Two New Species of Marsupial Tree-Frogs Genus Gastrotheca Fitzinger, 1843 (Anura, Hemiphractidae) from the Brazilian Atlantic Forest

Two new species of marsupial tree-frogs genus Gastrotheca Fitzinger, 1843 (Anura, Hemiphractidae) from the Brazilian Atlantic Forest

MAURO TEIXEIRA JR.1,2, FRANCISCO DAL VECHIO1, RENATO SOUSA RECODER1, ANA CAROLINA C ARNAVAL 3, MARIA STRANGAS3, ROBERTA PACHECO DAMASCENO4, MARCO AURÉLIO DE SENA1, MIGUEL TREFAUT RODRIGUES1 1Departamento de Zoologia, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP, Caixa Postal 11.461, CEP 05508- 090, Brazil. 2E-mail: [email protected] 3Department of Biology, The City University of New York, 526 Marshak Science Building, City College of New York, 160 Convent Avenue, New York, NY 10031, USA. 4University of California, Berkeley, Museum of Vertebrate Zoology, 3101 Valley Life Sciences Building, Berkeley, CA 94720–3140, USA.

ABSTRACT

Two new species of Gastrotheca are described from northeastern Minas Gerais and southern Bahia, in the Atlantic Forest of Brazil. Data on morphology, calls, mitochondrial, and nuclear DNA are provided. Allied to G. fissipes and G. megacephala, the new taxa provide evidence for a higher diversity of species of Gastrotheca than previously thought at the Atlantic Forest. The data also suggest that G. pul chra, another Atlantic Forest taxon, is more closely related to non- Atlantic Forest species than to the remaining analyzed Brazilian Gastrotheca species. This implies that the Gastrotheca at the Brazilian coastal forests have at least two independent origins.

Key words: Reserva Biológica da Mata Escura, Estação Ecológica Estadual de Wenceslau Guimarães, Jequitinhonha Riv- er, Atlantic Forest refuges.

INTRODUCTION

In their eighth volume of Erpétologie Générale, Duméril and Bibron (1841) described a new species of a tree- frog from Cuzco, Peru, which they attributed to the genus Hyla. The new species had a particularity that would distinguish it from all other congeners: it possessed a pouch on its back in which it carried its eggs. To this species, they gave the very appropriate name Hyla marsupiata. Two years later, Fitzinger (1843) removed this species from Hyla and created a new genus to accommodate this marsupial tree-frog, the genus Gastrotheca. Almost 160 years after Fitzinger’s (1843) work, Gastrotheca now comprises about 60 species distributed from southern Central America to northern Argentina and eastern South America (Duellman 1984). Its highest diversity is found along the Andean slopes and the tropical lowlands of northwestern South America. With fewer endemics, the genus also occurs along the Atlantic Forest of eastern Brazil (Duellman 1984; Caramaschi & Rodrigues 2007). The taxonomic history of the Brazilian Atlantic Forest’s Gastrotheca species begins when Boulenger (1888) described Nototrema fissipes from Pernambuco, in the northeastern coast. About two decades later, Andersson described Nototrema microdiscus from Paraná (Lönnberg & Andersson 1910) and N. fulvorufa (Andersson 1911) from São Paulo. Ten more years had passed before Miranda-Ribeiro (1920) described Gastrotheca ernestoi from Rio de Janeiro; two decades later, A. Lutz and B. Lutz (1939) described G. virid is and G. albolineata from São Paulo and Rio de Janeiro states, respectively. After four and a half decades of taxonomic stasis, Duellman (1984) rendered all names but G. f i s si p e s junior synonyms of G. microdiscus. A second reassessment based on newly collected specimens removed those species from G. mi cro discu s synonymy,

Accepted by S. Castroviejo-Fisher: 6 Jul. 2012; published: 24 Aug. 2012 1 placing G. virid is in the synonymy of G. ernesto i, and described G. pulchra from southern Bahia (Caramaschi & Rodrigues 2007). In the subsequent year, G. flamma, also from southern Bahia, was described (Juncá & Nunes 2008). By 2009, G. fissipes was considered the most widespread species of Gastrotheca in the Atlantic Forest, ranging from southern Espírito Santo to Pernambuco. However, a recent revision described a novel species allied to G. fissipes: G. megacephala (Izecksohn et al. 2009). In their work, Izecksohn et al. (2009) recommended that only those populations from Pernambuco be considered G. fissipes, whereas populations south of Pernambuco should be called G. megacephala (Izecksohn et al. 2009). Despite Izecksohn et al.’s (2009) points, the name G. fissipes is still being applied to Gastrotheca populations in southern Bahia (Pimenta et al. 2009; Freitas 2011; Moura et al. 2012). Because the diversity of Gastrotheca in the Atlantic Forest was only recently revealed, it has not yet been properly addressed in existing phylogenetic studies. Mendelson et al. (2000) used a morphological approach to address the relationship of hemiphractine frogs. This study proposed G. fissipes as the sister group of G. microdiscus, nested deeply within the Gastrotheca genus. However, those were the only two species recognized for the Atlantic Forest at that time, and the individuals of G. fissipes included likely represent G. megacaphala, as the specimens are from Vila Velha, Espírito Santo, and those of G. microdiscus may represent G. f ulvo rufa, G. ernestoi or G. albolineata, as the specimens are from Teresópolis, Rio de Janeiro. Therefore, data about their relationships with westernmost species are still scarce, and the monophyly of the Atlantic Forest assemblage has been debated (Duellman 1984; Caramaschi & Rodrigues 2007). Recent molecular phylogenetic studies recovered Gastrotheca fissipes as the basal lineage among all Gastrotheca (Wiens et al. 2007; Pyron & Wiens 2011), but no other species from the Atlantic Forest were surveyed. Through recent field work efforts, tied to molecular DNA sequencing, we discovered a population of Gastrotheca in southern Bahia that is morphologically and genetically distinct from both G. fissipes and G. megacephala. We also collected a series belonging to yet another distinct population from northeastern Minas Gerais. Here we describe both species, provide notes on their natural history, describe their advertisement call, and present a preliminary molecular phylogenetic analysis to demonstrate the uniqueness of these lineages. To this end, we include other available samples of Atlantic Forest species.

MATERIAL AND METHODS

Morphological assessment

Morphometric variable terminology and definition, morphological descriptions, and diagnosis follow Caramaschi and Rodrigues (2007) and Izecksohn et al. (2009); snout terminology follows Heyer et al. (1990), web formulae follow Savage and Heyer (1997). After fixation, measurements were taken with an electronic caliper to the nearest 0.01mm and rounded to the first decimal unit (Hayek et al. 2001) to avoid pseudoprecision. Measurements are: SVL (snout-vent length); HL (head length); HW (head width); ED (eye diameter); TD (tympanum diameter); END (eye to nostril distance); ESD (eye-snout distance); THL (thigh length); TL (tibia length); FL (foot length); EW (eyelid width); IOS (interorbital space); 3FD (diameter of third finger disk); 4TD (diameter of fourth toe disk). Observations of morphological characters were performed with a stereomicroscope Zeiss STEMI SV6. Small-sized individuals (all about 20mm SVL) were considered to be juveniles and were not measured. All others (larger than 65mm SVL) were included in the measurements. Literature data (Duellman 1984; Mendelson et al. 2000; Caramaschi & Rodrigues 2007; Izecksohn & de Carvalho-e-Silva 2008; Juncá & Nunes 2008; Izecksohn et al. 2009) and examination of collection vouchers housed at Museu de Zoologia da Universidade de São Paulo (MZUSP) and Museu de História Natural da Universidade Federal de Alagoas (UFAL) (Appendix I) enabled morphological comparisons among the newly described species and other congeners. Osteological comparisons were made through three-dimensional images generated by a computerized tomography using an x-ray micro-tomographer in median and low resolution, without filter. This examination was performed for specimens housed in MZUSP.

