XDH Gene Mutation Is the Underlying Cause of Classical Xanthinuria: a Second Report

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

Kidney International, Vol. 57 (2000), 2215–2220

GENETIC DISORDERS – DEVELOPMENT

XDH gene mutation is the underlying cause of classical xanthinuria: A second report

DAVID LEVARTOVSKY,AYALA LAGZIEL,ODED SPERLING,URI LIBERMAN,MICHAEL YARON, TATSUO HOSOYA,KIMIYOSHI ICHIDA, and HAVA PERETZ

Tel Aviv Sourasky Medical Center and Rabin Medical Center, Tel Aviv University, Tel Aviv, Israel; and The Jikey University School of Medicine, Tokyo, Japan

XDH gene mutation is the underlying cause of classical enzymes that catalyze the last two steps of purine degra- xanthinuria: A second report. dation, that is, oxidation of hypoxanthine to xanthine Background. Classical xanthinuria is a rare autosomal reces- and xanthine to uric acid. The incidence of inherited sive disorder characterized by excessive excretion of xanthine in urine. Type I disease results from the isolated deficiency of xanthinuria is estimated to be between 1:6,000 and xanthine dehydrogenase (XDH), and type II results from dual 1:69,000 [1]. Three rare autosomal recessive forms of deficiency of XDH and aldehyde oxidase. The XDH gene has hereditary xanthinuria have been described: classical been cloned and localized to chromosome 2p22-23. The aim xanthinuria types I and II and a distinct clinical type, of this study was to characterize the molecular basis of classical xanthinuria in an Iranian-Jewish family. molybdenum cofactor deficiency. Classical xanthinuria Methods. The apparently unrelated parents originated from type I results from an isolated deficiency of xanthine a community in which consanguineous marriages are common. dehydrogenase (XDH), and type II xanthinuria results Subtyping xanthinuria was attempted by homozygosity mapping from a dual deficiency of XDH and the related enzyme using microsatellite markers D2S352, D2S367, and D2S2374 in aldehyde oxidase (AO) [1]. Traditionally, classical xan- the vicinity of the XDH gene. Mutation detection was accom- plished by PCR-SSCP screening of all 36 exons and exon-intron thinuria is typed by the allopurinol loading test [2]. This junctions of the XDH gene, followed by direct sequencing and test assesses the activity of XDH and AO by measuring confirmation of sequence alteration by restriction analysis. the conversion of allopurinol to oxypurinol. Oxypurinol Results. The index case was homozygous for all three micro- is detected in blood and urine of type I patients who satellite markers analyzed. The expected frequency of this ge- lack XDH activity yet possess intact AO activity. In type notype in a control population was 0.0002. These results suggested that xanthinuria in the patient is linked to the XDH II patients, who lack both enzymatic activities, oxypuri- gene. Consequently, a 1658insC mutation in exon 16 of the nol is undetectable. The formation of urinary xanthine XDH gene was identified. The 1658insC mutation was not calculi, the main clinical feature of classical xanthinuria, detected in 65 control DNA samples. may present at any age, leading in some cases to renal Conclusion. A molecular approach to the diagnosis of classi- failure. Other occasionally observed manifestations of cal xanthinuria type I in a female patient with profound hypouricemia is described. Linkage of xanthinuria to the XDH locus classical xanthinuria are arthropathy [3], myopathy [4], was demonstrated by homozygosity mapping, and a 1658insC and duodenal ulcer. Still, some patients remain asymp- mutation, predicting a truncated inactive XDH protein, was tomatic throughout their lives [1]. A third type of heredi- identified. These results reinforce the notion that mutations in tary xanthinuria, molybdenum cofactor deficiency, is the XDH gene are the underlying cause of classical xanthinuria characterized by a lack of activity of sulfite oxidase in type I. addition to that of XDH and AO. This triple enzyme deficiency results in a severe neonatal form of xanthinuria associated with neurological features [1]. Xanthinuria, excessive excretion of xanthine in urine, The human XDH cDNA and gene have been cloned results from an acquired or inherited dysfunction of the and localized to chromosome 2p22-23 [5–8]. The XDH gene comprises 36 exons and 35 introns, spans at least Key words: uric acid, xanthinuria, linkage analysis, hypouricemia, mo- 60 kb, and encodes a polypeptide of 1333 amino acids. lybdenum cofactor deficiency. The mature enzyme is a homodimer with a subunit molecular weight of about 150,000. Each subunit contains Received for publication September 3, 1999 and in revised form December 11, 1999 four redox active centers: two iron-sulfur, one FAD/ Accepted for publication January 7, 2000 NAD, and one molybdopterin. XDH can be post-transla-  2000 by the International Society of Nephrology tionally converted to an oxidase form, xanthine oxidase

