Identification of Two Mutations in Human Xanthine Dehydrogenase Gene Responsible for Classical Type I Xanthinuria

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Identification of two mutations in human xanthine dehydrogenase gene responsible for classical type I xanthinuria. K Ichida, … , T Hosoya, O Sakai J Clin Invest. 1997;99(10):2391-2397. https://doi.org/10.1172/JCI119421. Research Article Hereditary xanthinuria is classified into three categories. Classical xanthinuria type I lacks only xanthine dehydrogenase activity, while type II and molybdenum cofactor deficiency also lack one or two additional enzyme activities. In the present study, we examined four individuals with classical xanthinuria to discover the cause of the enzyme deficiency at the molecular level. One subject had a C to T base substitution at nucleotide 682 that should cause a CGA (Arg) to TGA (Ter) nonsense substitution at codon 228. The duodenal mucosa from the subject had no xanthine dehydrogenase protein while the mRNA level was not reduced. The two subjects who were siblings with type I xanthinuria were homozygous concerning this mutation, while another subject was found to contain the same mutation in a heterozygous state. The last subject who was also with type I xanthinuria had a deletion of C at nucleotide 2567 in cDNA that should generate a termination codon from nucleotide 2783. This subject was homozygous for the mutation and the level of mRNA in the duodenal mucosa from the subject was not reduced. Thus, in three subjects with type I xanthinuria, the primary genetic defects were confirmed to be in the xanthine dehydrogenase gene. Find the latest version: https://jci.me/119421/pdf Identification of Two Mutations in Human Xanthine Dehydrogenase Gene Responsible for Classical Type I Xanthinuria Kimiyoshi Ichida,* Yoshihiro Amaya,‡ Naoyuki Kamatani,§ Takeshi Nishino,ʈ Tatsuo Hosoya,* and Osamu Sakai* *Second Department of Medicine, The Jikei University School of Medicine, Tokyo 105; ‡Department of Biochemistry, Yokohama City University School of Medicine, Yokohama 236, Japan; §Institute of Rheumatology, Tokyo Women’s Medical College, Tokyo 162; and ʈDepartment of Biochemistry and Molecular Biology, Nippon Medical School, Tokyo 113, Japan Abstract enzyme itself is a typical molybdenum containing flavo-pro- tein. Hereditary xanthinuria is classified into three categories. Inherited xanthine dehydrogenase deficiency, or xanthin- Classical xanthinuria type I lacks only xanthine dehydroge- uria, was first reported by Dent and Philport (1). The current nase activity, while type II and molybdenum cofactor defi- classification of this inherited disorder is rather complicated. ciency also lack one or two additional enzyme activities. In In classical xanthinuria type I, only xanthine dehydrogenase the present study, we examined four individuals with classi- activity is lacking, while in classical xanthinuria type II, alde- cal xanthinuria to discover the cause of the enzyme defi- hyde oxidase activity is also deficient (2, 3). More complicated ciency at the molecular level. One subject had a C to T base still is the presence of molybdenum cofactor deficiency, in substitution at nucleotide 682 that should cause a CGA which sulfite oxidase activity is missing as well as the above (Arg) to TGA (Ter) nonsense substitution at codon 228. The two enzymes (4). duodenal mucosa from the subject had no xanthine dehy- Classical xanthinuria types I and II are rare autosomal re- drogenase protein while the mRNA level was not reduced. cessive disorders and the combined incidence has been re- The two subjects who were siblings with type I xanthinuria ported to be 1/69,000 (5). The affected individuals may de- were homozygous concerning this mutation, while another velop urinary tract calculi, acute renal failure, or myositis due subject was found to contain the same mutation in a het- to tissue deposition of xanthine, but some subjects with ho- erozygous state. The last subject who was also with type I mozygous xanthinuria remain asymptomatic (2). Molybdenum xanthinuria had a deletion of C at nucleotide 2567 in cDNA cofactor deficiency is usually associated with severe neurologi- that should generate a termination codon from nucleotide cal disorders (4). The relationship between the three condi- 2783. This subject was homozygous for the mutation and tions has not been well understood at the molecular level, the level of mRNA in the duodenal mucosa from the subject since precise molecular analyses have not been performed. was not reduced. Thus, in three subjects with type I xanthi- We recently cloned rat (6) and subsequently human (7) nuria, the primary genetic defects were confirmed to be in xanthine dehydrogenase cDNA and determined the primary the xanthine dehydrogenase gene. (J. Clin. Invest. 1997. 