To map the known distributional ranges of Gastrotheca species over the Atlantic Forest we complied locality from the literature (Duellman 1984; Sachsse et al. 1999; Mendelson et al. 2000; Caramaschi & Rodrigues 2007; Carvalho-e-Silva et al. 2008; Gressler et al. 2008; Izecksohn & de Carvalho-e-Silva 2008; Juncá & Nunes 2008; Freitas et al. 2009; Santos & Santos 2009; GBIF 2011; Siqueira et al. 2011; SpeciesLink 2011; Mendes et al. 2012), personal communications (J. Rodrigues), and museum specimens (MZUSP and UFAL).

Field sampling methods

Active searches were carried out in all forest types available at Estação Ecológica Estadual de Wenceslau Guimarães (EEEWG, state of Bahia, Brazil) and Reserva Biológica da Mata Escura (RBME, state of Minas Gerais, Brazil). Field work was performed during the rainy season (EEEWG: Dec 8th–Dec 20th 2011; RBME: Dec 1st 2009–Jan 4th 2010) by four to six people, for four to six hours per night. Collected specimens were fixed in 10% formalin, preserved in 70% ethanol, and housed at MZUSP.

Bioacoustics

At RBME, calls were recorded with a Panasonic RR-US450 portable digital audio recorder with built-in microphone under a sampling rate of 44.1 kHz, 16 bit resolution, and recording pitch up to 7 kHz in a mono channel. At EEEWG, calls were recorded with an Olympus LS-10 portable digital audio recorder using built-in microphones with recording pitch up to 20 kHz in a stereo channel. Audio analyses, audiospectrograms, and oscillograms were generated with Sound Ruler v. 0.9.6 software (Gridi-Papp 2007). Air temperatures were taken with quick-reading Miller and Weber Inc. T-6000 thermometer.

Diet

Due to the large number of individuals collected at EEEWG, a stomach content analysis enabled the characterization of the diet of one of the newly described species. For this purpose, ten individuals were dissected after fixation, the stomachs removed, and contents were analyzed under a Zeiss STEMI SV6 stereomicroscope. Items were identified to the more inclusive taxon, up to the level of Order.

Phylogenetic analysis

To determine the level of divergence and patterns of relationships between G. fissipes, G. megacephala, and the newly described species, we combined newly obtained sequences with data deposited in GenBank for a portion of the mitochondrial gene NADH dehydrogenase subunit 1 (ND1), of the 12S gene, and of four nuclear genes: rhodopsin, a portion of exon 2 of the nuclear proto-oncogene cellular myelocytomatosis (c-myc), seventh in absentia (SIA), and beta A-4 crystalline (cryBA). DNA extraction followed Carnaval and Bates (2007). Amplifications of ND1 and cmyc exon 2 were carried out with primers 16Sfrog and tmet-frog and cmyc1u and cmyc2f, respectively, as described by Wiens et al. (2005). Fragments of 12S, the rhodopsin and the SIA genes were amplified using the protocols and primer pairs mvz 59 and mvz 50, rhod1A and rhod1C, and SIA1 and SIA2, as described in Faivovich et al. (2005). Primers cryb2Ls and cryb1s were used to amplify the cryBA gene, as per Dolman and Phillips (2004). DNA sequences were generated for individuals belonging to the two species here described, but also for specimens of G. fissipes that we had collected in the township of Colônia (Jaqueira municipality, state of Pernambuco) as well as samples of G. p ul chra from Camacan and Wenceslau Guimarães, in the state of Bahia. All newly generated sequences are available in GenBank (JX262889–JX262927) (Appendix II) with the exception of those for cryBa (Appendix III).

TWO NEW SPECIES OF GASTROTHECA Zootaxa 3437 © 2012 Magnolia Press · 3 Phylogenetic analyses included sequences of G. megacephala from Guarapari, state of Espírito Santo, that were available in GenBank (accession numbers AY844790, AY844564, and AY844381, originally published under the name of G. fissipes). We were also able to include sequences of G. cf. marsupiata from Santa Cruz, Bolivia (AY844563, AY844789). A phylogenetic tree was inferred through Bayesian analysis in BEAST (Drummond and Rambaut, 2007) after running 10,000,000 generations, logging results at every 1000 generations, and discarding burn-in. A concatenated data matrix was used for the phylogenetic inference using a best–fit model of nucleotide substitution for each gene partition as selected through jModelTest (Posada 2008). Scinax catharinae sequences (AY844742, AY844941, AY819522, AY819225) were used as representatives of more distantly related taxa for rooting purposes. Available sequences of Flectonotus fitzgeraldi (AY819486, AY819189) and Fritziana sp. (AY844562, AY844788), a genus closely related to Gastrotheca (Faivovich et al. 2005), were used as outgroups.

RESULTS

Gastrotheca prasina sp. nov. (Figs. 1–3)

Holotype: MZUSP 147059 (Figs 1–3A), an adult male from Reserva Biológica da Mata Escura (16°20'30.08"S, 40°59'49.17"W, WGS84, 989 m a.s.l.), Jequitinhonha municipality, Minas Gerais state, Brazil, collected on December 6th 2009 by M. Teixeira Jr., M. A. de Sena, R. S. Recoder, M. T. Rodrigues, R. P. Damasceno and A. C. Carnaval; field number MTR 17236.

FIGURE 1. Holotype of Gastrotheca prasina sp. nov. (MZUSP 147059): Dorsal (left) and ventral (right) views.

Paratopotypes: MZUSP 147060–63, MZUSP 147065, adult males, collected from December 6th 2009 to January 9th 2010; field number MTR 17248, MTR 17459–61 and MTR 17707, respectively. MZUSP 147064, an adult female, collected on December 6th 2009; field number MTR 17462. Same collectors as holotype. Etymology: The specific epithet is a Latin word derived from prasinus (=green), which refers to the greenish general body color of this new species. Diagnosis: Comparative list of diagnostic features are presented in Table 1. (1) A large-sized species (SVL 97.2mm in females, 79.3–89.6mm in males); (2) head length smaller than head width (HL about 90% of HW); (3) skin co-ossified to the skull; (4) snout truncate in dorsal view and in profile; (5) tympanum vertically elliptical, TD about 85% of ED; (6) upper eyelid without a distinctive tubercle; (7) crescent order of length of fingers, II

4 · Zootaxa 3437 © 2012 Magnolia Press TEIXEIRA JR. ET AL. dorsal skin shagreened; (12) background coloration orangish green with a dark brown subocular bar; (13) posterior edge of skull bones straight; (14) presence of whitish nuptial excrescences. Description of the holotype: An adult male (SVL=83.11mm). Head wider than long; snout truncate in dorsal and lateral views. Canthal ridge sharp, straight; nostrils anterior, directed laterally. Loreal region slightly concave with an upper groove delimitate by the canthal ridge; lips thin, rounded. Vomerine teeth in two series, slightly oblique, between choanae, widely separate, internal edge placed posteriorly. Vocal slits present, lateral to tongue; vocal sac single, subgular. Tongue ovoid, slightly narrow. Interorbital space slightly concave; eyes prominent. Posterior edge of skull bones straight. Upper eyelid without a distinctive tubercle. Tympanum elliptical, TD 95% ED; tympanic annulus distinct, tympanic membrane smooth, with a supratympanic fold. Arms slender, forearm slightly hypertrophied. Axillary membrane absent; hand large. Fingers long, in crescent order of size, II

FIGURE 2. Holotype (MZUSP 147059) of Gastrotheca prasina sp. nov.: Dorsal (A), Lateral (B) views of the head; Foot (C) and hand (D). Scale bar = 5 mm.

