ligand-binding domain. Mol Cell Proteomics 2004 Jul;3(7):692-703. 182. Zhang XK, Lehmann J, Hoffmann B, Dawson MI, Cameron J, Graupner G,et al. Homodimer formation of retinoid X receptor induced by 9-cis retinoic acid. Nature 1992 Aug 13;358(6387):587-591. 183. Germain P, Chambon P, Eichele G, Evans RM, Lazar MA, Leid M, et al. International Union of Pharmaco- logy. LX. Retinoic acid receptors. Pharmacol Rev 2006 Dec;58(4):712-725. 184. Dolle P. Developmental expression of retinoic acid receptors (RARs). Nucl Recept Signal 2009;7:e006. 185. Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM. Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature 1992 Jan 30;355(6359):446-449. 186. Umesono K, Murakami KK, Thompson CC, Evans RM. Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 1991 Jun 28;65(7):1255-1266. 187. Allenby G, Janocha R, Kazmer S, Speck J, Grippo JF, Levin AA. Binding of 9-cis-retinoic acid and all-trans-retinoic acid to retinoic acid receptors alpha, beta, and gamma. Retinoic acid receptor gamma binds all-trans-retinoic acid preferentially over 9-cis-retinoic acid. J Biol Chem 1994 Jun 17;269(24):16689- 16695. 188. Repa JJ, Hanson KK, Clagett-Dame M. All-trans-retinol is a ligand for the retinoic acid receptors. Proc Natl Acad Sci U S A 1993 Aug 1;90(15):7293-7297. 189. Panariello L, Quadro L, Trematerra S, Colantuoni V. Identification of a novel retinoic acid response element in the promoter region of the retinol-binding protein gene. J Biol Chem 1996 Oct 11;271(41):25524-25532. 190. Mangelsdorf DJ, Umesono K, Kliewer SA, Borgmeyer U, Ong ES, Evans RM. A direct repeat in the cellular retinol-binding protein type II gene confers differential regulation by RXR and RAR. Cell 1991 Aug 9;66(3):555-561. 191. Denson LA, Sturm E, Echevarria W, Zimmerman TL, Makishima M, Mangelsdorf DJ, et al. The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. Gastroen- terology 2001 Jul;121(1):140-147. 192. Denson LA, Auld KL, Schiek DS, McClure MH, Mangelsdorf DJ, Karpen SJ. Interleukin-1β suppresses retinoid transactivation of two hepatic transporter genes involved in bile formation. J Biol Chem 2000 Mar 24;275(12):8835-8843. 193. Crestani M, Sadeghpour A, Stroup D, Galli G, Chiang JY. Transcriptional activation of the cholesterol 7α-hydroxylase gene (CYP7A) by nuclear hormone receptors. J Lipid Res 1998 Nov;39(11):2192-2200. 194. Chen W, Cai SY, Xu S, Denson LA, Soroka CJ, Boyer JL. Nuclear receptors RXRα:RARα are repressors for human MRP3 expression. Am J Physiol Gastrointest Liver Physiol 2007 May;292(5):G1221-G1227. 195. Moore DD, Kato S, Xie W, Mangelsdorf DJ, Schmidt DR, Xiao R, et al. International Union of Pharmaco- logy. LXII. The NR1H and NR1I receptors: constitutive androstane receptor, pregnene X receptor, farnesoid X receptor alpha, farnesoid X receptor beta, liver X receptor alpha, liver X receptor beta, and vitamin D receptor. Pharmacol Rev 2006 Dec;58(4):742-759. 196. Kawamata Y, Fujii R, Hosoya M, Harada M, Yoshida H, Miwa M, et al. A G protein-coupled receptor responsive to bile acids. J Biol Chem 2003 Mar 14;278(11):9435-9440.

52 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

197. Maruyama T, Miyamoto Y, Nakamura T, Tamai Y, Okada H, Sugiyama E, et al. Identification of membrane-type receptor for bile acids (M-BAR). Biochem Biophys Res Commun 2002 Nov 15;298(5):714-719. 198. Watanabe M, Houten SM, Mataki C, Christoffolete MA, Kim BW, Sato H,et al. Bile acids induce energy expenditure by promoting intracellular thyroid hormone activation. Nature 2006 Jan 26;439(7075):484-489. 199. Seol W, Choi HS, Moore DD. Isolation of proteins that interact specifically with the retinoid X receptor: two novel orphan receptors. Mol Endocrinol 1995 Jan;9(1):72-85. 200. Forman BM, Goode E, Chen J, Oro AE, Bradley DJ, Perlmann T, et al. Identification of a nuclear receptor that is activated by farnesol metabolites. Cell 1995 Jun 2;81(5):687-693. 201. Zavacki AM, Lehmann JM, Seol W, Willson TM, Kliewer SA, Moore DD. Activation of the orphan receptor RIP14 by retinoids. Proc Natl Acad Sci U S A 1997 Jul 22;94(15):7909-7914. 202. Wang H, Chen J, Hollister K, Sowers LC, Forman BM. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 1999 May;3(5):543-553. 203. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, et al. Bile acids: natural ligands for an orphan nuclear receptor. Science 1999 May 21;284(5418):1365-1368. 204. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, et al. Identification of a nuclear receptor for bile acids. Science 1999 May 21;284(5418):1362-1365. 205. Wang S, Lai K, Moy FJ, Bhat A, Hartman HB, Evans MJ. The nuclear hormone receptor farnesoid X receptor (FXR) is activated by androsterone. Endocrinology 2006 Sep;147(9):4025-4033. 206. Zhao A, Yu J, Lew JL, Huang L, Wright SD, Cui J. Polyunsaturated fatty acids are FXR ligands and differentially regulate expression of FXR targets. DNA Cell Biol 2004 Aug;23(8):519-526. 207. Deng R, Yang D, Yang J, Yan B. Oxysterol 22(R)-hydroxycholesterol induces the expression of the bile salt export pump through nuclear receptor farsenoid X receptor but not liver X receptor. J Pharmacol Exp Ther 2006 Apr;317(1):317-325. 208. Maloney PR, Parks DJ, Haffner CD, Fivush AM, Chandra G, Plunket KD, et al. Identification of a chemical tool for the orphan nuclear receptor FXR. J Med Chem 2000 Aug 10;43(16):2971-2974. 209. Pellicciari R, Fiorucci S, Camaioni E, Clerici C, Costantino G, Maloney PR, et al. 6α-ethyl-chenodeoxycholic acid (6-ECDCA), a potent and selective FXR agonist endowed with anticholestatic activity. J Med Chem 2002 Aug 15;45(17):3569-3572. 210. Cui J, Huang L, Zhao A, Lew JL, Yu J, Sahoo S, et al. Guggulsterone is a farnesoid X receptor antagonist in coactivator association assays but acts to enhance transcription of bile salt export pump. J Biol Chem 2003 Mar 21;278(12):10214-10220. 211. Urizar NL, Liverman AB, Dodds DT, Silva FV, Ordentlich P, Yan Y, et al. A natural product that lowers cholesterol as an antagonist ligand for FXR. Science 2002 May 31;296(5573):1703-1706. 212. Zhang Y, Kast-Woelbern HR, Edwards PA. Natural structural variants of the nuclear receptor farnesoid X receptor affect transcriptional activation. J Biol Chem 2003 Jan 3;278(1):104-110. 213. Huber RM, Murphy K, Miao B, Link JR, Cunningham MR, Rupar MJ, et al. Generation of multiple farnesoid-X-receptor isoforms through the use of alternative promoters. Gene 2002 May 15;290(1-2):35-43. 214. Otte K, Kranz H, Kober I, Thompson P, Hoefer M, Haubold B,et al. Identification of farnesoid X receptor beta as a novel mammalian nuclear receptor sensing lanosterol. Mol Cell Biol 2003 Feb;23(3):864-872. 215. Zhang ZD, Cayting P, Weinstock G, Gerstein M. Analysis of nuclear receptor pseudogenes in vertebrates: how the silent tell their stories. Mol Biol Evol 2008 Jan;25(1):131-143. 216. Plass JR, Mol O, Heegsma J, Geuken M, Faber KN, Jansen PL, et al. Farnesoid X receptor and bile salts are involved in transcriptional regulation of the gene encoding the human bile salt export pump. Hepatology 2002 Mar;35(3):589-596. 217. Ananthanarayanan M, Balasubramanian N, Makishima M, Mangelsdorf DJ, Suchy FJ. Human bile salt export pump promoter is transactivated by the farnesoid X receptor/bile acid receptor. J Biol Chem 2001 Aug 3;276(31):28857-28865.

53 Chapter 1

218. Landrier JF, Eloranta JJ, Vavricka SR, Kullak-Ublick GA. The nuclear receptor for bile acids, FXR, transactivates human organic solute transporter-alpha and -beta genes. Am J Physiol Gastrointest Liver Physiol 2006 Mar;290(3):G476-G485. 219. Lee H, Zhang Y, Lee FY, Nelson SF, Gonzalez FJ, Edwards PA. FXR regulates organic solute transporters a and b in the adrenal gland, kidney, and intestine. J Lipid Res 2006 Jan;47(1):201-214. 220. Grober J, Zaghini I, Fujii H, Jones SA, Kliewer SA, Willson TM, et al. Identification of a bile acid-responsive element in the human ileal bile acid-binding protein gene. Involvement of the farnesoid X receptor/9-cis-retinoic acid receptor heterodimer. J Biol Chem 1999 Oct 15;274(42):29749-29754. 221. Pircher PC, Kitto JL, Petrowski ML, Tangirala RK, Bischoff ED, Schulman IG,et al. Farnesoid X receptor regulates bile acid-amino acid conjugation. J Biol Chem 2003 Jul 25;278(30):27703-27711. 222. Jung D, Podvinec M, Meyer UA, Mangelsdorf DJ, Fried M, Meier PJ, et al. Human organic anion transporting polypeptide 8 promoter is transactivated by the farnesoid X receptor/bile acid receptor. Gastroentero- logy 2002 Jun;122(7):1954-1966. 223. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, et al. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000 Sep;6(3):517-526. 224. Chen W, Owsley E, Yang Y, Stroup D, Chiang JY. Nuclear receptor-mediated repression of human cholesterol 7α-hydroxylase gene transcription by bile acids. J Lipid Res 2001 Sep;42(9):1402-1412. 225. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, et al. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 2000 Sep;6(3):507-515. 226. Holt JA, Luo G, Billin AN, Bisi J, McNeill YY, Kozarsky KF, et al. Definition of a novel growth factor-dependent signal cascade for the suppression of bile acid biosynthesis. Genes Dev 2003 Jul 1;17(13):1581-1591. 227. Li J, Pircher PC, Schulman IG, Westin SK. Regulation of complement C3 expression by the bile acid receptor FXR. J Biol Chem 2005 Mar 4;280(9):7427-7434. 228. Kast HR, Goodwin B, Tarr PT, Jones SA, Anisfeld AM, Stoltz CM, et al. Regulation of multidrug resistance-associated protein 2 (ABCC2) by the nuclear receptors pregnane X receptor, farnesoid X-activated receptor, and constitutive androstane receptor. J Biol Chem 2002 Jan 25;277(4):2908-2915. 229. Song CS, Echchgadda I, Baek BS, Ahn SC, Oh T, Roy AK, et al. Dehydroepiandrosterone sulfotransferase gene induction by bile acid activated farnesoid X receptor. J Biol Chem 2001 Nov 9;276(45):42549-42556. 230. Barbier O, Torra IP, Sirvent A, Claudel T, Blanquart C, Duran-Sandoval D, et al. FXR induces the UGT2B4 enzyme in hepatocytes: a potential mechanism of negative feedback control of FXR activity. Gastroentero- logy 2003 Jun;124(7):1926-1940. 231. Shen H, Zhang Y, Ding H, Wang X, Chen L, Jiang H, et al. Farnesoid X receptor induces GLUT4 expression through FXR response element in the GLUT4 promoter. Cell Physiol Biochem 2008;22(1-4):1-14. 232. Claudel T, Sturm E, Duez H, Torra IP, Sirvent A, Kosykh V, et al. Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J Clin Invest 2002 Apr;109(7):961-971. 233. Claudel T, Inoue Y, Barbier O, Duran-Sandoval D, Kosykh V, Fruchart J, et al. Farnesoid X receptor agonists suppress hepatic apolipoprotein CIII expression. Gastroenterology 2003 Aug;125(2):544-555. 234. Lee FY, Lee H, Hubbert ML, Edwards PA, Zhang Y. FXR, a multipurpose nuclear receptor. Trends Biochem Sci 2006 Oct;31(10):572-580. 235. Anisfeld AM, Kast-Woelbern HR, Lee H, Zhang Y, Lee FY, Edwards PA. Activation of the nuclear receptor FXR induces fibrinogen expression: a new role for bile acid signaling. J Lipid Res 2005 Mar;46(3):458-68. 236. Plass JRM. Function and regulation of the human bile salt export pump (dissertation).Groningen: Rijks- universiteit Groningen, 2005. 237. Zhao A, Lew JL, Huang L, Yu J, Zhang T, Hrywna Y, et al. Human kininogen gene is transactivated by the farnesoid X receptor. J Biol Chem 2003 Aug 1;278(31):28765-28770. 238. Qin P, Borges-Marcucci LA, Evans MJ, Harnish DC. Bile acid signaling through FXR induces intracellular adhesion molecule-1 expression in mouse liver and human hepatocytes. Am J Physiol Gastrointest Liver Physiol 2005 Aug;289(2):G267-G273.

54 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

239. Matsukuma KE, Bennett MK, Huang J, Wang L, Gil G, Osborne TF. Coordinated control of bile acids and lipogenesis through FXR-dependent regulation of fatty acid synthase. J Lipid Res 2006 Dec;47(12):2754- 2761. 240. Urizar NL, Dowhan DH, Moore DD. The farnesoid X-activated receptor mediates bile acid activation of phospholipid transfer protein gene expression. J Biol Chem 2000 Dec 15;275(50):39313-39317. 241. Kast HR, Nguyen CM, Sinal CJ, Jones SA, Laffitte BA, Reue K,et al. Farnesoid X-activated receptor induces apolipoprotein C-II transcription: a molecular mechanism linking plasma triglyceride levels to bile acids. Mol Endocrinol 2001 Oct;15(10):1720-1728. 242. Huang W, Ma K, Zhang J, Qatanani M, Cuvillier J, Liu J, et al. Nuclear receptor-dependent bile acid signaling is required for normal liver regeneration. Science 2006 Apr 14;312(5771):233-236. 243. Claudel T, Staels B, Kuipers F. The Farnesoid X receptor: a molecular link between bile acid and lipid and glucose metabolism. Arterioscler Thromb Vasc Biol 2005 Oct;25(10):2020-2030. 244. Nguyen A, Bouscarel B. Bile acids and signal transduction: Role in glucose homeostasis. Cell Signal 2008 Dec;20(12):2180-97. 245. Id BH, Lagneaux L, Fayyad-Kazan H, Badran B, Najar M, Wiedig M, et al. Role of farnesoid X receptor (FXR) in the process of differentiation of bone marrow stromal cells into osteoblasts. Bone 2011 Dec;49(6):1219-1231. 246. Huang L, Zhao A, Lew JL, Zhang T, Hrywna Y, Thompson JR, et al. Farnesoid X receptor activates transcription of the phospholipid pump MDR3. J Biol Chem 2003 Dec 19;278(51):51085-51090. 247. Gnerre C, Blattler S, Kaufmann MR, Looser R, Meyer UA. Regulation of CYP3A4 by the bile acid receptor FXR: evidence for functional binding sites in the CYP3A4 gene. Pharmacogenetics 2004 Oct;14(10):635- 645. 248. Sanyal S, Bavner A, Haroniti A, Nilsson LM, Lundasen T, Rehnmark S, et al. Involvement of corepressor complex subunit GPS2 in transcriptional pathways governing human bile acid biosynthesis. Proc Natl Acad Sci U S A 2007 Oct 2;104(40):15665-15670. 249. Lu Y, Heydel JM, Li X, Bratton S, Lindblom T, Radominska-Pandya A. Lithocholic acid decreases expression of UGT2B7 in Caco-2 cells: a potential role for a negative farnesoid X receptor response element. Drug Metab Dispos 2005 Jul;33(7):937-946. 250. Kardassis D, Roussou A, Papakosta P, Boulias K, Talianidis I, Zannis VI. Synergism between nuclear receptors bound to specific hormone response elements of the hepatic control region-1 and the proximal apolipoprotein C-II promoter mediate apolipoprotein C-II gene regulation by bile acids and retinoids. Biochem J 2003 Jun 1;372(Pt 2):291-304. 251. Hubbert ML, Zhang Y, Lee FY, Edwards PA. Regulation of hepatic Insig-2 by the farnesoid X receptor. Mol Endocrinol 2007 Jun;21(6):1359-1369. 252. Chao F, Gong W, Zheng Y, Li Y, Huang G, Gao M, et al. Upregulation of scavenger receptor class B type I expression by activation of FXR in hepatocyte. Atherosclerosis 2010 Dec;213(2):443-8. 253. Peyer AK, Jung D, Beer M, Gnerre C, Keogh A, Stroka D, et al. Regulation of human liver delta-aminole- vulinic acid synthase by bile acids. Hepatology 2007 Dec;46(6):1960-1970. 254. Lee FY, Kast-Woelbern HR, Chang J, Luo G, Jones SA, Fishbein MC, et al. Alpha-crystallin is a target gene of the farnesoid X-activated receptor in human livers. J Biol Chem 2005 Sep 9;280(36):31792-31800. 255. Bungard CI, McGivan JD. Identification of the promoter elements involved in the stimulation of ASCT2 expression by glutamine availability in HepG2 cells and the probable involvement of FXR/RXR dimers. Arch Biochem Biophys 2005 Nov 15;443(1-2):53-59. 256. Zhang Q, He F, Kuruba R, Gao X, Wilson A, Li J, et al. FXR-mediated regulation of angiotensin type 2 receptor expression in vascular smooth muscle cells. Cardiovasc Res 2008 Feb 1;77(3):560-569. 257. Hu T, Chouinard M, Cox AL, Sipes P, Marcelo M, Ficorilli J, et al. Farnesoid X receptor agonist reduces serum asymmetric dimethylarginine levels through hepatic dimethylarginine dimethylaminohydrolase-1 gene regulation. J Biol Chem 2006 Dec 29;281(52):39831-39838. 258. Li J, Wilson A, Kuruba R, Zhang Q, Gao X, He F, et al. FXR-mediated regulation of eNOS expression in vascular endothelial cells. Cardiovasc Res 2008 Jan;77(1):169-177.

55 Chapter 1

259. Murakami T, Walczak R, Caron S, Duhem C, Vidal V, Darteil R, et al. The farnesoid X receptor induces fetuin-B gene expression in human hepatocytes. Biochem J 2007 Nov 1;407(3):461-469. 260. Renga B, Mencarelli A, Cipriani S, D'Amore C, Zampella A, Monti MC, et al. The nuclear receptor FXR regulates hepatic transport and metabolism of glutamine and glutamate. Biochim Biophys Acta 2011 Nov;1812(11):1522-31. 261. Lee H, Hubbert ML, Osborne TF, Woodford K, Zerangue N, Edwards PA. Regulation of the sodium/sulfate co-transporter by farnesoid X receptor alpha. J Biol Chem 2007 Jul 27;282(30):21653-21661. 262. Popowski K, Eloranta JJ, Saborowski M, Fried M, Meier PJ, Kullak-Ublick GA. The human organic anion transporter 2 gene is transactivated by hepatocyte nuclear factor-4 alpha and suppressed by bile acids. Mol Pharmacol 2005 May;67(5):1629-1638. 263. Jung D, Mangelsdorf DJ, Meyer UA. Pregnane X receptor is a target of farnesoid X receptor. J Biol Chem 2006 Jul 14;281(28):19081-19091. 264. Anisfeld AM, Kast-Woelbern HR, Meyer ME, Jones SA, Zhang Y, Williams KJ, et al. Syndecan-1 expression is regulated in an isoform-specific manner by the farnesoid-X receptor. J Biol Chem 2003 May 30;278(22):20420-20428. 265. Chignard N, Mergey M, Barbu V, Finzi L, Tiret E, Paul A, et al. VPAC1 expression is regulated by FXR agonists in the human gallbladder epithelium. Hepatology 2005 Sep;42(3):549-557. 266. Kliewer SA, Moore JT, Wade L, Staudinger JL, Watson MA, Jones SA, et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell 1998 Jan 9;92(1):73-82. 267. Blumberg B, Sabbagh W, Jr., Juguilon H, Bolado J, Jr., van Meter CM, Ong ES, et al. SXR, a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev 1998 Oct 15;12(20):3195-3205. 268. Bertilsson G, Heidrich J, Svensson K, Asman M, Jendeberg L, Sydow-Backman M, et al. Identification of a human nuclear receptor defines a new signaling pathway for CYP3A induction. Proc Natl Acad Sci U S A 1998 Oct 13;95(21):12208-12213. 269. Staudinger JL, Goodwin B, Jones SA, Hawkins-Brown D, MacKenzie KI, LaTour A, et al. The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc Natl Acad Sci U S A 2001 Mar 13;98(6):3369-3374. 270. Xie W, Radominska-Pandya A, Shi Y, Simon CM, Nelson MC, Ong ES, et al. An essential role for nuclear receptors SXR/PXR in detoxification of cholestatic bile acids. Proc Natl Acad Sci U S A 2001 Mar 13;98(6):3375-3380. 271. Lehmann JM, McKee DD, Watson MA, Willson TM, Moore JT, Kliewer SA. The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J Clin Invest 1998 Sep 1;102(5):1016-1023. 272. Frank C, Makkonen H, Dunlop TW, Matilainen M, Vaisanen S, Carlberg C. Identification of pregnane X receptor binding sites in the regulatory regions of genes involved in bile acid homeostasis. J Mol Biol 2005 Feb 18;346(2):505-519. 273. Synold TW, Dussault I, Forman BM. The orphan nuclear receptor SXR coordinately regulates drug metabolism and efflux. Nat Med 2001 May;7(5):584-590. 274. Sonoda J, Xie W, Rosenfeld JM, Barwick JL, Guzelian PS, Evans RM. Regulation of a xenobiotic sulfonation cascade by nuclear pregnane X receptor (PXR). Proc Natl Acad Sci U S A 2002 Oct 15;99(21):13801-13806. 275. Teng S, Jekerle V, Piquette-Miller M. Induction of ABCC3 (MRP3) by pregnane X receptor activators. Drug Metab Dispos 2003 Nov;31(11):1296-1299. 276. Geick A, Eichelbaum M, Burk O. Nuclear receptor response elements mediate induction of intestinal MDR1 by rifampin. J Biol Chem 2001 May 4;276(18):14581-14587. 277. Wistuba W, Gnewuch C, Liebisch G, Schmitz G, Langmann T. Lithocholic acid induction of the FGF19 promoter in intestinal cells is mediated by PXR. World J Gastroenterol 2007 Aug 21;13(31):4230-4235. 278. Song KH, Li T, Owsley E, Strom S, Chiang JY. Bile acids activate fibroblast growth factor 19 signaling in human hepatocytes to inhibit cholesterol 7α-hydroxylase gene expression. Hepatology 2009 Jan;49(1):297- 305.

56 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

279. Inagaki T, Choi M, Moschetta A, Peng L, Cummins CL, McDonald JG, et al. Fibroblast growth factor 15 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab 2005 Oct;2(4):217-225. 280. Makishima M, Lu TT, Xie W, Whitfield GK, Domoto H, Evans RM, et al. Vitamin D receptor as an intestinal bile acid sensor. Science 2002 May 17;296(5571):1313-1316. 281. Adachi R, Honma Y, Masuno H, Kawana K, Shimomura I, Yamada S, et al. Selective activation of vitamin D receptor by lithocholic acid acetate, a bile acid derivative. J Lipid Res 2005 Jan;46(1):46-57. 282. St-Arnaud R. The direct role of vitamin D on bone homeostasis. Arch Biochem Biophys 2008 May 15;473(2):225-230. 283. Carlberg C, Bendik I, Wyss A, Meier E, Sturzenbecker LJ, Grippo JF, et al. Two nuclear signalling pathways for vitamin D. Nature 1993 Feb 18;361(6413):657-660. 284. Carlberg C, Seuter S. A genomic perspective on vitamin D signaling. Anticancer Res 2009 Sep;29(9):3485- 3493. 285. Drocourt L, Ourlin JC, Pascussi JM, Maurel P, Vilarem MJ. Expression of CYP3A4, CYP2B6, and CYP2C9 is regulated by the vitamin D receptor pathway in primary human hepatocytes. J Biol Chem 2002 Jul 12;277(28):25125-25132. 286. Tachibana S, Yoshinari K, Chikada T, Toriyabe T, Nagata K, Yamazoe Y. Involvement of Vitamin D receptor in the intestinal induction of human ABCB1. Drug Metab Dispos 2009 Aug;37(8):1604-1610. 287. McCarthy TC, Li X, Sinal CJ. Vitamin D receptor-dependent regulation of colon multidrug resistance-associated protein 3 gene expression by bile acids. J Biol Chem 2005 Jun 17;280(24):23232-23242. 288. Echchgadda I, Song CS, Roy AK, Chatterjee B. Dehydroepiandrosterone sulfotransferase is a target for transcriptional induction by the vitamin D receptor. Mol Pharmacol 2004 Mar;65(3):720-729. 289. Chatterjee B, Echchgadda I, Song CS. Vitamin D receptor regulation of the steroid/bile acid sulfotransferase SULT2A1. Methods Enzymol 2005;400:165-191. 290. Honjo Y, Sasaki S, Kobayashi Y, Misawa H, Nakamura H. 1,25-dihydroxyvitamin D3 and its receptor inhibit the chenodeoxycholic acid-dependent transactivation by farnesoid X receptor. J Endocrinol 2006 Mar;188(3):635-643. 291. Baes M, Gulick T, Choi HS, Martinoli MG, Simha D, Moore DD. A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoic acid response elements. Mol Cell Biol 1994 Mar;14(3):1544-1552. 292. Choi HS, Chung M, Tzameli I, Simha D, Lee YK, Seol W, et al. Differential transactivation by two isoforms of the orphan nuclear hormone receptor CAR. J Biol Chem 1997 Sep 19;272(38):23565-23571. 293. Tzameli I, Moore DD. Role reversal: new insights from new ligands for the xenobiotic receptor CAR. Trends Endocrinol Metab 2001 Jan;12(1):7-10. 294. Forman BM, Tzameli I, Choi HS, Chen J, Simha D, Seol W, et al. Androstane metabolites bind to and de- activate the nuclear receptor CAR-beta. Nature 1998 Oct 8;395(6702):612-615. 295. Huang W, Zhang J, Chua SS, Qatanani M, Han Y, Granata R, et al. Induction of bilirubin clearance by the constitutive androstane receptor (CAR). Proc Natl Acad Sci U S A 2003 Apr 1;100(7):4156-4161. 296. Zhang J, Huang W, Qatanani M, Evans RM, Moore DD. The constitutive androstane receptor and pregnane X receptor function coordinately to prevent bile acid-induced hepatotoxicity. J Biol Chem 2004 Nov 19;279(47):49517-49522. 297. Guo GL, Lambert G, Negishi M, Ward JM, Brewer HB, Jr., Kliewer SA, et al. Complementary roles of farnesoid X receptor, pregnane X receptor, and constitutive androstane receptor in protection against bile acid toxicity. J Biol Chem 2003 Nov 14;278(46):45062-45071. 298. Beilke LD, Aleksunes LM, Holland RD, Besselsen DG, Beger RD, Klaassen CD, et al. Constitutive androstane receptor-mediated changes in bile acid composition contributes to hepatoprotection from lithocholic acid-induced liver injury in mice. Drug Metab Dispos 2009 May;37(5):1035-1045. 299. Saini SP, Sonoda J, Xu L, Toma D, Uppal H, Mu Y, et al. A novel constitutive androstane receptor-mediated and CYP3A-independent pathway of bile acid detoxification. Mol Pharmacol 2004 Feb;65(2):292-300.

57 Chapter 1

300. Goodwin B, Hodgson E, D'Costa DJ, Robertson GR, Liddle C. Transcriptional regulation of the human CYP3A4 gene by the constitutive androstane receptor. Mol Pharmacol 2002 Aug;62(2):359-365. 301. Nitta M, Ku S, Brown C, Okamoto AY, Shan B. CPF: an orphan nuclear receptor that regulates liver-specific expression of the human cholesterol 7α-hydroxylase gene. Proc Natl Acad Sci U S A 1999 Jun 8;96(12):6660-6665. 302. Lu TT, Repa JJ, Mangelsdorf DJ. Orphan nuclear receptors as eLiXiRs and FiXeRs of sterol metabolism. J Biol Chem 2001 Oct 12;276(41):37735-37738. 303. Wang ZN, Bassett M, Rainey WE. Liver receptor homologue-1 is expressed in the adrenal and can regulate transcription of 11 beta-hydroxylase. J Mol Endocrinol 2001 Oct;27(2):255-258. 304. Ueda H, Sun GC, Murata T, Hirose S. A novel DNA-binding motif abuts the zinc finger domain of insect nuclear hormone receptor FTZ-F1 and mouse embryonal long terminal repeat-binding protein. Mol Cell Biol 1992 Dec;12(12):5667-5672. 305. Forman BM. Are those phospholipids in your pocket? Cell Metab 2005 Mar;1(3):153-155. 306. Sablin EP, Krylova IN, Fletterick RJ, Ingraham HA. Structural basis for ligand-independent activation of the orphan nuclear receptor LRH-1. Mol Cell 2003 Jun;11(6):1575-1585. 307. Lee YK, Parker KL, Choi HS, Moore DD. Activation of the promoter of the orphan receptor SHP by orphan receptors that bind DNA as monomers. J Biol Chem 1999 Jul 23;274(30):20869-20873. 308. Del Castillo-Olivares A, Gil G. Alpha 1-fetoprotein transcription factor is required for the expression of sterol 12α -hydroxylase, the specific enzyme for cholic acid synthesis. Potential role in the bile acid-mediated regulation of gene transcription. J Biol Chem 2000 Jun 9;275(23):17793-17799. 309. Chen F, Ma L, Dawson PA, Sinal CJ, Sehayek E, Gonzalez FJ, et al. Liver receptor homologue-1 mediates species- and cell line-specific bile acid-dependent negative feedback regulation of the apical sodium-dependent bile acid transporter. J Biol Chem 2003 May 30;278(22):19909-19916. 310. Inokuchi A, Hinoshita E, Iwamoto Y, Kohno K, Kuwano M, Uchiumi T. Enhanced expression of the human multidrug resistance protein 3 by bile salt in human enterocytes. A transcriptional control of a plausible bile acid transporter. J Biol Chem 2001 Dec 14;276(50):46822-46829. 311. Song X, Kaimal R, Yan B, Deng R. Liver receptor homolog 1 transcriptionally regulates human bile salt export pump expression. J Lipid Res 2008 May;49(5):973-984. 312. Frankenberg T, Rao A, Chen F, Haywood J, Shneider BL, Dawson PA. Regulation of the mouse organic solute transporter alpha-beta, Ostα-Ostβ, by bile acids. Am J Physiol Gastrointest Liver Physiol 2006 Ma- y;290(5):G912-G922. 313. Freeman LA, Kennedy A, Wu J, Bark S, Remaley AT, Santamarina-Fojo S, et al. The orphan nuclear receptor LRH-1 activates the ABCG5/ABCG8 intergenic promoter. J Lipid Res 2004 Jul;45(7):1197-1206. 314. Del Castillo-Olivares A, Gil G. Role of FXR and FTF in bile acid-mediated suppression of cholesterol 7α-hydroxylase transcription. Nucleic Acids Res 2000 Sep 15;28(18):3587-3593. 315. Matsukuma KE, Wang L, Bennett MK, Osborne TF. A key role for orphan nuclear receptor liver receptor homologue-1 in activation of fatty acid synthase promoter by liver X receptor. J Biol Chem 2007 Jul 13;282(28):20164-20171. 316. Lee YK, Schmidt DR, Cummins CL, Choi M, Peng L, Zhang Y, et al. Liver receptor homolog-1 regulates bile acid homeostasis but is not essential for feedback regulation of bile acid synthesis. Mol Endocrinol 2008 Jun;22(6):1345-1356. 317. Mataki C, Magnier BC, Houten SM, Annicotte JS, Argmann C, Thomas C,et al. Compromised intestinal lipid absorption in mice with a liver-specific deficiency of liver receptor homolog 1. Mol Cell Biol 2007 Dec;27(23):8330-8339. 318. Bohan A, Chen WS, Denson LA, Held MA, Boyer JL. Tumor necrosis factor alpha-dependent up-regulation of Lrh-1 and Mrp3(Abcc3) reduces liver injury in obstructive cholestasis. J Biol Chem 2003 Sep 19;278(38):36688-36698. 319. Chong HK, Biesinger J, Seo YK, Xie X, Osborne TF. Genome-wide analysis of hepatic LRH-1 reveals a promoter binding preference and suggests a role in regulating genes of lipid metabolism in concert with FXR. BMC Genomics 2012;13:51.

58 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

320. Yang Y, Zhang M, Eggertsen G, Chiang JY. On the mechanism of bile acid inhibition of rat sterol 12α-hydroxylase gene (CYP8B1) transcription: roles of alpha-fetoprotein transcription factor and hepatocyte nuclear factor 4α. Biochim Biophys Acta 2002 Jun 13;1583(1):63-73. 321. Miao J, Choi SE, Seok SM, Yang L, Zuercher WJ, Xu Y, et al. Ligand-dependent regulation of the activity of the orphan nuclear receptor, small heterodimer partner (SHP), in the repression of bile acid biosynthetic CYP7A1 and CYP8B1 genes. Mol Endocrinol 2011 Jul;25(7):1159-1169. 322. Lee HK, Lee YK, Park SH, Kim YS, Park SH, Lee JW, et al. Structure and expression of the orphan nuclear receptor SHP gene. J Biol Chem 1998 Jun 5;273(23):14398-14402. 323. Oropeza CE, Li L, McLachlan A. Differential inhibition of nuclear hormone receptor dependent hepatitis B virus replication by small heterodimer partner. J Virol 2008 Apr;82(8):3814-21. 324. He N, Park K, Zhang Y, Huang J, Lu S, Wang L. Epigenetic inhibition of nuclear receptor small heterodimer partner is associated with and regulates hepatocellular carcinoma growth. Gastroenterology 2008 Mar;134(3):793-802. 325. Volle DH, Duggavathi R, Magnier BC, Houten SM, Cummins CL, Lobaccaro JM, et al. The small heterodimer partner is a gonadal gatekeeper of sexual maturation in male mice. Genes Dev 2007 Feb 1;21(3):303- 315. 326. Nishigori H, Tomura H, Tonooka N, Kanamori M, Yamada S, Sho K, et al. Mutations in the small heterodimer partner gene are associated with mild obesity in Japanese subjects. Proc Natl Acad Sci U S A 2001 Jan 16;98(2):575-580. 327. Mitchell SM, Weedon MN, Owen KR, Shields B, Wilkins-Wall B, Walker M, et al. Genetic variation in the small heterodimer partner gene and young-onset type 2 diabetes, obesity, and birth weight in U.K. subjects. Diabetes 2003 May;52(5):1276-1279. 328. Goodwin B, Watson MA, Kim H, Miao J, Kemper JK, Kliewer SA. Differential regulation of rat and human CYP7A1 by the nuclear oxysterol receptor liver X receptor-alpha. Mol Endocrinol 2003 Mar;17(3):386- 394. 329. Seol W, Choi HS, Moore DD. An orphan nuclear hormone receptor that lacks a DNA binding domain and heterodimerizes with other receptors. Science 1996 May 31;272(5266):1336-1339. 330. Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA, Mangelsdorf DJ. LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes Dev 1995 May 1;9(9):1033-1045. 331. Apfel R, Benbrook D, Lernhardt E, Ortiz MA, Salbert G, Pfahl M. A novel orphan receptor specific for a subset of thyroid hormone-responsive elements and its interaction with the retinoid/thyroid hormone receptor subfamily. Mol Cell Biol 1994 Oct;14(10):7025-7035. 332. Song C, Kokontis JM, Hiipakka RA, Liao S. Ubiquitous receptor: a receptor that modulates gene activation by retinoic acid and thyroid hormone receptors. Proc Natl Acad Sci U S A 1994 Nov 8;91(23):10809-10813. 333. Forman BM, Ruan B, Chen J, Schroepfer GJ, Jr., Evans RM. The orphan nuclear receptor LXRα is positively and negatively regulated by distinct products of mevalonate metabolism. Proc Natl Acad Sci U S A 1997 Sep 30;94(20):10588-10593. 334. Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver BB, Su JL, et al. Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J Biol Chem 1997 Feb 7;272(6):3137- 3140. 335. Song C, Hiipakka RA, Liao S. Selective activation of liver X receptor alpha by 6α-hydroxy bile acids and analogs. Steroids 2000 Aug;65(8):423-427. 336. Janowski BA, Willy PJ, Devi TR, Falck JR, Mangelsdorf DJ. An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature 1996 Oct 24;383(6602):728-731. 337. Dahlman-Wright K, Zhao C. LXR in cholesterol metabolism. J Endocrinol 2010 Mar;204(3):233-40. 338. Ulven SM, Dalen KT, Gustafsson JA, Nebb HI. LXR is crucial in lipid metabolism. Prostaglandins Leukot Essent Fatty Acids 2005 Jul;73(1):59-63. 339. Peet DJ, Turley SD, Ma W, Janowski BA, Lobaccaro JM, Hammer RE, et al. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell 1998 May 29;93(5):693- 704.

59 Chapter 1

340. Edwards PA, Kast HR, Anisfeld AM. BAREing it all: the adoption of LXR and FXR and their roles in lipid homeostasis. J Lipid Res 2002 Jan;43(1):2-12. 341. Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ. Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J Biol Chem 2002 May 24;277(21):18793-18800. 342. Pare JF, Malenfant D, Courtemanche C, Jacob-Wagner M, Roy S, Allard D, et al. The fetoprotein transcription factor (FTF) gene is essential to embryogenesis and cholesterol homeostasis and is regulated by a DR4 element. J Biol Chem 2004 May 14;279(20):21206-21216. 343. Landrier JF, Grober J, Demydchuk J, Besnard P. FXRE can function as an LXRE in the promoter of human ileal bile acid-binding protein (I-BABP) gene. FEBS Lett 2003 Oct 23;553(3):299-303. 344. Okuwaki M, Takada T, Iwayanagi Y, Koh S, Kariya Y, Fujii H, et al. LXR alpha transactivates mouse organic solute transporter alpha and beta via IR-1 elements shared with FXR. Pharm Res 2007 Feb;24(2):390-398. 345. Wang J, Einarsson C, Murphy C, Parini P, Bjorkhem I, Gafvels M, et al. Studies on LXR- and FXR-mediated effects on cholesterol homeostasis in normal and cholic acid-depleted mice. J Lipid Res 2006 Feb;47(2):421-430. 346. Wang L, Lee YK, Bundman D, Han Y, Thevananther S, Kim CS, et al. Redundant pathways for negative feedback regulation of bile acid production. Dev Cell 2002 Jun;2(6):721-731. 347. Desvergne B. RXR: from partnership to leadership in metabolic regulations. Vitam Horm 2007;75:1-32. 348. Issemann I, Prince RA, Tugwood JD, Green S. The retinoid X receptor enhances the function of the peroxisome proliferator activated receptor. Biochimie 1993;75(3-4):251-256. 349. Kliewer SA, Umesono K, Noonan DJ, Heyman RA, Evans RM. Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors. Nature 1992 Aug 27;358(6389):771-774. 350. DiRenzo J, Soderstrom M, Kurokawa R, Ogliastro MH, Ricote M, Ingrey S, et al. Peroxisome proliferator-activated receptors and retinoic acid receptors differentially control the interactions of retinoid X receptor heterodimers with ligands, coactivators, and corepressors. Mol Cell Biol 1997 Apr;17(4):2166-2176. 351. Forman BM, Umesono K, Chen J, Evans RM. Unique response pathways are established by allosteric interactions among nuclear hormone receptors. Cell 1995 May 19;81(4):541-550. 352. Ferrara J, McCuaig K, Hendy GN, Uskokovic M, White JH. Highly potent transcriptional activation by 16-ene derivatives of 1,25-dihydroxyvitamin D3. Lack of modulation by 9-cis-retinoic acid of response to 1,25-dihydroxyvitamin D3 or its derivatives. J Biol Chem 1994 Jan 28;269(4):2971-2981. 353. MacDonald PN, Dowd DR, Nakajima S, Galligan MA, Reeder MC, Haussler CA, et al. Retinoid X receptors stimulate and 9-cis retinoic acid inhibits 1,25-dihydroxyvitamin D3-activated expression of the rat osteocalcin gene. Mol Cell Biol 1993 Sep;13(9):5907-5917. 354. Castillo AI, Sanchez-Martinez R, Moreno JL, Martinez-Iglesias OA, Palacios D, Aranda A. A permissive retinoid X receptor/thyroid hormone receptor heterodimer allows stimulation of prolactin gene transcription by thyroid hormone and 9-cis-retinoic acid. Mol Cell Biol 2004 Jan;24(2):502-513. 355. Tzameli I, Chua SS, Cheskis B, Moore DD. Complex effects of rexinoids on ligand dependent activation or inhibition of the xenobiotic receptor, CAR. Nucl Recept 2003 Jun 6;1(1):2. 356. Kassam A, Miao B, Young PR, Mukherjee R. Retinoid X receptor (RXR) agonist-induced antagonism of farnesoid X receptor (FXR) activity due to absence of coactivator recruitment and decreased DNA binding. J Biol Chem 2003 Mar 21;278(12):10028-10032. 357. Del Castillo-Olivares A, Gil G. Suppression of sterol 12α-hydroxylase transcription by the short heterodimer partner: insights into the repression mechanism. Nucleic Acids Res 2001 Oct 1;29(19):4035-4042. 358. Li H, Chen F, Shang Q, Pan L, Shneider BL, Chiang JY, et al. FXR-activating ligands inhibit rabbit ASBT expression via FXR-SHP-FTF cascade. Am J Physiol Gastrointest Liver Physiol 2005 Jan;288(1):G60-G66. 359. Lee YK, Moore DD. Dual mechanisms for repression of the monomeric orphan receptor liver receptor homologous protein-1 by the orphan small heterodimer partner. J Biol Chem 2002 Jan 25;277(4):2463-2467.