99: structures. The human gene was mapped to chromosome 2p22 2391–2397.) Key words: urolithiasis • aldehyde oxidase • or 2p23 (8). Human aldehyde oxidase cDNA was also cloned sulfite oxidase • molybdenum cofactor • hypouricemia and sequenced, although it was initially claimed as cDNA of xanthine dehydrogenase (9) and was subsequently found to be Introduction of aldehyde oxidase (10). As a first step to determine which gene is responsible for each xanthinuria type, we attempted to Human xanthine dehydrogenase (EC 1.1.1.204) catalyzes the define mutations in the human xanthine dehydrogenase gene terminal two steps of the purine degradation pathway; i.e., the in patients with classical xanthinuria. formation of xanthine from hypoxanthine and uric acid from xanthine. Under certain conditions, xanthine dehydrogenase is Methods converted to the oxidase form, known as xanthine oxidase (EC 1.2.3.2). This enzyme has been a focus of extensive studies Subjects used in this study. Subjects 1 and 2 were brothers, 34 and 35 since (a) it is the target of action of a widely used antihyperuri- yr old, respectively, when examined. Their parents were first cousins. cemic drug, allopurinol; (b) it may be responsible for the pro- Subject 1 was first found to be hypouricemic during a routine health duction of superoxide radicals, which are putative pathological examination; he also had mild gastritis and a duodenal ulcer. Subject compounds in various disorders in humans; (c) inherited en- 2 was asymptomatic. Details on subject 3, a 65-yr-old male, and sub- zyme deficiencies have been described in humans; and (d) the ject 4, a 37-yr-old male, have been reported previously in the Japa- nese literature (11, 12). The chronic renal failure of subject 3 had been attributed to diabetes mellitus (11). Subject 4 had a single kid- ney. The parents of subject 4 were not consanguineous, but their fam- Address correspondence to Kimiyoshi Ichida, Second Department of ilies had lived in the neighborhood for generations. As far as we Medicine, The Jikei University School of Medicine, Nishi-Shinbashi, traced, there was no familial relationship between subjects 3 and 4 Minato-ku, Tokyo 105, Japan. Phone: 81-3-3433-1111; FAX: 81-3- and the parents of subjects 1 and 2. Duodenal mucosal tissues were 3433-4297. obtained from subjects 1 and 4 and a control subject during endo- Received for publication 11 November 1996 and accepted in re- scopic examinations. The mucosal tissues were frozen at Ϫ80ЊC im- vised form 28 February 1997. mediately after collection. The control subject from whom the duode- nal mucosa sample and the peripheral blood cells were obtained was J. Clin. Invest. a healthy 36-yr-old male. Peripheral blood cells from five other © The American Society for Clinical Investigation, Inc. healthy volunteers were used for isolating DNA as control samples. 0021-9738/97/05/2391/07 $2.00 Liver tissue from a 58-yr-old male tumor patient was used for confir- Volume 99, Number 10, May 1997, 2391–2397 mation of the reactivity of the antiserum against rat xanthine dehy- Mutation in Xanthine Dehydrogenase 2391 Table I. Primers Used for this Study Forward Reverse Name Sequence Position* Name Sequence Position* Comp20 GTGACAATGACAGCAGACAAACAAGTTT- Comp21 GTGGCTGACTGAGTGGTCATTTGATT- CGTGAGCTGATTG CTGGACCATGGC 20 GCGAATTCGTGACAATGACAGCAGACAAA Ϫ6–15 21 AACTCGAGGTGGCTGACTGAGTGGTC 573–556 64 GTCTCTTAGGAGTGAGG Ϫ49–Ϫ33 65 GTGGCTGACTGAGTGGTC 573–556 22 AACTCGAGGATGGTGGATGCTGTGGA 496–513 13 CACTGGCCATGAACACG 1105–1089 P4 GCGCTGGTTTGCTGGGAAGC 1002–1021 6 GATGCAGCTCCTCTGCC 1486–1470 17 TCAGCCCTCAAGACCAC 1393–1409 27 GCCTCGAGGATATGCCCAACACAAGT 2001–1984 49 CCCAAGGGTCAGTCTGAG 1693–1710 50 AATCCGGTTTGCTGGAAC 2364–2347 28 CAGAATTCGCGAAGGATAAGGTTACT 1968–1986 5 TCCAGCATGCATCGCAC 2486–2470 1 GAGCACTTCTACCTGGA 2221–2237 10 TAGCAGTTGTCCATGTG 2669–2653 30 CGGAATTCGCCCTGGCTGCATATAAG 2440–2457 31 TTCTCGAGCTTGTCAACCTCACTCTT 2961–2944 55 GAAGTTGCAGTGACCTGT 2788–2805 33 TTCTCGAGGTTAGTCTCAAAGCTGTA 3438–3421 34 TGGAATTCTGCCACTGGGTTTTATAG 3385–3404 35 AGCTCGAGCTGCACGGATGG 3852–3833 42 TTTGTCCAGGGCCTTGG 3598–3614 66 AAGACTCTGCTGAGGAC 4026–4010 Primers Comp20, Comp21, 20, and 21 were used for competitive RT-PCR. *Nucleotide residue numbers are according to Ichida et al. (7). drogenase to human enzyme after hepatectomy. Informed consents Quantification of mRNA for xanthine dehydrogenase using com- for various procedures were obtained from all subjects at the outset petitive reverse transcriptase-PCR. Total RNA was isolated from of the study. duodenal mucosae or B lymphoblasts using Isogen (Nippon Gene, Determination of compounds in serum and urine. Concentrations Tokyo, Japan) according to the manufacturer’s recommendations. of hypoxanthine, xanthine, and uric acid in both serum and urine, and Xanthine dehydrogenase mRNA in the samples was quantified by concentrations of oxypurinol in serum were determined
Recommended publications
  • 35 Disorders of Purine and Pyrimidine Metabolism