TWO NEW SPECIES OF GASTROTHECA Zootaxa 3437 © 2012 Magnolia Press · 5 Color: Background dorsal coloration greenish with a slightly anteriorly oriented darker green chevron and scattered darker green over dorsum; head orangish green with a curve interorbital green bar; dark brown blotch posterior to nostril contiguous with a brown line along canthal groove, loreal region green; canthal ridge and lips orangish. Dark brown infraorbital bar, postorbital dark brown stripe passing over tympanum and extending posteriorly into a lateral wide black stripe interrupted after arm insertion. Flanks with green and brown coloration, and ventrolaterally with black vermiculations and small yellowish irregular markings, that extends over the arm. Hindlimbs dorsal surfaces orangish green with transverse green bars than enters anterior surface of thighs with a whitish background coloration and blackish transverse bars; posterior surfaces of thigh with dark vermiculations and yellowish irregular markings; forearm with transverse green bars; dorsal surfaces of hands and feet orangish; throat and chest dark grey, belly light gray with lateral dark vermiculations. Ventral surfaces of arms and legs dark grey with light markings. Sub-cloacal region black with white spots. In preservative green tones turned into gray tones, general coloration is dark gray; yellowish and orangish colorations turned into light gray tones. Measurements of the holotype (mm): SVL=83.11; HL=27.94; HW=31.53; ED=6.65; TD=6.1; END=8.63; ESD=12.71; THL=36.29; TL=38.18; FTL=51.41; 3FD=4.7; EW=6.23; IOS=14.03; 4TD=3.55.

FIGURE 3. Living holotype (MZUSP 147059) of Gastrotheca prasina sp. nov. (A), living paratopotypes hiding inside a bromeliad (B), calling with extended vocal sac (C), and a female carrying eggs on its pouch (D).

6 · Zootaxa 3437 © 2012 Magnolia Press TEIXEIRA JR. ET AL. FIGURE 4. Advertisement call of Gastrotheca prasina sp. nov.: (A) Oscillogram containing four calls and; (B) An oscillogram of a section comprising a single call; (C) Spectrogram of the same call; (D) Amplitude spectrum of the same call. Calls were recorded about 20:00 h on 6th December 2009, air temperature was about 21ºC.

Variation: Small color variation was observed among individuals, mostly affecting the visibility of the dorsal chevrons. Some specimens possessed homogeneous green dorsal surfaces, others had a distinctive chevron-shaped spot, while a few showed an intermediate color pattern. Variation in measurements is presented in Table 2. Advertisement call: A series of four to eight calls are emitted by males at a rate of 0.82 call/sec. Each call consists of two pulsed notes, the first averaging 485ms in length (432–543ms), the second 172ms (149–187ms). Dominant frequency of the first note is ca. 1370 Hz (1350–1405 Hz) and the second note 1331 Hz (1240–1515 Hz). The first note has about 15.3 pulses (14–17) and the second about 7.3 (6–8). Notes and pulses are slightly frequency- modulated and no harmonic structure is visible (Fig. 4). Occasionally only the first note is given. Comparison with other species (data from congeners are presented in parenthesis): G. prasina sp. nov. can be distinguished from all other Gastrotheca from the Atlantic Forest with the exception of G. fissipes, G. megacephala and G. recava sp. nov. by its large size, 97mm in females, 79.3–89.6mm in males (combined SVL of the other species 32.6–77.2mm in females, 27.7–70.0mm in males), tympanum large, vertically elliptical, with diameter about 80–95% of eye diameter (tympanum small to medium sized, circular, 50–71% of eye diameter), toes vestigially webbed (toes distinctively webbed), dorsal skin shagreened (smooth, weakly granulate in G. flamma). G. prasina sp. nov. can be further distinguished from G. pulchra and G. flamma by the absence of a tubercle on the upper eyelid and by lacking an appendage on calcars (present). From G. albolineata, G. microdiscus, and G. pulchra, it can be distinguished by its

TWO NEW SPECIES OF GASTROTHECA Zootaxa 3437 © 2012 Magnolia Press · 7 FIGURE 5. Comparison of posterior edge of skull in (A) Gastrotheca megacephala, (B) G. pr a sin a sp. nov., (C) G. recava sp. nov., and (D) G. fissipes, externally (left) and internally (right). Externally visible edge of skull bones represented by a black dashed line. Bones: 1= sphenethmoid; 2=nasal; 3=frontoparietal; 4=squamosal. skull skin extensively co-ossified (not co-ossified). It can be distinguished from G. megacephala by its narrower head 37–39% of SVL (40–43% of SVL), larger body size 79.3–89.6mm in males (71.9–78.7mm in males), tympanum diameter in males 5.54–6.83mm (6.9–8.1mm in males), and several advertisement call features, including the duration of first note 432–543ms (350ms), the duration of the second note 149–187ms (60ms), the number of pulses in the first note 14–17 (9) and in the second note 6–8 (5), the occurrence of notes and pulses slightly frequency-modulated (notes end pulses not frequency modulated), and the fact that the first note is the most intense one (second note is the most intense). From G. fissipes, G. recava sp nov., and G. megacephala, it can be distinguished by its greenish background dorsal coloration (brownish background coloration). From G. recava sp nov. and G. f is sip es, it can be distinguished by having the posterior edged of parietal bones roughly straight (Fig. 5A) (posterior edge of skull bones extensively

8 · Zootaxa 3437 © 2012 Magnolia Press TEIXEIRA JR. ET AL. arched inwards, and arched outwards, respectively; Figs. 5C, D). Additionally from G. recava sp. nov. it can be distinguished by the presence of a dark brown infraorbital bar (absent, replaced by a dark brown temporal coloration contiguous with a dark brown stripe that extends through the lateral surfaces of the body) and an advertisement call consisting of pulsed notes with 6 to 17 pulses (24 pulses). Natural history and distribution: Males were commonly found calling from the vegetation at nighttime after rainy days. Calls were heard soon after the sunset. Males were heard and seen while calling from inside ground bromeliads between 18h–19h; it is possible that they hide in the axils of these plants during the day. From 20h–21h, they were heard and seen at lower branches of small trees emerging from large clusters of bromeliads. At ca. 22h, males were calling from higher branches (2–3 m high) in small trees, close to bromeliad clusters. One female was found inside a bromeliad tank, carrying more than 16 eggs. Although ground bromeliads were also present inside the forest, every individual was either found or heard in isolated patches of open vegetation with bare ground and sandy soil (Fig. 6). The species was mainly found in this kind of habitat, a transitional formation between forest and high-altitude grassland that resembles the coastal restingas, but that is found in the region only above 900 m a.s.l. of elevation. The currently known geographical range of this species is thus restricted to these patches, and the bromeliads occupied by individuals were also used by other frog species such as Phyllodytes luteolus and Bokermanohyla sp. This is the second record of Gastrotheca in the state of Minas Gerais (Moura et al. 2012) and the inland-most report at this latitude; most Atlantic Forest Gastrotheca species have coastal distributions (Fig. 7).