60 The Interrelationship Between Bile Acid and Vitamin A Homeostasis

360. Seol W, Chung M, Moore DD. Novel receptor interaction and repression domains in the orphan receptor SHP. Mol Cell Biol 1997 Dec;17(12):7126-7131. 361. Kerr TA, Saeki S, Schneider M, Schaefer K, Berdy S, Redder T, et al. Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis. Dev Cell 2002 Jun;2(6):713-720. 362. Wang L, Han Y, Kim CS, Lee YK, Moore DD. Resistance of SHP-null mice to bile acid-induced liver damage. J Biol Chem 2003 Nov 7;278(45):44475-44481. 363. Park YJ, Qatanani M, Chua SS, LaRey JL, Johnson SA, Watanabe M, et al. Loss of orphan receptor small heterodimer partner sensitizes mice to liver injury from obstructive cholestasis. Hepatology 2008 May;47(5):1578-1586. 364. Chiang JY, Kimmel R, Stroup D. Regulation of cholesterol 7α-hydroxylase gene (CYP7A1) transcription by the liver orphan receptor (LXRα). Gene 2001 Jan 10;262(1-2):257-265. 365. Agellon LB, Drover VA, Cheema SK, Gbaguidi GF, Walsh A. Dietary cholesterol fails to stimulate the human cholesterol 7α-hydroxylase gene (CYP7A1) in transgenic mice. J Biol Chem 2002 Jun 7;277(23):20131- 20134. 366. Karpen SJ, Sun AQ, Kudish B, Hagenbuch B, Meier PJ, Ananthanarayanan M, et al. Multiple factors regulate the rat liver basolateral sodium-dependent bile acid cotransporter gene promoter. J Biol Chem 1996 Jun 21;271(25):15211-15221. 367. Trauner M, Arrese M, Lee H, Boyer JL, Karpen SJ. Endotoxin downregulates rat hepatic ntcp gene expression via decreased activity of critical transcription factors. J Clin Invest 1998 May 15;101(10):2092-2100. 368. Jung D, Hagenbuch B, Fried M, Meier PJ, Kullak-Ublick GA. Role of liver-enriched transcription factors and nuclear receptors in regulating the human, mouse, and rat NTCP gene. Am J Physiol Gastrointest Liver Physiol 2004 May;286(5):G752-G761. 369. Jung D, Kullak-Ublick GA. Hepatocyte nuclear factor 1 alpha: a key mediator of the effect of bile acids on gene expression. Hepatology 2003 Mar;37(3):622-631. 370. Eloranta JJ, Jung D, Kullak-Ublick GA. The human Na+-taurocholate cotransporting polypeptide gene is activated by glucocorticoid receptor and peroxisome proliferator-activated receptor-gamma coactivator-1α, and suppressed by bile acids via a small heterodimer partner-dependent mechanism. Mol Endo- crinol 2006 Jan;20(1):65-79. 371. Jung D, Fantin AC, Scheurer U, Fried M, Kullak-Ublick GA. Human ileal bile acid transporter gene ASBT (SLC10A2) is transactivated by the glucocorticoid receptor. Gut 2004 Jan;53(1):78-84.

372. Del Castillo-Olivares A, Campos JA, Pandak WM, Gil G. The role of α1-fetoprotein transcription factor/ LRH-1 in bile acid biosynthesis: a known nuclear receptor activator that can act as a suppressor of bile acid biosynthesis. J Biol Chem 2004 Apr 16;279(16):16813-16821. 373. Gupta S, Stravitz RT, Dent P, Hylemon PB. Down-regulation of cholesterol 7α-hydroxylase (CYP7A1) gene expression by bile acids in primary rat hepatocytes is mediated by the c-Jun N-terminal kinase pathway. J Biol Chem 2001 May 11;276(19):15816-15822. 374. Jung D, Inagaki T, Gerard RD, Dawson PA, Kliewer SA, Mangelsdorf DJ, et al. FXR agonists and FGF15 reduce fecal bile acid excretion in a mouse model of bile acid malabsorption. J Lipid Res 2007 Dec;48(12):2693-2700. 375. Sinha J, Chen F, Miloh T, Burns RC, Yu Z, Shneider BL. β-Klotho and FGF-15/19 inhibit the apical sodium-dependent bile acid transporter in enterocytes and cholangiocytes. Am J Physiol Gastrointest Liver Physiol 2008 Sep 4. 376. Jiang W, Miyamoto T, Kakizawa T, Nishio SI, Oiwa A, Takeda T, et al. Inhibition of LXRα signaling by vitamin D receptor: possible role of VDR in bile acid synthesis. Biochem Biophys Res Commun 2006 Dec 8;351(1):176-184. 377. Chiang JY. Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms. J Hepatol 2004 Mar;40(3):539-551. 378. Davis RA, Miyake JH, Hui TY, Spann NJ. Regulation of cholesterol-7α-hydroxylase: BAREly missing a SHP. J Lipid Res 2002 Apr;43(4):533-543.

61 Chapter 1

379. Miyake JH, Wang SL, Davis RA. Bile acid induction of cytokine expression by macrophages correlates with repression of hepatic cholesterol 7α-hydroxylase. J Biol Chem 2000 Jul 21;275(29):21805-21808. 380. Triantis V, Saeland E, Bijl N, Oude-Elferink RP, Jansen PL. Glycosylation of fibroblast growth factor receptor 4 is a key regulator of fibroblast growth factor 19-mediated down-regulation of cytochrome P450 7A1. Hepatology 2010 Aug;52(2):656-666. 381. Tomiyama K, Maeda R, Urakawa I, Yamazaki Y, Tanaka T, Ito S, et al. Relevant use of Klotho in FGF19 subfamily signaling system in vivo. Proc Natl Acad Sci U S A 2010 Jan 26;107(4):1666-1671. 382. Stravitz RT, Rao YP, Vlahcevic ZR, Gurley EC, Jarvis WD, Hylemon PB. Hepatocellular protein kinase C activation by bile acids: implications for regulation of cholesterol 7 alpha-hydroxylase. Am J Physiol 1996 Aug;271(2 Pt 1):G293-G303. 383. Li T, Jahan A, Chiang JY. Bile acids and cytokines inhibit the human cholesterol 7 alpha-hydroxylase gene via the JNK/c-jun pathway in human liver cells. Hepatology 2006 Jun;43(6):1202-1210. 384. Gineste R, Sirvent A, Paumelle R, Helleboid S, Aquilina A, Darteil R, et al. Phosphorylation of farnesoid X receptor by protein kinase C promotes its transcriptional activity. Mol Endocrinol 2008 Nov;22(11):2433- 2447.

62 Chapter 2

Low Retinol Levels Differentially Modulate Bile Salt–Induced Expression of Human and Mouse Hepatic Bile Salt Transporters

Martijn O. Hoeke*1, Jacqueline R.M. Plass*1, Janette Heegsma1, Mariska Geuken1, Duncan van Rijsbergen1, Julius F.W. Baller2, Folkert Kuipers2, Han Moshage1, Peter L.M. Jansen3, and Klaas Nico Faber1

*These authors contributed equally to this work. From the 1Department of Gastroenterology and Hepatology and the 2Department of Pediatrics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands and the 3Department of Gastroenterology and Hepatology, Academic Medical Center, Amsterdam,The Netherlands

Hepatology. 2009 Jan;49 :151-159 Chapter 2

Abstract

The farnesoid X receptor/retinoid X receptor-alpha (FXR/RXRα) complex regulates bile salt homeostasis, in part by modulating transcription of the bile salt export pump (BSEP/ABCB11) and small heterodimer partner (SHP/NR0B2). FXR is activated by bile salts, RXRα by the vitamin A derivative 9-cis retinoic acid (9cRA). Cholestasis is associated with vitamin A malabsorption. Therefore, we evaluated the role of vitamin A/9cRA in the expression of human and mouse bile salt export pump (hBSEP/mBsep), small heterodimer partner (hSHP/mShp), and mouse sodium-dependent taurocholate co-transporting polypeptide (mNtcp). HBSEP and hSHP transcription were analyzed in FXR/RXRα-transfected HepG2 cells exposed to chenodeoxycholic acid (CDCA) and/or 9cRA. BSEP promoter activity was determined by luciferase reporter assays, DNA-binding of FXR and RXRα by pull-down assays. Serum bile salt levels and hepatic expression of Bsep/ BSEP, Shp, and Ntcp were determined in vitamin A–deficient (VAD)/cholic acid (CA)-fed C57BL/6J mice. Results indicated that 9cRA strongly repressed the CD- CA-induced BSEP transcription in HepG2 cells, whereas it super-induced SHP transcription; 9cRA reduced DNA-binding of FXR and RXRα. The 9cRA repressed the CDCA-induced BSEP promoter activity irrespective of the exact sequence of the FXR-binding site. In vivo, highest Bsep messenger RNA (mRNA), and protein expression was observed in CA-fed VAD mice. Shp transcription was highest in CA-fed vitamin A–sufficient mice.Ntcp protein expression was strongly reduced in CA-fed VAD mice, whereas mRNA levels were normal. CA-fed control and VAD mice had similarly increased serum bile salt levels. Conclusion: We showed that 9cRA has opposite effects on bile salt–activated transcription of FXR/RXRα target genes. Vitamin A deficiency in CA-fed mice leads to high BSEP expression. Clearance of serum bile salts may, however, be limited because of post-transcriptional reduction of NTCP. The molecular effects of vitamin A supplementation during cholestasis need further analysis to predict a therapeutic effect.

Introduction

Vitamin A and its metabolites retinaldehyde and retinoic acids fulfill important physiological functions at all stages of life, such as during embryogenesis, growth, and differentiation of tissues and reproduction (1,2). Mammals cannot synthesize vitamin A, and therefore it must be obtained from carotenoids and retinyl esters present in the diet. The liver is the main storage site of vitamin A in mammals. Approxi- mately 80% of the whole body content of retinols resides as retinyl palmitate in lipid droplets in the cytoplasm of hepatic stellate cells (3). Retinyl palmitate is the precurs- or for biologically active compounds such as retinoic acid, all-trans retinoic acid, and 9-cis retinoic acid (9cRA). Vitamin A is a fat-soluble vitamin, and efficient absorption in the intestine is dependent on the presence of micellar bile salts. Bile salts are synthesized in the liver

64 Low Retinol Levels Differentially Modulate Hepatic Bile Salt Transporters and efficiently maintained in an enterohepatic circulation because of the action of membrane-embedded bile salt transporter proteins in hepatocytes and enterocytes (4). Bile salt biosynthesis and transport are tightly controlled processes in which the bile salt–activated nuclear receptor farnesoid X receptor (FXR/NR1H4 [nuclear receptor subfamiliy 1, group H, member 4]) plays a key role (5). FXR acts as a heterodimer with the retinoic X receptor-alpha (RXRα/NR2B1 [nuclear receptor subfamily 2, group B, member 1]), the ligand of which is 9cRA. FXR/RXRα binds to a specific DNA-sequence, the FXR response element (FXRE), which is most commonly an inverted repeat with 1 nucleotide spacing (IR-1) (6). Key targets that are positively regulated by FXR/RXRα in the liver are the genes encoding the bile salt export pump (BSEP/ABCB11 [ATP-binding cassette, sub-family B, member 11]) (7, 8) and the orphan nuclear receptor small heterodimer partner (SHP/NR0B2 [nuclear receptor subfamily 0, group B, member 2]) (9, 10). BSEP transports bile salts from the liver to the bile. SHP represses expression of the basolateral sodium-dependent taurocholate co-transporting polypeptide (NTCP/SLC10A1) in conjunction with other mechanisms that repress expression of this transporter (11, 12). In addition, SHP also represses expression of cholesterol 7-hydroxylase (CYP7A1) (9, 10), the rate-limiting enzyme in bile salt biosynthesis. Cholestatic liver disease is associated with malabsorption of fat-soluble vitamins, including vitamin A, caused by low intestinal bile salt concentrations (13-15). Mo- reover, in these disorders hepatic stellate cells become activated, transdifferentiate into (myo)fibroblasts, and lose their retinoid content (3). So far, most studies repor- ting on FXR/RXRα-dependent regulation of target genes have been focused on the ligands for FXR, either natural or synthetic. The role of 9cRA-activated RXR has not been studied in detail. One study reported that ligand-activation of RXR inhibits the FXR-induced transcription of human BSEP (16). However, the combined action of the natural ligands for FXR and RXRα on transcriptional regulation of BSEP has not been reported. The aim of this study was to determine the interaction of chenodeoxycholic acid (CDCA) and 9cRA on FXR/RXRα-regulated transcription of human BSEP and SHP. In addition, we analyzed the in vivo effects of vitamin A deficiency in mice fed a cholic acid–supplemented diet.

Material and methods

Animals Pregnant (2 weeks post coitum) C57BL/6J mice were obtained from Harlan (Horst, The Netherlands) and were housed in a temperature-controlled environment with alternating 12-hour light and dark cycles. Food and water were available ad libitum.

Experimental Design Male mice (offspring) were made vitamin A deﬁcient essentially as described (17). Brieﬂy: Dams (+ offspring) were divided into two groups; one placed for 13 weeks on

65 Chapter 2 a vitamin A–deficient diet (VAD; no. 4148.10, Hope Farms, Woerden, The Nether- lands) and the other on a control diet (ref. no. 4068.02, Hope Farms), containing 18,000 international units vitamin A/kg. Subsequently, both groups were divided into two subgroups, one continued on the original diet (VAD; n = 6 or control diet; n = 6), and the other continued on the original diet supplemented with 0.5% (wt/wt) cholic acid (VAD+CA; n = 7 or control diet + CA; n = 7). One week later, the mice were sacrificed. The livers were removed and processed for (1) plasma membrane isolation, (2) RNA isolation, and (3) immunofluorescent microscopy. The experimental protocol was approved by the Ethical Committee on Animal Testing of the University of Groningen.

Cell Culture and Transfection The human hepatoma cell line HepG2.rNtcp (18) and derivatives were cultured as described earlier, (8) with the exception that lipid-stripped serum (Biosera, East Sussex, UK) was used instead of normal serum. HepG2.rNtcp cells were transiently transfected with (combinations of) plasmids as described previously. (8) Twenty-four hours after transfection, medium was refreshed and supplemented with 100 µmol/L CDCA and/or 9cRA in various concentrations, as described in the text. Cells were harvested after 24 hours for determination of luciferase activity and total RNA isolation.

Cell Viability Assay HepG2.rNtcp cells were exposed to various concentrations of CDCA (0-500µmol/L) with or without 1 µmol/L 9cRA for 24 hours. The cell viability was determined by measuring adenosine triphosphate levels with the Cell Titer Glow assay (Promega, Madison, WI).

Plasmids The plasmids pSG5-hRXRα (overexpression of RXRα), pGL3-1649 (previously named GL3- 1779 = luciferase reporter vector containing the -1649 to +25 bp BSEP/ ABCB11 promoter fragment) pCMV5 and pGEM-5 (control and carrier plasmids) have been described previously. (8) Six nucleotide changes were introduced in the FXRE of pGL3-1649 by site-directed mutagenesis (see Supporting Table 2.S1 for primers used), yielding pBSEP-FXRESHP, containing the FXRE sequence of human SHP (Fig. 2B). Modiﬁed sequences were conﬁrmed by sequence analysis. The human FXR expression plasmid (19) was provided by Prof. B. Staels, Lille, France.

RNA Isolation and Quantitative Polymerase Chain Reaction Total RNA isolation and quantitative real-time detection reverse transcription polymerase chain reaction (RT-qPCR) analysis of BSEP/Bsep, SHP/Shp, Ntcp, and Rxrα messenger RNA (mRNA) levels were described before (8, 20). Details about primer and probe sequences are shown in Supporting Table 2.S2.

66 Low Retinol Levels Differentially Modulate Hepatic Bile Salt Transporters

Biochemical and Analytical Procedures Liver retinol concentrations (21) and total serum bile salt concentrations (22) were determined as described. The BSEP promoter activity was measured using the luciferase reporter assay kit (8) according to the supplier’s protocol (Promega, Madison, WI). Nuclei were isolated from FXR/RXRα-transfected HepG2.Ntcp cells according to Shoemaker et al. (23) and analyzed by western blotting (24) for RXRα and P84 (nuclear marker). Total plasma membranes were isolated from three or four pooled mouse livers using sucrose-gradient ultracentrifugation as described (25). Equal protein fractions of liver plasma membrane proteins were analyzed by western blot analysis for BSEP, NTCP, and Na+K+-adenosine triphosphatase (ATPase) (loading control). Antibodies used in this study: anti-Na+K+-ATPase (gift from Dr. W. Peters, Radboud University Medical Center, Nijmegen, The Netherlands), anti-FXR (PP- A9033A-00; Perseus, Japan); anti- RXRα (D-20; sc-553; Santa Cruz Biotechnology, Santa Cruz, USA); anti-BSEP (K12; (25)) and anti-P84 (ab487; Abcam, Cambridge, UK). Protein concentrations were determined using the Bio-Rad Protein Assay system (Bio-Rad GmbH, Munich, Germany) using bovine serum albumin as a standard.

FXR/RXRα Pull-Down Assay A biotin-labeled, FXRE-containing DNA probe and streptavidin-coated beads were used to precipitate FXR/RXRα as described (26), with the following modiﬁcations: Two 53-bp oligo’s (Supporting Table 2.S1) were annealed, creating a double-stranded, biotin-labeled 53-bp DNA fragment from the BSEP promoter containing the FXRE. The biotin-labeled probe was coupled to streptavidin-coated beads. A cleared protein lysate was prepared of HepG2.rNtcp cells. FXRE beads were incubated for 4 hours with soluble HepG2.rNtcp proteins (equivalent of 2 × 106 cells) in the presence or absence of CDCA (100 µmol/L) and/or 9cRA (1 µmol/L). FXRE beads with bound proteins were washed three times with ice-cold phosphate-buffered saline containing 1 mmol/L ethylenediaminetetra-acetic acid, and 1 mmol/L dithiothreitol. Precipitated proteins were solubilized in sodium dodecyl sulfate polyacrylamide gel electrophoresis sample buffer and subjected to western blotting for the detection of FXR and RXRα.

Confocal Laser Scanning Microscopy For microscopical analyses, 4-µm sections were cut from frozen mouse liver tissue. After drying, the liver sections were ﬁxed in acetone and stained for BSEP expression using K12, with the corresponding secondary antibody Alexa ﬂuor 488 (Alexis Bio- chemicals, Lausen, Switzerland). Images were taken with a confocal scanning laser microscope (TCS 4D; Leica, Heidelberg, Germany) equipped with an argon/krypton laser and coupled to a Leitz DM IRB (Leica, Heidelberg, Germany) inverted microscope.

Statistical Analysis Data are presented as mean ± standard deviation (SD). Differences between the

67 Chapter 2 in vitro quantitative polymerase chain reaction groups or animal groups were determined in SPSS by Kruskal-Wallis followed by pairwise comparison of groups by Mann-Whitney U with p < 0.05.

Results

9-cis Retinoic Acid Differentially Modulates CDCA-Induced Transcription of Human BSEP and SHP The mRNA levels of human BSEP and SHP were analyzed in FXR/RXRα-transfected HepG2.rNtcp cells cultured in the presence or absence of CDCA (100 μmol/L) and/ or 9cRA. CDCA alone resulted in a significant (4.9-fold) increase inBSEP mRNA levels (Figure 2.1A). The CDCA-induced BSEP transcription was, however, strongly attenuated when also 1 μmol/L 9cRA was added to the culture medium (58% compared with CDCA-treated cells). This inhibitory effect was dose-dependent, and 9cRA did not increase BSEP transcription above the CDCA-induced level at any 9cRA concentration tested (down to 1 pmol/L; data not shown). In contrast, transcription of SHP was maximally induced in the presence of both ligands (Figure 2.1B). A similar ligand-dependent expression profile was detected in untransfected HepG2.rNtcp cells, and maximal effects were detected with 100 μM CDCA, although the same pattern of regulation was observed at lower concentrations of CDCA (Supporting Figure 2.S1).The nuclear RXRα protein levels appeared slightly but significantly -de creased after 9cRA treatment Figure( 2.1C), as reported by others (27). However, 9cRA did not significantly decrease nuclear RXRα levels in CDCA-treated HepG2. rNtcp cells. HepG2.rNtcp cells showed normal viability under our experimental conditions (Figure 2.1D). A reduction in cell viability was only detected at concentrations above 100 mol/L CDCA. Therefore, our data show that, in addition to synthetic ligands (16), natural ligands of RXRα repress FXR/CDCA-induced transcription of BSEP. Moreover, SHP transcription is regulated in an opposite fashion under identical experimental conditions.

Table 2.1. Effect of VAD and the CA-diet on General Animal Characteristics Control Control + CA VAD VAD + CA n = 6 n = 7 n = 6 n = 7 Body weight (g) 26.9 ± 1.1 25.8 ± 1.6 22.9 ± 2.8* 24.6 ± 3.6† Liver weight (g) 1.0 ± 0.2 1.2 ± 0.1 1.0 ± 0.2 1.0 ± 0.2 Liver to body ratio (%) 3.7 ± 0.6 4.5 ± 0.3 4.4 ± 0.5 4.2 ± 0.8 Liver retinol (µmol/g) 93.6 ± 33.8 135.9 ± 34.2 n.d. n.d.

Data are presented as mean ± SD. *Significantly different from control group. †Significantly different from VAD group.

68 Low Retinol Levels Differentially Modulate Hepatic Bile Salt Transporters

Figure 2.1. Opposite effect of 9cRA on FXR/RXR/CDCA-induced expression of human BSEP and SHP (A,B) FXR/RXRα-transfected HepG2.rNtcp cells were exposed to combinations of vehicle, 100 μmol/L CDCA, and 1 μmol/L 9cRA. BSEP (A) and SHP (B) mRNA levels were determined by quantitative RT-PCR and normalized to 18S (n = 5). CDCA-treated condition was set to 100%. (asignificantly different from transfected -/-; bsignificantly different from transfected -/9cRA; csignificantly different from transfected CDCA/-; dsignificantly different from transfected CDCA/9cRA) (C) FXR/RXRα-transfected HepG2.rNtcp cells were exposed to 0 or 100 μmol/L CDCA with or without 1 μmol/L 9cRA followed by isolation of nuclei. RXRα and P84 (nuclear marker) were detected by western blotting, and the RXRα signals from four independent experiments were quantified relative to P84. (D) HepG2 cell viability after 24 hours’ exposure to increasing concentrations of CDCA in the absence or presence of 1 μmol 9cRA. Reduced cellular adenosine triphosphate levels were only observed in HepG2 cells exposed to CDCA concentrations above 100 μmol. Data are presented as mean ± SD. *P < 0.05.

69 Chapter 2

Figure 2.2. 9cRA inhibits CDCA-induced BSEP promoter activity, independent of the specific IR-1 sequence (A) HepG2.rNtcp cells were transfected with pGL3-1649 and hRXRα and/or hFXR expression plasmids as indicated. Twenty-four hours after treatment with 100 μmol/L CDCA and various concentrations of 9cRA (μmol/L), cellular luciferase activities were determined. Values are presented as mean ± SD of n = 3. (B) The FXRE in the BSEP promoter was replaced by the FXRE from the SHP promoter. Nucleotide variations compared with the consensus IR-1 are shown in bold; mutations in the BSEP FXRE are underlined. (C) The pBSEP-WT (pGL3-1649) and pBSEP-FXRESHP were co-transfected with hFXR and hRXR into HepG2.rNtcp cells. Twenty-four hours after treatment with combinations of vehicle, 100 μmol/L CDCA, and 1 μmol/L 9cRA, cells were harvested and luciferase activities were determined. Values are presented as mean ± SD; n = 3. 9cRA Reduces the CDCA-Induced BSEP Promoter Activity by Inhibiting Bin- ding of FXR/RXRα to the FXRE To assess whether 9cRA acts directly on FXR/RXRα-regulated BSEP transcription, we performed BSEP promoter activity studies. HepG2.rNtcp cells were transfected with hFXR and hRXRα expression plasmids and pGL3-1649 containing the BSEP promoter sequence with an FXRE present at position 63 to 51. CDCA (100 μmol/L) induced BSEP promoter activity 11-fold in these cells. 9cRA reduced the CDCA-induced luciferase activity in a dose-dependent manner (63% at 1 μmol/L 9cRA; Fi- gure 2.2A), similar to the effect of 9cRA on the endogenous BSEP mRNA levels. To establish the molecular mechanism involved, we performed FXR/RXRα pulldown assays using a biotin-labeled 53-bp DNA fragment from the human BSEP promoter containing the FXRE (Figure 2.3). CDCA and/or 9cRA were added to protein extracts of HepG2.rNtcp cells, followed by precipitation by the biotin-labeled FXRE beads and western blot analysis for FXR and RXRα. CDCA clearly induced binding of both FXR and RXRα to the FXRE beads, whereas 9cRA strongly reduced binding of RXRα (80%) and FXR (30% to 40%). Similar results were obtained by electrophoretic mobility shift assays Supporting( Figure 2.S2).These results are in line with earlier observations that 9cRA inhibits binding of in vitro translated FXR/RXRα to the BSEP-FXRE after co-stimulation with the synthetic FXR ligand GW4064 (16). We next evaluated whether the opposite effect of 9cRA on FXR/CDCAinduced expression of BSEP and SHP is attributable to the specific nu-

70 Low Retinol Levels Differentially Modulate Hepatic Bile Salt Transporters cleotide sequence of the FXREs in the promoter elements of the corresponding genes. The FXRE in theBSEP promoter was changed to the one present in the SHP promoter (Figure 2.2B; pBSEP-FXRESHP contains six mismatches compared with the BSEP promoter). As shown in Figure 2.2C, 9cRA also reduced the CDCA-induced activity of the pBSEP-FXRESHP mutant promoter, similar to the wild-type BSEP promoter.

Figure 2.3. RXRα acts as a nonpermissive partner of FXR at the BSEP FXRE A 53-bp biotinylated DNA probe containing the BSEP FXRE was incubated in vitro with a total protein extract of HepG2.rNtcp cells in the presence or absence of 9cRA and/or CDCA. Streptavidin-coated agarose beads were used to precipitate the DNA probe with associated proteins. Antibodies against FXR and RXRα were used in western blot analysis, and the signals were quantified as a measure for ligand-dependent binding/release to the BSEP FXRE. CDCA induced binding of FXR and RXRα to the FXRE (both set at 100%), and 9cRA reduced binding of both nuclear receptors under basal and CDCA-induced conditions.

Vitamin A Deficiency Increases Cholic Acid–Induced Bsep Expression in Mouse Liver. Next, we analyzed whether vitamin A plays a role in regulation of hepatic Bsep and Shp expression in mice. From our in vitro data, we hypothesized that Bsep expression is high when vitamin A levels are low. Therefore, we generated vitamin A–deficient (VAD) mice and fed them a cholic acid (CA)–supplemented diet. Retinol levels were undetectable in the livers of VAD mice, whereas these were readily detectable in mice on control diets (Table 2.1). CA treatment itself did not significantly affect hepatic vitamin A levels. CA feeding of VAD mice resulted in a strong induction of hepatic Bsep mRNA levels (3.2-fold increased compared with control; p = 0.002), whereas only a 1.7-fold increase was observed in mice on control diets (p = 0.001; Figure 2.4A). Importantly, Bsep mRNA levels were similar in VAD and control mice that did not receive CA. In contrast, Shp mRNA levels were highest in CA-fed ontrol mice (2.2-fold increase compared with control without CA feeding; p = 0.022) (Figure 2.4B). CA feeding of mice has been reported to lead to FXR-dependent downregula- tion of Ntcp (28). Indeed, we found that the Ntcp mRNA levels were strongly reduced in CA-fed control mice (67%, p = 0.022 versus control) (Figure 2.4C). Remarkably, CA feeding had no effect on Ntcp mRNA levels in VAD mice, which were comparable to control mice. Rxrα gene transcription was similar in all four groups. Only a slight and significant increase ofRxrα mRNA level was detected in the VAD+CA group (1.5-fold increase compared with control, p = 0.009, Figure 2.4D). Bsep protein levels in purified liver plasma membranes were comparable in control and VAD mice Fi( - gure 2.5A). CA feeding of control mice did not lead to a significant increase inBsep

71 Chapter 2 protein levels. In contrast, Bsep protein levels were markedly increased (2.5-fold) in VAD+CA mice. Immunofluorescent microscopical analyses of liver sections showed a normal canalicular staining for BSEP for mice from all four groups, indicating that neither the VAD diet nor CA feeding gave rise to abnormal BSEP sorting in hepatocytes (Figure 2.5B-E).

Figure 2.4. Effect of CA feeding on hepatic mRNA levels of selected genes in control and VAD mice Total RNA was isolated from livers of mice either fed the control diet (black bars) or VAD diet (white bars), with (+) or without (-) CA supplementation. Relative Bsep (A), Shp (B), Ntcp (C), and Rxrα (D) mRNA levels were analyzed by quantitative RT-PCR and normalized to 18S. Data are presented as mean ± SD of individual mice per group. (aSignificantly different from control group;b significantly different from control+CA group; csignificantly different from VAD group;d significantly different from VAD+ CA group)

Bile Salt Clearance Is Not Increased in CA-fed VAD Mice To determine the consequences of the altered bile salt transporter expression in VAD mice, we analyzed the serum bile salt concentration in the four animal groups (Fi- gure 2.6). As expected, the serum bile salt concentration was increased in CA-fed control mice compared with the control animals (29.5 ± 4.4 μmol/L versus 55.8 ± 17.7 μmol/L, p = 0.006). A VAD diet per se did not lead to elevated serum bile salt levels. However, levels in CA-fed VAD mice were significantly increased compared

72 Low Retinol Levels Differentially Modulate Hepatic Bile Salt Transporters with those in VAD mice (30.2 ± 8.5 versus 107.7 ± 93.1, p = 0.002). No significant difference was observed between the CA-fed control and VAD groups. To find an explanation for the elevated serum bile salt levels in the CA-fed VAD mice, we determined the protein levels of NTCP in total hepatic membranes. In sharp contrast to what was expected from the mRNA levels (Figure 2.4C), Ntcp protein levels were strongly reduced (77%) in the CA-fed VAD mice (Figure 2.7). This may strongly limit the hepatic bile salt uptake from the serum.

Figure 2.5. Bsep protein expression is increased by CA feeding in VAD mice, but not in control mice (A) Total plasma membranes were isolated from three or four pooled livers from control or VAD mice receiving a diet supplemented with (+) or without (-) CA. Equal amounts of two independent membrane isolations were analyzed by western blotting for BSEP and Na+K+-ATPase protein expression. Western blot signals were scanned and quantified by Quantity One software. BSEP levels are expressed relative to the Na+K+-ATPase . BSEP levels of control mice were set to 1. Values are presented as mean ± SD. (B-E) Liver sections from control mice (B), CA-fed control mice (C), VAD mice (D), and CA-fed VAD mice (E) were stained for BSEP, and its subcellular location was determined by confocal laser scanning microscopy.

73 Chapter 2

Discussion

In this study, we show that vitamin A and its derivative 9cRA exert both transcriptional and post-transcriptional effects on the expression of hepatic proteins involved in bile salt homeostasis. Because cholestatic liver disease is associated with vitamin A deficiency (13-15), it is crucial to understand the molecular mechanisms involved. This may lead to novel treatment strategies aimed at optimizing transporter function in the liver. The FXR/RXRα heterodimer is the key transcriptional factor that controls bile salt homeostasis. Activation of FXR/RXRα by bile salts is well documented. The role of ligand-activated RXRα in regulation of FXR/RXRα target genes has not been syste- matically studied. RXRα is a dimerization partner for many nuclear receptors. Ligand (9cRA)-activated RXRα is called a permissive partner when it super-induces expression of target genes in combination with another ligand-activated nuclear receptor. It also may be inert or even repress expression of such genes and is then called a nonpermissive partner. As a nonpermissive partner for the vitamin D receptor (VDR), it has been shown that 9cRA destabilizes the DNA-bound RXRα/VDR heterodimer (29) Previously, RXRα has been shown to act as a permissive partner for FXR in the regulation of IBABP and PLTP (30, 31). Our study shows that 9cRA represses FXR/ RXRα/bile salt–induced expression of BSEP. Conversely, it super-induces bile salt– induced transcription of human SHP in vitro and mouse Shp in vivo. 9cRA inhibits CDCA-induced transcription of BSEP also when its FXRE is mutated to the FXRE found in the SHP promoter. Our FXR/RXRα pull-down assay with the biotin-labeled FXRE DNA element together with electrophoretic mobility shift assays performed by us and others (16) show that 9cRA inhibits binding of the FXR/RXRα heterodimer to its IR-1 target sequence in the BSEP promoter. This suggest that at the IR-1 site, RXRα acts as a nonpermissive partner for FXR and that in case of co-stimulation by liganded FXR and RXRα additional binding sites or cofactors are involved. It is important to note that in the presence of 9cRA, CDCA does induce FXR/ RXRα-dependent expression of human BSEP. Under these conditions, the promoter activity was induced 4.1-fold. Similar findings have been reported by others as well (7).

Figure 2.6. Plasma bile salt levels in control and VAD mice, with or without CA feeding Bile salt concentrations were determined in control mice (black bars) and VAD mice (white bars), with (+) or without (-) CA in their diet. Data are presented as mean ± SD of individual mice per group. (aSignificantly different from control group; bsignificantly different from control+CA group; csignificantly different from VAD group; dsignificantly different from VAD+CA group)

74 Low Retinol Levels Differentially Modulate Hepatic Bile Salt Transporters

Figure 2.7. Ntcp protein levels are strongly reduced in CA-fed VAD mice Total plasma membranes were isolated from three or four pooled livers from control or VAD mice receiving a diet supplemented with (+) or without (-) CA. Equal amounts of two independent membrane isolations were analyzed by western blotting for NTCP and Na+K+-ATPase protein expression. Western blot signals were scanned and quantified by Quantity One software. NTCP levels are expressed relative to the Na+K+-ATPase. NTCP levels of control mice were set to 1. Values are presented as mean ± SD.

However, the induction was found to be much more pronounced in the absence of 9cRA, where the promoter activity was induced 11-fold. A crucial factor to detect this difference is the use of lipid-stripped serum in the in vitro experiments. Normal serum appears to contain sufficient retinols to repress the CDCA-dependent induction. From our in vitro data, we hypothesized that the physiological levels of vitamin A may actually limit bile salt–induced expression of Bsep in mice with a normal vitamin A status. In line with this, Wolters et al. (32) reported only minor effects onBsep expression after taurocholic acid feeding of wild-type mice. Therefore, we generated vitamin A–deficient mice that were subsequently fed a CA-supplemented diet. In- deed, vitamin A deficiency strongly increased CA-inducedBsep mRNA and protein expression in mice. In line with the in vitro data, Shp transcription was highest in the control mice fed CA. Transcriptional down-regulation of Ntcp during cholestatic conditions in rodents is routinely observed (28, 33-35). Remarkably, Ntcp mRNA levels were not reduced by CA feeding of VAD mice. These data suggest that the livers of VAD+CA mice have an increased capacity to transport bile salts from the serum to the bile. It was therefore surprising to find that the serum bile salt concentrations were higher in these mice. The only explanation we can offer at this moment is that VAD mice contain significantly reduced Ntcp protein levels. Apparently, the combination of VAD and cholestasis induces a posttranscriptional reduction of the Ntcp protein level. Reduced NTCP protein levels with sustained mRNA levels have also been described in patients with progressive familial intrahepatic cholestasis (36). This may be a consequence of reduced retinoid levels or signaling causing a posttranscriptional reduction of NTCP. Selective protein synthesis and/or turnover have not yet been studied under vitamin A-deficient conditions, so we cannot speculate on the mechanisms that may cause this phenomenon. Liver disease, in particular chronic cholestatic liver disease, is associated with vitamin A deficiency (13-15). However, vitamin A supplementation in liver disease is controversial (37). The complex regulation of hepatic bile salt transporters as described in this study may be the first step to elucidate this phenomenon. In chronic cholestatic liver disease, the increased intrahepatocellular bile salt concentration, in combination with a decreased vitamin A concentration, presents the optimal condition for

75 Chapter 2

BSEP induction. At the same time, NTCP expression is reduced by a post-transcriptional mechanism. This may be viewed as a cytoprotective adaptation of the hepatocyte, leading to decreased bile salt uptake and increased bile salt secretion capacity. In these patients, supplementation with vitamin A may even aggravate liver damage because it would reduce BSEP and increase NTCP levels. However, in case of extrahepatic bile duct obstruction, persistent or elevated BSEP activity may contribute to increased intraluminal pressure in the intrahepatic cholangioles. This may result in bile infarcts and cause considerable damage to the liver parenchyma (38). Urso- deoxycholic acid therapy may be harmful for these patients, because it further increases biliary pressure. Reducing BSEP expression through vitamin A supplementation may decrease liver damage in this case. Support for this hypothesis was provided by De Freitas et al. (39), who showed that vitamin A supplementation in combination with biliary obstruction results in a significant reduction of liver fibrosis in rats. In conclusion, we show that vitamin A plays an important but complex role in bile salt homeostasis. A detailed analysis of the transcriptional and posttranslational mechanisms involved may help to better predict the therapeutic effect of vitamin A supplementation in patients with chronic liver disease.

Acknowledgment

The authors thank Dr. W. Peters, University Medical Centre, Nijmegen, The Nether- lands for providing antibodies against the Na+K+-ATPase, Prof. B. Steals, Lille, France for providing the human FXR-expression plasmid and E.E.A. Venekamp-Hoolsema for technical assistance in the retinol measurements.

76 Low Retinol Levels Differentially Modulate Hepatic Bile Salt Transporters

References 1. Clagett-Dame M, DeLuca HF. The role of vitamin A in mammalian reproduction and embryonic development. Annu Rev Nutr 2002;22:347-381. 2. Reichrath J, Lehmann B, Carlberg C, Varani J, Zouboulis CC. Vitamins as hormones. Horm Metab Res 2007 Feb;39(2):71-84. 3. Senoo H. Structure and function of hepatic stellate cells. Med Electron Microsc 2004 Mar;37(1):3-15. 4. Alrefai WA, Gill RK. Bile acid transporters: structure, function, regulation and pathophysiological implications. Pharm Res 2007 Oct;24(10):1803-1823. 5. Lee FY, Lee H, Hubbert ML, Edwards PA, Zhang Y. FXR, a multipurpose nuclear receptor. Trends Biochem Sci 2006 Oct;31(10):572-580. 6. Laffitte BA, Kast HR, Nguyen CM, Zavacki AM, Moore DD, Edwards PA. Identification of the DNA -bin ding specificity and potential target genes for the farnesoid X-activated receptor. J Biol Chem 2000 Apr 7;275(14):10638-10647. 7. Ananthanarayanan M, Balasubramanian N, Makishima M, Mangelsdorf DJ, Suchy FJ. Human bile salt export pump promoter is transactivated by the farnesoid X receptor/bile acid receptor. J Biol Chem 2001 Aug 3;276(31):28857-28865. 8. Plass JR, Mol O, Heegsma J, Geuken M, Faber KN, Jansen PL, et al. Farnesoid X receptor and bile salts are involved in transcriptional regulation of the gene encoding the human bile salt export pump. Hepatology 2002 Mar;35(3):589-596. 9. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, et al. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000 Sep;6(3):517-526. 10. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, et al. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 2000 Sep;6(3):507-515. 11. Denson LA, Sturm E, Echevarria W, Zimmerman TL, Makishima M, Mangelsdorf DJ, et al. The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. Gastroen- terology 2001 Jul;121(1):140-147. 12. Wang L, Lee YK, Bundman D, Han Y, Thevananther S, Kim CS, et al. Redundant pathways for negative feedback regulation of bile acid production. Dev Cell 2002 Jun;2(6):721-731. 13. Floreani A, Baragiotta A, Martines D, Naccarato R, D'odorico A. Plasma antioxidant levels in chronic cholestatic liver diseases. Aliment Pharmacol Ther 2000 Mar;14(3):353-358. 14. Phillips JR, Angulo P, Petterson T, Lindor KD. Fat-soluble vitamin levels in patients with primary biliary cirrhosis. Am J Gastroenterol 2001 Sep;96(9):2745-2750. 15. Feranchak AP, Gralla J, King R, Ramirez RO, Corkill M, Narkewicz MR, et al. Comparison of indices of vitamin A status in children with chronic liver disease. Hepatology 2005 Oct;42(4):782-792. 16. Kassam A, Miao B, Young PR, Mukherjee R. Retinoid X receptor (RXR) agonist-induced antagonism of farnesoid X receptor (FXR) activity due to absence of coactivator recruitment and decreased DNA binding. J Biol Chem 2003 Mar 21;278(12):10028-10032. 17. Smith JE. Preparation of vitamin A-deficient rats and mice. Methods Enzymol 1990;190:229-236. 18. Kullak-Ublick GA, Ismair MG, Kubitz R, Schmitt M, Haussinger D, Stieger B, et al. Stable expression and functional characterization of a NaC-taurocholate cotransporting green fluorescent protein in human he- patoblastoma HepG2 cells. Cytotechnology 2000;34:1-9. 19. Claudel T, Sturm E, Duez H, Torra IP, Sirvent A, Kosykh V, et al. Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J Clin Invest 2002 Apr;109(7):961-971. 20. Ros JE, Libbrecht L, Geuken M, Jansen PL, Roskams TA. High expression of MDR1, MRP1, and MRP3 in the hepatic progenitor cell compartment and hepatocytes in severe human liver disease. J Pathol 2003 Aug;200(5):553-560. 21. Zaman Z, Fielden P, Frost PG. Simultaneous determination of vitamins A and E and carotenoids in plasma by reversed-phase HPLC in elderly and younger subjects. Clin Chem 1993 Nov;39(11 Pt 1):2229-2234.