    35 Disorders of Purine and Pyrimidine Metabolism

    35 Disorders of Purine and Pyrimidine Metabolism Georges van den Berghe, M.- Françoise Vincent, Sandrine Marie 35.1 Inborn Errors of Purine Metabolism – 435 35.1.1 Phosphoribosyl Pyrophosphate Synthetase Superactivity – 435 35.1.2 Adenylosuccinase Deficiency – 436 35.1.3 AICA-Ribosiduria – 437 35.1.4 Muscle AMP Deaminase Deficiency – 437 35.1.5 Adenosine Deaminase Deficiency – 438 35.1.6 Adenosine Deaminase Superactivity – 439 35.1.7 Purine Nucleoside Phosphorylase Deficiency – 440 35.1.8 Xanthine Oxidase Deficiency – 440 35.1.9 Hypoxanthine-Guanine Phosphoribosyltransferase Deficiency – 441 35.1.10 Adenine Phosphoribosyltransferase Deficiency – 442 35.1.11 Deoxyguanosine Kinase Deficiency – 442 35.2 Inborn Errors of Pyrimidine Metabolism – 445 35.2.1 UMP Synthase Deficiency (Hereditary Orotic Aciduria) – 445 35.2.2 Dihydropyrimidine Dehydrogenase Deficiency – 445 35.2.3 Dihydropyrimidinase Deficiency – 446 35.2.4 Ureidopropionase Deficiency – 446 35.2.5 Pyrimidine 5’-Nucleotidase Deficiency – 446 35.2.6 Cytosolic 5’-Nucleotidase Superactivity – 447 35.2.7 Thymidine Phosphorylase Deficiency – 447 35.2.8 Thymidine Kinase Deficiency – 447 References – 447 434 Chapter 35 · Disorders of Purine and Pyrimidine Metabolism Purine Metabolism Purine nucleotides are essential cellular constituents 4 The catabolic pathway starts from GMP, IMP and which intervene in energy transfer, metabolic regula- AMP, and produces uric acid, a poorly soluble tion, and synthesis of DNA and RNA. Purine metabo- compound, which tends to crystallize once its lism can be divided into three pathways: plasma concentration surpasses 6.5–7 mg/dl (0.38– 4 The biosynthetic pathway, often termed de novo, 0.47 mmol/l). starts with the formation of phosphoribosyl pyro- 4 The salvage pathway utilizes the purine bases, gua- phosphate (PRPP) and leads to the synthesis of nine, hypoxanthine and adenine, which are pro- inosine monophosphate (IMP).
  • Review Article