2215 2216 Levartovsky et al: XDH gene mutation in xanthinuria

Fig. 1. Biochemical diagnosis of classical xanthinuria in an Iranian-Jewish family. The pedigree shows an asymptomatic index case and her nephew, the product of consanguineous marriage, who presented with nephrolithiasis (*). Each column of the table below the pedigree shows data of the respective sibling depicted in the pedigree. Note the markedly reduced jejunal XDH activity and the de- creased uric acid and increased oxypurines levels in the serum in the patient.

(XO) [1]. Two mutations in the XDH gene responsible studied. This study was approved by the Helsinki Com- for type I classical xanthinuria were recently identified in mittee of the Medical Center. Japanese patients [9]. The gene responsible for classical xanthinuria type II is unknown. DNA preparation Xanthinuria, although rare, has now been reported in Genomic DNA was extracted from peripheral blood over 20 countries, suggesting that it is not confined to leukocytes by a protein desalting method [12]. any specific ethnic group. However, more than two thirds of the cases were reported from Mediterranean and Mid- Microsatellite markers analysis dle Eastern countries [1]. In this article, a novel mutation The microsatellite CA repeat markers D2S352, in the XDH gene in an Iranian-Jewish family previously D2S2374, and D2S367 located in the vicinity of the XDH diagnosed with classical xanthinuria is described [10, 11]. gene in the interval of 54 to 58 cM on chromosome To our knowledge, this is the second report in the medi- 2 were analyzed [13]. A CEPH (Center d’Etudes du cal literature of a mutation in the XDH gene underlying Polymorphisme Humaine) reference sample (Coriel Cell classical xanthinuria type I and the first mutation de- Repository, Camden, NJ, USA; kindly provided by Dr. scribed among Jewish people. Debra French, Mount Sinai Medical Center, New York, NY, USA) was analyzed for comparison of allele sizes [13]. Alleles were numbered arbitrarily starting with the METHODS most slowly moving band observed in the studied sam- Subjects ples. Four siblings from a previously described Iranian-Jew- Polymerase chain reactions (PCRs) were carried out ish family from the city of Shiraz were studied (Fig. 1) in a total volume of 25 ␮L and contained 100 ng genomic [10, 11]. The apparently unrelated parents died of un- DNA, 0.2 ␮mol/L of each primer, 200 ␮mol/L of each known causes. The proposita, a 60-year-old female, pre- dNTP, 0.1 unit of Taq DNA Polymerase, 2.5 ␮Lof10ϫ sented with hypertension at the age of 32 years. The buffer (AB Epson, Surrey, UK), 1.5 ␮mol/L MgCl2, and finding of marked hypouricemia during routine blood 0.1 ␮L 33P-dATP 10 mCi/mL (Amersham, Buckingham- testing and further biochemical analysis led to the diag- shire, UK). All PCR reactions were run for 30 cycles. The nosis of classical xanthinuria [10, 11]. Xanthinuria was annealing temperature for markers D2S352 and D2S367 not detected in her siblings. Revised medical history of was 57ЊC, and for marker D2S2374, the annealing tem- the family revealed nephrolithiases in proposita’s perature was 50ЊC. For electrophoretic separation of mi- nephew. Thirty-three control subjects of Iranian-Jewish crosatellite alleles, 4.5 ␮L of PCR products diluted 1:4 origin and 32 controls of other Jewish origin were also in stop solution [95% formamide, 20 mmol/L ethylenedi- Levartovsky et al: XDH gene mutation in xanthinuria 2217 aminetetraacetic acid (EDTA), 0.05% bromophenol allele and an undigested fragment of 146 bp in the mu- blue, 0.05% xylene cyanol] were denatured for three tated allele. minutes at 90ЊC, run on 6% sequencing-polyacrylamide