77 Chapter 2

22. Kuipers F, van Ree JM, Hofker MH, Wolters H, In’t Veld G, Havinga R,et al. Altered lipid metabolism in apolipoprotein E-deficient mice does not affect cholesterol balance across the liver. Hepatology 1996 Jul;24(1):241-247. 23. Schoemaker MH, Ros JE, Homan M, Trautwein C, Liston P, Poelstra K, et al. Cytokine regulation of pro- and anti-apoptotic genes in rat hepatocytes: NF-kappaB-regulated inhibitor of apoptosis protein 2 (cIAP2) prevents apoptosis. J Hepatol 2002 Jun;36(6):742-750. 24. Kyhse-Andersen J. Electroblotting of multiple gels: a simple apparatus without buffer tank for rapid transfer of proteins from polyacrylamide to nitrocellulose. J Biochem Biophys Methods 1984 Dec;10(3-4):203-209. 25. Vos TA, Hooiveld GJ, Koning H, Childs S, Meijer DK, Moshage H, et al. Up-regulation of the multidrug resistance genes, Mrp1 and Mdr1b, and down-regulation of the organic anion transporter, Mrp2, and the bile salt transporter, Spgp, in endotoxemic rat liver. Hepatology 1998 Dec;28(6):1637-1644. 26. Deng WG, Zhu Y, Montero A, Wu KK. Quantitative analysis of binding of transcription factor complex to biotinylated DNA probe by a streptavidin-agarose pulldown assay. Anal Biochem 2003 Dec 1;323(1):12-18. 27. Nomura Y, Nagaya T, Hayashi Y, Kambe F, Seo H. 9-cis-retinoic acid decreases the level of its cognate receptor, retinoid X receptor, through acceleration of the turnover. Biochem Biophys Res Commun 1999 Jul 14;260(3):729-733. 28. Zollner G, Wagner M, Fickert P, Geier A, Fuchsbichler A, Silbert D, et al. Role of nuclear receptors and hepatocyte-enriched transcription factors for Ntcp repression in biliary obstruction in mouse liver. Am J Physiol Gastrointest Liver Physiol 2005 Nov;289(5):G798-G805. 29. MacDonald PN, Dowd DR, Nakajima S, Galligan MA, Reeder MC, Haussler CA, et al. Retinoid X receptors stimulate and 9-cis retinoic acid inhibits 1,25-dihydroxyvitamin D3-activated expression of the rat osteocalcin gene. Mol Cell Biol 1993 Sep;13(9):5907-5917. 30. Grober J, Zaghini I, Fujii H, Jones SA, Kliewer SA, Willson TM, et al. Identification of a bile acid-responsive element in the human ileal bile acid-binding protein gene. Involvement of the farnesoid X receptor/9-cis-retinoic acid receptor heterodimer. J Biol Chem 1999 Oct 15;274(42):29749-29754. 31. Urizar NL, Dowhan DH, Moore DD. The farnesoid X-activated receptor mediates bile acid activation of phospholipid transfer protein gene expression. J Biol Chem 2000 Dec 15;275(50):39313-39317. 32. Wolters H, Elzinga BM, Baller JF, Boverhof R, Schwarz M, Stieger B, et al. Effects of bile salt flux variations on the expression of hepatic bile salt transporters in vivo in mice. J Hepatol 2002 Nov;37(5):556-563. 33. Fickert P, Zollner G, Fuchsbichler A, Stumptner C, Pojer C, Zenz R, et al. Effects of ursodeoxycholic and cholic acid feeding on hepatocellular transporter expression in mouse liver. Gastroenterology 2001 Jul;121(1):170-183. 34. Rost D, Herrmann T, Sauer P, Schmidts HL, Stieger B, Meier PJ, et al. Regulation of rat organic anion transporters in bile salt-induced cholestatic hepatitis: effect of ursodeoxycholate. Hepatology 2003 Jul;38(1):187- 195. 35. Geier A, Zollner G, Dietrich CG, Wagner M, Fickert P, Denk H, et al. Cytokine-independent repression of rodent Ntcp in obstructive cholestasis. Hepatology 2005 Mar;41(3):470-477. 36. Keitel V, Burdelski M, Warskulat U, Kuhlkamp T, Keppler D, Haussinger D, et al. Expression and localization of hepatobiliary transport proteins in progressive familial intrahepatic cholestasis. Hepatology 2005 May;41(5):1160-1172. 37. Vollmar B, Heckmann C, Richter S, Menger MD. High, but not low, dietary retinoids aggravate manifesta- tion of rat liver fibrosis. J Gastroenterol Hepatol 2002 Jul;17(7):791-799. 38. Fickert P, Zollner G, Fuchsbichler A, Stumptner C, Weiglein AH, Lammert F, et al. Ursodeoxycholic acid aggravates bile infarcts in bile duct-ligated and Mdr2 knockout mice via disruption of cholangioles. Gastroen- terology 2002 Oct;123(4):1238-1251. 39. De Freitas JS, Bustorff-Silva JM, Castro e Silva Junior, Jorge GL, Leonardi LS. Retinyl-palmitate reduces liver fibrosis induced by biliary obstruction in rats. Hepatogastroenterology 2003 Jan;50(49):146-150.

78 Supplementary Data

A B 7 120 a, b, d 6 100 5 80 4 c 60 3 40 2 c c 1 20 RelativehBSEP mRNA levels RelativehBSEP mRNA levels 0 0 CDCA (µM) - - 10 10 30 30 50 50 100 100 200 200 CDCA (100 µM) - - + + 9cRA (1µM) - + - + - + - + - + - + 9cRA (1 µM) - + - + C D 8 250 7 a, b, c 200 6 5 150 4 d a, d 3 100 c, d 2 50 RelativehSHP mRNA levels

1 RelativehSHP mRNA levels

0 0 CDCA (µM) - - 10 10 30 30 50 50 100 100 200 200 CDCA (100 µM) - - + + 9cRA (1µM) - + - + - + - + - + - + 9cRA (1 µM) - + - +

Supplementary Figure 2.S1. Opposite effect of 9cRA on CDCA-induced expression of endogenous human BSEP and SHP HepG2.rNtcp cells (not transfected) were exposed to combinations of vehicle, different concentrations of CDCA and 1 μmol/L 9cRA. BSEP (A and B) and SHP (C and D) mRNA levels were determined by quantitative RT-PCR and normalized to 18S. Transcription of both BSEP and SHP is maximally induced in the presence of 100µM CDCA. 9cRA inhibits the CDCA-induced transcription of BSEP at all CDCA concentrations tested (A). In contrast, 9cRA super-induced transcription of SHP at all CDCA-concentrations tested (B). A representative experiment is shown in A and C, measured in triplo. Untreated condition was set to 1. Data (B and D) presented as means ± sd, n = 3. CDCA-treated condition was set to 100%. (asignificantly different from transfected -/-;b significantly different from transfected -/9cRA;c significantly different from transfected CDCA/-; dsignificantly different from transfected CDCA/9cRA). We have shown earlier the increase of absolute BSEP levels in FXR/RXRα-transfected and CDCA-stimulated HepG2.rNtcp cells versus CDCA-stimulated untransfected cells (Plass et al. 2002). A similar ligand-dependent expression profile for BSEP and SHP is observed in untransfected and FXR/ RXRα-transfected HepG2.rNtcp cells (Figure 2.1).

79 Chapter 2

Supplementary Figure 2.S2. FXR/RXRα binding to the BSEP-FXRE oligonucleotide is lost upon 9cRA treatment HepG2.rNtcp cells were incubated with vehicle (lanes 1 and 2), with 100 µmol/L CDCA (lanes 3 and 4), or with 100 µmol/L CDCA and 1 μmol/L 9cRA (lanes 5 and 6). Nuclear extracts were obtained and an electromobility shift assay was performed using a radioactively-labeled double stranded nucleotide containing the FXRE from the BSEP promoter. A clear protein-DNA complex is observed when the labeled oligonucleotide was incubated with nuclear extracts from untreated and CDCA-treated HepG2.rNtcp cells, whereas this protein-DNA complex was completely absent when also 9cRA was added. Material and Methods: Isolation of nuclear extracts from HepG2.rNtcp cells and the protocol for the electrophoretic mobility shift assay (EMSA) were performed according to (23). The DNA-probe was end labeled with [α-32P]dATP (Amersham, Buckinghamshire, UK) using Klenow polymerase (Promega, Madison, USA) and contained the IR-1 sequence (underlined) from the BSEP promoter: 5’-GATCCCT- TAGGGACATTGATCCTTAGG-3’.

Supplementary Table 2.S1. Oligo’s for site-directed mutagenesis of the FXRE in the BSEP promoter and biotin-labeled BSEP-FXRE probe Oligo Sequence Fwd BSEP FXRESHP 5'-GCTGCCCTTAGAGTTAATGACCTTTAGGCAAATAGATAATGTTCT-3' Rev BSEP FXRESHP 5'-CTATTTGCCTAAAGGTCATTAACTCTAAGGGCAGCCCAAGCACAGT-3' Fwd BSEP probe biotin- 5’-TGTCACTGAACTGTGCTTGGGCTGCCCTTAGGGACATTGATCCTTAGGCAAAT-3’ Rev BSEP probe 5’-ATTTGCCTAAGGATCAATGTCCCTAAGGGCAGCCCAAGCACAGTTCAGTGACA-3”

The FXRE in the BSEP promoter was replaced by the FXRE of the SHP promoter using the indicated primers by full vector amplification. The FXRE region is depicted in italics. The nucleotides that are different between theBSEP - and SHP-FXRE are underlined. Two 53-bp oligo’s were annealed creating a double stranded, biotin-labeled 53-bp DNA fragment from the BSEP promoter containing the FXRE (underlined).

80 Supplementary Data

Supplementary Table 2.S2. QPCR primer-probe sets used in this study Gene Oligo sequences h/m18S Fwd: 5’-cgg cta cca cat cca agg a-3’ Rev: 5'-cca att aca ggg cct cga aa-3' Probe: 5'-cgc gca aat tac cca ctc ccg a-3' hBSEP (ABCB11) Fwd: 5-’aca tgc ttg cga gga cct tta-3’ Rev: 5'-gga ggt tcg tgc acc agg ta-3' Probe: 5'-cca tcc ggc aac gct cca agt ct-3' hSHP (NR0B2) Fwd: 5’-gtc cag cta tgt gca cct cat c-3’ Rev: 5’-ttc ctg agg aag gcc act gt-3’ Probe: 5’- tcc aag gcc tcc cgg cag g-3’ mBsep(Abcb11) Fwd: 5-’ ctg cca agg atg cta atg ca-3’ Rev: 5'-cga tgg cta ccc ttt gct tct-3' Probe: 5'-tgc cac agc aat ttg aca ccc tag ttg g-3' mShp (Nr0b2) Fwd: 5’- acc tgc aac agg agg ctc act-3’ Rev: 5’-tgg aag cca tga gga gga ttc-3’ Probe: 5’-tcc tgg agc cct ggt acc cag cta gc-3’ mNtcp (Slc10a1) Fwd: 5-’ atg acc acc tgc tcc agc tt-3’ Rev: 5-’gcc ttt gta ggg cac ctt gt-3’ Probe: 5’-cct tgg gca tga tgc ctc tcc tc-3’ mRXRα (Nr2b1) Fwd: 5’-ggc aaa cat ggg gct gaa c-3’ Rev: 5’-gct tgt ctg ctg ctt gac aga t-3’ Probe: 5’-cca gct cac caa atg acc ctg tta cca ac-3’

Probes were 5‘-FAM/3‘-TAMRA labeled.

Chapter 3

Human FXR Regulates SHP Expression Through Direct Binding to an LRH-1 Binding Site, Independent of an IR-1 and LRH-1

Martijn O. Hoeke, Janette Heegsma, Mark Hoekstra, Han Moshage and Klaas Nico Faber

Department of Gastroenterology and Hepatology, University Medical Center Groningen, Groningen, University of Groningen, The Netherlands

Submitted Chapter 3

Abstract

FXR/RXRα is the master transcriptional regulator of bile salt synthesis and transport in liver and intestine. FXR is activated by bile acids, RXRα by the vitamin A– derivative 9-cis retinoic acid (9cRA). Remarkably, 9cRA inhibits binding of FXR/ RXRα to its response element, an inverted repeat-1 (IR-1). Still, most FXR/RXRα target genes are maximally expressed in the presence of both ligands, including the small heterodimer partner (SHP). Here, we revisited the FXR/RXRα-mediated regulation of human SHP. A 579-bp hSHP promoter element was analyzed to locate FXR/CDCA- and RXRα/ 9cRA-responsive elements. hSHP promoter constructs were analyzed in FXR/ RXRα-transfected DLD-1, HEK293 and HepG2 cells exposed to CDCA, GW4064 (synthetic FXR ligand) and/or 9cRA. FXR-DNA interactions were analyzed by in vitro pull down assays. hSHP promoter elements lacking the previously identified IR-1 (-291/-279) largely maintained their activation by FXR/CDCA, but were unresponsive to 9cRA. FXR-mediated activation of the hSHP promoter was primarily dependent on the -122/-69 region. Pull down assays revealed a direct binding of FXR to the -122/-69 sequence, which was abrogated by site-specific mutations in a binding site for the liver receptor homolog-1 (LRH-1) at -78/-70. These mutations strongly impaired the FXR/CDCA-mediated activation, even in the context of a hSHP promoter containing the IR-1. LRH-1 did not increase FXR/RXRα-mediated activation of hSHP promoter activity. FXR/CDCA-activated expression of SHP is primarily mediated through direct binding to an LRH-1 binding site, which is not modulated by LRH-1 and unresponsive to 9cRA. 9cRA-induced expression of SHP requires the IR-1 that overlaps with a DR-2 and DR-4. This establishes for the first time a co-stimulatory, but independent, action of FXR and RXRα agonists.

Introduction

The farnesoid X receptor (FXR/NR1H4) and the liver receptor homolog-1 (LRH-1/ NR5A2) are central factors in the control of bile salt homeostasis. In the liver, LRH-1 regulates expression of cholesterol 7-alpha-hydroxylase (CYP7A1), the rate-limiting enzyme in bile salt synthesis, as well as the bile salt export pump (BSEP/ABCB11) the major hepatobiliary bile salt exporter (1, 2). FXR typically acts together with the retinoid X receptor-alpha (RXRα/NR2B1) and upon activation by bile salts induces the expression of BSEP (3, 4) and the small heterodimer partner (SHP/NR0B2) (5-7). SHP, in turn, binds to LRH-1 and thereby inhibits the expression of CYP7A1 (6). In a similar way, SHP may bind the RXRα/retinoic acid receptor (RAR) heterodimer and thereby also repress expression of the hepatic bile salt importer Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) (8). SHP-dependent repression of bile salt synthesis acts in parallel with fibroblast growth factor 19 (FGF19)-mediated

84 FXR Regulates SHP Expression Through LRE, Independent of an IR-1 and LRH-1 repression, which may originate either from FXR-induced expression in the intestine (in rodents) (9) or the liver (particular in humans) (10). Both LRH-1 and FXR belong to the superfamily of nuclear receptors. FXR/RXRα binds to an inverted repeat sequence spaced by 1 nucleotide (IR-1) conforming to the consensus G/AGGTCAnTGACCT (11). Acting as a monomer, the conserved DNA binding site of LRH-1 is currently defined as (c/tCAAGGc/tCg/a) (12, 13). In recent mouse whole-genome chromatin-immunoprecipitation (ChIP) experiments a remarkable enrichment of LRH-1-type binding sites was detected in DNA sequences precipitated with antibodies against FXR. FXR and LRH-1 were found to synergistically induce transcription of mouse Shp (14). In line with these observations, functional LRH-1 binding sites have been identified in several genes that are also controlled by FXR/RXRα, including BSEP (2), SHP (6), organic solute transporter alpha/beta (OSTα/β) (15) and fatty acid synthase (FAS) (16, 17). FXR/RXRα-mediated transcriptional control is primarily regulated by their ligands, bile acids (in particular chenodeoxycholic acid (CDCA)) and 9-cis retinoic acid (9cRA), respectively. Earlier, we and others have shown that these ligands have opposite effects on binding of FXR/RXRα to the IR-1 and the resulting transcriptional activity of the human BSEP promoter (18, 19). FXR ligands (both CDCA and GW4064) strongly increase FXR/RXRα-mediated expression of BSEP, while co-administration of 9cRA effectively represses this effect. 9cRA strongly reduced the binding of FXR/ RXRα to the IR-1 sequences as they are present in the human BSEP and SHP promoters. In contrast to the effect on BSEP expression, however, CDCA and 9cRA synergistically activate SHP transcription, in both in vivo and in vitro experiments (19). This suggests that the mechanisms by which these ligands control FXR/RXRα-mediated regulation of BSEP and SHP may be fundamentally different, while they are both considered to be “typical” FXR/RXRα target genes. Opposite effects of RXRα ligands on CDCA-induced expression of FXR/RXRα target genes have been described by others also (18, 20), but the differential mechanisms remain elusive so far. Over the last decade it has become evident that the function of FXR and SHP is not restricted to bile acid synthesis, but that these factors also play a role in liver regeneration, viral replication, tumor suppression, fibrogenesis, glucose and lipid metabolism (21, 22). It is therefore highly relevant to understand the molecular mechanisms that determine the ligand-selective regulation of FXR/RXRα target genes, in particular that of SHP.

Material and methods

Cell Lines and Culture Conditions HepG2.rNtcp and DLD-1 cells were cultured in Dulbecco’s modified Eagle medium (DMEM) or RPMI 1640, respectively, supplemented with lipid-stripped serum (Bio- sera, East Sussex, UK) as described previously (19, 23). HEK293 cells were cultured like HepG2 cells. Culture conditions for mRNA and luciferase reporter assays were described before (19). Cells were exposed to 100 µmol/L CDCA (Calbiochem-Nova-

85 Chapter 3 biochem, San Diego, CA, USA) or 1 µmol/L GW4064 (Tocris, Ellisville, USA) and/ or 1 µmol/L 9cRA (Sigma Aldrich, St. Louis, MO), as described in the text. A DLD-1 cell line over-expressing hFXR (DLD-1.hFXR) was generated by stable transfection of pcDNA3-hFXR in DLD-1.

Transfection HepG2.rNtcp and HEK293 cells were transfected as described previously (4). DLD- 1 cells were transfected using Transfectine (Biorad, Hercules, CA) at a ratio of 3 µl Transfectine per µg DNA as recommended by the manufacturer. Expression plasmids of hFXR (pcDNA3-hFXR) and hRXRα (pSG5-hRXR) were used at 200 ng and 100 ng, respectively, and luciferase reporter plasmids (pGL3-basic derivatives) at 1 µg per 9.6 cm2 well. If needed, total amount of DNA was adjusted with pCMV5 plasmid to 1.3 µg per well.

Plasmids The 579-bp (-569/+10) hSHP promoter construct in pGL3 basic was a kind gift from Dr. S.M. Houten (Academic Hospital Amsterdam, The Netherlands). pcDNA5-mL- rh-1 was a kind gift from Dr. J. Hageman (University Medical Center Groningen, The Netherlands) (24). The plasmids pcDNA3-hFXR, pSG5-hRXR, pCMV5 and details about their use have been described (4, 19).

Site-Directed Mutagenesis 5’-truncated mutants of the hSHP promoter were made by PCR from the pGL3 hSHP -569/+10. pGL3 SHP -569/+10 FXRE KO (6) was generated via site-directed mutagenesis by full vector amplification. Deletion mutants lacking intra promoter regions, FXRE nonsense mutants and half-site nonsense mutants were generated by amplifying the two individual promoter fragments flanking the region to be mutated or deleted. Subsequently, these two fragments were fused by overlap PCR. PCR products were KpnI/BglII-ligated into pGL3 basic (Promega, Madison, USA). Oligo’s (Invitrogen, Paisley, UK) used to generate these SHP promoter mutants are shown in Supplementary Table 3.S1. Endotoxin-free plasmids were isolated (Macherey-Na- gel, Düren, Germany) from E. coli Top10 cells (Invitrogen, Paisley, UK). All promoter constructs were sequenced (BaseClear; Leiden; The Netherlands) to assure that the correct mutations were introduced. mRNA Isolation and QPCR mRNA was isolated from DLD-1, HepG2.rNtcp and HEK293 cells. RT-qPCR was performed as was described before (25). Sequences of the primer/probe sets are shown in Supplementary Table 3.S2.

Luciferase Reporter Assays Cells were lysed in 500 µl passive lysis buffer (Promega, Madison, USA). After cen- trifugation, 20 µl of the supernatant was used to determine luciferase activity in a

86 FXR Regulates SHP Expression Through LRE, Independent of an IR-1 and LRH-1

MPL1 Microplate Luminometer (Berthold Detection Systems). Using 50 µl luciferase substrate (Promega, Madison, USA), delay time set to 2.05 seconds and measuring time set to 10 seconds.

FXR Pull-Down Assay An FXR pull down assay was performed as described before (19) on a nuclear extract of DLD-1 cells that stably expressed hFXR (DLD-1.hFXR), treated for 24 hours with CDCA. 68-bp biotin-labeled DNA probes containing the “wild type” -122/-69 (GG- GGCAATGTCTGTGTGTTTTTTTCAATGAACATGACTTCTGGAGTCAAGGT- TGTTGGGCCATTCCCC; the putative LRH-1 binding site is indicated in italic) and “mutated” -122/-69 (GGGGCAATGTCTGTGTGTTTTTTTCAATGAACATG- ACTTCTGGAGTCATTAATTTTGGGCCATTCCCC; the mutated positions within the putative LRH-1 binding site are underlined) region were used to precipitate FXR. Biotin-labeled DNA probes containing a fragment of the BSEP promoter including the IR-1 (TGTCACTGAACTGTGCTTGGGCTGCCCTTAGGGACATTGATCCT- TAGGCAAAT; the IR-1 is indicated in italic) or a fragment of the LacI promoter (GTAGTGGCGAAATTGTGAGCGCTCACAATTCGTTTGGCCG) were used as positive and negative controls, respectively. Nuclear extracts were pre-incubated (1h at 4°C) with 3-fold excess of unlabeled “wild type” -122/-54, “mutated” -122/-54, BSEP-IR-1 (CCCTTAGGGACATTGATCCTTAGG; the IR-1 is indicated in italic) or LacI DNA probes in competition experiments. FXR binding was analyzed by western blotting, using anti-FXR (PP-A9033A-00; Perseus, Japan), exposed in a Chemi- Doc XRS system and quantified using the Quantity One software package (Bio-Rad, GmbH, Munich, Germany).

Statistical Analysis Data are presented as mean ± SD. Differences between conditions were determined in SPSS by Kruskal-Wallis followed by pair-wise comparison of groups by Mann-Whit- ney U with p≤0.05.

Results

The IR-1 at -291/-279 Is Largely Dispensable For FXR-dependent Induction of the Human SHP Promoter The RXRα ligand 9cRA lowers BSEP expression by inhibiting FXR/RXRα binding to the IR-1 (18, 19), while transcription of other FXR/RXRα target genes (SH P, OSTβ, ileal bile acid binding protein (IBABP), FGF19; see Supplementary Figure 3.S1) is super-induced. Here, we performed a detailed analysis of the human SHP promoter to obtain insight in the molecular mechanisms by which bile acids and 9cRA synergistically induce transcription of FXR/RXRα target genes. The -569/+10 SHP promoter element described earlier (6) showed the same pattern of regulation by CDCA and 9cRA as observed for genomic SHP (Figure 3.1 and Supplementary Figure 3.S1).

87 Chapter 3

Relative promoter activity Human SHP promoter variants 0 50 100 150 200 250

-569 Luc *

-303 Luc *

-278 Luc

-303 Luc

vehicle 9cRA -303 Luc CDCA CDCA/9cRA

Construct Sequence

Wild type -303 CTGGTACAGCCTGAGTTAATGACCTTGTTTA -272

IR-1 KO -303 CTGGTACAGCCTGAAATAATGTACTTGTTTA -272

IR-1 NS -303 CTGGTACAGCCTAGAGAGAGAGAGATGTTTA -272

IR-1 DEL -303 CTGGTACAGCCT...... TGTTTA -272 Figure 3.1. The IR-1 at -291/-279 is required for 9cRA-, but not for CDCA-mediated induction of the human SHP promoter DLD-1 cells were transfected with hFXR and hRXRα expression plasmids and various hSHP promoter constructs as indicated. Cells were treated with or without 100 µmol/L CDCA and/or 1 µmol/L 9cRA. The synergistic effect of the FXR ligand (CDCA) and RXRα ligand (9cRA) on SHP promoter activity depends on the previously identified IR-1 located at -291/-279. Mutation or deletion of this IR-1 sequence did not abolish SHP promoter activation by FXR/CDCA. Luciferase activity was measured to determine the SHP promoter activity. Data are presented as mean ± SD; n≥3. CDCA treated conditions are set to 100. P≤0.05 for *) in a pairwise comparison by Mann-Whitney U test. CDCA treatment resulted in a 12-fold increase of the SHP promoter activity and this was super-induced by 9cRA (+45% to 17-fold induction compared to untreated cells). An FXRE/IR-1 was previously identified at position -291/-279 in theSHP promoter (5-7). As expected, a 5’-truncated SHP promoter element up to position -303 (-303/+10) retained the CDCA-induction (9.8-fold) and 9cRA super-induction (+43% to 14-fold) characteristics. Further 5’ shortening of the SHP promoter element to -278/+10 (deleting the IR-1) led to the loss of 9cRA super-induction. Re- markably, the CDCA-induction of the -278/+10 SHP promoter element remained intact (8.1-fold; Figure 3.1). Disrupting the IR-1 sequence in the -303/+10 promoter element (by an IR-1 knock out mutation (KO) (6), replacement by a nonsense sequence (NS) or full deletion (DEL)) led to the absence of 9cRA super-induction,

88 FXR Regulates SHP Expression Through LRE, Independent of an IR-1 and LRH-1 but maintained the CDCA-induction (Figure 3.1), even in the context of the larger -569/+10 SHP promoter element (Supplementary Figure 3.S2). These data indicate that the 9cRA-mediated activation of the human SHP promoter depends on the IR-1 sequence at position 291/-279. However, this sequence is (largely) dispensable for the CDCA-induced activity. This latter finding was highly surprising and prompted us to study this in further detail.

CDCA-induced Activation of the -278/+10 SHP Promoter Elements Depends on FXR The CDCA-induced activation of the -278/+10 SHP promoter element was comparable to the -303/+10 SHP element (8.1-fold vs. 9.8-fold, respectively) and was fully dependent on the presence of FXR (Figure 3.2). The FXR/CDCA-induction was lost when the SHP promoter was reduced to a minimal element of -69/+10. This indicates that the -278/-69 region in the human SHP promoter contains a yet unidentified sequence that is essential for FXR/CDCA-dependent regulation. Relative promoter activity Human SHP promoter variants CDCA FXR 0 5 10 15 - + -569 Luc + +

- + -303 Luc + + *

- + -278 Luc + +

- - * -278 Luc + - *

- + = IR-1 -69 Luc + + Figure 3.2. FXR is required for CDCA-induced activation of the -278/+10 SHP promoter DLD-1 cells were transfected with hFXR and hRXRα expression plasmids and various hSHP promoter constructs as indicated. Cells were treated with or without 100 µmol/L CDCA. Luciferase activity was measured to determine the SHP promoter activity. Data are presented as means ± SD; n≥3. P≤0.05 for *) in a pairwise comparison by Mann-Whitney U test. The Novel FXR/CDCA-responsive Element Is Located in the -122/-69 Region of the SHP Promoter Two fragments (-203/-122 or -122/-69) were deleted from the -303/+10 and the -278/+10 SHP promoter elements to delineate the region involved in the regulation by FXR/RXRα/CDCA (Figure 3.3A). Deletion of the -122/-69 fragment from the -278/+10 SHP promoter element made it unresponsive to FXR/RXRα/CDCA, while deletion of the -203/-122 did not reduce the FXR/RXRα/CDCA-activation. Impor- tantly, the -122/-69 deletion also strongly reduced the FXR/RXRα/CDCA-activation of the IR-1-containing -303/+10 SHP promoter element (Figure 3.3B). Similar results were obtained when FXR/RXRα-transfected cells were treated with the synthetic FXR ligand GW4064 instead of CDCA (Figure 3.3C). The FXR/RXRα/CDCA- and FXR/RXRα/GW4064-induced regulation of the SHP promoter fragments was most pronounced in intestinal DLD-1 cells, but was also observed in hepatic HepG2.rNtcp and renal HEK293 cells (Figure 3.4).

89 Chapter 3

A Human SHP promoter variants -569 Luc pGL3 hSHP -569/+10

-303 Luc pGL3 hSHP -303/+10

-203 -122 -303 Luc pGL3 hSHP -303/+10 del -203/-122

-122 -69 -303 Luc pGL3 hSHP -303/+10 del -122/-69

-278 Luc pGL3 hSHP -278/+10

-203 -122 -278 Luc pGL3 hSHP -278/+10 del -203/-122

-122 -69 -278 Luc pGL3 hSHP -278/+10 del -122/-69

-69 Luc pGL3 hSHP -69/+10

Symbol Responsive element NR Position Reference

FXRE (IR-1) FXR -291/-279 Goodwin 2000

LXRE (DR-4) LXRα -284/-269 Goodwin 2003

PPRE (DR-1) PPARγ -90/-78 Kim 2007

B Relative CDCA induced promoter activity C Relative GW4064 induced promoter activity 0 2 4 6 8 10 12 14 16 0 2 4 6 8 10 12 14 CDCA GW4064 -569/+10 - - + c +

- - -303/+10 + +

- - -303/+10 del -203/-122 a, + c + b, c -303/+10 del -122/-69 - - + a, b, c + a, b, c

- - -278/+10 + a +

-278/+10 del -203/-122 - - + a +

-278/+10 del -122/-69 - - + a, b, c + a, b, c

-69/+10 - - + a, b, c + a, b, c

Figure 3.3. An FXR/RXRα/CDCA-responsive element is located in the -122/-69 region of the SHP promoter A) shows an overview of the different constructs used to localize the FXR-responsive element in the -278/-69 region of the SHP promoter. Relevant binding sites for other NRs are included. (B, C) DLD-1 cells were transfected with the indicated hSHP promoter constructs and expression plasmids for hFXR and hRXRα. Cells were treated with or without 100 μmol/L CDCA (B) or 1 μmol/L GW4064 (C). Luci- ferase activity was measured to determine SHP promoter activity. Data are presented as means of ± SD; n≥3. Significant differences are indicated when compared to aCDCA/GW4064-treated -569/+10; bCD- CA/GW4064-treated -303/+10; cCDCA/GW4064-treated -278/+10. P≤0.05 in a pairwise comparison by Mann-Whitney U test.

These data indicate that the -122/-69 sequence is crucial for FXR-dependent regulation of the SHP promoter. The previously identified IR-1 at position -291/-279 contributes only to a minor extend to the FXR-dependent regulation of SHP.

90 FXR Regulates SHP Expression Through LRE, Independent of an IR-1 and LRH-1

A Relative promoter activity B Relative promoter activity CDCA 0 2 4 6 8 10 12 14 16 GW4064 0 2 4 6 8 10 12 14 16 - - -569/+10 + + a, b b, c

- - -303/+10 + +

- - -278/+10 + +

DLD-1 DLD-1 - - -303/+10 del -122/-69 HEK 293 HEK 293 + a, b, c HepG2-rNtcp + a, b, c HepG2-rNtcp Figure 3.4. The -122/-69 region is required for optimal FXR-ligand-mediated induction of the SHP promoter in DLD-1, HEK293 and HepG2 cells The colon carcinoma (DLD-1), human embryonic kidney (HEK293) and hepatoma (HepG2.rNtcp) cell lines were transfected with the indicated hSHP promoter constructs and expression plasmids for hFXR and hRXRα. Cells were treated with or without 100 μmol/L CDCA (A) or 1 μmol/L GW4064 (B). Luciferase activity was measured to determine SHP promoter activity. Data are presented as mean of ± SD; n≥3. Promoter activity in CDCA/GW4064-treated condition is significantly different from the -278/+10 construct in aDLD-1, bHEK293 or cHepG2.rNtcp cells. P≥0.05 in a pairwise comparison by Mann-Whitney U test.

An LRH-1 Site Is Required for the FXR-Dependent Induction of Human SHP The -122/-69 region from theSHP promoter was screened for putative nuclear receptor binding sites. An IR-1-like sequence is detected at -118/-106 (AtGTCtgTGtgtT) with 7 out of 12 IR-1 consensus nucleotides. Alternatively, FXR-regulation may act through a previously identified DR-1/PPARγ binding site at position -90/-78 (26) as it also contains the core TGACCT sequence. In addition, this region contains a binding site for LRH-1 (TCAAGGTTG at -79/-71). Site-directed mutations were introduced in these 3 regions. While mutations in the IR-1-like and DR-1 sites only slightly reduced FXR-mediated induction of SHP promoter activity, it was almost completely abrogated when the LRH-1 site was mutated (Figure 3.5). Previously, it was suggested that FXR and LRH-1 may synergistically induce expression of murine Shp (14). While the human SHP promoter activity was dose-dependently induced by co-expression of mLRH-1, confirming the presence of a functional LRH-1 site, it did not enhance the FXR/CDCA-induced activity of the SHP promoter (Figure 3.6). In fact, at high doses, LRH-1 rather represses FXR/CDCA-activation of the -303/+10 hSHP promoter element. Similar results were obtained for the -569/+10 hSHP promoter (Supplementary Figure 3.S3). In addition, CDCA treatment of FXR/RXRα-transfected DLD-1 cells did not induce LRH-1 expression (Supplemen- tary Figure 3.S4). Collectively, these data indicate that the FXR-mediated induction of human SHP is independent of LRH-1, but requires the LRH-1 binding site.

91 Chapter 3

A Sequence -122\-69

WT -122 GGCAATGTCTGTGTGTTTTTTTCAATGAACATGACTTCTGGAGTCAAGGTTGT -69 ATGTCTnTGTGTT (-118/-106) TGACTTnTGGAGT (-90/-78) LRH-1 site (-79/-71) TCAAGGTTG

mut-118/-114 -122 GGCATTTATTGTGTGTTTTTTTCAATGAACATGACTTCTGGAGTCAAGGTTGT -69

mut-110/-107 -122 GGCAATGTCTGTTAAATTTTTTCAATGAACATGACTTCTGGAGTCAAGGTTGT -69 mut-90/-86 -122 GGCAATGTCTGTGTGTTTTTTTCAATGAACAATTAATCTGGAGTCAAGGTTGT -69

mut-83/-82 -122 GGCAATGTCTGTGTGTTTTTTTCAATGAACATGACTTCCAGAGTCAAGGTTGT -69

mut-75/-70 -122 GGCAATGTCTGTGTGTTTTTTTCAATGAACATGACTTCTGGAGTCATTAATTT -69

B Relative promoter activity CDCA 0 1 2 3 4 5 6 7 8 9 10 - -278/+10 WT +

- -278/+10 mut-118/-114 + * - -278/+10 mut-110/-107 + * - -278/+10 mut-90/-86 +

- -278/+10 mut-83/-82 +

- -278/+10 mut-75/-70 + * C Relative promoter activity CDCA 0 2 4 6 8 10 12 14 16 - -569/+10 WT + b - -569/+10 mut-75/-70 + a, b

- -569/+10 IR-1 KO + a

- -569/10 IR-1 KO mut-75/-70 + a, b Figure 3.5. The LRH-1 site is required for FXR-induced expression of SHP (A) shows the location of IR-1-like half sites and an LRH-1 site in the -122/-69 region of the hSHP promoter. The latter was previously identified in the murine Shp promoter (34) and conserved in rat and human (see Supplementary Figure 3.S5). All 4 IR-1-like sites and the LRH-1 site were mutated and analyzed for the effect on FXR/CDCA-mediated induction of the -278/+10 hSHP promoter (B) mutating one of the IR-1 half-sites did not or only partially reduce FXR/CDCA-dependent activation of the -278/+10 hSHP promoter fragment, whereas mutations in the LRH-1 site strongly reduced the response of the -278/+10 hSHP promoter fragment to FXR/CDCA-stimulation. *) significantly different from CDCA treated -278/+10 WT (C) in the context of the -569/-10 hSHP promoter fragment the LRH-1 site is the dominant FXR/CDCA response element (over the previously identified IR-1). DLD-1 cells were transfected with hFXR and hRXRα expression plasmids and various hSHP promoter constructs as indicated. Cells were treated with or without 100 µmol/L CDCA. Luciferase activity was measured to determine the SHP promoter activity. asignificantly different from CDCA treated -569/+10 WT. bsignificantly different from CDCA treated -569/+10 IR-1 KO. Data presented as means ± SD; n≥3. P≤0.05 for *), a and b in a pairwise comparison by Mann-Whitney U test.

92 FXR Regulates SHP Expression Through LRE, Independent of an IR-1 and LRH-1

mLrh-1 (ng) Relative promoter activity Figure 3.6. No synergy between FXR and 0 2 4 6 8 10 12 14 16 LRH-1 in human SHP regulation LRH-1 dose-dependently induced activation of 0 the -303/+10 hSHP promoter fragment, confirming the presence of a functional LRH-1 res- b 12.5 ponsive element. In the presence of FXR a similar dose response curve is observed. However, a 50 b in the presence of CDCA, FXR and LRH-1 do not synergistically activate the SHP promoter. a LRH-1 rather limits the FXR/CDCA-depen- 100 b dent activation at a higher dose. DLD-1 cells a vehicle were transfected with hFXR and hRXRα ex- b 200 FXR/RXR FXR/RXR CDCA pression plasmids, the -303/+10 hSHP promoter construct and/or increasing amounts of an mLRH-1 expression plasmid as indicated. Cells were treated with or without 100 µmol/L CDCA. Luciferase activity was measured to determine the SHP promoter activity. asignificantly different from 0 ng mLrh-1 vehicle, between vehicle treated conditions. bsignificantly different from 0 ng mLrh-1 FXR/RXR, between FXR/RXR treated conditions. Data presented as mean ± SD; n≥3. P≤0.05 for a and b in a pairwise comparison by Mann-Whitney U test.

FXR Physically Binds to the LRH-1 Site in the -122/-69 Region of the Human SHP promoter Next, we analyzed whether FXR binds directly to the -122/-69 region in the human SHP promoter by applying an FXR-pull down assay (19) using a biotin-labeled 68-bp DNA fragment containing the -122/-69 region of the SHP promoter. ThisSHP promoter fragment efficiently precipitated FXR from nuclear extracts of CDCA-treated DLD-1 cells that stably overexpress hFXR (DLD-1.hFXR), similar as the positive control (BSEP-IR-1) did (Figure 3.7A). Binding of FXR was abrogated when the LRH-1 site was mutated in the -122/-69 element. Moreover, the mutated sequence did not compete for FXR binding, while the wild type -122/-69 SHP promoter fragment did (Figure 3.7A and B). Taken together, these data show that FXR-mediated expression of human SHP is largely controlled via direct binding of FXR to a newly-identified DNA sequence that includes an LRH-1 binding site at position -79/-71.