    Review Article

    Free Radical Biology & Medicine, Vol. 33, No. 6, pp. 774–797, 2002 Copyright © 2002 Elsevier Science Inc. Printed in the USA. All rights reserved 0891-5849/02/$–see front matter PII S0891-5849(02)00956-5 Review Article STRUCTURE AND FUNCTION OF XANTHINE OXIDOREDUCTASE: WHERE ARE WE NOW? ROGER HARRISON Department of Biology and Biochemistry, University of Bath, Bath, UK (Received 11 February 2002; Accepted 16 May 2002) Abstract—Xanthine oxidoreductase (XOR) is a complex molybdoflavoenzyme, present in milk and many other tissues, which has been studied for over 100 years. While it is generally recognized as a key enzyme in purine catabolism, its structural complexity and specialized tissue distribution suggest other functions that have never been fully identified. The publication, just over 20 years ago, of a hypothesis implicating XOR in ischemia-reperfusion injury focused research attention on the enzyme and its ability to generate reactive oxygen species (ROS). Since that time a great deal more information has been obtained concerning the tissue distribution, structure, and enzymology of XOR, particularly the human enzyme. XOR is subject to both pre- and post-translational control by a range of mechanisms in response to hormones, cytokines, and oxygen tension. Of special interest has been the finding that XOR can catalyze the reduction of nitrates and nitrites to nitric oxide (NO), acting as a source of both NO and peroxynitrite. The concept of a widely distributed and highly regulated enzyme capable of generating both ROS and NO is intriguing in both physiological and pathological contexts. The details of these recent findings, their pathophysiological implications, and the requirements for future research are addressed in this review.
  • (12) Patent Application Publication (10) Pub. No.: US 2013/0059868 A1 Miner Et Al

    (12) Patent Application Publication (10) Pub. No.: US 2013/0059868 A1 Miner Et Al

    US 2013 0059868A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0059868 A1 Miner et al. (43) Pub. Date: Mar. 7, 2013 (54) TREATMENT OF GOUT Publication Classification (75) Inventors: Jeffrey Miner, San Diego, CA (US); Jean-Luc Girardet, San Diego, CA (51) Int. Cl. (US); Barry D. Quart, Encinitas, CA A613 L/496 (2006.01) (US) A6IP 29/00 (2006.01) (73) Assignee: Ardea Biociences, Inc., San Diego, CA A6IP 9/06 (2006.01) (US) A613 L/426 (2006.01) A 6LX3/59 (2006.01) (21) Appl. No.: 13/637,343 (52) U.S. Cl. ...................... 514/262.1: 514/384: 514/365 (22) PCT Fled: Mar. 29, 2011 (86) PCT NO.: PCT/US11A3O364 (57) ABSTRACT S371 (c)(1), (2), (4) Date: Oct. 24, 2012 Sodium 2-(5-bromo-4-(4-cyclopropyl-naphthalen-1-yl)-4H Related U.S. Application Data 1,2,4-triazol-3-ylthio)acetate is described. In addition, phar (60) Provisional application No. 61/319,014, filed on Mar. maceutical compositions and uses Such compositions for the 30, 2010. treatment of a variety of diseases and conditions. Patent Application Publication Mar. 7, 2013 Sheet 1 of 10 US 2013/00598.68A1 FIGURE 1 S. C SOC 55000 40 S. s 3. s Patent Application Publication Mar. 7, 2013 Sheet 2 of 10 US 2013/00598.68A1 ~~~::CC©>???>©><!--->?©><??--~~~~~·%~~}--~~~~~~~~*~~~~~~~~·;--~~~~~~~~~;~~~~~~~~~~}--~~~~~~~~*~~~~~~~~;·~~~~~ |×.> |||—||--~~~~ ¿*|¡ MSU No IL-1ra MSU50 IL-1ra MSU 100 IL-1ra MSU500 IL-1ra cells Only No IL-1 ra Patent Application Publication Mar. 7, 2013 Sheet 3 of 10 US 2013/00598.68A1 FIGURE 3 A: 50000 40000 R 30000 2 20000 10000 O -7 -6 -5 -4 -3 Lesinurad (log)M B: Lesinurad (log)M Patent Application Publication Mar.
  • Study of Purine Metabolism in a Xanthinuric Female