FIGURE 6. Habitats occupied by Gastrotheca prasina sp. nov.: (A) A general view of the landscape at RBME; note hills slopes covered with forests and patches of open sparse vegetation on their top; (B) a detail of the open vegetation that dominate the summit, showing the sandy soil with bare ground, and dense clusters of bromeliads; (C) and the bromeliad in which individuals of Gastrotheca prasina sp. nov. were found.

TWO NEW SPECIES OF GASTROTHECA Zootaxa 3437 © 2012 Magnolia Press · 9 10 · Zootaxa 3437 © 2012 Magnolia Press TEIXEIRA JR. ET AL. TABLE 2. Measurements of Gastrotheca prasina sp. nov., G. recava sp. nov., G. fissipes and G. megacephala. Abbreviations are explained in the text.

G. prasina sp. nov. G. recava sp. nov female (n=1) males (n=6) females (n=7) males (n=14) SVL 97.2 83.7 (79.2–89.5) 76 (67.2–84.9) 65.8 (57–75.4) HL 32.8 29.5 (27.6–32.2) 27 (24.3–29.4) 23.3 (20.7–26.1) HW 36.5 32.4 (31–34.9) 30.7 (27.8–33.2) 26.1 (22.3–29.6) ED 8.1 7.2 (6.4–7.9) 7.6 (6.5–8.7) 7.3 (6.4–8.4) TD 6.7 6.1 (5.5–6.8) 6.6 (5.9–7.8) 5.9 (5–6.6) END 9.6 8.7 (8.1–9.4) 7.3 (6.2–8.2) 6.2 (5.8–7.2) ESD 14.1 13.4 (12.5–14.7) 11.1 (9.8–12.1) 9.6 (8.2–10.9) THL 40.2 37.4 (35.8–39.1) 39.6 (35.6–44.4) 34 (29.5–39.2) TL 41.4 38.2 (35.5–40.4) 40 (37–43.1) 34.4 (31.1–38.8) FTL 56.2 52.8 (51.4–55.6) 52.3 (48.7–59.1) 45.1 (40.6–49.8) 3FD 4.6 4.7 (4.3–5) 4.1 (3.1–4.8) 3.5 (3–4.1) IOS 15.7 6.3 (5.9–6.9) 7.4 (6.1–8.9) 6.9 (6–8) 4TD 3.4 14.3 (13.7–14.9) 12 (10.2–13) 10.2 (8.9–11.6)

G. fissipes G. megacephala males (n=8) females (n=4) males (n=7) SVL 67.2 (65.2–69.1) 89.7 (81–99.4) 75.2 (71.9–80.1) HL 23.5 (21.5–27.9) 30.8 (26–34.37) 24.7 (23.5–26.2) HW 25.9 (24.3–27.4) 36.4 (32.6–39.9) 31.5 (30.1–32.9) ED 6.7 (6–7.6) 8.5 (8.1–9.2) 7.5 (7–7.9) TD 5.9 (5.3–6.8) 7.1 (6.1–7.9) 7.5 (6.9–8.1) END 5.9 (5.2–6.7) 8.7 (8.2–9.4) 8.3 (8–8.4) ESD 9 (8.5–10.8) 13.8 (11.8–15.6) 11.6 (10.6–13) THL 30.8 (29.9–31.9) 42.2 (36.5–49.2) 34.9 (33.3–36.2) TL 30.8 (29.6–31.8) 41.4 (35.8–46.4) 34.9 (33–37) FTL 43.5 (41.1–46) 58.8 (48.5–68.6) 47.9 (45.7–50.9) 3FD 3.1 (2.6–3.8) 5.3 (4.4–5.9) 3.7 (3.3–4) IOS 11.2 (10.5–12.1) 15.7 (14.6–17.3) 13.6 (11.6–14.6) 4TD 2.4 (1.9–2.9) 4.5 (3.7–5.3) 3.2 (2.7–3.8)

Gastrotheca recava sp. nov. (Figs. 8–10)

Gastrotheca fissipes (part) Freitas 2011:9; Mendes et al. 2012 Gastrotheca megacephala (part) Freitas 2011:9

Holotype: MZUSP 147033 (Figs. 8, 9), an adult male from Estação Ecológica Estadual de Wenceslau Guimarães (13°35'41.8"S, 39°43'10.5"W, SAD69, 530 m a.s.l.), state of Bahia, Brazil, collected on December 8th 2011 by M. Teixeira Jr., R. S. Recoder, M. T. Rodrigues, F. Dal Vechio, J. Tonini; field number MTR 21973. Paratopotypes: MZUSP 147031, MZUSP 147039, MZUSP 147042, MZUSP 147044, MZUSP 147052 and MZUSP 147055, adult females, collected from December 8th to 20th 2011; field numbers MTR 21971, MTR 22043, MTR 22049, MTR 22079, MTR 22194 and MTR 22259, respectively. MZUSP 147032, MZUSP 147035–38, MZUSP 147040, MZUSP 147041, MZUSP 147043, MZUSP 147045, MZUSP 147047–147049, MZUSP 147051

12 · Zootaxa 3437 © 2012 Magnolia Press TEIXEIRA JR. ET AL. and MZUSP 147057, adult males, collected from December 8th to 20th 2011; field numbers MTR 21972, MTR 22026–22029, MTR 22047–2048, MTR 22078, MTR 22096, MTR 22169–22171, MTR 22183 and MTR 22301, respectively. MZUSP 147034, MZUSP 147046, MZUSP 147050, MZUSP 147053–56 and MZUSP 147058, juveniles, collected from December 8th to 20th 2011; field numbers MTR 22012, MTR 22136, MTR 22172, MTR 22207–95 and MTR 22302, respectively. Same collectors as for the holotype.

FIGURE 8. Holotype of Gastrotheca recava sp. nov. (MZUSP 147033): Dorsal (left) and ventral (right) views.

FIGURE 9. Holotype (MZUSP 147033) of Gastrotheca recava sp. nov.: Dorsal (A), Lateral (B) views of the head; Foot (C) and hand (D). Scale bar = 5 mm.

TWO NEW SPECIES OF GASTROTHECA Zootaxa 3437 © 2012 Magnolia Press · 13 Etymology: The specific epithet is derived from the Latin word recavus (=arched inward, concave) in reference to the posterior edge of skull bones, which are arched inward. Diagnosis: Comparative list of diagnostic features are presented in Table 1. (1) A large sized species (SVL 67.21–84.92mm in females, 57.08–75.41mm in males); (2) head length smaller than head width (HL about 90% of HW); (3) skin co-ossified to the skull; (4) snout truncate in dorsal view and in profile; (5) tympanum vertically elliptical, TD about 85% of ED; (6) upper eyelid without a distinctive tubercle; (7) crescent order of length of fingers, II

14 · Zootaxa 3437 © 2012 Magnolia Press TEIXEIRA JR. ET AL. FIGURE 10. Living specimen of Gastrotheca recava sp. nov. (A), perching over a fern, where they were commonly find (B), a juvenile (C), an ovigerous female (D) and a male calling with extended vocal sac (E).