Discussion

In this study, we show that FXR regulates human SHP expression primarily via direct binding to an LRH-1 site and not the previously identified IR-1. No synergism was detected between FXR and LRH-1 in regulation of human SHP. In contrast, the IR-1 sequence was required for 9cRA-induced expression of SHP. This is the first in- depth analysis of the co-stimulatory transcriptional regulation by the ligands of FXR and RXRα, CDCA and 9cRA. This mechanism is fundamentally different from FXR/ RXRα-mediated regulation of BSEP that acts through an IR-1 (4). Sequencing of DNA fragments that bind FXR in the mouse genome has recently revealed that indeed the IR-1 is the most prominent binding site of this transcription

93 Chapter 3

A Pull down probe IR-1 LacI SHP-122/-69 EB

FXR

competitor ------IR-1 LacI --

Quantification 160 54 100 41 140 30

B SHP-122/-69 Pull down probe EB LacI IR-1 Mut WT WT WT FXR competitor ------WT Mut

Quantification 8.0 35 271 20 100 72 124 Figure 3.7. FXR binds to the LRH-1 responsive element in the hSHP promoter FXR was precipitated from nuclear extracts of hFXR-overexpressing DLD-1 cells using a DNA probe containing the SHP -122/-69 region (“wild type”(WT) or “mutated”(mut)), the IR-1 from the hBSEP promoter (positive control), the LacI binding site (negative control) or empty beads (EB, negative control). A) DNA probes of SHP -122/-69 and BSEP-IR-1 bind FXR. Competition experiments were performed with 3-fold excess hBSEP-IR-1 or LacI lacking a biotin label. B) the SHP -122/-69 region with a mutated LRH-1 site failed to precipitate or compete for FXR binding. Competition experiments were performed with 3-fold excess wild type SHP -122/-69, mutated SHP -122/-69 or LacI lacking a biotin label. factor (14, 27, 28). Notably, the IR-1 in the mouse, rat and human SHP promoters deviate from the experimentally established IR-1 consensus at least at one crucial position (GAGTTAaTGACCT, where the underlined T in the SHP IR-1 is a G or C in the consensus IR-1). The second most enriched FXR-binding sequence in the genome-wide chromatin immunoprecipitation experiments appeared to confirm to an LRH-1 binding site that is in close proximity to the IR-1. Co-transfection experiments revealed a synergistic effect of FXR/RXR and LRH-1 on the activity of theShp promoter (14). Our data show that 1) FXR-mediated expression of human SHP is largely independent of the IR-1, 2) LRH-1 does not enhance FXR/RXRα-induced SHP promoter activity, 3) FXR is precipitated with a DNA fragment containing the LRH-1 site, which is abrogated when this site is mutated; 4) FXR-mediated induction of a SHP promoter lacking an IR-1 is similar in cells without endogenous LRH-1 (HEK293) and in cells that contain intermediate (DLD-1) or high levels of LRH-1 (HepG2.rNtcp). This suggest that FXR-mediated regulation does not depend on the presence of LRH-1, which is in line with the observation that GW4064-induced Shp mRNA expression in mouse liver was hardly affected by the absence of Lrh-1 (29). Most surprising was the fact that the IR-1 was extraneous for FXR-mediated induction of the hSHP promoter, but required a downstream sequence that harbors an LRH- 1 binding site. The minimal LRH-1 binding site was, however, not sufficient to bind significant amounts of FXR in pull-down assays (data not shown), suggesting that sequences flanking the LRH-1 binding site are required for efficient FXR binding.

94 FXR Regulates SHP Expression Through LRE, Independent of an IR-1 and LRH-1

This is corroborated by the observation that mutations in the -122/-69 region outside the LRH-1 consensus sequence also reduced the FXR-induced SHP promoter activity, though this was less pronounced than the mutations in the LRH-1 site. Taken together, we conclude that the LRH-1 site in the human SHP promoter is most important site for FXR-mediated expression. Importantly, this novel FXR binding site is fully conserved in the human, mouse and rat SHP/Shp promoters (Supplementary Figure 3.S5). Another remarkable finding was that the previously identified IR-1 was actually -re quired for 9cRA-induced expression of SHP. Previously, it has been shown that the IR-1 overlaps with an LXRα/RXRα DR-4 response element at -284/-269 (30). The synthetic ligand RXRα was shown to be a potent activator of LXR/RXRα-induced transcriptional activity, even more so than the LXRα ligand T0901317. Thus, it is very well possible that 9cRA induces SHP expression through LXR/RXRα. In addition, the IR-1 also contains a putative DR-2 sequence (Supplementary Figure 3.S6). RXRα homodimers and RXRα/RAR heterodimers have been shown to bind DR-2 elements (31). SHP promoter activity was indeed induced by 9cRA-activated RXRα, which was not affected by co-transfection with RAR (data not shown). So, alternatively, 9cRA may act via RXRα homodimers by binding the DR-2 in the -291/-279 region in the SHP promoter. At present it is unknown how common this alternative pathway of FXR-mediated transcription through LRH-1(-like) sequences is. The FXR/CDCA-induced activity via the LRH-1 site is insensitive to 9cRA. Together with the fact that the “IR-1” is required for the 9cRA-mediated induction of SHP this provides the first molecular mechanism explaining how these ligands (9cRA and CDCA) lead to maximum induction of transcription, albeit via two independent sites. Maximum expression after exposure to both ligands was also observed for OSTβ, IBABP, FGF19 and others observed this for phospholipid transfer protein (PLTP) (32) and sulfotransferase 2A1 (SULT2A1/STD) (33). In contrast, OSTα showed a BSEP-like pattern (9cRA blocks CDCA-induced expression). Since 9cRA was found to reduce binding of FXR/RXRα to the IR-1 sequence (as present in the human BSEP and SHP promoter), the IR-1 containing promoters of OSTβ, IBABP and FGF19 need to harbor compensatory mechanism that ultimately lead to maximal transcription with both ligands. Our data contrast to those previously reported by Lu et al. (5) and Goodwin et al. (6), who reported that the IR-1 is essential for FXR-induced expression of human SHP. We followed the same experimental approach as these studies. Most of our data was generated using DLD-1 cells, in which we observed the most robust FXR-mediated induction of the SHP promoter. Still, we show that the IR-1 was also dispensable for FXR-mediated induction of the SHP promoter in HEK293 and HepG2 cells, which were used in the earlier studies. A putative explanation for these, seemingly opposite, observations may be that both the IR-1 and the LRH-1 site can bind FXR and activate SHP expression, but that their relative contribution may depend on the cellular and/or nuclear levels of FXR, RXRα and their ligands. These factors may vary between cell types, passage numbers and the experimental conditions in these 3 studies.

95 Chapter 3

The RXRα ligand (9cRA) may reduce the binding of the FXR/RXRα heterodimer to the IR-1 sequence and stimulate LXR/RXRα or RXRα homodimer binding in the -291/-269 region. In contrast, 9cRA does not affect the FXR-mediated regulation of SHP via the -122/-69 element. Physiologically, this maintains SHP-mediated regulation of bile salt synthesis (CYP7A) and bile salt import (NTCP, ASBT) independent of the vitamin A/9cRA levels. In line with this, bile salt-mediated induction of Shp was maintained in vitamin A-deficient mice (19). In conclusion, our study reveals for the first time a molecular mechanism of FXR-activated transcription that is not inhibited by the RXRα ligand 9cRA, which is the most frequent mode of regulation observed for FXR-target genes. Surprisingly, this is mediated through a non-IR-1 FXR response element that shows typical characteristics of an LRH-1 DNA binding consensus.

Acknowledgements

The authors would like to thank Dr. S. M. Houten (University of Amsterdam, The Netherlands) and Dr. J. Hageman (University of Groningen, The Netherlands) for the generous gifts of pGL3-SHP(-569/+10) and pcDNA5-mLrh-1, respectively.

96 FXR Regulates SHP Expression Through LRE, Independent of an IR-1 and LRH-1

References

1. Nitta M, Ku S, Brown C, Okamoto AY, Shan B. CPF: an orphan nuclear receptor that regulates liver-specific expression of the human cholesterol 7α-hydroxylase gene. Proc Natl Acad Sci U S A 1999;96:6660-6665. 2. Song X, Kaimal R, Yan B, Deng R. Liver receptor homolog 1 transcriptionally regulates human bile salt export pump expression. J Lipid Res 2008;49:973-984. 3. Ananthanarayanan M, Balasubramanian N, Makishima M, Mangelsdorf DJ, Suchy FJ. Human bile salt export pump promoter is transactivated by the farnesoid X receptor/bile acid receptor. J Biol Chem 2001;276:28857-28865. 4. Plass JR, Mol O, Heegsma J, Geuken M, Faber KN, Jansen PL, et al. Farnesoid X receptor and bile salts are involved in transcriptional regulation of the gene encoding the human bile salt export pump. Hepatology 2002;35:589-596. 5. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, et al. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 2000;6:507-515. 6. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, et al. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000;6:517-526. 7. Chen W, Owsley E, Yang Y, Stroup D, Chiang JY. Nuclear receptor-mediated repression of human cholesterol 7α-hydroxylase gene transcription by bile acids. J Lipid Res 200142:1402-1412. 8. Denson LA, Sturm E, Echevarria W, Zimmerman TL, Makishima M, Mangelsdorf DJ, et al. The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. Gastroen- terology 2001;121:140-147. 9. Holt JA, Luo G, Billin AN, Bisi J, McNeill YY, Kozarsky KF, et al. Definition of a novel growth factor-dependent signal cascade for the suppression of bile acid biosynthesis. Genes Dev 2003;17:1581-1591. 10. Song KH, Li T, Owsley E, Strom S, Chiang JY. Bile acids activate fibroblast growth factor 19 signaling in human hepatocytes to inhibit cholesterol 7α-hydroxylase gene expression. Hepatology 2009;49:297-305. 11. Forman BM, Goode E, Chen J, Oro AE, Bradley DJ, Perlmann T, et al. Identification of a nuclear receptor that is activated by farnesol metabolites. Cell 1995;81:687-693. 12. Lu TT, Repa JJ, Mangelsdorf DJ. Orphan nuclear receptors as eLiXiRs and FiXeRs of sterol metabolism. J Biol Chem 2001;276:37735-37738. 13. Ueda H, Sun GC, Murata T, Hirose S. A novel DNA-binding motif abuts the zinc finger domain of insect nuclear hormone receptor FTZ-F1 and mouse embryonal long terminal repeat-binding protein. Mol Cell Biol 1992;12:5667-5672. 14. Chong HK, Infante AM, Seo YK, Jeon TI, Zhang Y, Edwards PA, et al. Genome-wide interrogation of hepatic FXR reveals an asymmetric IR-1 motif and synergy with LRH-1. Nucleic Acids Res 2010;38:6007-6017. 15. Frankenberg T, Rao A, Chen F, Haywood J, Shneider BL, Dawson PA. Regulation of the mouse organic solute transporter alpha-beta, Ostα-Ostβ, by bile acids. Am J Physiol Gastrointest Liver Physiol 2006;290:G912-G922. 16. Matsukuma KE, Bennett MK, Huang J, Wang L, Gil G, Osborne TF. Coordinated control of bile acids and lipogenesis through FXR-dependent regulation of fatty acid synthase. J Lipid Res 2006;47:2754-2761. 17. Matsukuma KE, Wang L, Bennett MK, Osborne TF. A key role for orphan nuclear receptor liver receptor homologue-1 in activation of fatty acid synthase promoter by liver X receptor. J Biol Chem 2007;282:20164- 20171. 18. Kassam A, Miao B, Young PR, Mukherjee R. Retinoid X receptor (RXR) agonist-induced antagonism of farnesoid X receptor (FXR) activity due to absence of coactivator recruitment and decreased DNA binding. J Biol Chem 2003;278:10028-10032. 19. Hoeke MO, Plass JR, Heegsma J, Geuken M, van Rijsbergen D, Baller JF, et al. Low retinol levels differentially modulate bile salt-induced expression of human and mouse hepatic bile salt transporters. Hepatology 2009;49:151-159.

97 Chapter 3

20. Cai SY, He H, Nguyen T, Mennone A, Boyer JL. Retinoic acid represses CYP7A1 expression in human hepatocytes and HepG2 cells by FXR/RXR-dependent and independent mechanisms. J Lipid Res 2010;51:2265- 2274. 21. Chanda D, Park JH, Choi HS. Molecular basis of endocrine regulation by orphan nuclear receptor Small Heterodimer Partner. Endocr J 2008;55:253-268. 22. Wang YD, Chen WD, Moore DD, Huang W. FXR: a metabolic regulator and cell protector. Cell Res 2008;18:1087-1095. 23. Dijkstra G, Blokzijl H, Bok L, Homan M, Van Goor H, Faber KN, et al. Opposite effect of oxidative stress on inducible nitric oxide synthase and haem oxygenase-1 expression in intestinal inflammation: anti-inflammatory effect of carbon monoxide. J Pathol 2004;204:296-303. 24. Out C, Hageman J, Bloks VW, Gerrits H, Sollewijn Gelpke MD, Bos T, et al. Liver receptor homolog-1 is critical for adequate up-regulation of Cyp7a1 gene transcription and bile salt synthesis during bile salt se- questration. Hepatology 2011;53:2075-2085. 25. Blokzijl H, Vander Borght S, Bok LI, Libbrecht L, Geuken M, van den Heuvel FA, et al. Decreased P-glycoprotein (P-gp/MDR1) expression in inflamed human intestinal epithelium is independent of PXR protein levels. Inflamm Bowel Dis 2007;13:710-720. 26. Kim HI, Koh YK, Kim TH, Kwon SK, Im SS, Choi HS, et al. Transcriptional activation of SHP by PPAR-gamma in liver. Biochem Biophys Res Commun 2007;360:301-306. 27. Thomas AM, Hart SN, Kong B, Fang J, Zhong XB, Guo GL. Genome-wide tissue-specific farnesoid X receptor binding in mouse liver and intestine. Hepatology 2010;51:1410-1419. 28. Lee J, Mi SS, Yu P, Kim K, Smith Z, Rivas-Astroza M, et al. Genomic analysis of hepatic farnesoid X receptor (FXR) binding sites reveals altered binding in obesity and direct gene repression by FXR. Hepatology 2012 Jul;56(1):108-17. 29. Lee YK, Schmidt DR, Cummins CL, Choi M, Peng L, Zhang Y, et al. Liver receptor homolog-1 regulates bile acid homeostasis but is not essential for feedback regulation of bile acid synthesis. Mol Endocrinol 2008;22:1345-1356. 30. Goodwin B, Watson MA, Kim H, Miao J, Kemper JK, Kliewer SA. Differential regulation of rat and human CYP7A1 by the nuclear oxysterol receptor liver X receptor-alpha. Mol Endocrinol 2003;17:386-394. 31. Castelein H, Janssen A, Declercq PE, Baes M. Sequence requirements for high affinity retinoid X receptor-alpha homodimer binding. Mol Cell Endocrinol 1996;119:11-20. 32. Urizar NL, Dowhan DH, Moore DD. The farnesoid X-activated receptor mediates bile acid activation of phospholipid transfer protein gene expression. J Biol Chem 2000;275:39313-39317. 33. Song CS, Echchgadda I, Baek BS, Ahn SC, Oh T, Roy AK, et al. Dehydroepiandrosterone sulfotransferase gene induction by bile acid activated farnesoid X receptor. J Biol Chem 2001;276:42549-42556. 34. Lee YK, Parker KL, Choi HS, Moore DD. Activation of the promoter of the orphan receptor SHP by orphan receptors that bind DNA as monomers. J Biol Chem 1999;274:20869-20873.

98 Supplementary Data

Supplementary Table 3.S1 Oligo’s used to create mutant constructs of the hSHP -569/+10 promoter Primer Purpose Sequence Outer primers in pGL3 basic Fwd Amplify complete insert CTAGCAAAATAGGCTGTCCC (RVprimer3) Rev Amplify complete insert CCGAGTGTAGTAAACATTCC Site directed mutagenesis by full vector amplification Fwd FXRE KO GTACAGCCTGAAATAATGTACTTGTTTATCCACTTGAGTCA Rev FXRE KO GATAAACAAGTACATTATTTCAGGCTGTACCAGGGCACC Truncation (primers contain KpnI site) Fwd Truncate to -303 CCTTGGTACCCTGGTACAGCCTGAGTTAAT Fwd Truncate to -278 AGTTAAGGTACCTGTTTATCCACTTGAGTCAT Fwd Truncate to -122 TCCTGGTACCGGCAATGTCTGTGTGTTTTT Fwd Truncate to -69 TCAAGGTACCTGGGCCATTCCCCCCGTTCC Overlap PCR primers Fwd nonsense FXRE ACAGCCTAGAGAGAGAGAGATGTTTATCCACTTGAGTCAT Rev nonsense FXRE ATAAACATCTCTCTCTCTCTAGGCTGTACCAGGGCACCAA Fwd deleted FXRE TTGGTGCCCTGGTACAGCCTTGTTTATCCACTTGAGTCAT Rev deleted FXRE ATGACTCAAGTGGATAAACAAGGCTGTACCAGGGCACCAA Fwd deleted -203/-122 CTGTGCCCTGCACCGGCCACGGCAATGTCTGTGTGTTTTT Rev deleted -203/-122 AAAAACACACAGACATTGCCGTGGCCGGTGCAGGGCACAG Fwd deleted -122/-69 TCCCCACCATTCCTGCCAGGTGGGCCATTCCCCCCGTTCC Rev deleted -122/-69 GGAACGGGGGGAATGGCCCACCTGGCAGGAATGGTGGGGA Fwd mut-118/-114 CACCATTCCTGCCAGGGGCATTTATTGTGTGTTTTTTTCAATGAAC Rev mut-118/-114 GTTCATTGAAAAAAACACACAATAAATGCCCCTGGCAGGAATGGTG Fwd mut-110/-107 CCTGCCAGGGGCAATGTCTGTTAAATTTTTTCAATGAACATGACTT Rev mut-110/-107 AAGTCATGTTCATTGAAAAAATTTAACAGACATTGCCCCTGGCAGG Fwd mut-90/-86 TGTGTTTTTTTCAATGAACAATTAATCTGGAGTCAAGGTTGTTGGG Rev mut-90/-86 CCCAACAACCTTGACTCCAGATTAATTGTTCATTGAAAAAAACACA Fwd mut-83/-82 TTTTCAATGAACATGACTTCCAGAGTCAAGGTTGTTGGGCCATTCC Rev mut-83/-82 GGAATGGCCCAACAACCTTGACTCTGGAAGTCATGTTCATTGAAAA Fwd mut-75/-70 GAACATGACTTCTGGAGTCATTAATTTTGGGCCATTCCCCCCGTTC Rev mut-75/-70 GAACGGGGGGAATGGCCCAAAATTAATGACTCCAGAAGTCATGTTC

99 Chapter 3

Supplementary Table 3.S2. Taqman primer-probe sets used for RT-qPCR Gene Oligo sequences 18S Fwd: 5’-cgg cta cca cat cca agg a-3’ Rev: 5'-cca att aca ggg cct cga aa-3' probe: 5'-cgc gca aat tac cca ctc ccg a-3' BSEP/ABCB11 Fwd: 5-’aca tgc ttg cga gga cct tta-3’ Rev: 5'-gga ggt tcg tgc acc agg ta-3' probe: 5'-cca tcc ggc aac gct cca agt ct-3' FGF19 Fwd: 5’-tgc aat ccc gat aag aaa tgc-3’ Rev: 5’-cag cct tat ata gta gcg cct tac g-3’ probe: 5’-ctt ggg cac cta ccc gt-3’ IBABP Fwd: 5’-aag gcc cgc aac ttc aag at-3’ Rev: 5’-gga gta gtg ctg gga cca agt g-3’ probe: 5’-cca tcc tgc tgc acc tcc gtg a-3’ LRH-1/ NR5A2 Fwd: 5’-acg gac tta cac cta ttg tgt ctc aa-3’ Rev: 5’-agg tga gga gcc cat aat ggt ac-3’ probe: 5’-cac ggg aca aag ctc ttc cag atc ttc a-3’ OST alpha Fwd: 5’-ggt gag cag aac atg gga gc-3’ Rev: 5’-atg gag ggc tgt agg gca gt-3’ probe: 5’-aaa ttt gct ctg ttc cag gtt ctc ctc atc c-3’ OST beta Fwd: 5’-cag gag ctg ctg gaa gag at-3’ Rev: 5’-gac cat gct tat aat gac cac ca-3’ probe: 5’-cgt gtg gaa gat gca tct ccc tgg aat cat tc-3’ SHP/NR0B2 Fwd: 5’-gtc cag cta tgt gca cct cat c-3’ Rev: 5’-ttc ctg agg aag gcc act gt-3’ probe: 5’-tcc aag gcc tcc cgg cag g-3’

Probes were FAM TAMRA labeled.

100 Supplementary Data

A B HepG2.rNtcp DLD-1 350 350 a, c vehicle a vehicle a a b b c 18S 300 9cRA c 18S 300 9cRA c CDCA a CDCA a b c 250 CDCA/9cRA c 250 CDCA/9cRA

200 200 a b c 150 a a a a a a a 150 a a b b b d a a a b b a b d b d d c d d b d d d d a a 100 b d 100 b b b c b c c a c c c c c a c d c c b c d d 50 d d d 50 b c d d d c d

Relative mRNA levels versus versus levels mRNARelative versus levels mRNARelative c d d d 0 0 BSEP OSTα SHP OSTβ OSTα IBABP SHP FGF19 OSTβ Supplementary Figure 3.S1. Gene- and cell type-specific regulation of FXR/RXRα target genes by 9cRA HepG2.rNtcp (A) and DLD-1 (B) cells were transfected with expression plasmids for hFXR and hRXRα and treated with or without 100 µmol/L CDCA and/or 1 µmol/L 9cRA. mRNA levels of FXR target genes were determined by RT-qPCR. Data are corrected for 18S and displayed as means ± SD; n≥3. CDCA treated conditions are set to 100. Significant differences (p≤0.05) are indicated when compared to auntreated condition, b9cRA-treated condition, cCDCA-treated condition or dCDCA/9cRA-treated condition in a pair-wise comparison by Mann-Whitney U test.

Relative promoter activity FXRE sequence CDCA 0 5 10 15 -297 -273 - wild type CAGCCTGAGTTAATGACCTTGTTTA +

- “knock out” CAGCCTGAAATAATGTACTTGTTTA + *

- * AGAGAG GAGAGA nonsense CAGCCT A TGTTTA +

- deleted CAGCCT...... TGTTTA +

Supplementary Figure 3.S2. Inactivation of the IR-1 at position -291/-279 does not abolish FXR/ CDCA-mediated induction of the -569/+10 hSHP promoter DLD-1 cells were transfected with hFXR and hRXRα expression plasmids and the -569/+10 SHP promoter constructs. Cells were treated with or without 100 µmol/L CDCA. Luciferase activity was measured to determine the SHP promoter activity. Data presented as mean ± SD; n≥3. P≤0.05 for *) in a pair wise comparison by Mann-Whitney U test.

101 Chapter 3

mLrh-1 (ng) Relative promoter activity 0 5 10 15 20 25

12.5

100

vehicle 200 FXR/RXR FXR/RXR CDCA

Supplementary Figure 3.S3. No synergy between FXR and LRH-1 in human SHP regulation LRH-1 dose dependently induced activation of the -569/+10 hSHP promoter fragment, confirming the presence of a functional LRH-1 responsive element. In the presence of FXR a similar dose response curve is observed. However, in the presence of CDCA, FXR and LRH-1 do not synergistically activate the SHP promoter. LRH-1 rather limits the FXR/CDCA-dependent activation at a higher dose. DLD-1 cells were transfected with hFXR and hRXRα expression plasmids, the -569/+10 SHP promoter construct and/or increasing amounts of the mLRH-1 expression plasmid as indicated. Cells were treated with or without 100 µmol/L CDCA. Luciferase activity was measured to determine the SHP promoter activity. Data presented as mean ± SD.

1.2 18S 1.0

0.8 levels versus versus levels 0.6 mRNA 0.4 LRH1

0.2 Supplementary Figure 3.S4. FXR does not induce LRH-1 expression in DLD-1 cells Relative 0.0 DLD-1 cells were transfected with expression plasmids for FXR - + + hFXR and hRXRα and treated with or without 100 µmol/L RXR - + + CDCA. mRNA levels of LRH-1 were determined by RT-qPCR. CDCA - - + Data are corrected for 18S and displayed as mean ± SD; n≥3.

102 Supplementary Data

mouse -337 CTGGTACAGCCTGGGTTAATGACCCTGTTTATGCACTTGAGTCATCCGATAAAGGGCATC -278 rat -328 CTGGTACAGCCTGGGTTAATAACCCTGTTTATACACTTGAGTCATCCGATAAAGGGCATC -269 human -303 CTGGTACAGCCTGAGTTAATGACCTTGTTTATCCACTTGAGTCATCTGATAAGGGGCAGC -244 ************* ****** *** ******* ************* ***** ***** * mouse -277 CAGGCAGTGGGCAGGTGGCCCTGTGCCCTGCAATGGCCACTTCATTGACTAAAGTGATAG -218 rat -268 CAGGCAGTGGGCAGGTGGCCCTGTGCCCTGCAATGGCCACTTCATTGACTAAAGCGATAG -209 human -243 TGAGTGAGCGGCAGGTGGCCCTGTGCCCTGCACCGGCCACTTCATTGACTGAGGTGATAT -184 * *********************** **************** * * **** mouse -217 CAAGGCCACGTGGAGCTTCCAGTGCCCC-TCCCCCACCACTTCCCCATCAGTCCTGCCAG -159 rat -208 CAAGGCCACGTGGAGCTTCCAGTGCCCC-TCCCCCACCACTTCTCCACCAGTCCTGCCAG -150 human -183 CAGTGCCACGTGGGGTTCCCAATGCCCCCTCCCCCACCACTTCCCCACCATTCCTGCCAG -124 ** ********* * * *** ****** ************** *** ** ********* mouse -158 GGTCAGCGTGTATGCATTGTGTGTGTGTATGGTTTTTTTTTTTTTTTTCCTTTCAATGAA -99 rat -149 GGTCAGCGTGTATGCATTGTGTGTGTGTGTATGGTTTTTTTTTTTTTT---TTCAATGAA -93 human -123 GG------GCAATGTCTGTGTGT------TTTT---TTCAATGAA -94 ** *** *** ******* **** ********* mouse -98 CATGACTTCTGGAGTCAAGGTTGTTTGGCCAGTCCCCT--TCCCGCCCATCAAGGATATA -41 rat -92 CATGACTTCTGGAGTCAAGGTTGTTTGGCCAGTCCCCC--TCCCGCCCATCAAGGATATA -35 human -93 CATGACTTCTGGAGTCAAGGTTGTTGGGCCATTCCCCCCGTTCCACTCACTGGGAATATA -34 ************************* ***** ***** * ** * ** * ***** mouse -40 AATAGCACTCACAGTAGAGAGAGAGAGAGAGAGGGCCAGATAG +3 rat -34 AATAGCACTCC--GTAGAGAGGGCCACAGAG----CCAGGAAG +3 human -33 AATAGCACCCA---CAGCGCAGAACACAGAG----CCAGAGAG.+3 ******** * ** * * **** **** ** Supplementary Figure 3.S5. Comparison of human, mouse and rat SHP promoter sequences The IR-1 (italic+bold) is not fully conserved, whereas the LRH-1 binding site (underlined) is fully conserved in the mouse, rat and human SHP promoter. The -122/-69 region is depicted in bold.

DR-4 DR-2

-300 GTACAGCCTGAGTTAATGACCTTGTTTATCCACTTGAGTCA -260 IR-1

Supplementary Figure 3.S6. The 9cRA responsive element accommodates an IR-1, an DR-4 and a putative DR-2 The IR-1 (-291/-279) overlaps with a previously identified DR-4 (Goodwinet al., 2003; binds LXRα/ RXRα) and a putative DR-2 (binds RXRα/RXRα and RXRα/RAR).

103

Chapter 4

Vitamin A Deficiency Causes Mild Cholestasis in Rats

Martijn O. Hoeke, Mark Hoekstra, Janette Heegsma, Han Moshage and Klaas Nico Faber

Department of Gastroenterology and Hepatology, University Medical Center Groningen, Groningen, University of Groningen, The Netherlands

In preparation Chapter 4

Abstract

Vitamin A is a fat-soluble vitamin that mammals acquire from the diet. Bile acids aid in intestinal absorption of vitamin A, which is stored in hepatic stellate cells in the liver that control vitamin A homeostasis. Bile acids and vitamin A-derived retinoic acids are important signaling molecules that activate the nuclear receptors farnesoid X receptor (FXR) and retinoid X receptor-alpha (RXRα), respectively. FXR regulates transcription of genes involved in bile acid synthesis and transport and does so in a heterodimer with RXRα. Recent data reveal that RXRα ligands strongly affect FXR-regulation in a target gene specific manner. Since hypovitaminosis A may develop in chronic liver and intestinal diseases, we determined the direct effect of VAD on bile salt synthesis and transport. Rats were fed a control (vitamin A sufficient; VAS) or vitamin A deficient (VAD) diet for 17 weeks. Bile acid levels were determined in plasma, liver and bile. Ex- pression of genes and proteins involved in bile acid synthesis and transport in the liver and terminal ileum was analyzed by RT-qPCR and western blotting, respectively. Serum retinol levels remained normal during 12 weeks of VAD diet, after which they sharply dropped. After 17 weeks of VAD diet, serum and hepatic retinol levels were decreased 85% and 99%, respectively, compared to control animals. Vi- tamin A deficiency increased serum bile acid concentrations by 3.0- fold (to 49 μM in VAD) compared to control animals, while biliary and hepatic bile acid concentrations were unchanged. VAD did not affect the expression of rate-limiting factors in bile salt synthesis (Cyp7A1) and transport (Ntcp and Bsep) in the liver. Also hepatic Ntcp protein levels were comparable between VAD and VAS livers. Expression of ileal Ostα (exports bile salts to the circulation) and Fgf15 (signals to the liver to repress Cyp7A1) was significantly increased. In addition, VAD did not change hepatic and ileal Shp (suppresses Cyp7a1) expression. These data show that vitamin A deficiency causes mild cholestasis in rats. Incre- ased Fgf15 expression in the ileum of VAD rats, combined with unchanged Shp levels, is ineffective in repressing hepatic Cyp7A1, the rate-limiting enzyme in bile salt synthesis. The primary cause of bile acid accumulation in the blood remains unclear, but increased intestinal absorption via OSTα may contribute to the cholestatic phenotype.

Introduction

Vitamin A is a vital micronutrient to mammals and plays important roles in embryogenesis, growth and differentiation of tissues and fertility (1, 2). It is needed for sight, immune-competence (3) and has therapeutic potential for various forms of cancers (4). Since mammals cannot produce vitamin A themselves it needs to be taken up via the diet as pro vitamin A (mainly beta-carotene) or preformed vitamin A (retinyl esters) (2). Vitamin A is a fat-soluble vitamin and its efficient absorption in the ile-

106 Vitamin A Deficiency Causes Mild Cholestasis in Rats um requires the action of bile salts (5). Bile salts are synthesized in the liver and are secreted to the bile where they form mixed micelles with phospholipids that are the carriers for fat-soluble compounds in the digestive tract to facilitate their absorption, digestion and/or secretion. Bile salts are effectively absorbed at the terminal ileum and transported back to the liver. The small portion of bile acids that is lost in the feces is compensated by de novo synthesis in the liver. Following intestinal absorption, vitamin A is transported via lymph and blood circulation as retinyl esters packed in chylomicrons. Most of the vitamin A is transported to and stored in the liver, which plays a central role in maintaining vitamin A homeostasis. Under normal, vitamin A sufficient, conditions most of the vitamin A resides in hepatic stellate cells, where it is stored in intracellular lipid droplets. The stellate cells contain up to 80% of the body reserves of vitamin A and maintain constant levels of retinols in the blood (6). Vitamin A fulfils its function primarily through metabolites like retinoic acids that modulate the activity of transcription factors, the so-called retinoic acid receptors (RARs) and retinoid X receptors (RXRs). RARs are typically activated by all-trans retinoic acids and RXRs by 9-cis retinoic acids (9cRA), though there is redundancy in the spectrum of ligands that activate these nuclear receptors (7-11). RXRs, in particular retinoid X receptor alpha (RXRα/NR2B1), is a crucial factor in many metabolic pathways as it is an obligatory partner for several other ligand-activated nuclear receptors. The farnesoid X receptor (FXR/NR1H4) is such a transcription factor that requires heterodimerisation with RXRα for regulation of most of its target genes. FXR is the mammalian bile acid receptor (12), which controls expression of genes that are involved in bile acid synthesis and transport. Its most potent endogenous ligand is chenodeoxycholic acid (CDCA) (12-14). Activated FXR induces expression of transporters that export bile salts from the hepatic and ileal epithelial cells, the bile salt export pump (BSEP/ABCB11) (15) and organic solute transporter complex alpha-beta (OSTα/β) (16, 17), respectively. At the same time, FXR represses bile salt synthesis and import via several indirect feedback mechanisms through the actions of the small heterodimer partner (SHP/NR0B2) and the fibroblast growth factor 19 (FGF19) (FGF15 is the rodent ortholog) (18, 19). Both SHP (19-21) and FGF19/Fgf15 (18, 22) are FXR target genes. SHP represses the expression of cholesterol 7-alpha hydroxylase (CYP7A1), which is the rate-limiting step in hepatic bile salt synthesis (20), as well as the hepatic and ileal bile acid importers, sodium/taurocholate transporting polypeptide (NTCP/SLC10A1) (23) and apical sodium-dependent bile acid transporter (ASBT/SLC10A2) (24, 25), respectively. FGF19/FGF15 is expressed in the ileum and released into the circulation. It binds to the FGF receptor 4 (FGFR4) on hepatocytes and via JNK phosphorylation represses Cyp7a1 expression (18, 26-28). Besides FXR, two other nuclear receptors can be activated by bile acids, the vitamin D receptor (VDR/NR1I1) (29, 30) and pregnane X receptor (PXR/NR1I2) (31) and suppress CYP7A1 expression (31, 32). Also PXR and VDR need to form a heterodimer with RXRα to be transcriptionally active (33, 34). Vitamin A signalling may therefore affect several mechanisms that control bile salt synthesis and transport. In-

107 Chapter 4 deed, we showed that the RXRα-ligand 9cRA significantly affects the regulation of FXR-target genes. Remarkably, 9cRA strongly represses FXR-induced expression of BSEP by reducing the binding of the FXR/RXRα complex to the FXR/RXRα binding site in the BSEP promoter (35, 36). Opposite effects were observed forSHP and led to the identification of novel and independent sites in theSHP promoter that are required for 9cRA- and FXR/CDCA-induced expression (36). Thus, the vitamin A status may directly affect bile acid homeostasis, which may become particularly important in diseases that are associated with vitamin A deficiency, including chronic liver and intestinal diseases (37-39). To determine whether hypovitaminosis A has direct effects on bile salt metabolism, we analyzed the bile salt concentration in blood, liver and bile, as well as transcript and proteins levels of hepatic and ileal factors involved in bile salt synthesis and transport in vitamin A deficient rats.

Material and methods

Biochemical Procedures Plasma and liver retinol concentrations (40) and total bile salt concentrations (41, 42) were determined in blood plasma, bile and liver tissue as described. mRNA was isolated from liver tissue and terminal ileum using the Nucleospin II RNA kit (Ma- cherey-Nagel, Düren, Germany) according to the manufacturer’s recommendations. RT-qPCR was performed as described before (43). Primer-probe sets used are displayed in Table S4.1. NTCP expression in liver homogenates was determined by western blot using the K4 antibody (kind gift from Dr. B. Stieger, Zurich, Switzerland (44)).

Statistical Analysis Data are presented as mean ± SD or as a box plot with medians represented by the horizontal lines with the 75th percentiles at the top and the 25th percentiles at the bottom of the boxes. Ranges are represented as whiskers. Differences between the animal groups were determined with SPSS 17.0 by Mann-Whitney U with p<0.05.

108 Vitamin A Deficiency Causes Mild Cholestasis in Rats

Results

Vitamin A Depletion by Diet Does Not Affect Animal Growth To establish vitamin A deficiency, young male Wistar rats (5 weeks old) were put on a diet lacking vitamin A and body weight (Figure 4.1A). Plasma retinol levels (Figure 4.1B) were determined regularly (once every 1-2 weeks). The plasma retinol levels remained constant at approximately 0.16 mg/L during the first 12 weeks of the vitamin A deficient (VAD) diet, similar to animals receiving the vitamin A-containing control diet (e.g. 20,000 IU/kg; vitamin A-sufficient; VAS). After 12 weeks of VAD diet, the plasma retinol levels sharply decreased and animals were sacrificed at week 17 when plasma levels had decreased to 0.012 ± 0.006 mg/L (Figure 4.1C), while no difference in body weight between the VAS and VAD group was observed yet (Figure 4.1A). Liver retinol levels had dropped 99% in VAD rats compared to livers from VAS rats (0.12 ± 0.24 mg/g versus 10.53 ± 3.93 mg/g, respectively) (Figure 4.1D).

A B 600 150

400 100

200 50 VAS VAS Bodyweight (g) VAD VAD

0 Plasmaretinol (% of VAS) 0 0 5 10 15 0 5 10 15 Weeks on diet Weeks on diet C D 0.10 20

0.08 15 0.06 10 0.04

5 0.02

* liver) (ug/g Retinol Plasma retinol (mg/L) 0.00 0 * VAS VAD VAS VAD Diet Diet Figure 4.1. Animal characteristics rats fed a VAS or VAD diet Rats were fed either a vitamin A deficient (VAD) diet or a vitamin A sufficient (VAS) diet for 17 weeks. The increase in bodyweight over the period of 17 weeks (A) was not different between animals fed a control (VAS; n=18) or VAD (n = 22) diet. Plasma retinol levels of animals on a VAD diet were stable and similar to those on a VAS diet up to 12 weeks, after which they sharply declin- ed in the VAD group (B). At termination at 17 weeks, plasma retinol levels (C) were 85% reduced in VAD rats (n=4) compared to VAS rats (n=4), while hepatic retinol levels (D) were 99% reduced in the VAD rats. Data displayed as mean ± SD. *) significant difference between VAS and VAD, p<0.05.

109 Chapter 4

Vitamin A Deficiency Increases Plasma Bile Acid Concentrations VAD did not cause an increase of liver damage markers (AST, ALT, ALP, yGT; data not shown) in blood. Remarkably, the bile acid concentration in blood was 3.0-fold increased in VAD animals compared to VAS controls (49 ± 32 mmol/L versus 16 ± 6.5 mmol/L; p = 0.043, respectively) (Figure 4.2A). A trend towards increased bile acid concentrations in bile of VAD rats was also detected, though this did not reach statistical significance (VAS: 23.0 ± 9.9 mmol/L versus VAD: 34.4 ± 5.3 mmol/L;p = 0.077) (Figure 4.2B). In contrast, the bile acid concentrations in the liver were not different between VAD and VAS animals Figure( 4.2C).

A B C   

    

       

                                       Figure 4.2. Blood (A), biliary (B) and hepatic (C) bile acid concentration in control (VAS) and VAD rats Vitamin A depleted rats displayed a 199% increase in plasma bile acid concentration (VAD (n = 22) versus VAS (n = 18)) at 16 weeks of VAD diet (A). Bile acid concentration in bile (VAS (n = 4) versus VAD (n = 3)) and liver (VAS n=4 versus VAD livers (n = 4)) were not different. Data displayed as mean ± SD. *) significant difference between VAS and VAD, p<0.05.

Vitamin A Deficiency Does Not Majorly Affect Bile Acid Transporter mRNA -Ex pression Next, we analyzed whether the VAD-increased serum bile acid concentrations were accompanied by transcriptional changes in genes encoding proteins involved in bile acid transport in the liver (Figure 4.3A) and intestine (Figure 4.3B). Despite the increased concentrations of bile salts in plasma, transcription levels of hepatic Bsep and Ntcp and ileal Asbt and Ostβ were not significantly affected by vitamin A deficiency. Only Ostα and intestinal bile acid binding protein (Ibabp) mRNA levels were 1.6-fold and 1.7-fold increased on average, respectively, in VAD animals, compared to VAS animals. These data show that vitamin A deficiency per se does not significantly affect transcription of genes involved in bile salt transport.

110 Vitamin A Deficiency Causes Mild Cholestasis in Rats

A B Bsep Ostα Asbt 1.5 4 5 ) ) ) * 4 3 36B4 36B4 36B4 1.0 expression expression expression 3 α 2

Asbt 2 Ost Bsep 0.5 1 1 (mRNA versus (mRNA versus (mRNA versus Relative Relative Relative 0.0 0 0 VAS VAD VAS VAD VAS VAD

Ntcp Ostβ Ibabp 1.5 15 6 ) ) ) * 36B4 36B4 1.0 10 36B4 4 expression expression expression β Ntcp Ost 0.5 5 Ibabp 2 (mRNA versus (mRNA versus (mRNA versus Relative Relative 0.0 0 Relative 0 VAS VAD VAS VAD VAS VAD Figure 4.3. Vitamin A deficiency does not affect bile acid transporter mRNA expression RT-qPCR analysis of hepatic (A) and ileal (B) bile acid transporter expression in control (VAS) and VAD rats. Only the transcription of Ostα and Ibabp was increased in VAD compared to VAS rats. Data was corrected for 36B4 and is presented as a box plot with medians represented by the horizontal lines with the 75th percentiles at the top and the 25th percentiles at the bottom of the boxes. Ranges are represented as whiskers. *) significant difference between VAS and VAD, p<0.05.