    Study of Purine Metabolism in a Xanthinuric Female

    Study of Purine Metabolism in a Xanthinuric Female MICHAEL J. BRADFORD, IRWIN H. KRAKOFF, ROBERT LEEPER, and M. EARL BALis From the Sloan-Kettering Institute, Sloan-Kettering Division of Cornell University Graduate School of Medical Sciences, and the Department of Medicine of Memorial and James Ewing Hospitals, New York 10021 A B S TR A C T A case of xanthinuria is briefly de- Case report in brief. The patient is a 62 yr old scribed, and the results of in vivo studies with Puerto Rican grandmother, whose illness is de- 4C-labeled oxypurines are discussed. The data scribed in detail elsewhere.' Except for mild pso- demonstrate that the rate of the turnover of uric riasis present for 30 yr, she has been in good acid is normal, despite an extremely small uric health. On 26 June 1966, the patient was admitted acid pool. Xanthine and hypoxanthine pools were to the Second (Cornell) Medical Service, Bellevue measured and their metabolism evaluated. The Hospital, with a 3 day history of pain in the right bulk of the daily pool of 276 mg of xanthine, but foot and fever. The admission physical examina- only 6% of the 960 mg of hypoxanthine, is ex- tion confirmed the presence of monoarticular ar- creted. Thus, xanthine appears to be a metabolic thritis and mild psoriasis. The patient's course in end product, whereas hypoxanthine is an active the hospital was characterized by recurrent fevers intermediate. Biochemical implications of this find- to 104°F and migratory polyarthritis, affecting ing are discussed. both ankles, knees, elbows, wrists, and hands over a 6 wk period.
  • Complete Deficiency of Adenine Phosphoribosyltransferase

    Complete Deficiency of Adenine Phosphoribosyltransferase

    Arch Dis Child: first published as 10.1136/adc.54.1.25 on 1 January 1979. Downloaded from Archives of Disease in Childhood, 1979, 54, 25-31 Complete deficiency of adenine phosphoribosyltransferase A third case presenting as renal stones in a young child T. M. BARRATT, H. A. SIMMONDS, J. S. CAMERON, C. F. POTTER, G. A. ROSE, D. G. ARKELL, AND D. I. WILLIAMS Department of Medicine, Guy's Hospital, The Hospital for Sick Children, Great Ormond Street, and the Institute of Urology, St Philip's Hospital, London SUMMARY We report a third case of 2, 8-dihydroxyadenine stones in a child with a complete lack of the adenine salvage enzyme-adenine phosphoribosyltransferase (APRT). The propositus, a 20-month-old girl of consanguineous Arab parents, presented with multiple urinary tract infections and supposed 'uric acid' stones in the right renal pelvis and left ureter. Both parents and one brother were heterozygotes for the defect, in keeping with an autosomal recessive mode of inheritance. In contrast with the other purine salvage enzyme disorder of childhood with true uric acid stones (the Lesch-Nyhan syndrome), uric acid excretion was normal in all family members. As in our previous case, treatment with allopurinol, without alkali, has eliminated the urinary excretion of 2, 8-dihy- droxyadenine: the stones were removed surgically. 2, 8-Dihydroxyadenine should be considered in any child thought to have uric acid stones and tests made to distinguish the two compounds. Many urinary stones or crystals identified in children AMP IMP result from the overexcretion of normally minor http://adc.bmj.com/ urinary constituents, compounds of limited solubility whose overexcretion may be the direct consequence adenosine inosine of a block in an essential step in a metabolic pathway.
  • Xanthine Urolithiasis: Inhibitors of Xanthine Crystallization