Comparison with other species (data from congeners are presented in parenthesis): G. recava sp. nov. can be distinguished from all other Gastrotheca species from the Atlantic Forest, except G. fissipes, G. megacephala and G. p rasi na sp. nov., by a large vertically elliptical tympanum with diameter about 69–95% of eye diameter (tympanum small to medium sized, circular, 50–65% of eye diameter; combination of G. ernestoi, G. albolineata, G. fulvorufa and G. microdiscus), toes vestigially webbed (toes distinctively webbed), dorsal skin shagreened (smooth in all others and weakly granulate in G. flamma). G. recava sp. nov. can also be distinguished from G. pulchra and G. flamma by the absence of a tubercle on the upper eyelid and no appendage on calcars (present). From G. albolineata, G. microdiscus, and G. pulchra, it can be distinguished by its skull skin extensively co- ossified (not co-ossified). It can be distinguished from G. megacephala, G. fissipes and G. prasina sp. nov. by the absence of an infraorbital brown bar, by an infraorbital brown coloration extending posteriorly along the temporal region and over the tympanum, reaching a lateral brown stripe (infraorbital brown bar present), by having skull bones with an extensively arched inwards posterior edge (posterior edge of skull bones roughly straight, in G. megacephala and G. prasina sp. nov. [Figs. 5A, B], and arched outwards [Fig. 5D], in G. fissipes). The extensively arched inwards posterior edge of G. recava sp. nov. skull bones produces a narrow contact between frontoparietal

TWO NEW SPECIES OF GASTROTHECA Zootaxa 3437 © 2012 Magnolia Press · 15 and squamosal bones (Fig. 5C), while in G. fissipes there is a broad contact between frontoparietal and squamosal bones (Fig. 5D). Natural history and distribution: Individuals commonly called at night after sunny days, and also (although less often) at daytime on cloudy days. On a sunny day, males started to call around 19h and continued throughout the night. The species appears to be a habitat generalist, as it was commonly found in secondary growth forests in early stages of regeneration, as well as in denser or more pristine forests. Irrespective of habitat used, individuals were found from 10 cm above the ground to more than 5 m high, perching on branches of small shrubs and trees. Only one ovigerous female was found, two others showed signs of recent use of the pouch, and small juveniles of a few days of age were commonly found on the vegetation (Fig. 12). The ovigerous female was kept in captivity in a small terrarium with water and food supply ad libidum. After one month in captivity, she gave birth to 20 fully developed juveniles weighting 0.8g on average. Hundreds of males were heard calling from the vegetation, being the most common forest tree frog at the site. Two other Gastrotheca species were also recorded at EEEWG, G. pulchra and G. megacephala, both sharing the forest with G. recava sp. nov. However, only one individual of G. pulchra was collected and a few individuals of G. megacephala were heard calling from the trees along the forest, but none was observed. An analysis of stomach content of G. recava sp. nov. showed a generalist diet consisting of arachnids (Araneae), insects (Blattaria, Hemiptera and Orthoptera) and mollusks (Gastropoda). Plant materials (seeds) were also found. Orthopterans were the most common prey category, found in five of the ten stomachs analyzed. Two stomachs were empty. Gastrotheca recava sp. nov. is currently known from the Atlantic Forest of southeastern Bahia, south from the “Recôncavo Baiano” (Fig. 7)

FIGURE 11. Advertisement call of Gastrotheca recava sp. nov.: (A) Oscillogram containing two calls and; (B) An oscillogram of a section comprising a single call; (C) Spectrogram of the same call; (D) Amplitude spectrum of the same call. Calls were recorded about 20:00h on 8th December 2011, air temperature was about 22ºC.

16 · Zootaxa 3437 © 2012 Magnolia Press TEIXEIRA JR. ET AL. FIGURE 12. Habitats occupied by Gastrotheca recava sp. nov. at EEEWG. (A) view of the interior of the forest; (B) external view of a hill covered with forest; and (C) an anthropized area in regeneration.

Remarks: Recently, the advertisement call of a Gastrotheca identified as G. fissipes was described from southern Bahia (Mendes et al. 2012). Mendes et al. (2012) comment that individuals from the population addressed in their work show some differences and recognize that “they do not have a light blotch under the eye as described for individuals from the type locality in Pernambuco” (Mendes et al. 2012: 62). Given the absence of this white blotch and dark bar under the eye (present in G. fissipes, absent in G. recava sp. nov.), the locality (G. recava sp. nov. is currently known from southern Bahia and G. fissipes restricted to Pernambuco and Alagoas), the picture and the advertisement call described by Mendes et al. (2012), we recognized the population addressed in their work as belonging to G. recava sp. nov. Although Mendes et al. (2012) provided an accurate description of the advertisement call; we here re-describe it based on individuals that we collected at the type locality (see Advertisement call section).

Phylogenetic relationships

Following primer sequence removal, clean-up, and alignment, DNA sequences were cropped to the following lengths: 356 bp (SIA), 221 bp (cmyc), 308 bp (rhodopsin), 178 bp (cryBA), 823 bp (ND1), and 738 bp (12S). Given the amount of gaps in the alignment of the 12S gene, and because we were unable to obtain 12S sequences for samples of G. fissipes from Pernambuco (a crucial species for comparative purposes), we opted to exclude that marker from the phylogenetic analysis. For phylogeny estimation, we thus used the following best–fit models of nucleotide substitution: HKY for cryBA, HKY + G for ND1, c-myc, rhodopsin, and SIA. The resulting phylogenetic tree clusters all sampled species associated with the G. fissipes group (G. fissipes from Pernambuco, G. megacephala from Espírito Santo, G. pr asi na sp. nov. from Minas Gerais and G. reca va sp. nov. from Bahia) in a single clade with high posterior probability; it also depicts the two species here described as independent lineages (Fig. 13). Uncorrected sequence divergence of the ND1 coding region between G. prasina sp. nov. and G. recava sp. nov., as well as between each newly described species and G. fissipes from Pernambuco, is about 21%; 12S sequences of G. prasina sp. nov. and G. recava sp. nov. are approximately 11% divergent (Table 3). Gastrotheca prasina sp. nov. is shown as closely related to G. megacephala in the molecular phylogenetic analysis. Although ND1 sequences of G. megacephala are not available in GenBank, preventing divergence estimation, 12S sequences of G. prasina sp. nov. were 3.5% divergent from that of G. megacephala available in GenBank (Table 3). The phylogenetic position of Gastrotheca recava sp. nov. relative to G. fissipes and the (G. prasina, G. megacephala) clade is still unresolved. The data also suggest that G. pulchra is more closely related to Andean specimens used in our analysis (G. cf. marsupiata, from Bolivia) than to the remaining analyzed Brazilian species.