Ntcp Protein Expression Was Not Affected by Vitamin A Deficiency Previously, we reported that cholate-fed VAD mice display reduced Ntcp protein levels in the liver despite an increase in Ntcp mRNA expression (Chapter 2). There- fore, we next studied the possibility of a VAD-dependent17 cm-double columndecrease in Ntcp protein expression in rats. Western blot analysis of total liver extracts revealed that NTCP 8,2 cm single column 8,2 cm single column levels were not reduced in VAD rats compared to VAS control rats (Figure 4.4). In addition, no difference in protein levels of hepatic BSEP, ileal OSTβ and ASBT was detected (data not shown).

0.9 ± 0.2 1.0 ± 0.1 rNTCP

rNa,K-ATPase a

VAS VAD Figure 4.4. Ntcp protein expression is not affected by vitamin A deficiency EqualFigure amounts 4.4 of protein from total liver homogenates from control (VAS) and VAD rats were analyzed for NTCP levels by western blotting. Similar levels of NTCP were detected in livers of VAS (n = 4) and VADNtcp (n expression = 4) animals. not decreased NTCP isexpression VAD animals. was quantified using Image Lab by Bio-Rad and corrected for + + expressionFiguren gebaseerd of the Na op ,8 K dieren, ATPase VAS-sham-vehicle alpha subunit. (n=4) Data versus presented VAD-sham-vehicle as mean ± (n=4) SD.

111 Chapter 4

Sustained Bile Salt Synthesis, Despite Increased Fgf15 Expression in Vitamin A Deficient Condition Transcript levels of Cyp7A1, the rate-limiting enzyme in bile acid synthesis, were highly variable in the VAD rats. Though a trend was observed of increasedCyp7A1 levels in the livers of VAD rats, this did not reach statistical significance Figure( 4.5A). Moreover, Cyp7A1 levels in the individual VAD rats did not correlate with the bile acid concentrations in blood. Shp levels were not significantly changed (Figure 4.5B and E). In contrast, Fgf15 transcript levels in the ileum were significantly increased in the VAD rats (Figure 4.5D), while the expression of the corresponding receptor in the liver, Fgfr4, was unchanged (Figure 4.5C). These data reveal that VAD does not cause major transcriptional effects on bile acid biosynthesis and that it makes bile acid biosynthesis unresponsive to Fgf15 mediated repression.

A Cyp7a1 B hepatic Shp C Fgfr4 8 4 1.5 ) ) )

6 3 36B4 36B4 36B4 xpression 1.0 expression 4 expression 2 Shp Fgfr4

Cyp7a1 e 0.5 2 1 (mRNA versus (mRNA versus (mRNA versus Relative Relative

Relative 0 0 0.0 VAS VAD VAS VAD VAS VAD

D Fgf15 E Ileal Shp 6 6 ) * ) 36B4 36B4

xpression 4 4 xpression Shp e Fgf15 e 2 2 (mRNA versus (mRNA versus Relative Relative 0 0 VAS VAD VAS VAD Figure 4.5. Increase in ileal Fgf15 expression fails to repress bile acid synthesis RT-qPCR analysis of hepatic (A-C) and ileal (D-E) factors controlling bile acid synthesis in control (VAS) and VAD rats. Expression of the rate-limiting enzyme in bile acid synthesis (Cyp7a1; A), as well as Shp (B, in liver; E, in ileum) and the FGF receptor 4 (Fgfr4) (C) was not significantly changed. mRNA expression of ileal Fgf15 was increased 3.9-fold (D) in VAD rats compared to VAS rats. Data was corrected for 36B4 and is presented as a box plot with medians represented by the horizontal lines with the 75th percentiles at the top and the 25th percentiles at the bottom of the boxes. Ranges are represented as whiskers. *) significant difference between VAS and VAD, p<0.05.

Discussion

In this study, we show that vitamin A deficiency in rats leads to mild cholestasis, without affecting bile acid concentrations in liver and bile. Remarkably, VAD did not cause major changes in transcript levels of the rate-limiting enzyme in bile acid synthesis nor in the transcript and protein levels of hepatic and ileal bile acid transporters. Ileal expression of Fgf15 is significantly induced, but appears ineffective in repressing bile salt synthesis in the liver.

112 Vitamin A Deficiency Causes Mild Cholestasis in Rats

Previously, we and others have shown that vitamin A-derived 9cRA is an important co-regulator of FXR/RXRα-mediated transcription of BSEP and SHP. 9cRA strongly represses FXR/CDCA-induced expression of BSEP by preventing the binding of the FXR/RXR heterodimer to the hBSEP promoter element (35, 36). In contrast, 9cRA induces SHP expression in a mechanism that is independent of the FXR/CDCA-modulated SHP expression. These observations suggest that the vitamin A status may be important to maintain normal bile salt homeostasis. Indeed, we found that rats that just reached vitamin A deficiency have significantly increased bile acid concentrations in blood, while these concentrations are normal in liver and bile. However, the increased bile acid concentrations in blood were not accompanied by changed expression in bile acid transporters nor the rate-limiting enzyme in bile salt synthesis. The increased bile acid concentrations in blood, with normal hepatic and biliary bile acid concentrations, imply that import into hepatocytes is compromised and export is maintained. However, the transcript and protein levels of the predominant bile salt importer, NTCP, are not changed in the livers of VAD rats. Moreover, the FXR regulatory system seems insensitive to increased bile salt concentrations as compensatory mechanisms are not activated, e.g. Bsep and Shp expression are not induced and Cyp7A1 expression is not repressed. A similar phenomenon is observed in bile duct-ligated rats, where Cyp7A1 expression is induced under cholestatic conditions. This led to the identification of a second repressive mechanism acting onCyp7A1 , e.g Fgf15. Bile acids induce expression of FGF15 in the ileum, which signals to the liver to repress Cyp7A1 (28). This CYP7A1 repressive pathway is blocked in bile duct-ligated rats, where intestinal bile acid concentrations are extremely low with strongly reduced FGF15 expression as a result. Remarkably, ileal Fgf15 expression is induced in VAD rats, but does not lead to repression of Cyp7A1 expression. In line with the induced ileal Fgf15 expression in VAD rats, also expression of Ostα and Ibabp is induced in the gut, indicating increased bile acid signaling in the ileal epithelium. Increased expression of these genes under VAD conditions suggests that there is an increased bile acid flow through the enterocyte and elevatedOstα may contribute to the increased serum bile acid levels. However, OSTα requires OSTβ to become a functional bile acid transporters at the basolateral membrane of enterocytes and the expression of Ostβ is not changed in VAD, but may be present in excess over OSTα so that the bile acid export capacity in enterocytes is primarily controlled by regulating OSTα levels. In contrast to human ASBT, rat Asbt is not reported to be a target gene of RAR. In addition, human and mouse, but not rat Asbt expression is negatively regulated by bile acids (25, 45). Concurrently, we detected no change in ileal ASBT expression in VAD rats. Both McClintick et al. and Kang et al. studied the genome-wide transcriptional effects of VAD in rodent livers in rats and mice, respectively. Changes in transcript levels of genes encoding bile acid transporters were not reported. A minor 1.4-fold decrease was detected for Fxr, but this had no effect on downstream targets, further confirming that not so much the absolute level of FXR is important, but rather its bile salt-activated state (46, 47).

113 Chapter 4

The reason why VAD rats develop mild cholestasis therefore requires further investi- gation. A change in bile acid profile or level of glycine/taurine-conjugation may cause a less efficient uptake via NTCP, which may not be fully compensated by other bile acid transporters at the basolateral membrane, like OATPs. Such a change in profile would, however, also results in poor export from the hepatocyte by BSEP, which does not seem to be the case given the normal bile salt concentrations in liver and bile in VAD rats. Alternatively, VAD may lead to circulating metabolites that inhibit the transport activity of NTCP. While several drugs have been found to inhibit the transport activity of NTCP, no endogenous compounds have so far been demonstrated to be able to do so (48-50). Cyp7a1 is a known target gene of RAR and transcript levels are increased by retinoic acid (51). However, VAD did not strongly affectCyp7a1 expression and if any, it was increased rather than decreased. Moreover, bile acid concentrations in blood were elevated in VAD rat. This happens under conditions were the ileal mechanism to repress bile acid synthesis (Fgf15) is activated (Figure 4.5). A similar observation was made in VAD mice (36). Though serum bile acids levels were not significantly increased in VAD mice, they do seem to suffer from an impaired negative feedback regulation on bile acid synthesis. Cholic acid (CA)-feeding elevated plasma bile acids in VAD mice, but not in VAS animals, while Cyp7a1 and Shp mRNA expression remained unaffected Figure( 2.6). Thus, sufficient vitamin A seems to be required for effective repression of bile salt synthesis. Physiologically, this make sense. Bile acids are required for effective absorption of vitamin A in the intestine. If vitamin A levels are insufficient, increased bile acid production and secretion may help to maximize absorption of this important vitamin in the intestine. However, increasing bile salt production and secretion may aggravate liver disease especially in obstructive cholestasis. Further research is required to determine the potential therapeutic effect of vitamin A supplementation in cholestatic liver disease under conditions where vitamin A levels are severely decreased.

Acknowledgements

The authors thank E.E.A. Venekamp-Hoolsema for technical assistance in the retinol measurements and V.W. Bloks for his advice on data analysis.

114 Vitamin A Deficiency Causes Mild Cholestasis in Rats

References

1. Reifen R. Vitamin A as an anti-inflammatory agent. Proc Nutr Soc 2002 Aug;61(3):397-400. 2. Blomhoff R, Blomhoff HK. Overview of retinoid metabolism and function. J Neurobiol 2006 Jun;66(7):606- 630. 3. Stephensen CB. Vitamin A, infection, and immune function. Annu Rev Nutr 2001;21:167-192. 4. Clarke N, Germain P, Altucci L, Gronemeyer H. Retinoids: potential in cancer prevention and therapy. Ex- pert Rev Mol Med 2004 Nov 30;6(25):1-23. 5. Harrison EH. Mechanisms of digestion and absorption of dietary vitamin A. Annu Rev Nutr 2005;25:87- 103. 6. Senoo H. Structure and function of hepatic stellate cells. Med Electron Microsc 2004 Mar;37(1):3-15. 7. Heyman RA, Mangelsdorf DJ, Dyck JA, Stein RB, Eichele G, Evans RM, et al. 9-cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell 1992 Jan 24;68(2):397-406. 8. Levin AA, Sturzenbecker LJ, Kazmer S, Bosakowski T, Huselton C, Allenby G, et al. 9-cis retinoic acid stereoisomer binds and activates the nuclear receptor RXR alpha. Nature 1992 Jan 23;355(6358):359-361. 9. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, et al. Characterization of three RXR genes that mediate the action of 9-cis retinoic acid. Genes Dev 1992 Mar;6(3):329-344. 10. Allenby G, Janocha R, Kazmer S, Speck J, Grippo JF, Levin AA. Binding of 9-cis-retinoic acid and all-trans-retinoic acid to retinoic acid receptors alpha, beta, and gamma. Retinoic acid receptor gamma binds all-trans-retinoic acid preferentially over 9-cis-retinoic acid. J Biol Chem 1994 Jun 17;269(24):16689- 16695. 11. Repa JJ, Hanson KK, Clagett-Dame M. All-trans-retinol is a ligand for the retinoic acid receptors. Proc Natl Acad Sci U S A 1993 Aug 1;90(15):7293-7297. 12. Wang H, Chen J, Hollister K, Sowers LC, Forman BM. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 1999 May;3(5):543-553. 13. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, et al. Bile acids: natural ligands for an orphan nuclear receptor. Science 1999 May 21;284(5418):1365-1368. 14. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, et al. Identification of a nuclear receptor for bile acids. Science 1999 May 21;284(5418):1362-1365. 15. Plass JR, Mol O, Heegsma J, Geuken M, Faber KN, Jansen PL, et al. Farnesoid X receptor and bile salts are involved in transcriptional regulation of the gene encoding the human bile salt export pump. Hepatology 2002 Mar;35(3):589-596. 16. Landrier JF, Eloranta JJ, Vavricka SR, Kullak-Ublick GA. The nuclear receptor for bile acids, FXR, transactivates human organic solute transporter-alpha and -beta genes. Am J Physiol Gastrointest Liver Physiol 2006 Mar;290(3):G476-G485. 17. Lee H, Zhang Y, Lee FY, Nelson SF, Gonzalez FJ, Edwards PA. FXR regulates organic solute transporters alpha and beta in the adrenal gland, kidney, and intestine. J Lipid Res 2006 Jan;47(1):201-214. 18. Holt JA, Luo G, Billin AN, Bisi J, McNeill YY, Kozarsky KF, et al. Definition of a novel growth factor-dependent signal cascade for the suppression of bile acid biosynthesis. Genes Dev 2003 Jul 1;17(13):1581-1591. 19. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, et al. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 2000 Sep;6(3):507-515. 20. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, et al. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000 Sep;6(3):517-526. 21. Chen W, Owsley E, Yang Y, Stroup D, Chiang JY. Nuclear receptor-mediated repression of human cholesterol 7α-hydroxylase gene transcription by bile acids. J Lipid Res 2001 Sep;42(9):1402-1412. 22. Li J, Pircher PC, Schulman IG, Westin SK. Regulation of complement C3 expression by the bile acid receptor FXR. J Biol Chem 2005 Mar 4;280(9):7427-7434.

115 Chapter 4

23. Denson LA, Sturm E, Echevarria W, Zimmerman TL, Makishima M, Mangelsdorf DJ, et al. The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. Gastroen- terology 2001 Jul;121(1):140-147. 24. Li H, Chen F, Shang Q, Pan L, Shneider BL, Chiang JY, et al. FXR-activating ligands inhibit rabbit ASBT expression via FXR-SHP-FTF cascade. Am J Physiol Gastrointest Liver Physiol 2005 Jan;288(1):G60-G66. 25. Neimark E, Chen F, Li X, Shneider BL. Bile acid-induced negative feedback regulation of the human ileal bile acid transporter. Hepatology 2004 Jul;40(1):149-156. 26. Gupta S, Stravitz RT, Dent P, Hylemon PB. Down-regulation of cholesterol 7α-hydroxylase (CYP7A1) gene expression by bile acids in primary rat hepatocytes is mediated by the c-Jun N-terminal kinase pathway. J Biol Chem 2001 May 11;276(19):15816-15822. 27. Wang L, Lee YK, Bundman D, Han Y, Thevananther S, Kim CS,et al. Redundant pathways for negative feedback regulation of bile acid production. Dev Cell 2002 Jun;2(6):721-731. 28. Inagaki T, Choi M, Moschetta A, Peng L, Cummins CL, McDonald JG, et al. Fibroblast growth factor 15 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab 2005 Oct;2(4):217-225. 29. Makishima M, Lu TT, Xie W, Whitfield GK, Domoto H, Evans RM,et al. Vitamin D receptor as an intestinal bile acid sensor. Science 2002 May 17;296(5571):1313-1316. 30. Adachi R, Honma Y, Masuno H, Kawana K, Shimomura I, Yamada S, et al. Selective activation of vitamin D receptor by lithocholic acid acetate, a bile acid derivative. J Lipid Res 2005 Jan;46(1):46-57. 31. Staudinger JL, Goodwin B, Jones SA, Hawkins-Brown D, MacKenzie KI, LaTour A, et al. The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc Natl Acad Sci U S A 2001 Mar 13;98(6):3369-3374. 32. Jiang W, Miyamoto T, Kakizawa T, Nishio SI, Oiwa A, Takeda T, et al. Inhibition of LXRα signaling by vitamin D receptor: possible role of VDR in bile acid synthesis. Biochem Biophys Res Commun 2006 Dec 8;351(1):176-184. 33. Dong D, Noy N. Heterodimer formation by retinoid X receptor: regulation by ligands and by the receptor's self-association properties. Biochemistry 1998 Jul 28;37(30):10691-10700. 34. Desvergne B. RXR: from partnership to leadership in metabolic regulations. Vitam Horm 2007;75:1-32. 35. Kassam A, Miao B, Young PR, Mukherjee R. Retinoid X receptor (RXR) agonist-induced antagonism of farnesoid X receptor (FXR) activity due to absence of coactivator recruitment and decreased DNA binding. J Biol Chem 2003 Mar 21;278(12):10028-10032. 36. Hoeke MO, Plass JR, Heegsma J, Geuken M, van Rijsbergen D, Baller JF, et al. Low retinol levels differentially modulate bile salt-induced expression of human and mouse hepatic bile salt transporters. Hepatology 2009 Jan;49(1):151-159. 37. Phillips JR, Angulo P, Petterson T, Lindor KD. Fat-soluble vitamin levels in patients with primary biliary cirrhosis. Am J Gastroenterol 2001 Sep;96(9):2745-2750. 38. Strople J, Lovell G, Heubi J. Prevalence of subclinical vitamin K deficiency in cholestatic liver disease. J Pe- diatr Gastroenterol Nutr 2009 Jul;49(1):78-84. 39. Main AN, Mills PR, Russell RI, Bronte-Stewart J, Nelson LM, McLelland A, et al. Vitamin A deficiency in Crohn's disease. Gut 1983 Dec;24(12):1169-1175. 40. Zaman Z, Fielden P, Frost PG. Simultaneous determination of vitamins A and E and carotenoids in plasma by reversed-phase HPLC in elderly and younger subjects. Clin Chem 1993 Nov;39(11 Pt 1):2229-2234. 41. Kuipers F, van Ree JM, Hofker MH, Wolters H, In't Veld G, Havinga R, et al. Altered lipid metabolism in apolipoprotein E-deficient mice does not affect cholesterol balance across the liver. Hepatology 1996 Jul;24(1):241-247. 42. Jung D, Elferink MG, Stellaard F, Groothuis GM. Analysis of bile acid-induced regulation of FXR target genes in human liver slices. Liver Int 2007 Feb;27(1):137-144. 43. Blokzijl H, Vander Borght S, Bok LI, Libbrecht L, Geuken M, van den Heuvel FA, et al. Decreased P-glycoprotein (P-gp/MDR1) expression in inflamed human intestinal epithelium is independent of PXR protein levels. Inflamm Bowel Dis 2007 Jun;13(6):710-720.

116 Vitamin A Deficiency Causes Mild Cholestasis in Rats

44. Stieger B, Hagenbuch B, Landmann L, Hochli M, Schroeder A, Meier PJ. In situ localization of the hepatocy- tic Na+/Taurocholate cotransporting polypeptide in rat liver. Gastroenterology 1994 Dec;107(6):1781-1787. 45. Chen F, Ma L, Dawson PA, Sinal CJ, Sehayek E, Gonzalez FJ, et al. Liver receptor homologue-1 mediates species- and cell line-specific bile acid-dependent negative feedback regulation of the apical sodium-dependent bile acid transporter. J Biol Chem 2003 May 30;278(22):19909-19916. 46. McClintick JN, Crabb DW, Tian H, Pinaire J, Smith JR, Jerome RE, et al. Global effects of vitamin A deficiency on gene expression in rat liver: evidence for hypoandrogenism. J Nutr Biochem 2006 May;17(5):345-55. 47. Kang HW, Bhimidi GR, Odom DP, Brun PJ, Fernandez ML, McGrane MM. Altered lipid catabolism in the vitamin A deficient liver. Mol Cell Endocrinol 2007 Jun 15;271(1-2):18-27. 48. Leslie EM, Watkins PB, Kim RB, Brouwer KL. Differential inhibition of rat and human Na+-dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1)by bosentan: a mechanism for species differences in hepatotoxicity. J Pharmacol Exp Ther 2007 Jun;321(3):1170-1178. 49. Greupink R, Dillen L, Monshouwer M, Huisman MT, Russel FG. Interaction of fluvastatin with the liver-specific Na+ -dependent taurocholate cotransporting polypeptide (NTCP). Eur J Pharm Sci 2011 Nov 20;44(4):487-496. 50. Greupink R, Nabuurs SB, Zarzycka B, Verweij V, Monshouwer M, Huisman MT, et al. In silico identification of potential cholestasis-inducing agents via modeling of Na+-dependent taurocholate cotransporting polypeptide substrate specificity. Toxicol Sci 2012 Sep;129(1):35-48. 51. Crestani M, Sadeghpour A, Stroup D, Galli G, Chiang JY. Transcriptional activation of the cholesterol 7α-hydroxylase gene (CYP7A) by nuclear hormone receptors. J Lipid Res 1998 Nov;39(11):2192-2200.

117 Chapter 4

Supplementary data

Table S4.1. Taqman primer-probe sets used for RT-qPCR Gene Oligo sequences Asbt/Scl10a2 Fwd: 5'-ACCACTTGCTCCACACTGCTT-3' (NM_017222) Rev: 5'-CGTTCCTGAGTCAACCCACAT-3' Probe: 5'-CTTGGAATGATGCCCCTTTGCCTCT-3' Bsep/Abcb11 Fwd: 5'-CCAAGCTGCCAAGGATGCTA-3' (NM_031760) Rev: 5'-CCTTCTCCAACAAGGGTGTCA-3' Probe: 5'-CATTATGGCCCTGCCGCAGCA-3' Cyp7a1 Fwd: 5'-CAGGGAGATGCTCTGTGTTCA-3' (NM_012942.1) Rev: 5'-AGGCATACATCCCTTCCGTGA-3' Probe: 5'-TGCAAAACCTCCAATCTGTCATGAGACCTCC-3' Fgf15 Fwd: 5'-GCCATCAAGGACGTCAGCA-3' (NM_130753) Rev: 5'-CTTCCTCCGAGTAGCGAATCAG-3' Probe: 5'-CGCTCATGCAGAGGTACCGCACG-3' Fgfr4 Fwd: 5'-TCGTTATCAACGGCAGCAGTT-3' (BC100260.1) Rev: 5'-TTGATGTCTGTTGTCTTCAGGACTT-3' Probe: 5'-CGGCGCTGATGGTTTCCCCTACGTA -3' Ntcp/Slc10a1 Fwd: 5'-ATGACCACCTGCTCCAGCTT-3' (M77479) Rev: 5'-GCCTTTGTAGGGCACCTTGT-3' Probe: 5'-CCTTGGGCATGATGCCACTCCTC-3' Ostα Fwd: 5'-AGTTTGCTCTGTTCCAGGTGCTT-3' (NM_145932.3) Rev: 5'-TGTTAGCCAAGATGGAGAAAATGG-3' Probe: 5'-CATCCTGACCGCCCTGCAGCC-3' Ostβ Fwd: 5'-CCCAGATCCAGGCCCAGA-3' (XM_238546.3) Rev: 5'-CGGCACTGGCTGCAGC-3' Probe: 5'-AGGATCAGGAGCATGGACCACAGTGC -3' Shp/Nr0b2 Fwd: 5'-ACCTGCAACAGGAGGCTCACT-3' (NM_057133) Rev: 5'-TGGAAGCCATGAGGAGGATTC-3' Probe: 5'-TCCTGGAGCCCTGGTACCCAGCTAGC-3' 36B4 Fwd: 5'-GCTTCATTGTGGGAGCAGACA-3' (NM_022402) Rev: 5'-CATGGTGTTCTTGCCCATCAG-3' Probe: 5'-TCCAAGCAGATGCAGCAGATCCGC-3'

Sequences of primer/probe sets used for studying gene transcription. Probes were FAM/TAMRA-labeled.

118 Chapter 5

Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis Which Is Effectively Treated by Acute Vitamin A Supplementation

Martijn O. Hoeke, Mark Hoekstra, Janette Heegsma, Han Moshage and Klaas Nico Faber

Department of Gastroenterology and Hepatology, University Medical Center Groningen, Groningen, University of Groningen, The Netherlands

In preparation Chapter 5

Abstract

Cholestasis is accompanied by malabsorption of fat-soluble vitamins, including vitamin A. Moreover, the stellate cells in the liver lose their vitamin A stores upon cholestatic liver injury and start producing excessive amounts of extracellular matrix leading to liver fibrosis. As a consequence, chronic cholestasis is associated with hypovitaminosis A. Vitamin A is an antioxidant and its derivatives are crucial signaling molecules for the retinoid X receptor alpha (RXRα) that regulates bile salt homeostasis in conjunction with the farnesoid X receptor (FXR). Supplementing cholestatic patients with vitamin A is, however, a controversial issue. We studied the effect of vitamin A deficiency and retinyl palmitate (RP) therapy in an animal model of cholestasis. Rats were made vitamin A deficient (VAD) by omitting vitamin A from their diet for 16 weeks, followed by ligation of the common bile duct (BDL) or a sham operation. 7 Days later the animals were sacrificed. During the final 7 days, half of the animals received daily IP injections with RP. BDL induced a dramatic weight loss in VAD rats (-15 to -20% in 7 days, compared to -5% in vitamin A sufficient (VAS)-BDL rats) and serum hepatic damage markers (AST/ALT) were approximately 10-fold increased compared to BDL rats receiving an VAS diet. Markers for oxidative stress (Ho-1), inflammation iNos( ), fibrosis (α-Sma and Col1a1) were strongly increased. Large regions of necrotic hepatocytes were observed in VAD-BDL rats together with strong proliferation of bile ductular cells. Importantly, all these liver disease markers were efficiently reversed by RP supplementation to the level observed in VAS-BDL rats. Only minor changes in hepatic transcriptional regulation of bile salt homeostasis were detected. We conclude that vitamin A deficiency dramatically aggravates liver damage caused by obstructive cholestasis, but is efficiently prevented by vitamin A supplementation. These data warrant a detailed analysis of the hepatoprotective effect of vitamin A in patients with chronic cholestasis.

Introduction

Vitamin A is an important nutrient during all stages of mammalian life and is essential in embryogenesis, differentiation of tissues and fertility. Moreover, it is required for eyesight, immune competence and has anti-inflammatory properties. Most of its actions are performed through activation of the nuclear receptors retinoic acid receptor (RAR) and retinoid X receptor (RXR) that are ligand-activated transcription factors responding to vitamin A-derivatives, including all-trans and 9-cis retinoic acid (1, 2). In addition, vitamin A may act as an antioxidant (3, 4). Mammals cannot synthesize vitamin A themselves, so they need to obtain it from their diet, either as pro-vitamin A carotenoids from fruits or vegetables or as retinyl esters from animal sources.

120 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis

Vitamin A is a fat-soluble vitamin and its efficient absorption in the intestine depends on the action of bile salts (5, 6). Bile salts are synthesized in the hepatocytes in the liver and secreted via the common bile duct and the gallbladder into the duodenum. They form mixed-micelles with phospholipids and those act as carriers for a great variety of fat-soluble compounds in the small intestine. This allows efficient absorption, as for the fat-soluble vitamins A, D E and K, as well as the effective excretion of waste products from the body, including cholesterol and toxins. At the terminal ileum, bile salts are effectively absorbed and via the circulation transported back to the liver to be reused. This enterohepatic circulation of bile salts is highly efficient. Per cycle only approximately 5% escapes intestinal reabsorption and is excreted through the feces. De novo synthesis of bile salts in the liver compensates for the fecal loss of bile salts. (7). Most of the vitamin A that is absorbed in the intestine is also transported to the liver and stored in lipid droplets in hepatic stellate cells. Over 80% of the total vitamin A pool in the healthy body is present in these liver cells (8). Many liver diseases, both acute and chronic, affect the production and/or secretion of bile salts resulting in cholestasis, e.g. accumulation of bile salts in blood and liver caused by an impaired bile flow. This leads to malabsorption of fat-soluble compounds in the intestine, including the vitamins A, D, E and K. Liver injury, at the same time, leads to the activation, proliferation and differentiation of stellate cells that overproduce extracellular matrix proteins, like collagens and fibronectins, giving rise to fibrosis. The hepatic stellate cells lose their vitamin A content in this transdif- ferentiation process (8). As a result, chronic liver diseases are associated with vitamin A deficiency/hypovitaminosis A, as described for biliary atresia (9), primary biliary cirrhosis (PBC) (10) and cholelithiasis (gallstone disease) (11). Vitamin A supplementation in the treatment of these patients remains a controversial issue though (12). Vitamin A supplementation has been shown to reduce cholestasis and liver fibrosis in experimental animal models of liver disease including bile duct ligation and chronic CCl4 administration (13-18). On the other hand, vitamin A overdosing can also cause jaundice (19), cholestasis (20, 21) and fibrosis (22). Previously, we found that vitamin A (-derivatives) also affect bile salt synthesis and transport directly. They act via RXRα (NR2B1), which is the obligatory heterodimer partner of the farnesoid X receptor (FXR/NR1H4) (23), the mammalian bile salt sensor (24-26). FXR/RXRα regulates (directly or indirectly) transcription of key genes involved in bile salt synthesis and transport, including cholesterol 7-alpha-hydroxylase (CYP7A1) and the bile salt export pump (BSEP/ABCB11). Both genes are maximally expressed in the absence of 9-cis retinoic acid (27, 28). Moreover, we found that vitamin A deficiency alone leads to mild cholestasis in rats, most likely due to post-translational mechanisms. Thus, hypovitaminosis A effects bile homeostasis and may directly or indirectly affect the course of liver disease in obstructive cholestasis. Here, we studied the effect of vitamin A deficiency on liver injury in an animal model for obstructive cholestasis. In addition, we determined the acute effect of vitamin A supplementation on putative excessive liver damage in vitamin A deficient rats with obstructive cholestasis.

121 Chapter 5

Material and methods

Animals All animal experiments were approved by the ethics committee for animal testing of the University of Groningen, The Netherlands. Weaning male Wistar rats (35-50 grams) (Harlan, Horst, The Netherlands) were fed either a vitamin A deficient (VAD) diet TD.86143 (Harlan Teklad, Madison, USA) (n=22) or a vitamin A sufficient (VAS) diet TD.91280 (Harlan Teklad, Madison, USA) (n=18). The VAS diet was identical to the VAD diet, but supplemented with 20,000 U/kg vitamin A. Animals were housed in a temperature-controlled environment with alternating 12 hours light and dark cycles. Food and water were available ad libitum. Blood samples were taken at different time points during the diet phase to monitor the plasma retinol levels. Experimental design: After 16 weeks on the VAD/VAS diet, animals were bile duct-ligated (BDL) (VAD n=14; VAS n=10) or were given a sham treatment (VAD n=8; VAS n=8). After surgery animals continued on the same diet as before. Starting from the day of surgery, rats were IP injected daily with 50 U/g body weight retinyl palmitate (RP) (Sigma Aldrich, St. Louis, USA) diluted in corn oil (Sigma Aldrich, St. Lou- is MO, USA), or vehicle. RP or vehicle was given to VAD-BDL (n=7), VAD-sham (n=4), VAS-BDL (n=5) and VAS-sham (n=4) animals. Rats were sacrificed 7 days after BDL or sham surgery.

Biochemical Procedures Retinol (29) and total bile salt concentrations (30, 31) were determined in blood plasma and liver tissue as described. Concentrations of hepatic and bile ductular enzymes aspartate transaminase (AST), alanine transaminase (ALT), alkaline phosphatase (AP) and gamma-glutamyl transferase (γGT) levels were determined in blood plasma. mRNA was isolated from hepatic, ileal and renal tissue using the Nucleospin II RNA kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s recommendations. RT-qPCR was performed as described before (32). Taqman primer-probe sets used are displayed in Table 5.1. Protein expression was determined by western blot analysis, expression was quantified using the Quantity One software package (Biorad, Hercules CA, USA). BSEP and HO-1 were detected using K12 (anti-BSEP; (33)) and OSA-111 (anti-HO-1; Stress- gen, Victoria BC, Canada) respectively followed by goat anti-rabbit immunoglobulins/HRP (P0448, Dako, Glostrup, Denmark). α-SMA and GAPDH were detected using A-2547 (anti-α-Sma; Sigma Aldrich, St. Louis MO, USA) and 6C5 (anti-GAP- DH, CB1001, Calbiochem, Darmstadt, Germany), respectively, followed by rabbit anti-mouse immunoglobulins/HRP, (P0260, Dako Glostrup, Denmark). Sodium potassium ATPase was detected using anti-Na+K+-ATPase (kind gift from Dr. W. Pe- ters, St. Radboud University Medical Center, Nijmegen, The Netherlands) followed by rabbit anti-goat immunoglobulins/HRP (P0160, Dako).

122 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis

Immunohistochemistry on liver slides was performed as described before using K12 (α-BSEP) followed by Alexa Fluor 488, goat anti-rabbit IgG (H+L) (A11008, Invitro- gen, Paisley, United Kingdom) and M7249 (α-Ki67; Dako) followed by goat anti-rabbit immunoglobulins/biotinylated, (E0432, Dako) followed by peroxidase-conjugated streptavidin (P0397, Dako) (27).

Table 5.1. TaqMan primer-probe sets used for RT-qPCR Gene Oligo sequences α-Sma Fwd: 5'-GCCAGTCGCCATCAGGAAC-3' (NM_031004) Rev: 5'-CACACCAGAGCTGTGCTGTCTT-3' Probe: 5'-CTTCACACATAGCTGGAGCAGCTTCTCGA-3' Bsep Fwd: 5'-CCAAGCTGCCAAGGATGCTA-3' (NM_031760) Rev: 5'-CCTTCTCCAACAAGGGTGTCA-3' Probe: 5'-CATTATGGCCCTGCCGCAGCA-3' Krt19 Fwd: 5'-GAGGACTTGCGCGACAAGA-3' (NM_199498.1) Rev: 5'-GCGGGCATTGTCGATCTG-3' Probe: 5'-CGCCACCATTGAGAACTCCAAGATAGCCT-3' Col1a1 Fwd: 5'-TGGTGAACGTGGTGTACAAGGT-3' (NM_007742) Rev: 5'-CAGTATCACCCTTGGCACCAT-3' Probe: 5'-TCCTGCTGGTCCCCGAGGAAACA-3' Cyp7a1 Fwd: 5'-CAGGGAGATGCTCTGTGTTCA-3' (NM_012942.1) Rev: 5'-AGGCATACATCCCTTCCGTGA-3' Probe: 5'-TGCAAAACCTCCAATCTGTCATGAGACCTCC-3' Ho-1 Fwd: 5'-CACAGGGTGACAGAAGAGGCTAA-3' (NM_012580) Rev: 5'-CTGGTCTTTGTGTTCCTCTGTCAG-3' Probe: 5'-CAGCTCCTCAAACAGCTCAATGTTGAGC-3' iNos Fwd: 5'-GTGCTAATGCGGAAGGTCATG-3' (NM_012611.2) Rev: 5'-CGACTTTCCTGTCTCAGTAGCAAA-3' Probe: 5'-CCCGCGTCAGAGCCACAGTCCT-3' 18S Fwd: 5'-CGGCTACCACATCCAAGGA-3' (M11188.1) Rev: 5'-CCAATTACAGGGCCTCGAAA-3' Probe: 5'-CGCGCAAATTACCCACTCCCGA-3'

Probes used for RT-qPCR were FAM TAMRA labeled.

Statistical Analysis Relative mRNA levels were corrected for 18S and presented as a box plot with medians represented by the horizontal lines with the 75th percentiles at the top and the 25th percentiles at the bottom of the boxes. Ranges are represented as whiskers. Other data are presented as mean ± SD. Differences between the animal groups were determined with SPSS 17.0 (IBM, Armonk NY, USA) by Kruskal-Wallis followed by pair wise comparison of groups by Mann-Whitney U with p<0.05.

123 Chapter 5

Results

Vitamin A Depletion by Diet Does Not Affect Animal Growth To establish vitamin A deficiency, weaning male Wistar rats were fed a diet lacking this vitamin. No significant differences were detected in bodyweight of the animals receiving a control diet containing standard amounts (20,000 IU/kg) of vitamin A (VAS; vitamin A sufficient) (n=18) or a vitamin A deficient (VAD) (n=22) diet after 16 weeks on these diets (Figure 5.1A). After 16 weeks VAD diet, the plasma retinol levels had dropped 77% to 0.025 ± 0.012 mg/ml (Figure 5.1B).

A B 600 0.15

400 0.10

200 0.05

Bodyweight (g) * Plasma retinol (mg/L) 0 0.00 VAS VAD VAS VAD 16 weeks of diet 16 weeks of diet

Figure 5.1. VAD diet did not affect the growth of the animals Weaning male Wistar rats were fed either a vitamin A sufficient (VAS) (n=18) or deficient (VAD) (n=22) diet A). No significant differences were detected in bodyweight of the animals receiving a VAS or VAD diet over the whole period of 16 weeks. B) After 16 weeks (pri- or to BDL/sham surgery) VAD diet, the plasma retinol levels dropped in to on average 23%. Data displayed as mean ± SD. *) significant difference between VAS and VAD, p<0.05.

Vitamin A Deficiency Aggravates the Obstructive Cholestatic Phenotype After 16 weeks on diet, all animals underwent surgery, either a ligation of the common bile duct (BDL) or a sham operation, and were subdivided into 4 groups; VAS- sham, VAS-BDL, VAD-sham and VAD-BDL (Figure 5.2). The VAS-sham, VAD- sham and VAS-BDL animals lost approximately 5% body weight in the first 2 days following surgery, after which it stabilized until sacrifice at day 7 (Figure 5.2A). In contrast, VAD-BDL rats continued to lose weight almost linearly during the whole 7 day period post-surgery. On average they had lost approximately 70 grams (= 13%) bodyweight at time of sacrifice. Upon retrieval of the livers, clear macroscopic liver damage, e.g. yellow spots at the surface (Figure 5.2C), was observed in livers of the VAD-BDL animals, whereas this was not evident in livers from VAS-BDL (Figure 5.2B) and the sham operated animal (not shown). Moreover, bile accumulation was observed immediately before the site of ligation dilating the common bile duct and containing over 1 ml of bile. No such “bile sacs” were formed in VAS-BDL rats, or were merely the size of a pin-head from which only minor amounts of bile was re- trieved (data not shown).

124 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis

A D 8000 a,b,c 100 6000 95 4000 AST (U/L) 90 2000 b,d a,d d 0 Sham BDL Sham BDL 85 8 6 4 2 VAS VAD

Bodyweight % of day 0 E 80 2000 a,b,c 0 1 2 3 4 5 6 7 Days after BDL 1500

VAS-sham VAD-sham 1000

VAS-BDL VAD-BDL ALT (U/L) 500 d d d B VAS-BDL 0 Sham8 BDL6 Sham4 BDL2 VAS VAD F 200 a,c

150

a,c 100 AP (U/L)AP 50 b,d b,d 0 Sham8 BDL6 Sham4 BDL2 C VAD-BDL VAS VAD G 600 a,b,c

400 GT (U/L)

γ 200

d c,d b,d 0 Sham BDL Sham BDL 8 6 4 2 VAS VAD

Figure 5.2. Vitamin A deficiency dramatically aggravates obstructive cholestatic disease course Vitamin A sufficient (VAS) and deficient (VAD) rats were bile duct ligated (BDL) or sham treated and sacrificed 7 days after surgery. A) VAD-BDL animals dramatically lost weight, while animals in the VAS- BDL group had weights similar to sham treated animals on either diet. Data displayed as percentage of weight prior to BDL (day 0), mean ± SD. VAD-BDL animals showed clear macroscopic liver damage (C) compared to livers of VAS-BDL animals (B). Vitamin A deficiency strongly increased serum levels of hepatic and ductural damage markers aspartate transaminase (AST) (D), alanine transaminase (ALT) (E), alkaline phosphatase (AP) (F) and gamma-glutamyl transferase (γGT) (G) as a consequence of bile duct ligation. Data displayed as a box plot with medians represented by the horizontal lines with the 75th percentiles at the top and the 25th percentiles at the bottom of the boxes. Ranges are represented as whiskers. Significant difference between groups, p<0.05, asignificantly different from VAS-sham;b significantly different from VAS-BDL; csignificantly different from VAD-sham; dsignificantly different from VAD-BDL.

125 Chapter 5

As documented before (34), 7 days BDL in control (VAS) rats leads to slightly increased AST levels compared to sham-operated VAS rats (Figure 5.2D; 259 ± 71 versus 124 ± 158 U/L). A significant increase was also detected for serum AP levels (Figure 5.2F, 0.7 ± 0.6 versus 52 ± 32 U/L for VAS-sham and VAS-BDL, respectively). No significant increase was detected in serum ALT and γGT levels after 7 days BDL in VAS animals (Figure 5.2E and G). VAD alone did not lead to an increase in any of these markers in the serum of sham operated rats. In sharp contrast, serum levels of AST, ALT and γGT were strongly elevated and respectively 12.2-, 7.7- and 183-fold higher in VAD-BDL rats compared to VAS-BDL rats (Figure 5.2D, E and G). While clearly increased in VAD-BDL animals, AP serum levels were not significantly higher compared to the VAS-BDL group (Figure 5.2F). Remarkably, BDL led to a further reduction of serum retinol levels both in VAS (from 0.289 ± 0.014 U/L to 0.141 ± 0.054 U/L) and VAD (from 0.043 ± 0.022 U/L to 0.006 ± 0.007 U/L) rats compared to their respective control rats (Table 5.2). In contrast, retinol levels in the livers of VAS-BDL rats were significantly increased (10.53 ± 3.93 mg/ml versus 16.98 ± 7.44 in mg/ml VAS-sham and VAS-BDL, respectively). Hepatic retinol levels were low in VAD-sham rats and remained unchanged after BDL, suggesting the absence of alternative retinol stores. Collectively, these data show that vitamin A deficiency severely aggravates liver damage in obstructive cholestasis in rats.