gels, dried in vacuum for one hour at 80ЊC, and autora- RESULTS diographed. Biochemical evaluation Screening for mutations by SSCP analysis Laboratory evaluation of classical xanthinuria in this Primers were designed to amplify by PCR all 36 exons family was previously reported [10, 11] and is briefly and exon-intron junctions of the XDH gene [8]. summarized in Figure 1. Uric acid levels of proposita Exon 16 was amplified with the following primers: were 0.2 and 0.42 mg/dL in serum and 22.5 and 8.5 mg in forward, 5Ј GCAAGGAAGGAATCAGTGAT 3Ј; re- 24-hour urine collection, on two occasions, as compared verse, 5Ј CCAACTCATGTGGCCTGCAA 3Ј. with normal levels in her siblings. Levels of oxypurines Polymerase chain reactions were carried out as de- (xanthine and hypoxanthine) in proposita were elevated scribed here with the following modifications: 0.2 ␮mol/L both in serum (0.298 mg/dL) and in 24-hour urine collec- of each primer and 0.2 units of Taq DNA polymerase. All tion (390 mg). The XDH activity, in a biopsy sample PCR reactions were run for 30 cycles at 62ЊC annealing obtained from patient’s jejunal mucosa, assessed by con- temperature. version of 8-14C-hypoxanthine to uric acid, was 5.7% of For SSCP analysis, 5 ␮L of each amplification product normal. diluted 1:6 in stop solution were denatured for three minutes at 90ЊC, cooled on ice for three minutes, run on Analysis of linked polymorphic markers a Mutation Detection Enhancement (MDE) gel (FMC Analysis of the microsatellite markers D2S352, BioProducts Rockland, ME, USA) to which 6% glycerol D2S2374, and D2S367, encompassing a recombination was added at 420 V for six to seven hours at room temper- distance of about 4 cM near the XDH gene, revealed ature. Gels were dried in vacuum and autoradiographed. that the patient was homozygous for a specific haplotype defined by alleles 4, 5, and 7 of these markers, respec- Direct PCR sequencing tively (Fig. 2). In a collection of 21 Iranian-Jewish control Polymerase chain reaction products of exon 16 were DNA samples, 7, 8, and 11 different alleles were detected isolated using the Wizard PCR preps DNA purification for markers D2S352, D2S2374, and D2S367, respectively system for rapid purification of DNA fragments (Pro- (data not shown). The frequency of the disease-associ- mega, Madison, WI, USA). Direct sequencing of geno- ated alleles in the control chromosomes was 0.157 for mic DNA was performed using the ThermoSequenase D2S352 (N ϭ 42), 0.583 for D2S2374 (N ϭ 36), and 0.159 radiolabeled terminator cycle sequencing kit (Amer- for D2S367 (N ϭ 42). Based on these data and under sham, Cleveland, OH, USA), with the same primers used the assumption of random association between alleles for the PCR. Sequencing reaction products (3.5 ␮L) were at these loci, the expected frequency of the disease-char- denatured for five minutes at 70ЊC, run on 6% polyacryl- acteristic-haplotype (4-5-7) in the Iranian-Jewish popula- amide gels, dried, and autoradiographed. tion was 0.014. This implies, based on Hardy–Weinberg equilibrium, an estimated frequency of homozygotes for Mutation detection by PCR and artificially created this haplotype of 0.0142 ϭ ϳ0.0002 among the Iranian Drd I restriction site Jews. The forward primer and the PCR reaction conditions were as specified for PCR-SSCP analysis of exon 16. The Identification of the XDH gene mutation reverse primer sequence (5Ј-TTGGAAGAGCTGGA An aberrant SSCP pattern in exon 16 of the XDH gene CATCGA-3Ј) was designed with a C to T mismatch was observed in the patient as compared with control in the sense strand to create a Drd I recognition site samples (Fig. 3A). Direct sequencing of amplified geno-