    Xanthine Urolithiasis: Inhibitors of Xanthine Crystallization

    bioRxiv preprint doi: https://doi.org/10.1101/335364; this version posted May 31, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Xanthine urolithiasis: Inhibitors of xanthine crystallization Authors: Felix Grases, Antonia Costa-Bauza, Joan Roig, Adrian Rodriguez Laboratory of Renal Lithiasis Research, Faculty of Sciences, University Institute of Health Sciences Research (IUNICS-IdISBa), University of Balearic Islands, Ctra. de Valldemossa, km 7.5, 07122 Palma de Mallorca, Spain. Corresponding author: Felix Grases. Laboratory of Renal Lithiasis Research, Faculty of Sciences, University Institute of Health Sciences Research (IUNICS), University of Balearic Islands, Ctra. de Valldemossa, km 7.5, 07122 Palma de Mallorca, Spain. Telephone number: +34 971 17 32 57 e-mail: [email protected] Key words: xanthine lithiasis, 7-Methylxanthine, 3-Methylxanthine, Theobromine. 1 bioRxiv preprint doi: https://doi.org/10.1101/335364; this version posted May 31, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract OBJECTIVE. To identify in vitro inhibitors of xanthine crystallization that have potential for inhibiting the formation of xanthine crystals in urine and preventing the development of the renal calculi in patients with xanthinuria. METHODS. The formation of xanthine crystals in synthetic urine and the effects of 10 potential crystallization inhibitors were assessed using a kinetic turbidimetric system with a photometer.
  • Hereditary Xanthinuria

    Hereditary Xanthinuria

    Hereditary xanthinuria Author: Doctor H. Anne Simmonds1 Creation Date: July 2001 Update: July 2003 Scientific Editor: Professor Georges Van den Berghe 1Purine Research Unit, GKT, Guys Hospital, 5th Floor Thoma Guy House, London Bridge SE1 9RT, United Kingdom. [email protected] Abstract Keywords Disease name and synonyms Excluded diseases Diagnosis criteria / definition Differential diagnosis Prevalence Clinical description Management including treatment Etiology Diagnostic methods Genetic counseling Antenatal diagnosis Unresolved questions References Abstract Xanthinuria is a rare autosomal recessive disorder associated with a deficiency in xanthine dehydrogenase (XDH - also referred to as xanthine oxidoreductase, XOR), which normally catalyses the conversion of hypoxanthine and xanthine to uric acid. In humans NAD+ is the electron acceptor and significant activity is confined to liver and intestinal mucosa. Irreversible conversion to oxidase occurs during ischaemia. The preferential accumulation/excretion of xanthine in plasma and urine results from extensive hypoxanthine recycling by the salvage pathway for which xanthine is not a substrate in humans: excess xanthine deriving from guanine via guanine deaminase. Classical xanthinuria has two types - an isolated deficiency (XDH type I), a dual deficiency with aldehyde oxidase (XDH/AOX: type II). Additionally xanthiuria occurs in Molybdenum cofactor deficiency, where sulphite oxidase (SO) is also inactive. More than 150 cases have been described from 22 countries, indicating that the disorder is not confined to specific ethnic groups. Although xanthinuria is a rare disorder the number of cases found is certainly an underestimate. Clinical symptoms in classical XDH deficiency include xanthine calculi, crystalluria, or acute renal failure and unrecognized can lead to end-stage renal disease, nephrectomy, or death.
  • Allopurinol Metabolism in a Patient