Vitamin A Therapy Prevents Liver Injury in Vitamin A Deficient Cholestatic Rats In order to determine whether acute supplementation of vitamin A may prevent excessive liver damage, VAD-BDL rats received daily IP injections with retinyl palmitate (RP; 50 U/g bodyweight) on all days following surgery. Half of the animals from the other 3 groups (VAS-sham, VAS-BDL and VAD-sham) also received RP-therapy for control analyses. RP supplementation increased serum retinol concentrations in VAD-BDL rats to levels comparable to VAS-BDL rats (Table 5.2; 0.145 ± 0.046 mg/ ml versus 0.141 ± 0.054 mg/ml, respectively). Moreover, RP supplementation increased the hepatic retinol levels both in the VAS-BDL and the VAD-BDL group, indicating BDL-induced hepatic recruitment of retinol(s). RP supplementation significantly suppressed the excessive weight loss of the VAD-BDL animals, which stabilized at approximately -7% three days after BDL until sacrifice at day 7Figure ( 5.3A). Ma- croscopically, the livers from VAD-BDL-RP animals were comparably to VAS-BDL rats (compare Figure 5.3C and Figure 5.2B), lacking the yellow spots at the surface as observed for the VAD-BDL animals (Figure 5.2C and included again in 5.3B for comparison). Accordingly, serum levels of hepatocyte and bile duct damage markers AST, ALT, AP and γGT were drastically reduced in VAD-BDL after RP supplementation (Figure 5.3D-G). However, RP supplementation did not prevent the formation of the “bile sac” in the VAD-BDL rats at the site of the ligation (data not shown). An overview of physical and biochemical animal parameters of rats from all 8 treatment groups is given in Table 5.2.

126 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis VAD-BDL-vehicle; mean ± SD. Animal characteristics of rats fed a VAD diet, that were bile duct ligated and received vitamin A therapy, including corresponding controls. Data displayed as Table 5.2. Animal characteristics after BDLvitamin A therapyand ficantly different from VAS-BDL-RP; day 7 (mg/L) Plasma retinol day 7 (g) weight Body day 7 (mg/g) Liver retinol day 0 (g) weight Body Parameter N= day 7 (µmol/L) Plasma bile salt AST (U/L) 7 (µmol/g) Liver bile salt day ALT (U/L) AP (U/L) γGT (U/L) Group a significantly different from VAS-sham-vehicle; h b, c, d, e, f, h g, significantly different from VAD-BDL-RP 0.289 ± 0.014 10.53 ± 3.93 VAS-sham- 1.18 ± 0.11 0.67 ± 0.58 c, d, e, f, g 491 ± 36 514 ± 39 124 ± 58 c, d, h g, c, d, h g, 23 ± 14 46 ± 22 vehicle n.d. g, h g, c, g c, g 4 g e 0.224 ± 0.053 significantly different from VAD-sham-vehicle; 10.74 ± 3.58 VAS-sham- 1.13 ± 0.11 0.50 ± 0.58 0.25 ± 0.50 c, d, e, h g, 510 ± 58 533 ± 61 129 ± 57 9.2 ± 4.3 c, d, h g, c, d, h g, a, d, e, g d, e, f, g 50 ± 25 g, h g, c, g RP 4 g 0.141 ± 0.054 16.98 ± 7.44 VAS-BDL- 1187 ± 357 2.01 ± 0.30 a, e, f, h g, a, b, d, e, f 503 ± 30 538 ± 37 259 ± 71 1.3 ± e, f, h g, a, b, f, g a, b, e, f a, b, e, f 82 ± 19 52 ± 32 vehicle a, e, g f, g f, b 5 significantly different from VAS-sham-RP; 0.116 ± 0.031 24.55 ± 12.25 a, b, e, f, h g, VAS-BDL- 1029 ± 322 2.05 ± 0.31 a, b, e, f, g 493 ± 53 525 ± 40 273 ± 97 4.0 ± 3.9 7.2 ± 12 e, f, h g, a, b, e, f a, b, e, f 91 ± 58 b, f, g c, g RP f, g f, 5 f significantly different from VAD-sham-RP; a, b, c, d, f, h g, 0.043 ± 0.022 VAD-sham- a, b, c, d, f, h 0.12 ± 0.24 1.09 ± 0.18 0.25 ± 0.50 b, c, d, h g, 492 ± 36 517 ± 37 163 ± 67 c, d, h g, 39 ± 14 87 ± 43 vehicle c, g, h c, g, c, d, g n.d. f, g f, f, g f, 4 c significantly different from VAS-BDL-vehicle; 0.183 ± 0.034 a, b, c, d, e, g VAD-sham- 3.69 ± 1.60 1.16 ± 0.38 c, d, e, h g, c, d, e, h g, 469 ± 51 483 ± 43 c, d, h g, c, d, h g, a, d, e, g 32 ± 6,5 24 ± 16 75 ± 17 c, g, h c, g, c, d, g n.d. n.d RP 4 a, b, c, d, e, f, h a, b, c, d, e, f, h a, b, c, d, e, f, h a, b, c, d, e, f, h 0.006 ± 0.007 a, b, c, d, f, h a, b, d, e, f, h 3161 ± 2358 VAD-BDL- 1206 ± 268 0.08 ± 0.21 2.69 ± 1.39 630 ± 595 229 ± 148 455 ± 53 524 ± 55 a, b, e, f a, b, e, f 94 ± 57 vehicle g 7 significantly different from a, b, c, d, e, f, g 0.145 ± 0.046 VAD-BDL- 7.54 ± 5.17 1.85 ± 0.73 970 ± 387 350 ± 190 474 ± 43 514 ± 40 c, d, e, g a, b, e, f 92 ± 61 22 ± 20 24 ± 21 a, e, g b, f, g e, f, g RP f, g f, 7 d - signi

127 Chapter 5

A D 8000 a,b,d 100 6000 95 4000 AST(U/L) 90 2000 b,c b,c a,c,d 0 85 -8 RP7 -2 RP1 VAD-sham VAD-BDL Bodyweight % of day 0 E 80 2000 a,b,d 0 1 2 3 4 5 6 7 Days after BDL 1500

VAD-sham-vehicle VAD-BDL-vehicle 1000 VAD-sham-RP VAD-BDL-RP ALT (U/L) 500 b,c b,c a,c,d B VAD-BDL-Vehicle 0 - RP - RP 8 7 2 1 VAD-sham VAD-BDL F 200 a,b,d

150

100

AP (U/L)AP a,b,c 50 c,d c,d 0 -8 RP7 -2 RP1 C VAD-BDL-RP VAD-sham VAD-BDL G 600 a,b,d

400 GT (U/L)

γ 200 a,b,c c,d c,d 0 -8 RP7 -2 RP1 VAD-sham VAD-BDL

Figure 5.3. Vitamin A therapy rescued VAD BDL animals from dramatic weight loss and a severe cholestatic phenotype Vitamin A deficient, bile duct ligated (VAD-BDL) or sham treated (VAD-sham) rats received either retinyl palmitate (RP) or vehicle (-) IP on all days following surgery and were sacrificed 7 days after surgery. Vitamin A therapy prevented excessive weight loss of VAD BDL animals. Data displayed as percentage of weight prior to BDL (day 0), means ± SD (A). Vitamin A therapy prevented macroscopic liver damage as observed in VAD-BDL-vehicle treated rats (B). Livers of VAD-BDL rats receiving vitamin A therapy (C) resembled the livers of VAS-BDL rats (compare to Figure 5.2B). Hepatocyte and bile duct damage markers AST (D), ALT (E), AP (F) and γGT (G) were drastically reduced in VAD-BDL after RP supplementation. Data displayed as a box plot with medians represented by the horizontal lines with the 75th percentiles at the top and the 25th percentiles at the bottom of the boxes. Ranges are represented as whiskers. Significant difference between groups, p<0.05, asignificantly different from VAD-sham-vehicle; bsignificantly different from VAD-sham- RP; csignificantly different from VAD-BDL-vehicle;d significantly different from VAD-BDL-RP.

128 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis

Hematoxylin and eosin (H&E) stainings confirmed the macroscopic damage in the livers of VAD-BDL rats (Figure 5.4). Large necrotic areas were readily detectable in the livers of VAD-BDL rats (Figure 5.4D). Such necrotic regions were only rarely observed and much smaller in VAS-BDL liver (Figure 5.4C), while they were absent in sham operated VAS and VAD rats (Figure 5.4A and B).

VAS-sham

VAD-sham

VAS-BDL

VAD-BDL Figure 5.4. Vitamin A deficiency gives rise to necrotic regions in livers of bile duct ligated rats Hematoxylin and eosin (H&E) stainings were performed to visualize liver damage. Lar- ge areas of the liver, both on the surface and inside the liver were necrotic in VAD-BDL rats (D). Such necrotic regions were infrequent and much smaller in VAS-BDL liver (C), while they were absent in sham operated VAS and VAD rats (A and B).

129 Chapter 5

In addition, VAD-BDL livers were characterized by a much more pronounced bile duct proliferation compared to VAS-BDL livers (Figure 5.5 A-D). This was also evident from the significant increase in cytokeratin 19 (Krt19) (Figure 5E), a marker of cholangiocytes, which was 33-fold increased in VAD-BDL and only 12-fold increased in VAS-BDL, both compared to VAS-sham livers. RP supplementation strongly suppressed the bile duct proliferation in VAD-BDL rats, which was accompanied by a significant reduction inKrt19 mRNA levels in VAD-BDL rats to 20-fold increased compared to VAS-sham (Figure 5.5). RP supplementation did not change Krt19 expression nor bile duct proliferation (data not shown) in VAS-BDL rats.

A VAS-sham B VAS-BDL

C VAD-BDL D VAD-BDL-RP

E Figure 5.5. Vitamin A deficiency aggravates 50 BDL-induced bile duct proliferation and is rever-

) a,d 40 sed by vitamin A therapy. 18S a,c A-D) Immunohistochemical staining for Ki67 on

expression 30 livers from a control rat (A), a VAS-BDL rat (B) a VAD-BDL rat (C) and a VAD-BDL rat treated with 20 Krt19 a,d retinyl palmitate (D). BDL leads to bile duct proli- 10 feration in VAS rats as shown by Ki67 positive bile (mRNA versus b,c,d

Relative duct epithelial cells (B). The area of Ki67-positive 0 8 Vehicle6 2 R1P bile duct cells is strongly increased in VAD-BDL rats Sham BDL (C). Retinyl palmitate treatment strongly reduces VAS VAD bile duct proliferation and the number of Ki67 positive bile duct epithelial cells in VAD-BDL rats (D). Insets show enlarged areas with bile duct proliferation. E) Quantitative RT-qPCR analysis of the cholangiocyte marker Krt19. Hepatic Krt19 expression was significantly higher after 7 days BDL in VAD rats compared to VAS rats. Vitamin A therapy (RP) reduced Krt19 levels in VAD-BDL rats, but not in VAS-BDL rats. mRNA data was corrected for 18S and presented as a box plot with medians represented by the horizontal lines with the 75th percentiles at the top and the 25th percentiles at the bottom of the boxes. Ranges are represented as whiskers. Significant difference between groups, p<0.05, asignificantly different from VAS-sham-vehicle; bsignificantly different from VAS- BDL-vehicle; csignificantly different from VAD-BDL-vehicle; dsignificantly different from VAD-BDL-RP.

130 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis

Retinyl Palmitate Does Not Change Cyp7a1 and Bsep Expression in VAS-BDL and VAD-BDL Rats FXR/RXRα-mediated expression of mouse/human Bsep/BSEP is highest in the absence of RXR-ligands (27, 35). Moreover, VAD rats display increased bile acid concentrations in blood compared to control rats (Chapter 4). Thus, we next analyzed whether the excessive liver damage in VAD-BDL rats may be caused by high Bsep and Cyp7a1 expression resulting in bile accumulation in bile ducts. A C VAS-sham- VAS- VAS-BDL- VAS- vehicle sham-RP vehicle BDL-RP

A a,b, 150kD BSEP 20 a,b, e,f a,b, e,f,h f a,b, ) c Na+K+

18S 15 expression 10

Cyp7a1 VAD-sham- VAD- VAD-BDL- VAD- 5 vehicle sham-RP vehicle BDL-RP (mRNA versus 150kD BSEP

Relative 0 - RP - RP - RP - RP Sham BDL Sham BDL Na+K+ VAS VAD

B D B a,b, 3 e,f, g ) a,b, e,f, 18S 2 g expression c,d

Bsep 1 (mRNA versus

Relative 0 - RP - RP - RP - RP Sham BDL Sham BDL VAS VAD VAD-sham VAD-BDL Figure 5.6. BSEP expression does not correlate with increased Cy- p7a1 expression as a result of VAD and VAD-BDL. Cyp7a1 mRNA expression is increased after 7 days of BDL in both VAS and VAD rats (A). This increase in bile salt synthesis in BDL animals in not matched by increased expression of Bsep mRNA (B). Increased levels of Bsep pro- VAS-sham VAS-sham tein in liver homogenates (C) and liver tissue (D) was also not observed in VAD and VAD-BDL animals. The sodium/potassium-(Na+K+) pump was used as a loading control in western blot analyses. mRNA data was corrected for 18S and presented as a box plot with medians represented by the horizontal lines with the 75th percentiles at the top and the 25th percentiles at the bottom of the boxes. Ranges are represented as whiskers. Signi- ficant difference between groups, p<0.05, asignificantly different from VAS-sham-vehicle;b significantly different from VAS-sham-RP;c significantly different from VAS-BDL-vehicle;d significantly different from VAS-BDL-RP; esignificantly different from VAD-sham-vehicle;f significantly different from VAD- sham-RP; gsignificantly different from VAD-BDL-vehicle; hsignificantly different from VAD-BDL-RP.

131 Chapter 5

In line with earlier studies we found that Cyp7a1 (12.7-fold) and Bsep (1.9-fold) expression were increased by BDL in VAS rats (Figure 5.6A and B and Table 5.3). Cyp7a1 expression is induced to the same extend in VAD-BDL rats (10.1 ± 3.7-fold compared to VAS-sham) and in VAS-BDL (12.7 ± 2.4-fold compared to VAS-sham) rats. Moreover, Bsep expression is not increased by VAD in BDL rats and effectively 55% lower compared to VAS-BDL rats. Whereas RP supplementation dramatically reduced liver damage in VAD-BDL rats, it did not change expression of Cyp7a1 or Bsep. To rule out possible post-transcriptional regulation or high local expression of Bsep in functional liver tissue in VAD-BDL rats, we also analyzed Bsep protein expression by western blotting and immunohistochemistry. These analyses revealed no general or local increase in BSEP expression in VAD-BDL livers (Figure 5.6 C and D).

Serum (1.187 ± 0.357 mmol/L) and liver (2.01 ± 0.30 μmol/g) bile salt concentrations were increased in VAS-BDL, but not significantly different in VAD-BDL animals (1.206 ± 0.268 mmol/L and 2.69 ± 1.39 μmol/g, respectively (Figure 5.7 and Table 5.2). While RP supplementation seems to lower the bile salt concentrations in VAD- BDL a bit, no significant difference with vehicle-treated VAD-BDL rats was detected. Taken together, (de)regulation of bile salt synthesis and transport in VAD-BDL could not explain the excessive liver damage in VAD-BDL rats, nor the therapeutic effect of RP supplementation.

A B 2000 5

mol/L) 4

µ * 1500 * * * * 3 mol/g liver) mol/g

1000 µ 2 * * 500 1 Bile acid (

Plasma bile acids( 0 0 - RP - RP - RP - RP - RP - RP - RP - RP 8 7 6 5 4 3 2 1 8 7 6 5 4 3 2 1 Sham BDL Sham BDL Sham BDL Sham BDL VAS VAD VAS VAD

Figure 5.7. Vitamin A does not change serum and liver bile salt concentrations of BDL rats Bile salt concentrations in serum (A) and liver tissue (B) of sham- or BDL-treated VAS and VAD animals. BDL increased serum and hepatic bile acid concentrations to a similar level in VAS and VAD rats. Moreover, vitamin A supplementation (RP) did not significantly change serum and hepatic bile salts concentrations in VAD-BDL animals. Data presented as mean ± SD. *) indicates significant difference from the respective control; p < 0.05. †) indicates significant difference between RP and vehicle treated animals; p < 0.05.

132 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis sham-RP; Table 5.3. Relative mRNA expression data Relative mRNA data by determined RT-qPCR displayed as mean ± SD. cle; Col1a1 α-Sma iNos Ho-1 Bsep Cyp7a1 Krt19 Gene f significantly different from VAD-sham-RP; Group c significantly different from VAS-BDL-vehicle; N = VAS-sham- 1,0 ± 0,4 1,0 ± 0,7 1,0 ± 0,5 1,0 ± 0,2 1,0 ± 0,3 1,0 ± 0,5 1,0 ± 0,2 vehicle c,d,e,g,h c,d,e,g,h c,d,g,h c,d,g,h c,d,g,h c,d,g,h c,d, 4 VAS-sham- 1,1 ± 0,2 2,4 ± 1,4 1,7 ± 1,7 ± 1,3 1,7 ± 0,6 1,7 ± 0,8 2,8 ± 1,7 c,d,g,h c,d,g,h c,d,g,h c,d,g,h c,d,g,h RP c,d, 4 g g significantly different from VAD-BDL-vehicle; VAS-BDL- 12,3 ± 2,9 12,3 ± 2,6 12,7 ± 2,4 1,9 ± 0,4 2,9 ± 1,1 8,0 ± 6,3 5,5 ± 2,1 vehicle a,b,d,f,g a,b,e,f,h a,b,e,f,g a,b,e,f,g a,b,e,f,g a,b,f,g a,e,f,g 5 d significantly different from VAS-BDL-RP; VAS-BDL- 19,3 ± 16,5 16,3 ± 10,1 a 15,6 ± 9,8 11,9 ± 4,7 a,b,c,e,f,g significantly different from VAS-sham-vehicle; 1,5 ± 0,2 4,3 ± 4,1 6,3 ± 1,9 a,b,e,f,g a,b,e,f,g a,b,e,f,g a,b,f,g a,b,e,f a,e,f,g RP 5 VAD-sham- 1,1 ± 0,3 2,5 ± 2,3 1,2 ± 0,5 3,5 ± 2,5 4,2 ± 4,0 1,2 ± 0,2 1,4 ± 0,3 vehicle c,d,g,h c,d,g,h c,d,g a,f,g d,g c,d c,d 4 h significantly different from VAD-BDL-RP; p >0.05. VAD-sham- e 1,2 ± 0,6 1,1 ± 0,3 1,4 ± 0,9 1,3 ± 0,2 4,1 ± 3,0 1,0 ± 0,3 1,8 ± 1,0 c,d,e,g,h significantly different from VAD-sham-vehi- c,d,g,h c,d,g,h c,d,g,h a,c,d,g c,d,g RP c,d 4 b significantly different from VAS- VAD-BDL- 167,4 ± 164,5 a,b,c,d,e,f,h a,b,c,d,e,f,h a,b,c,d,e,f,h a,b,c,d,e,f,h a,b,c,d,e,f,h 33,2 ± 12,0 20,6 ± 10,2 81,3 ± 26,6 10,1 ± 3,7 32,7 ± 7,3 0,8 ± 0,4 vehicle a,b,f c,d 7 VAD-BDL- 35,6 ± 38,3 27,3 ± 24,1 20,4 ± 9,2 9,0 ± 7,4 1,3 ± 0,6 5,0 ± 2,2 7,3 ± 3,6 a,b,e,f,g a,b,e,f,g a,b,f,g a,b,f,g a,b,c RP a,g 7

133 Chapter 5

A B A a,b, B 50 c,d,e, 800 a,b, ) ) f,h c,d,e, 40 f,h 18S 18S 600 30 expression expression 400 iNos

Ho-1 20 a,b, a,b, a,b, a,b, a,b, f,g f,g 200 c,e, 10 f,g a,b,d, f,g (mRNA versus (mRNA versus f,g f,g Relative Relative 0 0 - RP - RP - RP - RP - RP - RP - RP - RP Sham BDL Sham BDL Sham BDL Sham BDL VAS VAD VAS VAD

C D a,b, C a,b, D 80 c,d,e, 150 c,d,e, f,h ) ) f,h 18S 18S 60 a,b,e 100

expression f,g expression 40

-Sma a,g a,b,e α a,e, Col1a1 50 a,b,e, f,g 20 a,e, f,g f,g (mRNA versus f,g (mRNA versus Relative 0 Relative 0 - RP - RP - RP - RP - RP - RP - RP - RP Sham BDL Sham BDL Sham BDL Sham BDL VAS VAD VAS VAD

E HO-1

α-SMA

GAPDH

- RP+ - RP+ - RP+ - RP+ Sham BDL Sham BDL ControlVAS VAD F F a,b, F a,b,c, 250 c,d,e 15 d,e,f f,h 200 a,b,c, f,g 10 a,b,c, 150 a,g e,f a,g, -SMA expression 100 h α a,b, 5 50 a,b, f,g g,h (protein versus GAPDH (protein versus GAPDH Relative HO-1 expression

Relative 0 0 - RP - RP - RP - RP - RP - RP - RP - RP Sham BDL Sham BDL Sham BDL Sham BDL VAS VAD VAS VAD

134 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis

Figure 5.8. Vitamin A therapy lowers oxidative stress, inflammation and fibrosis markers in VAD obstructive cholestatic rats mRNA levels of markers of oxidative stress hemeoxygenase-1 (Ho-1) (A), inflammation inducible nitric oxide synthase (iNos) (B) and fibrosis alpha-smooth muscle actin (α-Sma) (C) and Colla- gen type I (Col1a1) (D) were all increased in livers of VAD-BDL animals. Transcription of all these markers was normalized to levels observed in VAS-BDL-treated animals by RP supplementation. Vitamin A therapy prevented the elevated expression of HO-1 and α-SMA in VAD animals as a result of BDL (E and F). Protein expression was determined for all animals individually and corrected for GAPDH. Western blots shown are representative figures. Data is presented as mean ± SD. mRNA data was corrected for 18S and presented as a box plot with medians represented by the horizontal lines with the 75th percentiles at the top and the 25th percentiles at the bottom of the boxes. Ranges are represented as whiskers. Significant difference between groups, p<0.05, asignificantly different from VAS-sham-vehicle; bsignificantly different from VAS-sham-RP;c significantly different from VAS-BDL- vehicle; dsignificantly different from VAS-BDL-RP;e significantly different from VAD-sham-vehicle;f significantly different from VAD-sham-RP;g significantly different from VAD-BDL-vehicle;h significantly different from VAD-BDL-RP.

Vitamin A Therapy Reduces, Necrosis, Oxidative Stress, Inflammation and -Fi brosis Besides a putative role in regulating bile salt homeostasis, vitamin A(-derivatives) may also act as anti-oxidant, immune regulator and inhibitor of inflammation. In the liver specifically, vitamin A may control the development of fibrosis as activation of hepatic stellate cells is associated with loss of their retinol stores (13). Bile duct ligation in VAS rats increased the transcription of heme oxygenase-1 (Ho-1; oxidative stress marker), inducible nitric oxide synthase (iNos; inflammation marker), alpha-smooth muscle actin and collagen type I (α-Sma and Col1a1; fibrosis markers) by 5.5-, 8.0-, 2.9- and 12-fold, respectively, compared to sham operated VAS rats (Figure 5.8 and Table 5.3). VAD alone did not increase iNos, α-Sma and Col1a1 mRNA expression and only slightly induced Ho-1 (3.5-fold). However, all these markers were strongly increased in VAD-BDL rats (Ho-1, iNos, α-Sma and Col1a1 to 21-, 167-, 33- and 81–fold, respectively, compared to VAS animals); an increase of respectively 275, 1982, 1049 and 563 % compared to VAS-BDL. RP supplementation prevented the increase of all these markers in VAD animals as a result of BDL and the transcript levels of these four genes were similar or close to levels observed in VAS-BDL animals (Figure 5.8 A-D). Western blot analyses confirmed the strong increase in HO-1 and α-SMA protein expression in the livers of VAD-BDL rats and their repression upon RP supplementation (Figure 5.8 E and F).

Discussion

In this study, we show that vitamin A deficiency severely aggravates liver damage in rats with obstructive cholestasis, progressing to a life-threa- tening condition after 7 days. Hepatocyte necrosis, bile duct proliferation, inflammation, oxidative stress and activation of hepatic stellate cells are dramatically increased when vitamin A is absent in obstructive cholestasis, but

135 Chapter 5 are all strongly repressed when these rats are treated with retinyl palmitate. Vitamin A is therefore essential to prevent excessive liver damage in obstructive cholestatic liver disease. Vitamin A deficiency is a frequent condition in patients with chronic liver disease (10, 36-41). Disturbed bile salt homeostasis impairs intestinal absorption of fat-soluble vitamins and liver injury promotes the depletion of the vitamin A stores from hepatic stellate cells. Especially new-borns with obstructive cholestasis, as in biliary atresia, are at high risk for vitamin A deficiency as they have limited supplies of vitamin A immediately after birth. However, vitamin A deficiency is not restricted to chronic cholestatic liver diseases. Also inflammatory bowel disease (IBD), diabetes, obesity and alcoholic liver diseases are associated with vitamin A deficiency (42-49). Furthermore, treatment with various drugs may lower the hepatic vitamin A content (50). Establishment of vitamin A deficiency as an independent factor that causes liver damage is therefore relevant for a large and variable patient group. Vitamin A supplementation has been shown before to have beneficial effects in models of chronic liver disease, including long term (5-6 weeks) BDL and CCl4 administration (13-18). The combination of all-trans retinoic acid and ursodeoxycholic acid (UDCA), a synthetic bile acid used to treat cholestasis in humans, proved more successful in reducing liver fibrosis and necrosis as a result of BDL than UDCA alone (51). Until now, these studies were performed with vitamin A sufficient animals and did not reveal the dramatic effects we detected in VAD rats. We did not observe significant therapeutic effects of RP supplementation in VAS rats after 7 days BDL with respect to liver damage markers AST, ALT, γGT and serum bile salts. In fact, we detected a significant increase in the inflammation marker iNos in RP-treated VAS-BDL rats, whereas oxidative stress and stellate cell activation were not altered. The therapeutic effects detected in other studies are therefore likely to occur at later stages of liver disease. This is in line with our observation that liver retinol levels are actually increased after 7 days BDL, while serum levels are decreased. This suggests that vitamin A is recruited to the liver at the initial stages of bile obstruction and that only after progression of the disease hepatic VAD develops due to chronic intestinal malabsorption and hepatic stellate cell activation. Vitamin A deficiency and vitamin A therapy did not alter bile salt levels in liver or serum, nor the regulation of hepatic bile salt synthesis and transport at day 7 after bile duct ligation. This is in contrast to our earlier observations in vitro and in mice that FXR-mediated expression of BSEP is maximal in the presence of FXR- and absence of RXRα ligands (Chapter 2, (27)). Moreover, we found earlier that VAD rats develop mild cholestasis (Chapter 4). Both in VAS and VAD animals RP supplementation seems to lower bile salt concentrations in serum, although this decrease did not reach statistical significance Table( 5.2). We expected that excessive liver damage would arise from increased bile salt accumulation in liver bile ducts leading to bile infarcts. Much of the observed phenotype actually resembles effects of maintained or increased canalicular bile salt transport. In particular the excessive bile duct proliferation and bile duct damage, as indica-

136 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis ted by high γGT levels, suggest increased bile toxicity in the liver. Even though no increased BSEP levels were detected at day 7, it is possible that BSEP-mediated secretion earlier after the start of bile duct ligation is higher in the VAD animals and is the primary cause of excessive liver damage. When secondary inflammation and oxidative stress develop, BSEP expression may become suppressed as described for inflammation models of the liver (52, 53). The combination of VAD and BDL leads to the strong accumulation of bile in front of the ligation, suggesting increased bile flow in these animals. Remarkably, this increased bile flow was not suppressed by RP supplementation, while bile duct proliferation and γGT were strongly decreased. This indicates that RP reduces the levels of (a) toxic compound(s) in bile without reducing bile flow. In contrast to genes involved in bile salt homeostasis, expression of biomarkers for oxidative stress (Ho-1), inflammation iNos( ) and fibrosis α-Sma( and Col1a1) were strongly increased in VAD-BDL rats and strongly suppressed when these animals received RP supplementation. The transcription profiles of these biomarkers follow the occurrence of hepatic and ductular enzymes in blood plasma. Both BDL and VAD have independently been associated with increased oxidative stress, inflammation and fibrosis (54-58). In our study, we did not observe induction of iNos, α-Sma and Col1a1 and only a minor induction of Ho-1 mRNA in VAD rats. The absence of clear changes in these markers in VAD rats may be because the rats in this study were just depleted from vitamin A, whereas in other studies they may have been suffering from vitamin A deficiency for prolonged periods. Our data indicate that vitamin A deficiency per se is not inducing hepatic stellate cell activation and thus does not immediately lead to fibrosis. However, in combination with bile obstruction, stellate cells become superactivated. Rather than causing fibrosis in such a short time period, this may render the stellate cells highly contractile because of the strong induction of α-SMA expression. As these highly extended cells completely surround the sinusoids, cell contraction may lead to reduced blood flow through the liver. As this may lead to reduced oxygenation of the liver, it could contribute to the observed oxidative stress. Normal levels of vitamin A are required for integrity of epithelial barriers in various tissues and vitamin A supplementation has been reported to be beneficial in various disorders where inflammation is involved (57). RP supplementation (vitamin A therapy) prevented the formations of necrotic regions and the strong increase in Ho-1, iNos, α-Sma and Col1a1 transcription/expression in VAD-BDL animals and thus has acute therapeutic effect to slow down the process of liver injury by obstructive cholestasis in VAD rats. Vitamin A may directly repress the activation of stellate cells (59) and/or by its anti-oxidant function, reduce oxidative stress in the liver. Moreover, vitamin A may inhibit the influx of macrophages and strongly reduce inflammation (60). Most likely, the strong repression of liver damage by RP supplementation in VAD-BDL rats is a combination of several or all of these processes that may occur at specific time points after the start of the obstruction.

137 Chapter 5

Independent of the exact mechanisms involved, this study reveals the importance of vitamin A in preventing excessive liver damage in chronic liver diseases. Until now, this vitamin is regarded as an important vitamin to monitor in liver diseases, but not as a factor that may actually contribute to liver damage when vitamin A stores are limited. Contributing to the controversy surrounding vitamin A therapy is the lack of reliable non-invasive biomarkers to assess vitamin A status. As is evident from multiple studies, plasma retinol levels are a poor measure for the total pool of vitamin A in the body. Both in hyper- and hypovitaminosis A, plasma retinol levels may appear within normal range. Only when the liver is overflowing with, or nearly depleted of, vitamin A, this can be measured in plasma. And only when plasma retinol levels drop below 10 mg/L in humans this is correlated to the vitamin A content in the liver (61). In line with this, we found that serum retinol levels drop only after 12 weeks of feeding a VAD diet to rats. Assuming a linear decrease of the liver stores of vitamin A during the diet period, the liver had lost over 90% of its vitamin A content before serum levels dropped significantly. Taken together, our data show that vitamin A deficiency strongly aggravates liver damage in obstructive cholestasis in rats and retinyl palmitate supplementation is a safe and effective therapeuticum to reduce liver damage. These findings warrant a detailed analysis and monitoring of the vitamin A status in patients with cholestasis, as the condition of cholestatic patients with low vitamin A levels could deteriorate quickly, but might be effectively treated with vitamin A.

Acknowledgements

The authors thank E.E.A. Venekamp-Hoolsema for technical assistance in the retinol measurements and V.W. Bloks for his advice on data analysis.

138 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis

References

1. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, et al. Characterization of three RXR genes that mediate the action of 9-cis retinoic acid. Genes Dev 1992 Mar;6(3):329-344. 2. Allenby G, Janocha R, Kazmer S, Speck J, Grippo JF, Levin AA. Binding of 9-cis-retinoic acid and all-trans-retinoic acid to retinoic acid receptors alpha, beta, and gamma. Retinoic acid receptor gamma binds all-trans-retinoic acid preferentially over 9-cis-retinoic acid. J Biol Chem 1994 Jun 17;269(24):16689- 16695. 3. Livrea MA, Tesoriere L, Bongiorno A, Pintaudi AM, Ciaccio M, Riccio A. Contribution of vitamin A to the oxidation resistance of human low density lipoproteins. Free Radic Biol Med 1995 Mar;18(3):401-409. 4. Palace VP, Khaper N, Qin Q, Singal PK. Antioxidant potentials of vitamin A and carotenoids and their relevance to heart disease. Free Radic Biol Med 1999 Mar;26(5-6):746-761. 5. Hollander D. Retinol lymphatic and portal transport: influence of pH, bile, and fatty acids. Am J Physiol 1980 Sep;239(3):G210-G214. 6. Probstfield JL, Lin TL, Peters J, Hunninghake DB. Carotenoids and vitamin A: the effect of hypocholestero- lemic agents on serum levels. Metabolism 1985 Jan;34(1):88-91. 7. Pellicoro A, van den Heuvel FA, Geuken M, Moshage H, Jansen PL, Faber KN. Human and rat bile acid-CoA:amino acid N-acyltransferase are liver-specific peroxisomal enzymes: implications for intracellular bile salt transport. Hepatology 2007 Feb;45(2):340-348. 8. Senoo H. Structure and function of hepatic stellate cells. Med Electron Microsc 2004 Mar;37(1):3-15. 9. Andrews WS, Pau CM, Chase HP, Foley LC, Lilly JR. Fat soluble vitamin deficiency in biliary atresia. J Pediatr Surg 1981 Jun;16(3):284-290. 10. Phillips JR, Angulo P, Petterson T, Lindor KD. Fat-soluble vitamin levels in patients with primary biliary cirrhosis. Am J Gastroenterol 2001 Sep;96(9):2745-2750. 11. Tsai LY, Lee KT, Tsai SM, Lee SC, Yu HS. [Vitamin A status in patients with cholelithiasis]. Gaoxiong Yi Xue Ke Xue Za Zhi 1994 Jun;10(6):301-307. 12. Erickson JM, Mawson AR. Possible role of endogenous retinoid (Vitamin A) toxicity in the pathophysio- logy of primary biliary cirrhosis. J Theor Biol 2000 Sep 7;206(1):47-54. 13. Senoo H, Wake K. Suppression of experimental hepatic fibrosis by administration of vitamin A. Lab Invest 1985 Feb;52(2):182-194. 14. Seifert WF, Bosma A, Hendriks HF, van Leeuwen RE, van Thiel-de Ruiter GC, Seifert-Bock I, et al. Beta-carotene (provitamin A) decreases the severity of CCl4-induced hepatic inflammation and fibrosis in rats. Liver 1995 Feb;15(1):1-8. 15. Knook DL, Bosma A, Seifert WF. Role of vitamin A in liver fibrosis. J Gastroenterol Hepatol 1995;10 Suppl 1:S47-S49. 16. Wang L, Potter JJ, Rennie-Tankersley L, Novitskiy G, Sipes J, Mezey E. Effects of retinoic acid on the development of liver fibrosis produced by carbon tetrachloride in mice. Biochim Biophys Acta 2007 Jan;1772(1):66- 71. 17. Jiang H, Dan Z, Wang H, Lin J. Effect of ATRA on contents of liver retinoids, oxidative stress and hepatic injury in rat model of extrahepatic cholestasis. J Huazhong Univ Sci Technolog Med Sci 2007 Oct;27(5):491- 494. 18. De Freitas JS, Bustorff-Silva JM, Castro e Silva Junior, Jorge GL, Leonardi LS. Retinyl-palmitate reduces liver fibrosis induced by biliary obstruction in rats. Hepatogastroenterology 2003 Jan;50(49):146-150. 19. Smith JW. Vitamin A toxicity presenting as jaundice. Postgrad Med 1989 Mar;85(4):53-4, 56. 20. Oren R, Ilan Y. Reversible hepatic injury induced by long-term vitamin A ingestion. Am J Med 1992 Dec;93(6):703-704. 21. Becker P, Maurer B, Schirmacher P, Waldherr R, Parlesak A, Bode C, et al. Vitamin A-induced cholestatic hepatitis: a case report. Z Gastroenterol 2007 Oct;45(10):1063-1066.

139 Chapter 5

22. Nollevaux MC, Guiot Y, Horsmans Y, Leclercq I, Rahier J, Geubel AP, et al. Hypervitaminosis A-induced liver fibrosis: stellate cell activation and daily dose consumption. Liver Int 2006 Mar;26(2):182-186. 23. Forman BM, Goode E, Chen J, Oro AE, Bradley DJ, Perlmann T, et al. Identification of a nuclear receptor that is activated by farnesol metabolites. Cell 1995 Jun 2;81(5):687-693. 24. Wang H, Chen J, Hollister K, Sowers LC, Forman BM. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 1999 May;3(5):543-553. 25. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, et al. Identification of a nuclear receptor for bile acids. Science 1999 May 21;284(5418):1362-1365. 26. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, et al. Bile acids: natural ligands for an orphan nuclear receptor. Science 1999 May 21;284(5418):1365-1368. 27. Hoeke MO, Plass JR, Heegsma J, Geuken M, van Rijsbergen D, Baller JF, et al. Low retinol levels differentially modulate bile salt-induced expression of human and mouse hepatic bile salt transporters. Hepatology 2009 Jan;49(1):151-159. 28. Schmidt DR, Holmstrom SR, Fon TK, Bookout AL, Kliewer SA, Mangelsdorf DJ. Regulation of bile acid synthesis by fat-soluble vitamins A and D. J Biol Chem 2010 May 7;285(19):14486-94. 29. Zaman Z, Fielden P, Frost PG. Simultaneous determination of vitamins A and E and carotenoids in plasma by reversed-phase HPLC in elderly and younger subjects. Clin Chem 1993 Nov;39(11 Pt 1):2229-2234. 30. Jung D, Elferink MG, Stellaard F, Groothuis GM. Analysis of bile acid-induced regulation of FXR target genes in human liver slices. Liver Int 2007 Feb;27(1):137-144. 31. Kuipers F, van Ree JM, Hofker MH, Wolters H, In't Veld G, Havinga R, et al. Altered lipid metabolism in apolipoprotein E-deficient mice does not affect cholesterol balance across the liver. Hepatology 1996 Jul;24(1):241-247. 32. Blokzijl H, Vander Borght S, Bok LI, Libbrecht L, Geuken M, van den Heuvel FA, et al. Decreased P-glycoprotein (P-gp/MDR1) expression in inflamed human intestinal epithelium is independent of PXR protein levels. Inflamm Bowel Dis 2007 Jun;13(6):710-720. 33. Vos TA, Hooiveld GJ, Koning H, Childs S, Meijer DK, Moshage H, et al. Up-regulation of the multidrug resistance genes, Mrp1 and Mdr1b, and down-regulation of the organic anion transporter, Mrp2, and the bile salt transporter, Spgp, in endotoxemic rat liver. Hepatology 1998 Dec;28(6):1637-1644. 34. Schoemaker MH, Gommans WM, Conde de la Rosa L, Homan M, Klok P, Trautwein C, et al. Resistance of rat hepatocytes against bile acid-induced apoptosis in cholestatic liver injury is due to nuclear factor-kappa B activation. J Hepatol 2003 Aug;39(2):153-161. 35. Kassam A, Miao B, Young PR, Mukherjee R. Retinoid X receptor (RXR) agonist-induced antagonism of farnesoid X receptor (FXR) activity due to absence of coactivator recruitment and decreased DNA binding. J Biol Chem 2003 Mar 21;278(12):10028-10032. 36. Strople J, Lovell G, Heubi J. Prevalence of subclinical vitamin K deficiency in cholestatic liver disease. J Pediatr Gastroenterol Nutr 2009 Jul;49(1):78-84. 37. Jorgensen RA, Lindor KD, Sartin JS, LaRusso NF, Wiesner RH. Serum lipid and fat-soluble vitamin levels in primary sclerosing cholangitis. J Clin Gastroenterol 1995 Apr;20(3):215-219. 38. De Paula TP, Ramalho A, Braulio VB. The effectiveness of relative dose response to retinol intake as an evaluation of vitamin A status of cirrhotic patients. J Hum Nutr Diet 2010 Dec;23(6):583-589. 39. Peres WA, Chaves GV, Goncalves JC, Ramalho A, Coelho HS. Vitamin A deficiency in patients with hepatitis C virus-related chronic liver disease. Br J Nutr 2011 Jun 8;1-8. 40. Saron ML, Godoy HT, Hessel G. Nutritional status of patients with biliary atresia and autoimmune hepatitis related to serum levels of vitamins A, D and E. Arq Gastroenterol 2009 Jan;46(1):62-68. 41. Floreani A, Baragiotta A, Martines D, Naccarato R, D'odorico A. Plasma antioxidant levels in chronic cholestatic liver diseases. Aliment Pharmacol Ther 2000 Mar;14(3):353-358. 42. Bousvaros A, Zurakowski D, Duggan C, Law T, Rifai N, Goldberg NE, et al. Vitamins A and E serum levels in children and young adults with inflammatory bowel disease: effect of disease activity. J Pediatr Gastroen- terol Nutr 1998 Feb;26(2):129-135.