(GACN4 N2GTC) in the wild-type allele. PCR reactions mic DNA revealed a repeat of seven cytosine nucleotides were carried↓ out at 55ЊC annealing temperature, resulting in the patient opposed to six in the control DNA, starting in a product of 146 bp. Following amplification, PCR at position 1658 in the XDH cDNA (Fig. 3B) [7]. The products were digested with Drd I (New England Bio- presence of this sequence alteration was confirmed by labs, Beverly, MA, USA). Digestion occurred in 10 ␮L an artificially created Drd I RFLP assay (Fig. 3C). In reaction volume, 8 ␮L of PCR product, 10 units of restric- control DNA, the wild-type allele was characterized by tion endonuclease, and 1 ␮L10ϫ buffer (supplied with PCR digestion products of 123 and 23 bp. In contrast, the enzyme). The reaction mix was incubated for a mini- in patient’s DNA, the presence of an undigested PCR mum of two hours. Digestion products were separated product of 146 bp was consistent with homozygosity for on 4% agarose gels. The expected digestion products the mutation. The mutation was absent in 33 Iranian and are two fragments of 123 and 23 bp in the wild-type 32 non-Iranian Jewish control samples (data not shown). 2218 Levartovsky et al: XDH gene mutation in xanthinuria

I xanthinuria. Given the finding of homozygosity for all polymorphic markers analyzed, we proceeded with screening for mutations in the XDH gene and, indeed, identified the disease-causing mutation. We advocate that, in cases in which homozygosity is expected, linkage analysis using several markers flanking the XDH gene can be used as an alternative or as a complementary approach to the allopurinol loading test in distinguishing type I from type II xanthinuria. The selection of markers might be further optimized once a refined map of the region flanking the XDH gene is available. The 1658insC insertion in exon 16 of the XDH gene causes a translation frameshift predicting a truncated protein of 569 amino acids with an altered C-terminal amino acid sequence as compared with 1333 amino acids of the native protein (Fig. 4). The predicted truncated protein is anticipated to be functionally compromised, since amino acid residues (encoded by exon 22) needed for the formation of the putative NAD binding domain, the molybdopterin binding site (encoded by exons 22 and 23) and the amino acid residues involved in the conversion of XDH to XO (exons 16, 27, and 36) are lost [8]. Thus, homozygosity for the 1658insC mutation in the patient explains the profound hypouricemia and the excessive xanthine and hypoxanthine accumulation in her blood and urine. Nevertheless, throughout 28 years of follow-up, the patient has not complained of any symptom characteristic of xanthinuria. Interestingly, patient’s nephew presented with nephrolithiasis. In view of the potential carrier state of nephew’s mother (patient’s sister) and consanguinity of parents (Fig. 1), he Fig. 2. Analysis of XDH-linked microsatellite markers. Autoradio- might be XDH deficient. Unfortunately, family members grams show an analysis of microsatellite markers. Allele numbers are other than the patient were unavailable for testing. indicated on the right side of each panel. Lane R, reference CEPH The relevance of the molecular genetics of the DNA. Lane C, control DNA. Lane P, patient DNA. Note that the patient is homozygous for alleles 4, 5, and 7 of markers D2S352 (top), XDH/XO system is not restricted to xanthinuria. While D2S2374 (middle), and D2S364 (bottom), respectively, located in the uric acid generated by XDH is a major component of the vicinity of the XDH gene. antioxidant defense mechanisms [14], reactive oxygen species generated by XO, the oxidase form of the enzyme [15–17], have been implicated as mediators of cellular injury in a wide range of clinical conditions such as ische- DISCUSSION mia reperfusion [18], hypertension [19], and inflamma- Following the initial finding of a homozygous XDH- tion [20, 21]. XDH/XO is also involved in the metabolism linked haplotype, we identified a novel 1658insC muta- of N-heterocyclic compounds of pharmacological and tion in the XDH gene in a female patient affected by toxicological importance. For example, bone marrow classical xanthinuria. toxicity by azathioprine may be aggravated by XDH The allopurinol loading test, traditionally employed deficiency [22]. A recent survey of XDH activity sug- to discern type I from type II xanthinuria, was not feasi- gested XDH deficiency in up to 2% of healthy controls ble in the patient. Rareness of the disorder, its autosomal [23]. The possibility that genetic variants, polymor- recessive mode of inheritance and the origin of propos- phisms, or mutations of the XDH/XO system may modu- ita’s parents from a small, relatively closed Iranian-Jew- late important pathophysiological conditions warrants ish community of the city of Shiraz, suggested a common further investigation. ancestor and therefore homozygosity for the defect underlying her disease. Hence, we elected testing for homo- ACKNOWLEDGMENTS zygosity of markers linked to the XDH locus, as a molec- This information was presented in part at the 62nd National Scien- ular rather than biochemical approach, to diagnose type tific Meeting of the American College of Rheumatology, San Diego, Levartovsky et al: XDH gene mutation in xanthinuria 2219