TWO NEW SPECIES OF GASTROTHECA Zootaxa 3437 © 2012 Magnolia Press · 17 TABLE 3. Average pairwise genetic distances between target taxa, as given by uncorrected % sequence divergence. Lower triangle, 12S sequence divergence; upper triangle, ND1 sequence divergence. Sequences of G. cf. marsupiata and G. megacephala were obtained from Genbank. NA = data for comparison not available.

G. recava sp. G. prasina sp. G. G. cf. G. megacephala G. fissipes nov. nov. pulchra marsupiata G. recava sp. nov. 21% NA NA NA 21.4% G. prasina sp. nov. 11.0% NA NA NA 21.9% G. pulchra 20.0% 19.5% NA NA NA G. cf. marsupiata 18.0% 15.0% 20.0% NA NA G. megacephala 12.0% 3.5% 20.0% 14.0% NA G. fissipes NA NA NA NA NA

FIGURE 13. Bayesian Inference tree and posterior probabilities based on ND1, cmyc, cryBA, rhodopsin, and SIA sequences. Published sequences of Scinax, Flectonotus, and Fritziana were used as outgroup (not shown).

FIGURE 14. Living specimens of Gastrotheca of the fissipes group: (A) Gastrotheca recava sp. nov. (Wenceslau Guimarães, BA), (B) G. fissipes (Maceió, AL); (C) G. pr a sin a sp. nov. (Jequitinhonha, MG), and (D) G. megacephala (Guarapari, ES).

These descriptions increase the number of Gastrotheca species in the Atlantic Forest to ten, and although it is possible that future inventories will expand their known ranges, it is interesting to observe how the current distribution data match areas of endemism described for other Atlantic Forest endemics (Carnaval & Moritz 2008; Batalha-Filho & Miyaki 2011; Martins 2011). These centers of endemism have been hypothesized to correspond to climatically stable, wet forest refugia during extreme climates of the past (Carnaval et al. 2009). Gastrotheca fissipes and a disjunct population of G. pu lch ra are restricted to a northern refuge, the “Pernambuco region” (an existing record of G. fissipes in São Paulo state by Araujo et al. (2009) is likely erroneous). In the previously recognized “central refuge” or “Bahia region” one finds G. prasina sp. nov, G. recava sp. nov., G. megacephala, G. pulchra and G. flamma. In northern São Paulo, Rio de Janeiro and southern Minas Gerais are G. ernestoi, G. albolineata and G. fulvorufa, while Southern São Paulo and Paraná harbor only G. microdiscus (Fig. 7). Additional field work and dated phylogenies are needed to test a hypothesis that Tertiary and Quaternary cycles of forest expansion and retraction, followed by isolation and speciation, have produced current diversity patterns within Atlantic Forest species of Gastrotheca.

FIGURE 15. Original plate in the description of Nototrema fissipes by Boulenger (1888).

TWO NEW SPECIES OF GASTROTHECA Zootaxa 3437 © 2012 Magnolia Press · 19 The absence of samples of half of the currently known Gastrotheca species from the Atlantic Forest and most of the western species imposes difficulties in unequivocally addressing the relationships among the new species and those they are frequently confused with (G. fissipes and G. megacephala) (Fig. 14), and testing if they indeed represent a natural group. However we see our results, as a first preliminary approach that should be extended in future works, as testing their monophyly would require taxonomic sampling that is beyond the scope of this paper. Although molecular data exist for a considerable portion of the western species of Gastrotheca, available sequences of Atlantic Forest forms were, to date, limited to one sample of G. megacephala. By publicizing molecular sequences of the newly described species, G. fissipes, and G. pulchra, we hope to leverage ongoing phylogenetic studies of this genus. Therefore, although preliminary, our data suggest multiple historical connections between Gastrotheca in the Atlantic Forest and Andean environments. Additionally, our data suggest that highly morphologically similar species (e.g G. pra si na sp. nov. and G. megacephala) may be also molecularly closely related, given the low genetic divergence. However, these results are hampered by limited sampling and forthcoming broader reviews (W. Duellman, pers. com.) will provide invaluable insights about their taxonomy and the biogeographical connections amongst these lineages. In his description of Nototrema fissipes, Boulenger (1888) provided a detailed description and a picture in which some of the most conspicuous diagnostic features among the new species, G. fissipes and G. megacephala (Fig. 15) are present. These features include, for instance, the dark subocular bar, as well as the shape of the posterior edge of the skull bones. Although these characters were already present in Boulenger’s (1888) original pictures, it is remarkable to notice that these other lineages are only now recognized as distinct species from G. fissipes. A likely explanation for this relies in the historically small sizes of collection series of Gastrotheca specimens belonging to the different lineages, a gap that recent herpetological sampling efforts are finally filling in. Differences now attributed to lineage divergence were previously seen as no more than intraspecific variation. As the spatial coverage of herpetofaunal inventories in the Atlantic Forest increases, including areas away from large urban centers, as observed in the last few decades, we are now able to gather larger series of specimens and more easily recognize differences within species groups. The change in how we understand the systematics and biogeography of Atlantic Forest Gastrotheca was only recently spearheaded by the description of G. megacephala (Izecksohn et al. 2009), despite the fact that two previous revisionary studies (Duellman 1984; Caramaschi & Rodrigues 2007) had failed to recognize these southern lineages as distinct from G. fissipes. We nonetheless are still far from a complete description of herpetological diversity in Brazil. The two novel species herein presented, together with others recently described (Caramaschi & Rodrigues 2007; Juncá & Nunes 2008; Izecksohn et al. 2009), suggest that other Gastrotheca species may remain unknown in the coastal Brazilian forests.

ACKNOWLEDGMENTS

We are grateful to ICMBio officers at Reserva Biologica da Mata Escura, its director Tiago Leão Pereira, and SEMA officers at Estação Ecológica Estadual de Wenceslau Guimarães and especially to Rogério de Miranda Ribeiro, for his tireless support during field work; João Tonini and Ivan Prates for help in the field work; João Luiz Gasparini for the picture of G. megacephala, and Filipe Augusto Cavalcanti do Nascimento for the picture of G. fissipes; Juliana Rodrigues dos Santos Silva for the information on some localities of G. recava; Hussam Zaher and Carolina Castro-Mello for access to specimens housed at MZUSP, and Tami Mott for access to specimens housed at UFAL; Monique Simon for giving some of her time to helps us using the micro-CTScan; ICMBio (permit number 19754-1) and SEMA (permit number 2011-020194) for the authorizations; FAPESP and CNPq for financial support; A. Carnaval acknowledges funding from NSF (DEB 1035184 and 1120487); R. Damasceno acknowledges financial support from CAPES-Fulbright BEX 2740-06-0.