140 Vitamin A Deficiency Severely Aggravates Obstructive Cholestasis

43. Vagianos K, Bector S, McConnell J, Bernstein CN. Nutrition assessment of patients with inflammatory bowel disease. JPEN J Parenter Enteral Nutr 2007 Jul;31(4):311-319. 44. D'Odorico A, Bortolan S, Cardin R, D'Inca' R, Martines D, Ferronato A, et al. Reduced plasma antioxidant concentrations and increased oxidative DNA damage in inflammatory bowel disease. Scand J Gastroenterol 2001 Dec;36(12):1289-1294. 45. Suano de Souza FI, Silverio Amancio OM, Saccardo Sarni RO, Sacchi PT, Fernandes AP, ffonso Fonseca FL, et al. Non-alcoholic fatty liver disease in overweight children and its relationship with retinol serum levels. Int J Vitam Nutr Res 2008 Jan;78(1):27-32. 46. Chaves GV, Pereira SE, Saboya CJ, Ramalho A. Nutritional status of vitamin A in morbid obesity before and after Roux-en-Y gastric bypass. Obes Surg 2007 Jul;17(7):970-976. 47. Villaca CG, Pereira SE, Saboya CJ, Ramalho A. Non-alcoholic fatty liver disease and its relationship with the nutritional status of vitamin A in individuals with class III obesity. Obes Surg 2008 Apr;18(4):378-385. 48. Ray MB, Mendenhall CL, French SW, Gartside PS. Serum vitamin A deficiency and increased intrahepatic expression of cytokeratin antigen in alcoholic liver disease. Hepatology 1988 Sep;8(5):1019-1026. 49. Leo MA, Lieber CS. Hepatic vitamin A depletion in alcoholic liver injury. N Engl J Med 1982 Sep 2;307(10):597-601. 50. Leo MA, Lowe N, Lieber CS. Decreased hepatic vitamin A after drug administration in men and in rats. Am J Clin Nutr 1984 Dec;40(6):1131-1136. 51. He H, Mennone A, Boyer JL, Cai SY. Combination of retinoic acid and ursodeoxycholic acid attenuates liver injury in bile duct-ligated rats and human hepatic cells. Hepatology 2011 Feb;53(2):548-557. 52. Cherrington NJ, Slitt AL, Li N, Klaassen CD. Lipopolysaccharide-mediated regulation of hepatic transporter mRNA levels in rats. Drug Metab Dispos 2004 Jul;32(7):734-741. 53. Lee JM, Trauner M, Soroka CJ, Stieger B, Meier PJ, Boyer JL. Expression of the bile salt export pump is maintained after chronic cholestasis in the rat. Gastroenterology 2000 Jan;118(1):163-172. 54. Aguilar RP, Genta S, Oliveros L, Anzulovich A, Gimenez MS, Sanchez S. Vitamin A deficiency injures liver parenchyma and alters the expression of hepatic extracellular matrix. J Appl Toxicol 2009 Apr;29(3):214-22. 55. Bomzon A, Holt S, Moore K. Bile acids, oxidative stress, and renal function in biliary obstruction. Semin Nephrol 1997 Nov;17(6):549-562. 56. Gatica L, Alvarez S, Gomez N, Zago MP, Oteiza P, Oliveros L, et al. Vitamin A deficiency induces prooxidant environment and inflammation in rat aorta. Free Radic Res 2005 Jun;39(6):621-628. 57. Reifen R. Vitamin A as an anti-inflammatory agent. Proc Nutr Soc 2002 Aug;61(3):397-400. 58. Gibelli NE, Tannuri U, Mello ES. Immunohistochemical studies of stellate cells in experimental cholestasis in newborn and adult rats. Clinics 2008 Oct;63(5):689-694. 59. McCarroll JA, Phillips PA, Santucci N, Pirola RC, Wilson JS, Apte MV. Vitamin A inhibits pancreatic stellate cell activation: implications for treatment of pancreatic fibrosis. Gut 2006 Jan;55(1):79-89. 60. Kim CH. Retinoic acid, immunity, and inflammation. Vitam Horm 2011;86:83-101. 61. Amedee-Manesme O, Furr HC, Alvarez F, Hadchouel M, Alagille D, Olson JA. Biochemical indicators of vitamin A depletion in children with cholestasis. Hepatology 1985 Nov;5(6):1143-1148.

141

Chapter 6

General Discussion

Martijn O. Hoeke and Klaas Nico Faber

Department of Gastroenterology and Hepatology, University Medical Center Groningen, Groningen, University of Groningen, The Netherlands Chapter 6

The research presented in this thesis sheds new light on the interconnection between bile salt homeostasis and vitamin A homeostasis. Well established are the fat-emulsifying properties of bile salts that are required for the effective absorption of fat-soluble vitamins, including vitamin A. Moreover, the liver is the central organ in controlling vitamin A homeostasis, where 80% of the total body content of vitamin A is stored in lipid droplets in hepatic stellate cells. Work described in this thesis, however, shows that vitamin A directly affects transcription of genes that control bile salt synthesis and transport. In addition, vitamin A affects the protein level and/or function of the corresponding gene products. Vitamin A deficiency in furthermore healthy rats leads to mild cholestasis. When exposed to obstructive cholestasis, these vitamin A deficient (VAD) rats develop severe liver damage that quickly progresses to liver failure. Taken together, these studies show that vitamin A is important to maintain normal bile homeostasis and prevents excessive liver damage during obstructive cholestasis. Thus, the vitamin A status deserves more clinical attention in the treatment of liver diseases.

Hypovitaminosis A Vitamin A deficiency may develop from low dietary intake, insufficient intestinal uptake or increased release from the liver. Vitamin A deficiency is common in developing countries especially in children. In developed countries, vitamin A deficiency is a condition that may develop in patients with chronic disease of the digestive tracts, such as inflammatory bowel disease, biliary atresia or chronic hepatitis. One of the first clinical symptoms of vitamin A deficiency is night blindness, which is due to impaired regeneration of rhodopsin in the rod cells of the eye and may progress to permanent damage to the eye and ultimately blindness. At earlier, subclinical stages, vitamin A deficiency may already exert pathological effects as it is crucial for optimal functioning of the immune system. For instance, hypovitaminosis A is associated with a reduced number of lymphocytes and natural killer cells and a reduced antigen-specific immunoglobin response. In early age, vitamin A deficiency is associated with increased risk of HIV infection from mother to child and an increased risk of mortality as a result of diarrhea (1). On the other hand, low vitamin A levels were shown to relief symptoms of Asthma (2). In general, the symptoms of hypovitaminosis can be treated with vitamin A supplementation and night vision can be restored within 8 days (3). In developed countries, hypovitaminosis A is not a common problem in otherwise healthy people. Vitamin A reserves are high in humans and up to 1.5 years may be required before healthy volunteers develop the earliest manifestations of deficiency when they take a vitamin A-free diet (4). However, newborns have limited reserves of vitamin A. In combination with cholestasis these infants are in a precarious nutritional state, with limited ability to build up stores even though vitamin A is present in their diet (5). Therefore, infants suffering from cholestasis are at high risk of developing vitamin A deficiency.

144 General discussion

Hypervitaminosis A Hypervitaminosis A is typically the result of self-medication. Following excessive intake the liver becomes saturated with retinylesters, which eventually spill over into the general circulation. The plasma retinyl ester levels in hypervitaminotic humans can be as high as 67% of the total plasma vitamin A (6), while in healthy individuals only 5.5% of the total vitamin pool in blood consists of retinyl esters (7). Excessive intake of carrots and/or other vitamin A-rich vegetables may lead to a condition called carotenemia that is characterized by high serum levels of carotene (pro-vitamin A) and causes the skin to turn yellow. This is a benign condition, as the turnover from carotene to vitamin A is slow and prevents vitamin A poisoning (8). Pathological symptoms of chronic vitamin A intoxication include hair loss, pruritus, and dryness of mucus membranes, bone fractures and hepatitis. In addition, there is also a growing concern for subtoxicity without clinical signs of toxicity, because nowadays the intake of preformed vitamin A often exceeds the recommended daily allowance (RDA) in the developed countries. Osteoporosis and hip fractures have been associated with an intake of preformed vitamin A of twice the RDA (9).

Changes in total body stores of vitamin A are difficult to establish. The liver is capable of maintaining physiological optimal and constant retinol levels in the body despite declining storage or over-storage of vitamin A. As a result, plasma retinol concentrations do not reflect the hepatic vitamin A content and only change significantly when hepatic vitamin A levels are dangerously high or low (10). Moreover, plasma retinol levels are strongly affected by inflammation or magnesium deficiency (11, 12). As such, it is often not until clinical symptoms of hypo- or hypervitaminosis A develop, before patients are accurately diagnosed.

In this respect, monitoring changes in bile salt homeostasis is easier, as changes in bile salt concentrations can be readily detected in blood and/or feces. Moreover, a general obstruction in bile flow leads to jaundice, which is caused by the accumulation of bilirubin in blood and is often, but not strictly, associated by a changes in bile salt homeostasis.

Vitamin A co-regulates FXR target gene expression Both hypo- and hypervitaminosis A have the potential to interfere with bile salt homeostasis. Under- or overstimulation of the retinoid X receptor alpha (RXRα), which serves as the obligatory partner of the farnesoid X receptor (FXR), potentially affects expression of key genes involved in bile acid synthesis and transport. The data presented in this thesis show that the RXRα ligand 9cRA indeed co-regulates expression of FXR target genes. In chapter 2 and 3, we show that bile acid-induced expression of various FXR/RXR-target genes is modulated by the RXRα ligand. Depending on the FXR-target gene of interest the bile acid-induced expression is super-induced (SHP and FGF19), inhibited (BSEP and OSTα in HepG2 cells) or not affected (OSTα in the colon carcinoma cell line DLD-1) by the RXR ligand. In line

145 Chapter 6 with these in vitro data, hepatic BSEP expression in cholate (CA)-fed mice is increased when they are VAD (Chapter 2). Figure 6.1 shows the eff ects of vitamin A on the regulation of hepatic and ileal genes involved in bile salt homeostasis.

Figure 6.1. Vitamin A co-regulates bile salts transport and synthesis Th e farnesoid X receptor (FXR) acts as a heterodimer with the retinoid X receptor (RXR). Th is heterodimer regulates expression of key genes involved in bile salt transport (Bile salt export pump (BSEP)) and Organic Solute Transporter α/β (OSTα/β)) and negative feedback regulation on bile acid synthesis (small heterodimer partner (SHP) and fi broblast growth factor (FGF19)). FXR is activated by bile salts, while RXR is activated by vitamin A. In the presence of the FXR ligand, additional activation of RXR by vitamin A leads to a reduced expression of BSEP, while expression of OSTβ, SHP and FGF19 is super-induced under this condition. Vitamin A signaling via RXR-SHP and RXR-FGF19 leads to a decrease in bile acid synthesis (via CYP7A1). But vitamin A may also limit the expression of CYP7A1 via FXR/ RXR-independent mechanisms (Cai et al. 2010).

Th e FXR/RXRα Heterodimer Is “Non-Permissive” by Default Th e eff ect of the RXRα-ligand on the transcription of downstream targets of NR/ RXRα heterodimers has earlier been subdivided in “permissive” and “non-permissive” (13). As RXRα ligands were found to induce and/or super-induce bile salt-induced expression of the FXR target genes IBABP (14) and PLTP (15), RXRα was proposed to act as a permissive partner for FXR (16, 17). Th e observation that bile salt-induced expression of BSEP is inhibited by 9cRA and synthetic RXRα ligands, prompted Kassam et al. to designate the FXR/RXRα heterodimer as “conditionally permissive” (18). Th e inhibitory eff ect of RXRα ligands on transcription of FXR target genes is not unique for BSEP as we also observed this phenomenon for OSTα in HepG2 cells. Th e fact that 9cRA did not repress OSTα mRNA levels in DLD-1 cells

146 General discussion indicates that there are cell type-specific factors that modulate the FXR/RXRα transcriptional machinery. As the 9cRA-mediated repression of BSEP expression was not dependent on the specific nucleotide sequence of the FXR/RXRα binding site (IR-1), we proposed in chapter 2 that by default “RXRα acts as a nonpermissive partner for FXR”. More recent data presented in chapter 3 show that the IR-1 from SHP used in chapter 2 is actually not the main FXR-responsive element in the SHP promoter. Even though this IR-1 can function as an FXRE, it is not required for FXR/CDCA dependent activation of the SHP promoter (Figure 3.1). This underscores the presumed involvement“ of additional binding sites or cofactors in case of co-stimulation by liganded FXR and RXRα” as stated in the discussion of chapter 2.

Human SHP Promoter Contains a 9cRA Response Element Outside the FXRE Super-induction of FXR-target gene transcription by the RXR ligand, as observed for SHP and FGF19, requires additional RXR/9cRA- responsive elements that overcome the non-permissive effect of the FXR/RXR at the FXRE. We delineated such an 9cRA responsive element in the SHP promoter and surprisingly found that this RXR/9cRA responsive element overlaps with the IR-1 sequence previously identified as an FXRE (19). Besides the IR-1, this DNA region also contains a DR-4 (binds LXR/RXRα; (20)) and a DR-2 (binds RXR/RXR and RXR/RAR) (21) (Figure 3.S6). These three NR-response elements make use of the same half site TGACCT. Therefore, various NR/RXRα dimers could compete for binding to the same half site. In chapter 2, we placed this half-site in the context of the BSEP promoter and found that this SHP IR-1 sequence is activated by FXR and repressed by 9cRA (Figure 2.2). However, in the context of the SHP promoter this IR-1 sequence is dispensable for the FXR/ CDCA-mediated transcription of SHP (Figure 3.1). Unfortunately, this half site is mutated in all the constructed IR-1 mutants of the SHP promoter and therefore it is currently impossible to relate the 9cRA-mediated induction of SHP to either the IR-1, DR-2 or DR-4. Site-directed mutagenesis is required to pinpoint the functional retinoic acid-responsive element and the NR/RXRα dimer that is involved.

CDCA/FXR Response Element in hSHP Promoter Co-locates with LRE The newly identified CDCA/FXR response element in theSHP promoter co-locates with a previously identified LRH-1 response element (LRE; consensus sequence: TCAAGGTTG) and is conserved in human and rodents. The sequence of this LRE-region (GGAG_TCAAGGTTG) strongly resembles the reverse complement sequence of a previously identified atypical FXRE in the promoter region of apolipoprotein A-I (Apo-AI) (AGAGTTCAAGGATC; LRE in italic; non-matching nucleotides between SHP and Apo-AI are underscored) (22). FXR associates as a monomer with this atypical response element and represses transcription of Apo-AI (22). This is the opposite effect as we observed for FXR-mediated regulation of SHP. Maybe the orientation of this atypical FXRE determines its function as a positive or negative regulatory element. Interestingly, the FXR target genes BSEP and MRP3 require LRH-1

147 Chapter 6 for maximal expression (23, 24). However, this does not seem to be the case for the FXRE/LRE site in the SHP promoter. Co-transfection experiments with FXR, RXR and LRH-1 expression plasmids showed that LRH-1 modulates the basal level of SHP promoter activity, but the maximal FXR/CDCA-dependent SHP promoter activity is not different in the absence or presence of LRH-1 (Figure 3.S3). Previously, it was shown that LRH-1 may recruit FXR to the promoter of genes involved in lipid metabolism (a.o. Sec14l2, Scarb1, Srebp2, Lcat, Fdft1, Prkag2 and Ldlrap1) (25). However, we show that FXR regulates SHP expression via this element in the presence and absence of LRH-1, eliminating LHR-1 as a bridging factor in the FXR-mediated regulation of SHP. Moreover, LRH-1 does not seem to compete for FXR binding at this site in the SHP promoter, as increasing amounts of LRH-1 did not significantly change the FXR/CDCA-induced SHP promoter activity (Chapter 3, Figure 3.S3).

Physiological role of FXR target gene co-regulation by the RXR ligand vitamin A Vitamin A absorption depends on the emulsifying action of bile salts and vitamin A metabolites directly affect expression of genes involved in bile salt synthesis and transport. The putative role of vitamin A in bile salt physiology is discussed in the following section, where we hypothesize that local vitamin A concentrations are sensors to control optimal bile function.

Ileal Absorption of Vitamin A as an Additional Signal to Fine Tune Bile Acid Synthesis Vitamin A levels in the terminal ileum may control bile salt synthesis in the liver. Increased circulating bile acid levels suppress hepatic Cyp7a1 expression, however, this feedback inhibition on bile acid synthesis is impaired in obstructive cholestasis. This observation led to the identification of FGF15 in mice (FGF19 in humans) as a second, besides SHP, feedback inhibition mechanism for bile acid synthesis. FGF15 is expressed in the ileum and controlled by FXR. FGF15 is secreted to the circulation and signals to the liver to suppress bile acid synthesis. Obstructive cholestasis decreases the ileal bile acid concentrations and thereby impairs the FGF15/19 controlled inhibition of Cyp7a1. Transcription of SHP and FGF19 is induced by 9cRA alone and it super-induces the CDCA-dependent transcription of both genes (Chapter 3). Schmidt et al. also reported the vitamin A-dependent expression of mouse Fgf15, which required FXR/RXR, but was independent of bile acids. Vitamin A-induced expression of Fgf15 led to a decrease in hepatic Cyp7a1 (26). Efficient absorption of vitamin A in the ileum thus contributes to repression of bile acid synthesis in the liver. In the liver, vitamin A also contributes to the repression of bile acid synthesis. Cai et al. recently reported that CYP7A1 transcription is repressed by all-trans retinoic acid (atRA) in HepG2 cells. In these cells, both FGF19 and SHP transcription were increased by atRA. atRA may be transformed into its isomers 13-cis-RA and 9-cis- RA, either by spontaneous isomerization or by isomerases and subsequently act as a ligand for RXR (27). However, the inhibitory effect onCYP7A1 transcription persis-

148 General discussion ted when FXR and RXR expression was silenced with siRNA (28). This indicates that in the liver both FXR/RXR-dependent and -independent mechanisms contribute to suppression of CYP7A1 expression in response to vitamin A. Conversely, we showed in chapter 4 that vitamin A deficiency in rats increased bile acid levels in plasma 2.25-fold and that the increased expression of ileal Fgf15 is unable to efficiently repressCyp7a1 . Apparently, FXR/RXRα-mediated suppression of Cyp7a1 is overruled when ileal vitamin A levels are low. This may serve a direct physiological role in hypovitaminosis A as bile salt synthesis is maintained to support efficient intestinal absorption of vitamin A. The mechanisms that are interfering with FGF15-mediated signaling to suppress Cyp7A1 are presently unknown, but add an additional level of complexity to the regulation of bile salt synthesis. Together, these results show that efficient absorption of vitamin A in the intestine contributes to repression of bile acid synthesis via FXR-dependent (FGF19 and SHP) and FXR-independent mechanisms. Low levels of vitamin A entering the enterocyte maybe a signal for a limited action of bile salts in the intestinal lumen, reducing the negative feedback loop on bile acid synthesis. Figure 6.2 depicts the impaired negative feedback on bile acid synthesis as a consequence of vitamin A deficiency.

Absorption of Vitamin A as an Additional Signal to Fine Tune Bile Acid Trans- port With low levels of ileal and hepatic vitamin A the negative feedback mechanism fails to repress bile acid synthesis (Chapter 4) while high levels of vitamin A reduce bile acid synthesis (26). Genes encoding bile acid importers NTCP/Ntcp and ASBT/Asbt are both established RAR/RXRα target genes in human and rodents (29-31). Bile salts inhibit expression of rat NTCP by increasing expression of SHP, which interacts with RAR/RXRα and prevents its binding to the Ntcp promoter (29). SHP expression itself is also positively regulated by vitamin A, thereby creating a negative feedback loop on NTCP expression. Thus, vitamin A has the potential to increase ileal and hepatic import of bile acids by stimulating expression of NCTP and ASBT, but at the same time provides a “break” on their expression by also stimulating SHP transcription that represses transcription of NTCP and ASBT. Interestingly, rat Ntcp and human and mouse ASBT/Asbt, but not rat Asbt expression is repressed by bile acids (31). This specific difference between species may contribute to the observation that vitamin A deficient rats develop mild cholestasis (Chapter 4), while this was not observed for VAD mice (Chapter 2). Various FXR target genes are differentially regulated by the combination of FXR and RXRα ligands. A remarkable example are OSTα and OSTβ that together form a membrane-embedded bile salt transporter. In the colon carcinoma cell line DLD-1, 9cRA does not affect OSTα transcription while the CDCA-dependent transcription of OSTβ is enhanced by 9cRA. The contribution of the individual subunits of the obligatory complex OSTα/β to the transport activity is unknown as is the stoichio- metric ratio in which the α- and β-subunits are present at the plasma membrane. Ho- wever, one can envision that by fine tuning the ratio of α- and β-subunits vitamin A

149 Chapter 6 could modulate transport efficiency and/or specificity of this bile acid transporter at the basolateral membrane of enterocytes and thereby control the intestinal absorption of bile acids to the circulation. Vitamin A affects bile acid homeostasis not only at the transcriptional level, but also at the post-transcriptional level. Without an apparent reduction in Ntcp mRNA levels in cholate (CA)-fed VAD mice (Chapter 2), NTCP protein expression is markedly reduced in these animals compared to the vitamin A sufficient (VAS) controls (Figu- re 2.7). It is unclear whether this decrease is caused by the increased bile acid levels in plasma, or that the decrease in NTCP expression itself contributes to the observed increase in plasma bile acid levels. Vitamin A may thus affect ileal and hepatic bile acid import and export directly by acting as a ligand to transcription factors that induce transcription of bile acid transporters and indirectly by activation of a negative feedback mechanism on transcription or by post-translational lowering of protein levels of these transporter proteins.

Vitamin A (deficiency) and liver damage Both hyper- and hypovitaminosis A are known to affect liver function. There are multiple reports that excessive vitamin A intake leads to cholestasis in human (32-37). Notably, all described cases of vitamin A-induced cholestasis were reversible. Vita- min A-induced fibrosis correlates with stellate cell activation, although it remains to be elucidated whether vitamin A per se is the major cause of this phenomenon (38). At the other end of the spectrum, vitamin A deficiency (3 months VAD diet in rats) led to spontaneous morphological changes in the liver. Apart from the expected loss of lipid droplets in stellate cells, the hepatic architecture was disturbed and the parenchyma disorganized with fat droplets in the hepatocytes. Furthermore, expression of markers of stellate cell activation e.g. alpha-smooth muscle actin (α-Sma), collagen IV, laminin 1 and fibronectin were increased by VAD (39). Although rats were fed a VAD diet for 4 months in our experiments, we did not observe stellate cell activation and/or morphological changes of the liver. In the study of Aguilar et al. rats were put on the VAD diet at 3 weeks of age, while at the beginning of our study animals were 6 weeks of age. Younger animals have a smaller liver and thus less storage of vitamin A and thus these rats may have become vitamin A deficient earlier. In our experiments, we monitored the serum retinol level carefully and sacrificed the animals at the moment when the rats were not able anymore to maintain normal serum retinol levels. It could very well be that the hepatic architecture is rapidly disturbed after prolonged exposure to a vitamin A deficient diet. Another important difference between these 2 studies is that Aguilar et al. used female rats where we used male rats and clear differences in vitamin A storage, serum levels and minimal requirements of this vitamin between male and females have been described (40, 41).

Vitamin A Deficiency and Liver Injury Caused by Obstruction of Bile Flow Based on the research presented in chapter 4 we expected that the lack of vitamin A may contribute to liver injury in acute and chronic liver diseases as VAD alone led

150 General discussion to mild cholestasis. Furthermore, the observed maximal expression of Bsep mRNA under low retinol conditions (Figure 2.1 and (18, 42)) may also be harmful, in particular in obstructive cholestasis, as it maintains canalicular bile salt secretion while bile fl ow from the liver is compromised.

Figure 6.2. Vitamin A defi ciency impairs negative feedback loop on bile acid synthesis Vitamin A defi ciency leads to an increased bile salt concentration in plasma in rats. Despite increased expression of FGF15 (FGF19 is the human homolog) CYP7A1 levels are not down regulated. Expression of bile salt transporters was not majorly altered by vitamin A defi ciency. Th e lack of vitamin A therefore overrules FGF15-mediated repression of Cyp7A1 expression in the liver. Whether FGF15 requires vitamin A to fulfi ll its signaling function to the liver, or whether FGF15 and vitamin A signal via completely independent mechanisms remains to be determined. Th is way not only the presence of bile acids in the intestinal lumen, but also its ability to successfully fulfi l its function in absorption of fat (-soluble) compounds is a signal that adequate amounts of bile acids are in circulation. Indeed, vitamin A defi ciency led to severe liver damage in bile duct-ligated rats, a model of obstructive cholestasis. However, VAD-mediated dysregulation of FXR/RXR target genes could not explain the observed liver damage. Compared to bile salt feeding, bile duct ligation is a more complex model of cholestasis, which also leads to in- fl ammation and fi brosis and may involve the response of other liver cell types to VAD. Although vitamin A defi ciency represses the negative feedback on bile acid synthesis, resulting in increased bile salt serum concentration in rats (Chapter 4) and cholate-fed mice (Chapter 2), it does not lead to liver disease when bile fl ow is not obstructed.

151 Chapter 6

A remarkable observation was that VAD rats accumulated a significant volume of bile in front of the ligation resulting is swelling of the common bile duct, which was only minor in bile duct-ligated VAS animals. This implies that bile secretion is increased in VAD rats and that obstruction of the bile flow may lead to physical pressure in the biliary tree leading to excessive liver damage. However, treating these animals with vitamin A strongly repressed liver damage to a level observed in VAS-BDL rats, while these “bile sacs” were not reduced in size. This indicates that the putative increase in pressure in the biliary tree is not causing the excessive liver damage. Moreover, hepatic bile salt concentrations were not significantly increased in VAD-BDL rats compared to VAS-BDL. Still the VAD-BDL rats showed strongly increased serum γGT levels together with pronounced bile duct proliferation.

Thus, lack of vitamin A may affect the composition of bile, shifting the balance of individual bile salts or lowering the phospholipids and cholesterol content in bile. Toxic bile may be an important feature in primary sclerosing cholangitis (PSC) and contribute to the progression of this disease (43). A rapid normalization of bile salt composition in response to vitamin A therapy, without affecting total bile salt concentration/flow, could explain the beneficial effects of vitamin A therapy despite the occurrence of bile sacs in VAD-BDL animals. From these data we concluded that vitamin A therapy and deficiency do influence bile salt homeostasis, but that the acute therapeutic effect of vitamin A on bile duct ligation-induced liver injury under vitamin A-deficient conditions is most likely not caused by aberrant FXR/RXRα signaling. However, the one week window of BDL we used in these experiments may be too long to detect the involvement of FXR signaling in the onset of liver damage, as the cholestatic condition and occurrence of liver damage was greatly accelerated by VAD and the majority of the hepatocytes might already be damaged or necrotic when the animals were sacrificed.

Vitamin A Deficiency and Hepatic Stellate Cell Activation Hepatic stellate cells (HSCs) control vitamin A metabolism and contain up to 80% of the body stores of this nutrient. These cells appear to play a pivotal role in liver injury caused by both hypo- and hypervitaminosis A. Chronic liver damage leads to liver fibrosis, which is characterized by activation of HSCs that rapidly lose their vitamin A-containing lipid droplets. This prompted researchers to investigate the role of vitamin A in the activation of HSCs in relation to liver damage. Lecithin retinol acyltransferase deficient (Lrat-/-) mice cannot synthesize retinyl esters and therefore lack vitamin A-containing lipid droplets in the HSC. These mice do not spontane- ously develop liver fibrosis (44). Thus, the absence of vitamin perA se does not lead to activation of HSCs. Serum retinol concentrations are lowered during infection and retinol binding protein 4 (RBP4) synthesis and excretion is lowered by inflammation, leading to retinol accumulation in the liver (45, 46). BDL is accompanied by inflammation and consequently, we observed decreased plasma retinol levels (-51%) and increased hepatic

152 General discussion retinol levels (+61%) in VAS BDL rats (Table 5.2). This could be explained by recruitment of retinol to the liver or by conversion of retinyl palmitate to free retinol by activated HSC. Remarkably, Lrat-/- mice do not suffer more liver damage as a consequence of BDL (3 weeks) compared to WT mice. The absence of retinyl ester-containing lipid droplets in the HSC does not influence BDL-induced HSC activation/fibrosis (44). Although the Lrat-/- mice are unable to store vitamin A in the liver they are not vitamin A deficient. Dietary vitamin A in these animals is primarily absorbed as free retinol in chylomicrons. The storage function of vitamin A as retiny lesters is partially taken over by adipose tissue and results in normal serum retinol levels (47). Thus, the suppressive effect of vitamin A on the development of liver fibrosis seems not to be due to retinyl palmitate contained in the vitamin A droplets, but is likely mediated through free retinol. Like Lrat-/- mice, VAD rats have no retinoids stored in the HSC, but unlike Lrat-/- mice VAD rats cannot recruit free retinol to the liver since these animals lack vitamin A altogether. Consequently, BDL in VAD rats is accompanied by excessive liver damage and a strongly enhanced fibrotic response as shown by increasedα-Sma and collagen type I (Col1a1) expression (Chapter 5). In vitro studies have shown that HSC activation can be suppressed by vitamin A (48). Furthermore, various in vivo studies reported the beneficial effect of (pro)vitamin A-derived compounds on the disease course of experimentally induced liver damage/cholestasis in vitamin A sufficient animals. Retinoic acid and β-carotene were shown to reduce CCl4 induced hepatic fibrosis in rats (49-54). Release of vitamin A from activating stellate cells could therefore serve to prevent over activation of neig- hboring stellate cells. In our study, vitamin A therapy did not increase hepatic retinol levels in control (VAS) animals. In contrast, serum and hepatic retinol levels were significantly increased after 1 week vitamin A therapy in VAD rats to 63% and 35% of the levels observed in VAS animals, respectively (Chapter 5). Bile duct ligation led to a decrease in serum retinol levels (-51%) and an increase in hepatic retinol levels (+61%) in control rats, indicating that bile obstruction leads to a redistribution of retinols to the liver even when vitamin A is sufficiently present. This process was even more pronounced in VAS-BDL rats receiving vitamin A therapy, which showed 60% lower serum levels and 140% higher hepatic levels of retinol. BDL also enhanced hepatic retinol concentrations in vitamin-A treated VAD animals, but these levels were still 70% lower than in vitamin A treated VAS-BDL rats. Vitamin A deficiency alone did not lead to a -fi brotic response in rats. In contrast, BDL induced fibrosis in control (VAS) rats, which was not repressed by vitamin A therapy. The fibrotic response was strongly enhanced in VAD-BDL treated animals and was effectively suppressed by vitamin A therapy, while hepatic retinol levels were far below VAS-BDL levels. This indicates that absolute retinol levels in the liver are not associated with the fibrotic response and/or that only minor amounts or retinol are sufficient to prevent hepatic stellate cell activation.

153 Chapter 6

Vitamin A Deficiency and Inflammation Bile duct ligation leads to hepatic inflammation and is strongly enhanced in the absence of retinol. Vitamin A is required for several aspects of the immune responses. Vitamin A deficiency impairs both innate and adaptive immune response to infection resulting in an impaired ability to counteract extracellular pathogens (55). Retinoic acid affects the balance between Th1- en Th2-cells in favor of the latter and promotes the proliferation of regulatory T-cells. Furthermore, vitamin A modulates nitric oxide (NO) production and inhibits the production of the pro-inflammatory cytokines tumor necrosis factor alpha (TNFα) and interleukin-2 (IL-2), thereby favoring a Th2-

Treg non-inflammatory environment (reviewed by Mora et al. (56) and Pino-Lagos et al. (57)). This is in line with the observation that vitamin A deficiency aggravates the clinical manifestations of inflammatory reactions (58). Although we did not detect major effects of VAD on cytokine transcription (data not shown), iNos transcription is 21-fold increased in VAD-BDL rats compared to VAS- BDL animals. BDL gives rise to a sterile inflammatory response in which innate immune cells are activated (59). Kupffer cells (the hepatic macrophages) and attracted neutrophils produce ROS through increased expression of iNOS. Th1 cells are more potent activators of macrophages than Th2 cells and under vitamin A deficient condition the balance between Th1- and Th2- cells shifts towards the hT 1-cells favouring an environment in which macrophages and attracted neutrophils are stimulated to express more iNOS. However, VAD alone did not increase iNos mRNA levels (Figure 5.8 and Table 5.3), indicating that shortage of vitamin A itself is not the trigger of the sterile inflammatory response. Pro-vitamin A β-carotene is a potent antioxidant (60, 61), but also retinol, retinyl esters and retinoic acid have been shown to prevent lipid peroxidation in vitro (62, 63). Various studies in rodents show that vitamin A deficiency affects hepatic antioxidant enzyme expression and/or activity, but contradictory results have been reported. Ex- pression or activity of catalase (CAT) was found to be either up- (64-66) or down-regulated (67), while superoxide dismutase (SOD) was not affected (64, 66, 67) in liver, but reduced in lung (67). Glutathione peroxidase 1 (GPX1) was either up-regulated (66), unaffected (67) or down-regulated (64) by vitamin A deficiency. In our study, hepatic mRNA expression of both Cat and Gpx1 was reduced in vitamin A-deficient rats (data not shown). These results show that vitamin A deficiency alters the antioxidant defense of the liver. On the other hand, vitamin A (atRA) supplementation restored SOD activity and hepatic glutathione (GSH) levels of bile duct ligated (4 weeks) rats to that of sham treated rats. (53). However, in our one week BDL model we did not detect an effect on antioxidant enzymes (Cat, Gpx1 and Sod) in liver of VAS rats as a result of vitamin A therapy. Moreover, retinyl palmitate supplementation did not significantly increase expression of antioxidant enzymes in VAD-BDL treated rats. In conclusion, vitamin A deficiency gives rise to production of pro-inflammatory cytokines and makes the liver more vulnerable to oxidative stress by altering expression levels of antioxidant enzymes, but did not induce an inflammatory response

154 General discussion by itself in our study. However, it hereby increases the risk of acquiring irreversible tissue damage, as illustrated by our in vivo model of obstructive cholestasis.

Suggestions for future research Although inadequate FXR/RXRα signaling could not be established as the major cause of liver damage in VAD-BDL rats, it may still play a role in the initial phase/onset of this phenotype. It is therefore essential to analyze the progression of liver damage and the hepatic process involved in VAD-BDL treated rats at earlier time points. Es- tablishing FXR target gene expression at earlier time points may reveal whether FXR/ RXRα signaling is involved in initiating excessive the liver damage. Since the excessive liver damage is characterized by bile duct proliferation and bile duct damage, it seems particularly interesting to analyze the composition of the bile produced by VAD animals and how this is changed upon bile duct ligation.

In conclusion: In conclusion, the research described in this thesis shows that vitamin A co-regulates expression of various FXR target genes (such as BSEP, SHP, OSTα/β and FGF19) and is therefore an independent factor in controlling bile acid synthesis and transport. The RXRα ligand, 9cRA, inhibits binding of the FXR/RXRα-heterodimer to its responsive element (FXRE) as a default mechanism. We show that SHP is synergistically activated by RXRα/9cRA and FXR/CDCA through 2 spacely separated DNA elements, including a novel FXR binding site that shares high sequence homology to a LRH-1 binding element. Thesein vitro data show that the molecular mechanisms involving FXR and RXRα in regulating bile acid homeostasis is far more complex than simply binding of the FXR/RXRα heterodimers to the IR-1 element. The novel mechanisms that are required for synergistic regulation by RXRα/9cRA and FXR/ CDCA are particularly relevant for the negative feedback on bile acid synthesis via SHP and FGF19. Vitamin A is not only important for gene regulation, but also affects bile salt physiology at post-transcriptional levels. This is evident from the mild cholestasis that develops in vitamin A deficient rats, while there are no significant changes in transcript levels of genes involved in bile salt synthesis and transport. Finally, vitamin A is essential to prevent excessive liver damage in a rat model of obstructive cholestasis. Without vitamin A (therapy), these animals die from progressive liver injury. The exact molecular events that lead to liver failure under these conditions remain to be established, but appear highly relevant for patients with chronic liver disease that are prone to develop hypovitaminosis A, including biliary atresia, autoimmune hepatitis and fibrosis.

155 Chapter 6

References

1. Sommer A. Vitamin A deficiency and clinical disease: an historical overview. J Nutr 2008 Oct;138(10):1835- 1839. 2. Schuster GU, Kenyon NJ, Stephensen CB. Vitamin A deficiency decreases and high dietary vitamin A increases disease severity in the mouse model of asthma. J Immunol 2008 Feb 1;180(3):1834-1842. 3. Kemp CM, Jacobson SG, Faulkner DJ, Walt RW. Visual function and rhodopsin levels in humans with vitamin A deficiency. Exp Eye Res 1988 Feb;46(2):185-197. 4. Wolf G. The experimental induction of vitamin A deficiency in humans. J Nutr 2002 Jul;132(7):1805-1811. 5. Amedee-Manesme O, Mourey MS, Therasse J, Couturier M, Alvarez F, Hanck A, et al. Short- and long-term vitamin A treatment in children with cholestasis. Am J Clin Nutr 1988 Apr;47(4):690-693. 6. Smith FR, Goodman DS. Vitamin A transport in human vitamin A toxicity. N Engl J Med 1976 Apr 8;294(15):805-808. 7. Bankson DD, Russell RM, Sadowski JA. Determination of retinyl esters and retinol in serum or plasma by normal-phase liquid chromatography: method and applications. Clin Chem 1986 Jan;32(1 Pt 1):35-40. 8. Lascari AD. Carotenemia. A review. Clin Pediatr (Phila) 1981 Jan;20(1):25-29. 9. Penniston KL, Tanumihardjo SA. The acute and chronic toxic effects of vitamin A. Am J Clin Nutr 2006 Feb;83(2):191-201. 10. Tanumihardjo SA. Assessing vitamin A status: past, present and future. J Nutr 2004 Jan;134(1):290S-293S. 11. Rosales FJ, Ritter SJ, Zolfaghari R, Smith JE, Ross AC. Effects of acute inflammation on plasma retinol, retinol-binding protein, and its mRNA in the liver and kidneys of vitamin A-sufficient rats. J Lipid Res 1996 May;37(5):962-971. 12. Rayssiguier Y, Alexandre-Gouabau MC, Lyan B, Gueux E, Mazur A, Rock E. Inflammation interferes with the assessment of vitamin A status in magnesium deficiency. Magnes Res 2008 Dec;21(4):237-239. 13. Mangelsdorf DJ, Evans RM. The RXR heterodimers and orphan receptors. Cell 1995 Dec 15;83(6):841-850. 14. Grober J, Zaghini I, Fujii H, Jones SA, Kliewer SA, Willson TM, et al. Identification of a bile acid-responsive element in the human ileal bile acid-binding protein gene. Involvement of the farnesoid X receptor/9-cis-retinoic acid receptor heterodimer. J Biol Chem 1999 Oct 15;274(42):29749-29754. 15. Urizar NL, Dowhan DH, Moore DD. The farnesoid X-activated receptor mediates bile acid activation of phospholipid transfer protein gene expression. J Biol Chem 2000 Dec 15;275(50):39313-39317. 16. Forman BM, Goode E, Chen J, Oro AE, Bradley DJ, Perlmann T, et al. Identification of a nuclear receptor that is activated by farnesol metabolites. Cell 1995 Jun 2;81(5):687-693. 17. Zavacki AM, Lehmann JM, Seol W, Willson TM, Kliewer SA, Moore DD. Activation of the orphan receptor RIP14 by retinoids. Proc Natl Acad Sci U S A 1997 Jul 22;94(15):7909-7914. 18. Kassam A, Miao B, Young PR, Mukherjee R. Retinoid X receptor (RXR) agonist-induced antagonism of farnesoid X receptor (FXR) activity due to absence of coactivator recruitment and decreased DNA binding. J Biol Chem 2003 Mar 21;278(12):10028-10032. 19. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, et al. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000 Sep;6(3):517-526. 20. Goodwin B, Watson MA, Kim H, Miao J, Kemper JK, Kliewer SA. Differential regulation of rat and human CYP7A1 by the nuclear oxysterol receptor liver X receptor-alpha. Mol Endocrinol 2003 Mar;17(3):386-394. 21. Castelein H, Janssen A, Declercq PE, Baes M. Sequence requirements for high affinity retinoid X receptor-alpha homodimer binding. Mol Cell Endocrinol 1996 May 17;119(1):11-20. 22. Claudel T, Sturm E, Duez H, Torra IP, Sirvent A, Kosykh V, et al. Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J Clin Invest 2002 Apr;109(7):961-971. 23. Song X, Kaimal R, Yan B, Deng R. Liver receptor homolog 1 transcriptionally regulates human bile salt export pump expression. J Lipid Res 2008 May;49(5):973-984.