Fig. 3. Identiﬁcation of 1658insC mutation. (A) SSCP analysis of exon 16 of the XDH gene. Note the slower moving band in patient (lane P) as compared with control DNA (lane C). (B) Partial nucleotide sequence and predicted amino acid sequence of exon 16 of the XDH gene, in the control and patient. An insertion of a C nucleotide in position 1658 of the XDH cDNA encoding an altered amino acid sequence is evident in patient’s DNA. (C) PCR-Drd I restriction enzyme assay. The ethidium bromide-stained agarose gel shows in the patient (lane P) an undigested fragment of 146 bp as expected for a homozygous 1658insC mutation, while in a control DNA (lane C) the expected normal digestion product of 123 bp.

2. Ichida K, Yoshida M, Sakuma R, Hosoya T: Two siblings with classical xanthinuria type I: Significance of allopurinol loading test. Intern Med 37:77–82, 1998 3. Delbarre F, Weissenbach R, Auscher C, De Gery A: Attack of gout in a xanthinuric patient. Nouv Presse Med 2:2465–2466, 1973 4. Chalmers RA, Watts RW, Pallis C, Bitensky L, Chayen J: Crystalline deposits in striped muscle in xanthinuria. Nature 221:170–171, 1969 5. Ichida K, Amaya K, Noda S, Minoshima T, Hosoya O, Sakai N, Shimizu N, Nishsino T: Cloning of the cDNA encoding human xanthine dehydrogenase (oxidase): Structural analysis of the protein and chromosomal location of the gene. Gene 133:279–284, 1993 6. Minoshima S, Wang Y, Ichida K, Shimizu N, Nishino T, Shimizu Fig. 4. Schematic representation of normal (top) and mutated (bottom) N: Mapping of the gene for human xanthine dehydrogenase (oxi- XDH protein. The binding sites for the various cofactors are shown. dase) (XDH) to the band p23 of chromosome 2. Cytogenet Cell Note that the 1658insC mutation in exon 16 results in a highly truncated Genet 68:52–53, 1995 protein that lacks the molybdopterin binding site. Also lost are amino 7. Saksela M, Raivio KO: Cloning and expression in vitro of human acid residues encoded by exon 22, which are needed for the formation of the putative NAD-binding domain. xanthine dehydrogenase/oxidase. Biochem J 315:235–239, 1996 8. Xu P, Huecksteadt TP, Hoidal JR: Molecular cloning and charac- terization of the human xanthine dehydrogenase gene (XDH). Genomics 34:173–180, 1996 9. Ichida K, Amaya Y, Kamatani N, Nishino T, Hosoya T, Sakai O: CA, November 1998. Drs. Levartovsky, Lagziel, and Peretz’s work Identification of two mutations in human xanthine dehydrogenase was supported by grants from Tibor Bilha & Elizabeth Rubinstein gene responsible for classical type I xanthinuria. J Clin Invest deBilha, Tel Aviv University, and from the R&D Department, Tel 99:2391–2397, 1996 Aviv Sourasky Medical Center. 10. Sperling O, Liberman U, Frank M, De Vries A: Xanthinuria: An additional case with demonstration of xanthine oxidase defi- Reprint requests to Hava Peretz, Ph.D., Clinical Biochemistry Labo- ciency. Am J Clin Pathol 55:351–354, 1971 ratory, Tel Aviv Sourasky Medical Center, 6 Weizmann Street, Tel Aviv 11. Oliver I, Sperling O, Liberman UA, Frank M, De Vries A: 64239, Israel. Deficiency of xanthine oxidase activity in colostrum of a xan- E-mail: [email protected] thinuric female. Biochem Med 5:279–280, 1971 12. Miller SA, Dykes DD, Polesky HF: A simple salting out proce- REFERENCES dure for extracting DNA from human nucleated cells. Nucleic Acids Res 19:1215, 1988 1. Simmons A, Reiter S, Nishino T: Hereditary Xanthinuria, in The 13. Dib C, Faure S, Fizames C, Samson N, Drouot N, Vignal A, Metabolic and Molecular Bases of Inherited Diseases (vol 2), edited Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay by Scriver CR, Beaudet AL, Sly WS, Valle D, Stanbury JB, G, Morissette J, Weissenbach J: A comprehensive genetic map Wyngaarden JB, Fredrickson DS, New York, McGraw-Hill, Inc., of the human genome based on 5,264 microsatellites. Nature 1995, pp 1781–1797 380:A12–A13, 1996 2220 Levartovsky et al: XDH gene mutation in xanthinuria