Andersson, L.G. (1911) A new Leptodactylus and a new Nototrema from Brazil. Arkiv for Zoologi, 7, 1–6. Araujo, O.G.d.S., Toledo, L.F., Garcia, P.C.A. & Haddad, C.F.B. (2009) The amphibians of São Paulo State, Brazil. Biota Neotropica, 9, 197–209. Batalha-Filho, H. & Miyaki, C.Y. (2011) Phylogeography of the Atlantic Forest. Revista da Biologia, 7, 31–34. Boulenger, G.A. (1888) On some reptiles and batrachians from Iguarasse, Pernambuco. Annals and Magazine of Natural History, Series 6, 2, 40–43. Caramaschi, U. & Rodrigues, M.T. (2007) Taxonomic status of the species of Gastrotheca Fitzinger, 1843 (Amphibia, Anura, Amphignathodontidae) of the Atlantic Rain Forest of eastern Brazil, with description of a new species. Boletim do Museu Nacional, Nova Série - Zoologia, 525, 1–19. Carnaval, A.C., Hickerson, M.J., Haddad, C.F.B., Rodrigues, M.T. & Moritz, C. (2009) Stability Predicts Genetic Diversity in the Brazilian Atlantic Forest Hotspot. Science, 323, 785–789. Carnaval, A.C. & Moritz, C. (2008) Historical climate modelling predicts patterns of current biodiversity in the Brazilian Atlantic forest. Journal of Biogeography, 35, 1187–1201. Carnaval, A.C.O.Q. & Bates, J.M. (2007) Amphibian DNA shows marked genetic structure and tracks Pleistocene climate change in northeastern Brazil. Evolution, 61, 2942–2957. Carvalho-e-Silva, A.M.P.T., Silva, G.R. & Carvalho-e-Silva, S. (2008) Anurans at Rio das Pedras Reserve, Mangaratiba, RJ, Brazil. Biota Neotropica, 8, 199–209. Dolman, G. & Phillips, B. (2004) Single copy nuclear DNA markers characterized for comparative phylogeography in Australian Wet Tropics rainforest skinks. Molecular Ecology Notes, 4, 185–187. Duellman, W.E. (1984) Taxonomy of Brazilian Hylid Frogs of the Genus Gastrotheca. Journal of Herpetology, 18, 302–312. Duellman, W.E. & Trueb, L. (1994) Biology of Amphibians. The John Hopkins University Press, Baltimore, 670 pp. Duméril, A.M.C. & Bibron, G. (1841) Erpétologie Genérale ou Histoire Naturelle Complète des Reptiles. Volume 8. Librarie Enclyclopedique de Roret, Paris, 784 pp. Drummond, A.J. & Rambaut, A. (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7, 214. Faivovich, J., Haddad, C.F., Garcia, P.C., Frost, D.R., Campbell, J.A. & Wheeler, W.C. (2005) Systematic review of the frog family Hylidae, with special reference to Hylinae: phylogenetic analysis and taxonomic revision. Bulletin of the American Museum of Natural History, 294, 1–240. Fitzinger, L.J.F.L. (1843) Systema Reptilium. Fasciculus Primus. Braumüller et Seidel, Wien, 106 pp. Freitas, M.A. (2011) Anfibios do Nordeste Brasileiro. Mata Atlântica - Caatinga - Cerrado - Zona Costeira - Amazônia. (produced by the author), 86 pp. Freitas, M.A., Figueiredo Santos Silva, T. & Mendes Fonseca, P. (2009) Gastrotheca pulchra. Herpetological Review, 40, 233–234. GBIF. (2011) Global Biodiversity Information Facility - Data Portal. Global Biodiversity Information Facility. Available from: http://data.gbif.org/ (6 January 2012). Gressler, E., Aguirre, A.G. & Haddad, C.F. (2008) Amphibia, Anura, Amphignathodontidae, Gastrotheca albolineata: distribution extension, new state, and new altitudinal records. Check List, 4, 31–32. Gridi-Papp, M. (2007) Sound Ruler acoustic analysis. v. 0.9.6.0. Available from: http://soundruler.sourceforge.net Hayek, L.A.C., Heyer, W.R & Gascon, C. (2001) Frog morphometrics: a cautionary tale. Alytes, 18, 153–177. Heyer, W.R., Rand, A.S., Cruz, C.A.G.D., Peixoto, O.L. & Nelson, C.E. (1990) Frogs of Boracéia. Arquivos de Zoologia, 31, 231–410. Izecksohn, E. & Carvalho-e-Silva, S.P. (2008) The species of Gastrotheca Fitzinger at Organs Mountains, Rio de Janeiro State, Brazil (Amphibia : Anura : Amphignathodontidae). Revista Brasileira de Zoologia, 25, 100–110. Izecksohn, E., Carvalho-e-Silva, S.P. & Peixoto, O.L. (2009) On Gastrotheca fissipes (Boulenger, 1888), with the description of a new species (Amphibia, Anura, Amphignathodontidae). Arquivos do Museu Nacional, 67, 81–91. Juncá, F.A. & Nunes, I. (2008) A new species of marsupial frog of the genus Gastrotheca Fitzinger (Anura: Amphignatodontidae) from the State of Bahia, Northeastern Brazil. Zootaxa, 61–68. Lönnberg, E. & Andersson, L.G. (1910) A new Lizard and a new Frog from Paranà. Arkiv for Zoologi, 6, 1–11. Lutz, A. & Lutz, B. (1939) New Hylidae from Brazil/Hylideos novos do Brasil. Anais da Academia Brasileira de Ciencias, 11, 67–89. Martins, F.D.M. (2011) Historical biogeography of the Brazilian Atlantic forest and the Carnaval-Moritz model of Pleistocene refugia: what do phylogeographical studies tell us? Biological Journal of the Linnean Society, 104, 499–509. Mendes, C.V.M, Ruas, D.S., Lourenço-de-Moraes, R., Rödder, D. & Solé, M. (2012) The advertisement call of Gastrotheca fissipes Boulenger, 1888 (Anura, Hemiphractidae) with comments on its distribution. Zootaxa, 3312, 62–64. Mendelson, J.R., Silva, H.R. & Maglia, A.M. (2000) Phylogenetic relationships among marsupial frog genera (Anura: Hylidae: Hemiphractinae) based on evidence from morphology and natural history. Zoological Journal of the Linnean Society, 128, 125–148.

TWO NEW SPECIES OF GASTROTHECA Zootaxa 3437 © 2012 Magnolia Press · 21 Miranda-Ribeiro, A. (1920) As Hyla coelonotas do Museu Paulista. Revista do Museu Paulista, 12, 323–328. Moura, M.R., Motta, A.P., Fernandes, V.D. & Feio, R.N. (2012) Herpetofauna da Serra do Brigadeiro, um remanescente de Mata Atlântica em Minas Gerais, Sudeste do Brasil. Biota Neotropica, 12, 1–27. Pimenta, B.V.S., Napoli, M.F. & Haddad, C.F.B. (2009) A new species of casque-headed tree frog, genus Aparasphenodon Miranda-Ribeiro (Amphibia: Anura: Hylidae), from the Atlantic Rainforest of southern Bahia, Brazil. Zootaxa, 2009, 46–54. Posada, D. (2008) jModelTest: Phylogenetic Model Averaging. Molecular Biology and Evolution, 25, 1253–1256. Pyron, R.A. & Wiens, J.J. (2011) A large-scale phylogeny of Amphibia including over 2800 species, and a revised classification of extant frogs, salamanders, and caecilians. Molecular Phylogenetics and Evolution, 61, 543–583. Sachsse, R., Izecksohn, E. & de Carvalho-e-Silva, S.P. (1999) The systematic status of Hyla albolineata Lutz and Lutz, 1939 (Amphibia : Anura : Hylidae). Herpetologica, 55, 401–406. Santos, S.P.L. & Santos, E.M. (2009) Gastrotheca pulchra. Herpetological Review, 40, 445. Savage, J.M. & Heyer, W.R. (1997) Digital webbing formulae for anurans: a refinement. Herpetological Review, 28, 131. Siqueira, C.C., Vrcibradic, D., Dorigo, T.A. & Rocha, C.F.D. (2011) Anurans from two high-elevation areas of Atlantic Forest in the state of Rio de Janeiro, Brazil. Zoologia, 28, 457–464. SpeciesLink. (2011) Rede SpeciesLink. Centro de Referência em Informação Ambiental (CRIA), Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP). Available from: http://www.splink.org.br/ (6 January 2012). Wiens, J.J., Fetzner, J.W., Parkinson, C.L. & Reeder, T.W. (2005) Hylid frog phylogeny and sampling strategies for speciose clades. Systematic Biology, 54, 778–807. Wiens, J.J., Kuczynski, C.A., Duellman, W.E. & Reeder, T.W. (2007) Loss and re-evolution of complex life cycles in marsupial frogs: Does ancestral trait reconstruction mislead? Evolution, 61, 1886–1899.