156 General discussion

24. Bohan A, Chen WS, Denson LA, Held MA, Boyer JL. Tumor necrosis factor alpha-dependent up-regulation of Lrh-1 and Mrp3(Abcc3) reduces liver injury in obstructive cholestasis. J Biol Chem 2003 Sep 19;278(38):36688-36698. 25. Chong HK, Biesinger J, Seo YK, Xie X, Osborne TF. Genome-wide analysis of hepatic LRH-1 reveals a promoter binding preference and suggests a role in regulating genes of lipid metabolism in concert with FXR. BMC Genomics 2012;13:51. 26. Schmidt DR, Holmstrom SR, Fon TK, Bookout AL, Kliewer SA, Mangelsdorf DJ. Regulation of bile acid synthesis by fat-soluble vitamins A and D. J Biol Chem 2010 May 7;285(19):14486-94. 27. Marill J, Idres N, Capron CC, Nguyen E, Chabot GG. Retinoic acid metabolism and mechanism of action: a review. Curr Drug Metab 2003 Feb;4(1):1-10. 28. Cai SY, He H, Nguyen T, Mennone A, Boyer JL. Retinoic acid represses CYP7A1 expression in human hepatocytes and HepG2 cells by FXR/RXR-dependent and independent mechanisms. J Lipid Res 2010 Aug;51(8):2265-74. 29. Denson LA, Sturm E, Echevarria W, Zimmerman TL, Makishima M, Mangelsdorf DJ, et al. The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. Gastroen- terology 2001 Jul;121(1):140-147. 30. Denson LA, Auld KL, Schiek DS, McClure MH, Mangelsdorf DJ, Karpen SJ. Interleukin-1beta suppresses retinoid transactivation of two hepatic transporter genes involved in bile formation. J Biol Chem 2000 Mar 24;275(12):8835-8843. 31. Neimark E, Chen F, Li X, Shneider BL. Bile acid-induced negative feedback regulation of the human ileal bile acid transporter. Hepatology 2004 Jul;40(1):149-156. 32. Oren R, Ilan Y. Reversible hepatic injury induced by long-term vitamin A ingestion. Am J Med 1992 Dec;93(6):703-704. 33. Becker P, Maurer B, Schirmacher P, Waldherr R, Parlesak A, Bode C, et al. Vitamin A-induced cholestatic hepatitis: a case report. Z Gastroenterol 2007 Oct;45(10):1063-1066. 34. Smith JW. Vitamin A toxicity presenting as jaundice. Postgrad Med 1989 Mar;85(4):53-4, 56. 35. Ramanathan VS, Hensley G, French S, Eysselein V, Chung D, Reicher S, et al. Hypervitaminosis A inducing intra-hepatic cholestasis--a rare case report. Exp Mol Pathol 2010 Apr;88(2):324-325. 36. Russell RM. The vitamin A spectrum: from deficiency to toxicity. Am J Clin Nutr 2000 Apr;71(4):878-884. 37. Sheth A, Khurana R, Khurana V. Potential liver damage associated with over-the-counter vitamin supplements. J Am Diet Assoc 2008 Sep;108(9):1536-1537. 38. Nollevaux MC, Guiot Y, Horsmans Y, Leclercq I, Rahier J, Geubel AP, et al. Hypervitaminosis A-induced liver fibrosis: stellate cell activation and daily dose consumption. Liver Int 2006 Mar;26(2):182-186. 39. Aguilar RP, Genta S, Oliveros L, Anzulovich A, Gimenez MS, Sanchez S. Vitamin A deficiency injures liver parenchyma and alters the expression of hepatic extracellular matrix. J Appl Toxicol 2009 Apr;29(3):214-22. 40. Hoffmann R, Schneider A, Quamo Y. The sex difference in vitamin A metabolism. J Invest Dermatol 1950 Dec;15(6):409-419. 41. Johnson EJ, Krasinski SD, Russell RM. Sex differences in postabsorptive plasma vitamin A transport. Am J Clin Nutr 1992 Nov;56(5):911-916. 42. Hoeke MO, Plass JR, Heegsma J, Geuken M, van Rijsbergen D, Baller JF, et al. Low retinol levels differentially modulate bile salt-induced expression of human and mouse hepatic bile salt transporters. Hepatology 2009 Jan;49(1):151-159. 43. Fickert P, Moustafa T, Trauner M. Primary sclerosing cholangitis - The arteriosclerosis of the bile duct? Lipids Health Dis 2007;6:3. 44. Kluwe J, Wongsiriroj N, Troeger JS, Gwak GY, Dapito DH, Pradere JP, et al. Absence of hepatic stellate cell retinoid lipid droplets does not enhance hepatic fibrosis but decreases hepatic carcinogenesis. Gut 2011 Sep;60(9):1260-1268. 45. Rosales FJ, Ross AC. Acute inflammation induces hyporetinemia and modifies the plasma and tissue response to vitamin A supplementation in marginally vitamin A-deficient rats. J Nutr 1998 Jun;128(6):960-966.

157 Chapter 6

46. Gieng SH, Raila J, Rosales FJ. Accumulation of retinol in the liver after prolonged hyporetinolemia in the vitamin A-sufficient rat. J Lipid Res 2005 Apr;46(4):641-649. 47. Liu L, Gudas LJ. Disruption of the lecithin:retinol acyltransferase gene makes mice more susceptible to vitamin A deficiency. J Biol Chem 2005 Dec 2;280(48):40226-40234. 48. Pinzani M, Gentilini P, Abboud HE. Phenotypical modulation of liver fat-storing cells by retinoids. In- fluence on unstimulated and growth factor-induced cell proliferation. J Hepatol 1992 Mar;14(2-3):211-220. 49. Senoo H, Wake K. Suppression of experimental hepatic fibrosis by administration of vitamin A. Lab Invest 1985 Feb;52(2):182-194. 50. Seifert WF, Bosma A, Hendriks HF, van Leeuwen RE, van Thiel-de Ruiter GC, Seifert-Bock I, et al. Beta-ca-

rotene (provitamin A) decreases the severity of CCl4-induced hepatic inflammation and fibrosis in rats. Liver 1995 Feb;15(1):1-8. 51. Knook DL, Bosma A, Seifert WF. Role of vitamin A in liver fibrosis. J Gastroenterol Hepatol 1995;10 Suppl 1:S47-S49. 52. Wang L, Potter JJ, Rennie-Tankersley L, Novitskiy G, Sipes J, Mezey E. Effects of retinoic acid on the development of liver fibrosis produced by carbon tetrachloride in mice. Biochim Biophys Acta 2007 Jan;1772(1):66- 71. 53. Jiang H, Dan Z, Wang H, Lin J. Effect of ATRA on contents of liver retinoids, oxidative stress and hepatic injury in rat model of extrahepatic cholestasis. J Huazhong Univ Sci Technolog Med Sci 2007 Oct;27(5):491- 494. 54. de Freitas JS, Bustorff-Silva JM, Castro e Silva Junior, Jorge GL, Leonardi LS. Retinyl-palmitate reduces liver fibrosis induced by biliary obstruction in rats. Hepatogastroenterology 2003 Jan;50(49):146-150. 55. Wintergerst ES, Maggini S, Hornig DH. Contribution of selected vitamins and trace elements to immune function. Ann Nutr Metab 2007;51(4):301-323. 56. Mora JR, Iwata M, von Andrian UH. Vitamin effects on the immune system: vitamins A and D take centre stage. Nat Rev Immunol 2008 Sep;8(9):685-698. 57. Pino-Lagos K, Guo Y, Noelle RJ. Retinoic acid: a key player in immunity. Biofactors 2010 Nov;36(6):430- 436. 58. Wiedermann U, Chen XJ, Enerback L, Hanson LA, Kahu H, Dahlgren UI. Vitamin A deficiency increases inflammatory responses. Scand J Immunol 1996 Dec;44(6):578-584. 59. Jaeschke H. Reactive oxygen and mechanisms of inflammatory liver injury: Present concepts. J Gastroen- terol Hepatol 2011 Jan;26 Suppl 1:173-179. 60. Hix LM, Lockwood SF, Bertram JS. Bioactive carotenoids: potent antioxidants and regulators of gene expression. Redox Rep 2004;9(4):181-191. 61. Paiva SA, Russell RM. Beta-carotene and other carotenoids as antioxidants. J Am Coll Nutr 1999 Oct;18(5):426-433. 62. Samokyszyn VM, Marnett LJ. Inhibition of liver microsomal lipid peroxidation by 13-cis-retinoic acid. Free Radic Biol Med 1990;8(5):491-496. 63. Livrea MA, Tesoriere L, Bongiorno A, Pintaudi AM, Ciaccio M, Riccio A. Contribution of vitamin A to the oxidation resistance of human low density lipoproteins. Free Radic Biol Med 1995 Mar;18(3):401-409. 64. Sohlenius-Sternbeck AK, Appelkvist EL, DePierre JW. Effects of vitamin A deficiency on selected xenobiotic-metabolizing enzymes and defenses against oxidative stress in mouse liver. Biochem Pharmacol 2000 Feb 15;59(4):377-383. 65. Sohlenius AK, Reinfeldt M, Backstrom K, Bergstrand A, DePierre JW. Hepatic peroxisome proliferation in vitamin A-deficient mice without a simultaneous increase in peroxisomal acyl-CoA oxidase activity. Bio- chem Pharmacol 1996 Mar 22;51(6):821-827. 66. Anzulovich AC, Oliveros LB, Muñoz E, Martinez LD, Gimenez MS. Nutritional vitamin A deficiency alters antioxidant defenses and modifies the liver histoarchitecture in rat. 13 ed. 2008. 343-357. 67. Dogra SC, Khanduja KL, Gupta MP, Sharma RR. Effect of vitamin A deficiency on pulmonary and hepatic protective enzymes in rat. Acta Vitaminol Enzymol 1983;5(1):47-52.

158 Summary Samenvatting Summary

Stagnation of bile flow from the liver to the intestine results in a clinical condition known as cholestasis. Bile is required for the digestion and uptake of fats and fat-soluble compounds in the intestine. As a consequence cholestasis is accompanied by malabsorption of fat-soluble vitamins; including vitamin A. Vitamin A is primarily stored in the liver. Chronic cholestasis is associated with depletion of the vitamin A stores in the liver. Vitamin A is a group of compounds exhibiting the same biological activity as retinol. It has numerous functions in the mammalian body due to its anti-oxidant and signaling (hormone like) properties. Bile salts are the components of bile responsible for its emulsifying properties, which are crucial in the digestion and absorption vitamin A. Clearly bile salt homeostasis affects vitamin A homeostasis. This thesis aims to show that the reverse connection also exists, namely vitamin A influencing bile salt homeostasis. Chapter 1 introduces the reader to the enterohepatic circulation of bile salts, ileal vitamin A absorption and signalling pathways that include bile salts and vitamin A. The liver plays a crucial role in both vitamin A and bile salt homeostasis. Bile salts are synthesized from cholesterol and excreted into bile by the liver. With the aid of bile salts vitamin A is absorbed in the ileum. Absorbed vitamin A travels the circulation to the liver where it is stored in the hepatic stellate cells. From these stores, vitamin A is distributed throughout the body. At the terminal ileum bile salts are efficiently taken up and returned to the liver via the portal vein. As bile salts are potentially cytotoxic compounds, synthesis and transport is tightly regulated. Farnesoid X receptor (FXR) is the primary mammalian bile salt sensor. FXR belongs to the super family of nuclear receptors (NRs), which are ligand activated transcription factors. Key genes involved in bile acid synthesis and transport belong to the group of FXR target genes. These include the bile salt export pump (BSEP), small heterodimer partner (SHP) and fibroblast growth factor 19 (FGF19). BSEP transports bile salts from the hepatocyte (the liver parenchymal cell) into bile. SHP and FGF19 participate in the negative feedback loop on bile acid synthesis by inhibiting expression of the cytochrome P450 enzyme 7A1 (CYP7A1). In order to regulate transcription of its target genes, FXR dimerizes with another member of the NR-super family, namely the retinoid X receptor (RXR). The ligand of RXR is the vitamin A derivative 9-cis retinoic acid (9cRA). The FXR/RXR heterodimer recognizes so called FXR responsive elements (FXREs) in the promoter region of FXR target genes. The typical FXRE consists of an inverted repeat of six base pairs spaced by one nucleotide (IR-1) with consensus sequence AGGTCAnTGACCT. Chapter 2 and 3 describe how the RXR ligand vitamin A/9cRA co-regulates the transcription of FXR target genes in vitro and in vivo. Depending on the gene of interest vitamin A either super induces (SHP and FGF19) or inhibits (BSEP) the bile salt induced transcription of FXR target genes. By replacing the FXRE-sequence in the BSEP promoter with the FXRE-sequence in the human SHP promoter identified by Goodwin et al. (2000), we show in chapter 2 that the RXR ligand by default represses the bile salt induced promoter activity at the FXRE. This indicates that promoter regions secondary to the FXRE are involved in the super-induction of bile salt-dependent

160 Summary

FXR target gene transcription by the RXR/vitamin A ligand. In chapter 3 we describe the hunt for these vitamin A regulatory elements in the SHP promoter. Much to our surprise we found that the FXRE identified by Good- win et al. is neither required nor sufficient for FXR/CDCA-dependent transcription of SHP. However, this previously identified FXRE sequence is required for the 9cRA-dependent super induction of CDCA-activated SHP transcription. In addition, we identified a novel FXR/CDCA responsive region, which is located in between the previously identified FXRE and the transcription initiation site of hSHP. This novel FXR/CDCA responsive region co-localizes with a liver receptor homolog-1 (LRH-1) responsive element. In chapter 4 we describe the absence of negative feedback regulation on bile salt synthesis in vitamin A-deficient (VAD) animals. Although both Shp and Fgf15 (the rodent ortholog of human FGF19) transcription is increased in vitamin A-deficient animals, this does not lower Cyp7a1 levels. This resulted in increased plasma bile salt concentrations in these animals. We propose that vitamin A is involved in inhibitory pathways, which monitor that adequate amounts of bile salt reach the ileum for efficient vitamin A absorption. The in vivo observations that BSEP is maximal expressed in the absence of vitamin A, and that bile acid synthesis repression mechanisms are failing in VAD animals, implicate the possibility of an increased bile flow as a consequence of low vitamin A levels. Indeed VAD rats displayed signs of an increased bile flow as a consequence of VAD Chapter( 4), but this was not observed in VAD mice (Chapter 2). However, in both animal models negative feedback regulation on bile acid synthesis was impaired as a consequence of vitamin A deficiency, a condition which is unfavourable in case of obstructive cholestasis, as it would contribute to the extra hepatic accumulation of bile. In chapter 5 we studied the effect of vitamin A deficiency on the disease course of obstructive cholestasis in rats. One week of bile duct ligation (BDL) in VAD animals resulted in highly increased aspartate transaminase (AST), alanine transaminase (ALT), alkaline phosphatase (AP) and gamma-glutamyl transferase (γGT) levels and a clearly injured liver at the macroscopic level, a degree of liver disease that would only develop after at least 4 weeks of BDL in vitamin A sufficient (VAS) animals.- Im portantly, increase of all of these markers and weight loss was prevented by vitamin A therapy. AST, ALT, AP and γGT levels of vitamin A treated VAD-BDL rats were comparable to bile duct-ligated VAS animals. Lack of vitamin A thus aggravates liver damage and accelerates the cholestatic disease course in rats. We were unable to directly link these observations to FXR/RXR signalling. We did find that the expression of biomarkers for oxidative stress (Ho-1), inflammation (iNos) and fibrosis (α-Sma and Col1a1) was highly increased in vitamin A deficient bile duct-ligated rats. The transcription profiles of all four of these biomarkers closely follows the occurrence of hepatic and bile ductular enzymes in blood plasma. Both bile duct-ligation and vitamin A-deficiency have independently been associated with increased oxidative stress, inflammation, and fibrosis. In combination, vitamin A deficiency amplified BDL inflicted liver injury resulting in necroinflammation.

161 Summary

The data presented in this thesis shows that vitamin A is an important co-regulator of bile acid homeostasis and that efficient absorption of vitamin A in the intestine may well be an additional signal to the bile acid synthesis repression mechanisms. Clini- cally most relevant is the observation that vitamin A deficiency severely aggravates liver damage by obstructive cholestasis. This urges the close monitoring of vitamin A levels in cholestatic patients, as vitamin A shortage could rapidly deteriorate the patient’s condition.

162 Samenvatting

Het ziektebeeld cholestase wordt gekenmerkt door stagnatie van de galstroom van lever naar dunne darm. Gal is nodig voor het verteren en absorberen van vetten en vetoplosbare stoffen in de darm. Een gebrek aan gal in de darm, als gevolg van cholestase, gaat gepaard met malabsorptie van vetoplosbare vitaminen, waaronder vitamine A. Opslag van vitamine A vindt primair plaats in de lever. Chronische cholestase leidt uiteindelijk tot vitamine A depletie. Vitamine A is de benaming voor een groep van stoffen die dezelfde biologische activiteit vertonen als retinol. Het vervult velerlei functies in het lichaam, welke samenhangen met antioxidant/hormoonachtige eigenschappen. Galzouten zijn onderdeel van de gal en hebben emulgerende eigenschappen. Ze zijn cruciaal voor de opname van vetten en vetoplosbare stoffen zoals vitamine A uit de voeding. Het moge duidelijk zijn dat verstoring van de galzouthomeostase invloed heeft op de vitamine A homeostase. Dat de omgekeerde relatie ook opgaat wordt aangetoond in dit proefschrift. Hoofdstuk 1 introduceert de lezer in de enterohepatisch kringloop van galzouten, vitamine A absorptie in de darm en signaleringsroutes waarbij galzouten en vitamine A betrokken zijn. De lever speelt een cruciale rol bij zowel vitamine A- als galzouthomeostase. De lever maakt galzouten uitgaande van cholesterol en scheidt deze uit in de gal. Met behulp van deze galzouten wordt vitamine A in de darm geabsorbeerd. Via de bloedbaan wordt geabsorbeerd vitamine A vervoerd naar de lever, waar het wordt opgeslagen in de stellaatcellen. Vanuit deze opslag in de lever wordt vitamine A door het lichaam verspreid. In het laatste gedeelte van het ileum worden galzouten zelf opgenomen en via de circulatie naar de lever teruggevoerd waar ze worden gerecycled. Circulatie (van in dit geval galzouten) tussen lever en darm wordt de enterohepatische kringloop genoemd. Galzouten zijn zelf potentieel cytotoxische stoffen, daarom wordt de synthese en transport van galzouten nauwkeurig gereguleerd. De voornaamste galzoutsensor in zoogdieren is de farnesoid X receptor (FXR). FXR behoort tot de superfamilie van nucleaire receptoren (NRs), dit zijn ligand-afhankelijke transcriptiefactoren. Genen die een sleutelrol spelen bij de synthese en het transport van galzouten behoren tot de groep van FXR-aangestuurde genen. Tot deze groep behoren de galzoutexport- pomp (bile salt export pump; BSEP), small heterodimer partner (SHP) and fibroblast groeifactor 19 (FGF19). BSEP transporteert galzouten van de hepatocyt (lever pa- renchymcel) naar de gal. SHP en FGF19 zijn betrokken bij de negatieve feedbackloop op de galzoutsynthese door het remmen van de expressie van het cytochroom P450 enzym 7A1 (CYP7A1). Alvorens FXR transcriptie van haar doelgenen kan beïnvloe- den moet het eerst een dimeer vormen met de vitamine A receptor RXR (retinoid X receptor). RXR behoort ook tot de superfamilie van NRs. Het ligand van RXR is 9-cis retinolzuur (9cRA), een afgeleide van vitamine A. De FXR/RXR heterodimeer herkent zogenaamde FXR-respons elementen (FXREs) in de promoterregio van FXR doelgenen. Een typische FXRE bestaat uit een geinverteerde herhaling van 6 basen- paren gescheiden door één nucleotide (IR-1) met als consensus sequentie AGGT- CAnTGACCT.

163 Samenvatting

In hoofdstuk 2 en 3 wordt beschreven hoe het RXR ligand vitamine A/9cRA mede verantwoordelijk is voor de regulatie van transcriptie van FXR-aangestuurde genen in vitro en in vivo. Afhankelijk van het gen van interesse wordt de galzoutafhankelijke transcriptie verhoogd (SHP en FGF19) of onderdrukt (BSEP). In hoofdstuk 2 laten wij zien dat de galzout-afhankelijke promoteractiviteit door het RXR ligand wordt onderdrukt ter plaatste van de FXRE. Dit is aangetoond door de FXRE sequentie in de hBSEP promoter te vervangen door de FXRE-sequentie zoals geïdentificeerd door Goodwinet al. (2000) in de humane SHP promoter. Vooraf- gaande impliceert dat regio’s buiten de FXRE betrokken zijn bij de super-inductie van FXR-gestuurde genen door vitamine A. In hoofdstuk 3 beschrijven wij de zoektocht naar deze vitamine A-afhankelijke respons elementen in de humane SHP promoter. Onverwacht kwamen wij tot de ont- dekking dat de door Goodwin et al. beschreven FXRE niet nodig, nog voldoende is voor de galzoutafhankelijke transcriptie vanhSHP . Deze eerder als FXRE geïdenti- ficeerde regio is echter wel noodzakelijk voor de 9cRA–afhankelijke super-inductie van SHP. Daarnaast is een nieuwe FXR/CDCA-respons regio geïdentificeerd, deze bevindt zich tussen de eerder geïdentificeerde FXRE en het transcriptie-initiatiepunt van SHP en valt samen met een respons element voor de liver receptor homolog-1 (LRH-1). In hoofdstuk 4 beschrijven we de afwezigheid van negatieve feedback op galzoutsynthese in vitamine A deficiënte (VAD) ratten. Deze dieren werden vitamine A defici- ënt gemaakt door het voeren van een vitamine A deficiënt dieet gedurende 17 weken. Ondanks dat transcriptie van zowel Shp als Fgf15 (humane ortholoog is FGF19) verhoogd is, leidt dit niet tot verlaging van het Cyp7a1 niveau. Dit resulteert in verhoogde galzoutconcentraties in plasma en gal in deze dieren. De effectieve opname van vitamine A in de darm lijkt een signaal te zijn dat voldoende galzouten de darm bereiken en hun functie daar kunnen uitvoeren, wat bijdraagt aan de negatieve feedback op de galzoutsynthese. De in vivo en in vitro observatie dat BSEP expressie maximaal is in afwezigheid van vitamine A en dat negatieve feedback op Cyp7a1 transcriptie faalt in VAD dieren is een aanwijzing voor een verhoogde galzoutflux als gevolg van vitamine A deficiëntie. Deze verhoogde galzoutflux blijkt ook inderdaad op te treden in VAD ratten Hoofd( - stuk 4), maar niet in VAD muizen (Hoofdstuk 2). Wel is in beide diermodellen spra- ke van een gebrek aan negatieve feedback op galzoutsynthese als gevolg van vitamine A deficiëntie. De verhoogde galzoutflux als gevolg van vitamine A deficiëntie zou in combinatie met obstructieve cholestase kunnen leiden tot een verhoogde extrahepa- tische ophoping van galzouten, met extra leverschade als gevolg. In hoofdstuk 5 bestudeerden wij het effect dat vitamine A deficiëntie heeft op het ziekteverloop van obstructieve cholestase in ratten. Eén week galgangligatie (bile duct ligation; BDL) in VAD dieren resulteerde in sterk verhoogde leverschade mer- ker (ALAT (Alanine-Amino-Transferase), ASAT (Aspartaat-Amino-Transferase), AF (Alkalische fosfatase), Gamma-glutamyltransferase (γGT)) niveaus in bloed en een ogenschijnlijk zieke lever op macroscopisch niveau. Deze mate van leverschade

164 Samenvatting komt overeen met tenminste 4 weken BDL in vitamine A sufficiënte (VAS) ratten. Belangrijk hierbij is dat de toename van al bovengenoemde merkers voor leverschade en gewichtsverlies werd voorkomen met vitamine A therapie. De plasma niveaus van ASAT, ALAT, AF en γGT van met vitamine A behandelde VAD-BDL dieren waren vergelijkbaar met niveaus in galganggeligeerde VAS dieren. Deze observaties konden niet direct worden toegeschreven aan FXR/RXR signaalroutes. Wel werd aangetoond dat biomerkers voor oxidatieve stress (Ho-1) inflammatie iNos( ) en fibrose α-Sma( en Col1a1) sterk waren verhoogd in VAD-BDL behandelde dieren. Het transcrip- tieprofiel van deze vier biomerkers komt overeen met de aanwezigheid van lever- en galgangenzymen in bloedplasma. Zowel galgangligatie als vitamine A deficiëntie zijn onafhankelijk van elkaar geassocieerd met een toename in oxidatie stress, ontsteking en fibrose. In combinatie versterkt/versnelt een tekort aan vitamine A het cholestati- sche ziekteverloop, met necro-inflammatie als gevolg. De onderzoeksresultaten die in dit proefschrift worden beschreven tonen aan dat vitamine A een belangrijke co-regulator is van galzouthomeostase. Efficiënte absorptie van vitamine A in de darm is een aanvullend signaal in de mechanismen die galzoutsynthese onderdrukken. De klinisch belangrijke bevinding is dat vitamine A deficiëntie leverschade als gevolg van obstructieve cholestase drastisch verergert. Dit toont de noodzaak aan van het nauwgezet monitoren van de vitamine A status van patiënten die lijden aan cholestase, aangezien een tekort aan vitamine A de conditie van de patiënt snel zou kunnen doen verslechteren.

165

Dankwoord Dankwoord

Een promotieonderzoek tot een succesvol einde brengen, dat doe je niet alleen. Het proefschrift dat voor u ligt is het product van samenwerking met en aanmoediging en steun van collega’s, vrienden en familie. Er zijn dan ook heel wat mensen te bedanken, zeker als het gehele traject negen en een half jaar heeft geduurd. Het schrijven van dit dankwoord voelt niet als een afsluiting van mijn tijd als AIO, dat leventje ligt al weer een paar jaar achter me en was gevoelsmatig afgesloten op het moment dat ik niet meer op het lab werkzaam was en definitief verhuisd was uit Groningen (juli 2008). Wel ben ik bijzonder blij dat het nu voltooid is. Het risico van het schrijven van een dankwoord een aantal jaar na dato is dat je dingen bent vergeten en er zodoende mensen ontbreken, bij voorbaat excuses hiervoor. Gelukkig zijn de voornaamste en meest noemenswaardige herinneringen aan deze tijd gebleven en sommige zijn nog dagelijks voelbaar.

De oudste herinnering aan mijn AIO-periode moet het sollicitatiegesprek zijn, hierbij waren onder andere Klaas Nico Faber en Han Moshage aanwezig. Minstens de helft van de tijd werd er over koetjes en kalfjes gesproken in plaats van zaken gerelateerd aan de functie van AIO. Het feit dat Han, net als ik, in Nijmegen gestudeerd had, leek direct een band te scheppen. De sfeer van dit sollicitatiegesprek bleek tekenend voor de prettige (werk)sfeer op het MDL-lab. Na het hierop volgende arbeidsvoorwaarde gesprek kreeg ik de fiets van Klaas Nico te leen om in de stad op zoek te gaan naar huisvesting. Ik had zo echt het gevoel met open armen te worden ontvangen.

Beste Klaas Nico, bedankt voor je persoonlijke manier van begeleiden en de altijd openstaande deur, zelfs toen je het in de loop der jaren steeds drukker begon te krij- gen. Wat jij mij als geen ander hebt geleerd is dat uit een “mislukt” experiment ook zeer veel waardevolle informatie is te halen; en hoe een uit de klauwen gegroeid experiment van een overenthousiaste AIO terug is te brengen tot de essentie. Het leven van een AIO gaat niet altijd over rozen (en je had nog al wat AIOs in die tijd), bedankt voor je begrip en steun op het persoonlijke vlak. Aan het begin van dit traject was je mijn co-promoter, maar omdat het traject lang genoeg heeft geduurd, mag je nu mijn promoter zijn. En daar ben ik erg blij om.

Beste Han, jouw begeleiding is grotendeels vanaf de zijlijn geweest, maar zeker met invloed op het onderzoek en dit proefschrift. Tijdens werkbesprekingen in kleinere kring op jullie werkkamer, mengde je je vanachter je bureau ook in de discussies. Hepatologische kennis wordt feilloos afgewisseld met triviale sportfeitjes (wie staan er boven aan de adelaarskalender?) en het wel en wee van BN-ers.

I would like to thank the manuscript committee: professors Henkjan Verkade, Mar- tin Hofker and Chantal Housset for their willingness to judge my dissertation and their swift and critical remarks.

168 Dankwoord

De volgende die ik wil bedanken is mijn steun en toeverlaat op het lab, Janette. Sa- men met Jacqueline had je het vitamine A project opgezet en dus kende je alle “ins en outs” van het project. Ik heb dan ook erg veel van je kunnen leren. Je was niet alleen een extra paar handen voor het onderzoek, maar ook een sparring partner. Daarnaast ben je ook een gedreven onderzoeker. Op deze manier heb je ook inhoudelijk veel invloed gehad op het/ons onderzoek. Na mijn vertrek van het lab ben je doorgegaan met het onderzoek wat nu hoofdstuk 3 is van dit boekje. Ik ben blij en trots dat je tweede auteur bent op dit stuk.

Jacqueline en Mark, jullie zijn respectievelijk de AIO voor en na mij op het vitamine A project. Ik wil jullie bedanken voor de prettige samenwerking.

Het opofferen van de ratten was een teamprestatie, waaraan vrijwel het gehele MDL- lab (inclusief promotores) heeft bijgedragen. Voor buitenstaanders misschien moei- lijk te begrijpen, maar dat was een weliswaar hectische, maar vooral ook bijzonder gezellige week. Hectisch omdat we hadden besloten de boel grondig aan te pakken en meerdere weefsels in veelvoud te verzamelen, wat betekende dat er honderden samples genomen en verwerkt werden. En gezellig omdat gezamenlijk de buit binnen werd gehaald. Wat mij brengt bij het MDL-lab, in de bezetting van 2004-2008 wel te verstaan, velen hebben dit nest inmiddels verlaten. Wat de periode 2004-2008 zo speciaal maakte heeft denk ik onder andere te maken met het feit dat een aantal AIOs tegelijkertijd begon en dat de gehele groep (AIOs en analisten) van ongeveer dezelfde leeftijd was. MDL heeft in die tijd op congressen menig feestje gemaakt en in ieder geval afgesloten. Antonella, thank you for introducing me to the lab when I first arrived and for the sneak previews we enjoyed together with friends. Axel, Hans, Krzysztof (“do you wanna treat me like I am your technician?” and proud member of “The Chouffe Boys”), Mark (proud member of “The Chouffe Boys”) en Jannes (“sinaasappels in de groentenla helpen tegen de griep”), bedankt voor de gezellige avondjes in Der Witz en Chaplin’s Pub. Daarnaast wil ik Axel (en Eefje), en Jannes en Titia bedanken voor hun gastvrijheid. Laura, Sandra, Rebecca, Gerard, Manon, Marcus, Mariska, (Prin- cess) Fiona, Lisette, Elise, Golnar, Marjolein en Tjasso bedankt voor de samenwerking en de gezelligheid! Sytske en Jan Pieter, bedankt voor jullie inzet als stagiaire op mijn project.

Ook dank aan mijn kamergenoten/medebewoners van “het kippenhok”. Hans (lange tijd de enige mede-haan), Maaike, Jelske, Titia, Leonie, Esther, Margot, Miriam, An- niek en Niels en Henk, bedankt voor de gezellige tijd.

Dank ook aan alle collega’s van Kindergeneeskunde, met wie MDL het lab deelt, van voor de gezelligheid. In het bijzonder: Jaap, Janine, Harmen, Jan Freark, Annelies, Hilde, Marijke, Anke, Maxi, Feike, Uwe, Torsten, Fjodor, Renze, Juul, Henk, Janny, Nicolette, Frans S., Gemma, Hilde & Gea en Folkert. Han R., de SELDI-TOF was een

169 Dankwoord leuk avontuur, helaas bracht het niet wat we ervan gehoopt hadden, bedankt voor je hulp. Vincent, bedankt voor de ondersteuning met de DEC-aanvraag (mede dankzij jou verliep dit proces heel soepel) en voor je advies over qPCR-statistiek.

Speciale dank ben ik verschuldigd aan microchirurgisch team (het “A-team”) en Ar van het CDP voor de assistentie bij de experimenten.

In 2008 kreeg ik de kans om te beginnen als docent moleculaire biologie bij Hoge- school Van Hall Larenstein. Ik vroeg om een rondleiding, maar kreeg een uitno- diging van Feike om mijn promotieonderzoek te presenteren voor zijn studenten “Gene Hunting”. De rest is geschiedenis. Dank je wel Feike!

Tegen het einde van mijn periode op het MDL-lab bekroop mij de vrees dat ik nooit meer een plek zou vinden waar ik met zo veel plezier zou werken. Gelukkig bleek deze vrees ongegrond. Dank daarvoor aan al mijn collega’s van Life Sciences & Tech- nology bij Hogeschool Van Hall Larenstein/Noordelijke Hoegeschool Leeuwarden. In het bijzonder mijn kamergenoten Antje, Gerrit en Luuk en daarnaast Karin, Ni- colette, Ina, Feike en Wendy (dank je voor de sponsoring) voor de bijzonder prettige samenwerking en onophoudelijke aansporing.

Dank ook aan de collega’s bij RSG- Sneek voor de samenwerking en in het bijzonder Mart en Jan voor de aanmoediging toch vooral de promotie af te ronden. Beste Mart, mijn coach in het middelbaar onderwijs avontuur, ik heb bewondering voor de ge- drevenheid waarmee jij onderwijst. Beste Jan, ik ben jaloers op jouw alfa-mannetjes uitstraling voor een groep pubers. En dank voor de gezelligheid op de Londenreis.

Gedurende de jaren na het behalen van het VWO-diploma ben ik het langzamerhand steeds noordelijker op gaan zoeken, steeds verder weg van Brabant, met als uitbijter ruim een half jaar Kopenhagen. Lieve pap en man, ik ben jullie enorm dankbaar voor de steun en vrijheid die ik heb ervaren bij het kiezen en voltooien van mijn studie. Met als klap op de vuurpijl het brengen naar en ophalen vanuit Kopenhagen (met veel te veel bagage). We zeggen re- gelmatig tegen elkaar dat het jammer is dat Sneek en Breugel zo ver uit elkaar liggen. Gelukkig is er Skype zodat we elkaar toch nog geregeld kunnen zien.

Voor mijn broer en zus: het is fijn om te merken dat naarmate we ouder worden we elkaar nog beter gaan begrijpen en meer naar elkaar toe groeien. Lieve Rens, ook al zal je altijd mijn jongere broertje zijn, je bent ook een voorbeeld voor mij, met je humor, nuchterheid en tegelijkertijd je gevoeligheid. Ik ben dan ook erg blij en trots dat je aan mijn zijde staat als paranimf. En bedankt voor je creatieve bijdrage aan dit proefschrift, ik ben erg trots op het geheel. Lieve Juultje (oftewel Zus), ik weet nog goed hoe je mij welkom heette toen ik in het geheim even terug kwam uit Denemar- ken. Nu is het heerlijk om elkaars kinderen te kunnen zien opgroeien en met elkaar

170 Dankwoord te zien spelen. Lieve broer en zus, het is jammer dat jullie zo ver weg wonen.

Het laatste half jaar van mijn tijd op het lab had ik twee woonplaatsen. Door de week woonde ik in Groningen en vanaf vrijdagmiddag tot maandagochtend woonde ik in Sneek. In het weekend moest er namelijk geklust worden in het nieuwe huis en werd er overnacht op de boerderij aan de Oerdyk. Johan en Froukje (heit en mem), Maaike en Wilfred, Lambertus en Aukje (en de rest van de Heegsma-Smit familie) ben ik erg dankbaar voor de gastvrijheid en de manier waarop ik ben welkom geheten in Fryslân!

Tenslotte kom ik weer terug bij jou mijn lieve Janette. Want het beste wat ik aan mijn promotietraject heb overgehouden ben jij. Nooit zien aankomen, verwacht of gepland, maar ineens was het daar. Je was al mijn steun en toeverlaat op het lab, maar nu ook daar buiten. Je hebt het gehele promotietraject meegemaakt. Van het begin tot aan het einde, een einde dat zich steeds maar weer liet opschuiven. Met name het laatste stuk van het traject ben jij degene geweest die mij aangespoord heeft dit boekje af te schrijven. Bedankt voor je geduld en steun, zonder jouw was dit niet gelukt! Dank je wel dat je mijn paranimf bent en wilt zijn! En er zijn meer personen die geduld hebben moeten. Ook Femke en Jelmer werden blootgesteld aan het vele werken van Tijn. “Jongens” het is eindelijk af, tijd voor leu- kere dingen!

Tot slot de twee personen die ik nog niet genoemd heb in dit dankwoord. Over vele jaren lezen jullie dit dankwoord pas. Weet dan dat jullie de kroon zijn om een heel bijzondere periode in mijn leven. De mooiste titel kreeg in van jullie, Papa! Mijn lieve Elona en Jurre dit boekje is voor jullie.

171

Curriculum Vitae List of Publications Curriculum Vitae

Martijn Oscar Hoeke werd geboren op 18 juni 1977 in Tilburg. Hij groeide op als oudste zoon in een gezin met drie kinderen in Son en Breugel. Na het behalen van het VWO-diploma aan het Lorentz Lyceum te Eindhoven in 1996 begon Martijn aan de studie Scheikundige Technologie aan de Technische Universiteit Eindhoven. Na het behalen van het propedeutisch examen zette hij de studie Scheikunde voort aan de Katholiek Universiteit Nijmegen (inmiddels Radboud Universiteit geheten). Na het voltooien van de studie Scheikunde (augustus 2002) behaalde Martijn zijn eerste- graads onderwijsbevoegdheid als docent Scheikunde in augustus 2003, tevens aan de Katholieke Universiteit Nijmegen. April 2004 begon Martijn met het promotieonderzoek getiteld: “The role of vitamin A in controlling bile salt homeostasis in cholestatic diseases” (MWO 03 – 38) bij het onderzoekslaboratorium van de afdeling Maag-, Darm- en Leverziekten van het Uni- versitair Medische Centrum Groningen, onder begeleiding van prof. dr. K.N. Faber en prof. dr. H. Moshage. Sinds november 2008 (met een uitstapje in studiejaar 2009/2010, waarin Martijn Scheikunde gaf op de middelbare school RSG Magister-Alvinus te Sneek) is Martijn werkzaam bij Hogeschool Van Hall Larenstein in Leeuwarden als docent moleculaire biologie.

Publications

Hoeke MO, Plass JR, Heegsma J, Geuken M, van Rijsbergen D, Baller JF, Kuipers F, Moshage H, Jansen PL, Faber KN. Low retinol levels differentially modulate bile salt-induced expression of human and mouse hepatic bile salt transporters. Hepatology. 2009 Jan;49(1):151-9.

Hoeke MO, Heegsma J, Hoekstra M, Moshage H, Faber KN. Human FXR regulates SHP expression through direct binding to an LRH-1 binding site, independent of an IR-1 and LRH-1. Submitted.

Hoeke MO, Hoekstra M, Heegsma J, Moshage H, Faber KN. Vitamin A deficiency causes mild cholestasis in rats. In preparation.

Hoeke MO, Hoekstra M, Heegsma J, Moshage H, Faber KN. Vitamin A deficiency severely aggravates obstructive cholestasis which is effectively treated by acute vitamin A supplementation. In preparation.

Hof D, Hoeke MO, Raats JM. Multiple-antigen immunization of chickens facilitates the generation of recombinant antibodies to autoantigens. Clin Exp Immunol. 2008 Feb;151(2):367-77.

174 Curriculum Vitae

Presented abstracts

Hoeke MO, Plass JR, Heegsma J, Geuken M, van Rijsbergen D, Baller JF, Kuipers F, Moshage H, Jansen PL, Faber KN. Low retinol levels potentiate bile acid-induced expression of the Bile Salt Export Pump in vitro and in vivo. AALSD 2004, Boston; Najaarsverdagering NVH 2004, Veldhoven; Falk Symposium 2006, Freiburg.

Hoeke MO, Heegsma J, van den Berg JP, Faber KN. FXR/RXR target genes are differentially regulated by the natural RXR-ligand, 9-cis retinoic acid, in liver and intestinal cell lines. Falk Symposium 2006, Freiburg.

Hoeke MO, Heegsma J, Moshage H, Faber KN. The human small heterodimer partner (SHP) promoter contains independent and unconventional 9-cis retinoic acid- and bile salt-responsive elements. ALSD 2007, Boston; Najaarsverdagering NVH 2007, Veldhoven; Falk Symposium 2008, Amsterdam.

Hoeke MO, Heegsma J, Moshage H, Faber KN. Vitamin A deficiency dramatically aggravates obstructive cholestasis in rats, but is prevented by acute vitamin A therapy. Falk Symposium 2008, Amsterdam.

Hoeke MO, Heegsma J, Moshage H, Faber KN. Vitamin A deficiency strongly aggravates liver damage during obstructive cholestasis; acute vitamin A therapy is the cure. Voorjaarsvergadering NVH 2009, Veldhoven.

175