14. Sevanian A, Davies KJ, Hochstein P: Serum urate as an antioxi- ously hypertensive rats. Proc Natl Acad Sci USA 95:4754–4759, dant for ascorbic acid. Am J Clin Nutr 54(Suppl 6):1129s–1134s, 1998 1991 20. Blake DR, Stevens CR, Sahinoglu T, Ellis G, Gaffney K, 15. Harrison R: Human xanthine oxidoreductase: In search of a func- Edmonds S, Benboubetra M, Harrison R, Jawed S, Kanczler tion. Biochem Soc Trans 25:786–791, 1997 J, Millar TM, Winyard PG, Zhang Z: Xanthine oxidase: Four 16. Wright RM, Repine JE: The human molybdenum hydroxylase roles for the enzyme in rheumatoid pathology. Biochem Soc Trans gene family: Co-inspirators in metabolic free-radical generation in 25:812–816, 1997 disease. Biochem Soc Trans 25:799–804, 1997 21. Hoidal JR, Xu P, Huecksteadt T, Sanders KA, Pfeffer K: Tran- 17. Bulkley GB: Physiology of reactive oxidant-mediated signal trans- scriptional regulation of human xanthine dehydrogenase/xanthine duction: An overview. Biochem Soc Trans 25:804–812, 1997 oxidase. Biochem Soc Trans 25:796–799, 1997 18. Nishino T, Nakanishi S, Okamoto K, Mizushima J, Hori H, Iwa- 22. Serre-Debeauvais F, Bayle F, Amirou M, Bechtel Y, Boujet C, saki T, Nishino T, Ichimori K, Nakazawa H: Conversion of xan- Vialtel P, Bessard G: Hematoxicite de l’azathioprine a determini- thine dehydrogenase into oxidase and its role in reperfusion injury. sme genetique aggravee par un deﬁcit en xanthine oxidase chez Biochem Soc Trans 25:783–786, 1997 une transplantee renale. Presse Med 24:987–988, 1995 19. Suzuki H, Delano FA, Parks DA, Jamshidi N, Granger DN, Ishi 23. Kalow W, Tang BK: Use of caffeine metabolite ratios to explore H, Suematsu M, Zweifach BW, Schmid-Schonbein GW: Xanthine CYP1A2 and xanthine oxidase activities. Clin Pharmacol Ther oxidase activity associated with arterial blood pressure in spontane- 50:508–519, 1991