APPENDIX I

Gastrotheca ernestoi—BRAZIL: SÃO PAULO: São José do Barreiro, Campo de Fruticultura MZUSP 139365. Gastrotheca fissipes—BRAZIL: PERNAMBUCO: Recife, Mata Dois Irmãos MZUSP 101626. ALAGOAS: Fleixeiras, Fazenda Areado MUFAL 1898. Maceió, Mata do Catolé MUFAL 2331, MUFAL 4666. Maceió, Serra da Saudinha MUFAL 4804. Gastrotheca fulvorufa—BRAZIL: RIO DE JANEIRO: Teresópolis, Alto do Soberbo MZUSP 53394. Gastrotheca megacephala—BRAZIL: BAHIA: Maraú MZUSP 101735; Cumuruxatiba, Fazenda Imbaçuaba MZUSP 59434, 63078. ESPÍRITO SANTO: Santa Teresa MZUSP 126102. Gastrotheca pulchra—BRAZIL: BAHIA: Porto Seguro, Reserva Biológica de Pau Brasil (CEPLAC) MZUSP 85970 (holotype).

APPENDIX II

List of sequenced individuals and genes. Sequences for the gene cryBA are provided in the Appendix III, all others are available on GenBank. BA = Bahia; EEEWG = Estação Ecológica Estadual de Wenceslau Guimarães; RPPNSB = Reserva Particular do Patrimonio Natural Serra Bonita, (15°23'16.15"S, 39°33'45.82"W); MG = Minas Gerais; RBME = Reserva Biológica da Mata Escura. Usina Colonia, Jaqueira municipality (8°43'21"S, 35°50'44"W).

Species ID Locality ND1 cmyc SIA Rhod 12s G. pulchra 16228 RPPNSB, BA - JX262898 JX262914 JX262907 JX262894 G. recava sp. nov. 22079 EEEWG, BA JX262921 JX262903 JX262919 JX262910 JX262890 G. recava sp. nov. 22049 EEEWG, BA JX262920 JX262902 JX262918 - JX262889 G. prasina sp. nov. 17460 RBME, MG JX262923 JX262900 JX262916 JX262909 JX262892 G. prasina sp. nov. 17261 RBME, MG JX262924 JX262901 JX262917 - JX262893 G. prasina sp. nov. 17248 RBME, MG JX262922 JX262899 JX262915 JX262908 JX262891 G. fissipes 131 Jaqueira, PE JX262926 JX262896 JX262912 JX262905 - G. fissipes 114 Jaqueira, PE JX262925 JX262895 JX262911 JX262904 - G. fissipes 505 Jaqueira, PE JX262927 JX262897 JX262913 JX262906 -

Nucleotide sequences of cryBa nuclear gene, used in this study. Specimen identification are presented in Appendix II.

G. fissipes (131): AATTTCAGTTGGAAAAGTCAGATAACCACAAAACTACACAAAGTTTCAAGAAGAAATCCACTATGA CATACCATGCCATCTCTATTGGCTAATGACATTTTTTACAAAATATCTATATAGACATTTTGCCCAAT TTTTTTGCACTTACAGCAGAACAGATTGGGCGGAAAGACATCA

G. fissipes (114): AATTTCAGTTGGAAAAGTCAGATAACCACAAAACTACACAAAGTTTCAAGAAGAAATCCACTATGA CATACCATGCCATCTCTATTGGCTAATGACATTTTTTACAAAATATCTATATAGACATTTTGCCCAAT TTTTTTGCACTTACAGCAGAACAGATTGGGCGGAAAGACATCA

G. fissipes (505): AATTTCAGTTGGAAAAGTCAGATAACCACAAAACTACACAAAGTTTCAAGAAGAAATCCACTATGA CATACCATGCCATCTCTATTGGCTAATGACATTTTTTACAAAATATCTATATAGACATTTTGCCCAAT TTTTTTGCACTTACAGCAGAACAGATTGGGCGGAAAGACATCA

G. pulchra (16228): AACTTCAATTGTAATAGGCAGATAACCACAAAACTACACAAAGTTTCAAAAAGAAATCCACTATGA TATTTCTATAGACTAATGCCATTTTTTCTCAAAATATCTATTTAGTTTTGCCCACTTTTTTGCACTTAC AGCAGAACAGATTGGGCGGAAAGACATCA

G. prasina sp. nov. (17248): AATTTCATTTGTAAAAGTCAGATAACCACAAAACTACACAAAGTTTCAAGAAGAAATCCACTATGAC ATACCATGCTATCTCTATTGGCTAATGACATTTTTTACAAAATATATATACTCTTTGCCCACTTTTTTG CACTTACAGCAGAACAGATTGGGCGGAAAGACATCA

G. prasina sp. nov. (17460): AATTTCATTTGTAAAAGTCAGATAACCACAAAACTACACAAAGTTTCAAGAAGAAATCCACTATGAC ATACCATGCTATCTCTATTGGCTAATGACATTTTTTACAAAATATATATACTCTTTGCCCACTTTTTTG CACTTACAGCAGAACAGATTGGGCGGAAAGACATCA

G. prasina sp. nov. (17461): AATTTCATTTGTAAAAGTCAGATAACCACAAAACTACACAAAGTTTCAAGAAGAAATCCACTATGAC ATACCATGCTATCTCTATTGGCTAATGACATTTTTTACAAAATATATATACTCTTTGCCCACTTTTTTG CACTTACAGCAGAACAGATTGGGCGGAAAGACATCA

G. recava sp. nov. (22049): AATTTCAATTGTAAAAGTCAGATAACCACAAAACTACACAAAGTTTCAAGAAGAAATCCACTATAA CATACCATGCCATCTCTATTGGCTAATGACATATTTTACAAAATATCTATATAGACTTTTTGCCCAAT TTTTTTGCACTTACAGCAGAACAGATTGGGCGGAAAGACATCA

G. recava sp. nov. (22079): AATTTCAATTGTAAAAGTCAGATAACCACAAAACTACACAAAGTTTCAAGAAGAAATCCACTATAACA TACCATGCCATCTCTATTGGCTAATGACATATTTTACAAAATATCTATATAGACTTTTTGCCCAATTTTTTT GCACTTACAGCAGAACAGATTGGGCGGAAAGACATCA