    Allopurinol Metabolism in a Patient

    Ann Rheum Dis: first published as 10.1136/ard.42.6.684 on 1 December 1983. Downloaded from Annals ofthe Rheumatic Diseases, 1983, 42, 684-686 Allopurinol metabolism in a patient with xanthine oxidase deficiency HISASHI YAMANAKA, KUSUKI NISHIOKA, TAKEHIKO SUZUKI,* AND KEIICHI KOHNO* From the Rheumatology Department, Clinical Research Centre, Tokyo Women's Medical College, 2-4-1, NS BLD, Nishishinjuku, Shinjukuku, Tokyo, Japan SUMMARY A patient with complete deficiency of xanthine oxidise would not be expected to oxidase allopurinol to oxipurinol if allopurinol did not have any alternative metabolic pathway. 400 mg of allopurinol was administered to a patient with xanthine oxidase deficiency, and plasma allopurinol, oxipurinol, hypoxanthine, and xanthine levels were determined serially by the use of high-perfornman9e liquid chromatography (HPLC). Plasma oxipurinol as well as allopurinol was increased after the administration of allopurinol, and oxipurinol reached a maximum level of 13 1 ,u.g/ml at 6 hours after the administration. This was the same pattern as that of normal controls. This result demonstrated the existence of some other oxidising enzyme of allopurinol than xanthine oxidase. Allopurinol (4-hydroxypyrazolo[3,4-d]pyrimidine) free diet. Creatinine clearance was 73 3 m/min, and is known as a potent inhibitor of xanthine oxidase no calculus was found in her urinary tract by abdomi- copyright. (EC 1.2.3.2). In addition allopurinol itself is nal plain x-ray film and drip infusion pyelography. metabolised in vivo by xanthine oxidase to oxipurinol The xanthine oxidase activity of the duodenal (4,6-dihydroxypyrazolo[ 3,4-d]pyrimidine, which mucosa, which was obtained by gastrofibroscopy, also inhibits xanthine oxidase.
  • Hereditary Xanthinuria

    Hereditary Xanthinuria

    Hereditary xanthinuria Description Hereditary xanthinuria is a condition that most often affects the kidneys. It is characterized by high levels of a compound called xanthine and very low levels of another compound called uric acid in the blood and urine. The excess xanthine can accumulate in the kidneys and other tissues. In the kidneys, xanthine forms tiny crystals that occasionally build up to create kidney stones. These stones can impair kidney function and ultimately cause kidney failure. Related signs and symptoms can include abdominal pain, recurrent urinary tract infections, and blood in the urine (hematuria). Less commonly, xanthine crystals build up in the muscles, causing pain and cramping. In some people with hereditary xanthinuria, the condition does not cause any health problems. Researchers have described two major forms of hereditary xanthinuria, types I and II. The types are distinguished by the enzymes involved; they have the same signs and symptoms. Frequency The combined incidence of hereditary xanthinuria types I and II is estimated to be about 1 in 69,000 people worldwide. However, researchers suspect that the true incidence may be higher because some affected individuals have no symptoms and are never diagnosed with the condition. Hereditary xanthinuria appears to be more common in people of Mediterranean or Middle Eastern ancestry. About 150 cases of this condition have been reported in the medical literature. Causes Hereditary xanthinuria type I is caused by mutations in the XDH gene. This gene provides instructions for making an enzyme called xanthine dehydrogenase. This enzyme is involved in the normal breakdown of purines, which are building blocks of DNA and its chemical cousin, RNA.
  • Functional Studies on Oligotropha Carboxidovorans Molybdenum

    Functional Studies on Oligotropha Carboxidovorans Molybdenum

    Functional studies on Oligotropha carboxidovorans molybdenum-copper CO dehydrogenase produced in Escherichia coli Paul Kaufmann1, Benjamin R. Duffus1, Christian Teutloff2 and Silke Leimkühler1* From the 1Institute of Biochemistry and Biology, Department of Molecular Enzymology, University of Potsdam, 14476 Potsdam, Germany. 2Institute for Experimental Physics, Free University of Berlin, Arnimallee 14, 14195 Berlin, Germany. *corresponding author: Silke Leimkühler; Department of Molecular Enzymology, Institute of Biochemistry and Biology, University of Potsdam, Karl-Liebknecht-Str. 24-25, 14476 Potsdam, Germany; Tel.: +49-331-977-5603; Fax: +49-331-977-5128; E-mail: sleim@uni- potsdam.de Running title: Studies on a molybdenum-copper CO dehydrogenase expressed in E. coli 1 The abbreviations used are: molybdenum cofactor (Moco), molybdopterin (MPT), bis-MPT guanine dinucleotide (bis-MGD), carbon monoxide ehydrogenase (CODH), cytidine-5’-monophosphate (5'CMP), high-performance liquid chromatography (HPLC), electron paramagnetic resonance (EPR), ethylenediaminetetraacetic acid (EDTA), g-factor (g). 2 ABSTRACT The Mo/Cu-dependent CO dehydrogenase (CODH) from Oligotropha carboxidovorans is an enzyme that is able to catalyze both the oxidation of CO to CO2 and the oxidation of H2 to protons and electrons. Despite the close to atomic resolution structure (1.1 Å), significant uncertainties have remained with regard to the reaction mechanism of substrate oxidation at the unique Mo/Cu-center, as well as the nature of intermediates formed during the catalytic cycle. So far the investigation of the role of amino acids at the active site was hampered due to the lack of a suitable expression system that allowed for detailed site-directed mutagenesis studies at the active-site.
  • Defects in Metabolism of Purines and Pyrimidines

    Defects in Metabolism of Purines and Pyrimidines

    Ned Tijdschr Klin Chem 1999; 24: 171-175 Defects in metabolism of purines and pyrimidines A.H. van GENNIP Defects in the metabolism of purines and pyrimidines To date 27 defects of purine and pyrimidine metabo- are not well-known in the general hospital. For this lism have been documented. They are listed in Tables reason relatively few patients suffering from these 1 and 2. diseases are being diagnosed. However, at present 27 different defects of purine- and pyrimidine metabo- Diagnosis lism have already been documented. Clinically, these In purine metabolism uric acid is the end product of defects are not easily recognised, at least for the larger biosynthesis 'de novo', salvage and degradation and part, because of non-specific symptoms. Therefore, therefore measurement of uric acid in plasma and the assistance of a clinical chemistry laboratory spe- urine will lead to an indication for several purine cialized in inborn errors is indispensable to discover defects but certainly not all defects (table 1). Pyrim- most of these defects. This review describes the various idine metabolism does not have such an end product. biochemical and clinical aspects of the defects of purine Moreover, as in many inborn errors of metabolism and pyrimidine metabolism and provides a guide for clinical symptomatology is aspecific and highly variable their detection, diagnosis and treatment. (Table 3). Therefore, screening methods covering a broad spectrum of purine and pyrimidine metabolites Definition and frequency will provide the best possibility of detecting most of Defects of purine and pyrimidine metabolism are the known defects or even new defects. Such methods characterized by abnormal concentrations of purines, are already operative in many centres around the pyrimidines and/or their metabolites in cells or body world for amino acids, organic acids, mucopolys- fluids due to a decreased or an increased activity of accharides and oligosaccharides.
  • A Metabolic Profiling Approach Oded Shaham

    A Metabolic Profiling Approach Oded Shaham

    A Metabolic Profiling Approach to Human Disorders of Energy Metabolism by Oded Shaham Submitted to the Harvard-MIT Division of Health Sciences and Technology in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY IN ARCHIVES BIOINFORMATICS AND INTEGRATIVE GENOMICS MASSACHUSETTS INSTITUTE at the OF TECHN4OLO MASSACHUSETTS INSTITUTE OF TECHNOLOGY OCT 0 2 2009 September 2009 LIBRARIES ( Oded Shaham, MMIX. All rights reserved. The author hereby grants to MIT permission to reproduce and to distribute publicly paper and electronic copies of this thesis document in whole or in part in any medium now known or hereafter created. A utho r....... ......................... ........ Harvard-MIT D(vision of Health Sciences and Technology July 8, 2009 C ertified by ....... ............... ........... ........... .. .. .... .. .. Vamsi K. Mootha, MD Associate Professor Department of Systems Biology, Harvard Medical School Thesis Supervisor Accepted by ...................... .................. ... ................ Ram Sasisekharan, PhD Director, Harvard-MIT Division of Health Sciences and Technology Edward Hood Taplin Professor of Health Sciences and Technology and Biological Engineering A Metabolic Profiling Approach to Human Disorders of Energy Metabolism by Oded Shaham Submitted to the Harvard-MIT Division of Health Sciences and Technology on July 8, 2009, in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY IN BIOINFORMATICS AND INTEGRATIVE GENOMICS Abstract The integrated network of biochemical reactions known collectively as metabolism is essential for life, and dysfunction in parts of this network causes human disease - both rare, inherited disor- ders and common diseases such as diabetes mellitus. The study of metabolic disease depends upon quantitative methods which are traditionally custom-tailored to a given compound.