ACTIVE GASDERMIN D FORMS PLASMA MEMBRANE PORES AND
DISRUPTS INTRACELLULAR COMPARTMENTS TO EXECUTE
PYROPTOTIC DEATH IN MACROPHAGES DURING CANONICAL
INFLAMMASOME ACTIVATION
by
HANA RUSSO
Submitted in partial fulfillment of the requirements for the degree of
Doctor of Philosophy
Dissertation Advisor: George R. Dubyak, Ph.D.
Department of Pathology
Immunology Training Program
CASE WESTERN RESERVE UNIVERSITY
August, 2017
CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
Hana Russo
candidate for the degree of Doctor of Philosophy
Alan Levine (Committee Chair)
Clifford Harding
Pamela Wearsch
Carlos Subauste
Clive Hamlin
George Dubyak
Date of Defense
April 26, 2017
We also certify that written approval has been obtained for any proprietary
material contained therein.
Table of Contents
List of Figures iv
List of Tables vii
List of Abbreviations viii
Acknowledgements xii
Abstract 1
Chapter 1: Introduction
1.1: Clinical relevance of pyroptosis 4
1.2: Pyroptosis requires inflammasome activation 4
1.2a: Non-canonical inflammasome complex 6
1.2b: Canonical inflammasome complexes 6
1.3: Role of pyroptosis in host defense and disease 13
1.4: N-terminal Gsdmd constitutes the pyroptotic pore 15
1.5: IL-1β biology and mechanism of release 19
1.6: Cell type specificity of pyroptosis 25
1.7: The gasdermin family 26
1.8: Apoptotic signaling during inflammasome activation in the absence of
caspase-1 or Gsdmd 28
1.9: NLRP3 inflammasome-mediated organelle dysfunction 29
1.10: Objective of Dissertation Research 31
i Chapter 2: Active caspase-1 induces plasma membrane pores that precede
pyroptotic lysis and are blocked by lanthanides
Abstract 33
Introduction 35
Materials and Methods 39
Results 46
Discussion 78
Chapter 3: Active Gasdermin D mediates ROS-dependent pyroptotic death
signaling during NLRP3 inflammasome activation
Abstract 89
Introduction 91
Materials and Methods 95
Results 101
Discussion 128
Chapter 4: Future Directions
Research Summary 138
4.1: Gsdmd-mediated regulation of IL-1β release 140
4.2: Role of Gsdmd in IL-1β-mediated pathology 144
4.3: Mechanism by which lanthanides suppress pyroptosis and promote
redox homeostasis during inflammasome activation 148
ii 4.4: Active Gsdmd-mediated organelle dysfunction independent of its
plasma membrane pore function 151
4.4a: Mitochondria 153
4.4b: Lysosome 155
4.4c: Peroxisome 156
4.4d: Endoplasmic Reticulum 157
4.5: Mechanism of glycine cytoprotection during pyroptotic signaling 158
Concluding Remarks 160
Copyright Release 161
Bibliography 162
iii List of Figures
Chapter 1
1.1: Canonical and non-canonical inflammasome complexes 5
1.2: N-terminal Gsdmd forms plasma membrane pores and induces
pyroptotic cell death 16
Chapter 2
2.1: A rapidly induced propidium influx is triggered downstream of
inflammasome activation but upstream of pyroptotic cell lysis 48
2.2: NLRP3 and Pyrin inflammasome activation licenses the opening of a
large, nonselective cation- and anion-permeable pyroptotic pore 52
2.3: Gsdmd is required for caspase-1 induction of both the prelytic pyroptotic
pores and subsequent pyroptotic lysis 56
2.4: Lanthanides coordinately suppress both the Gsdmd-dependent plasma
membrane permeability change and pyroptotic lysis induced by NLRP3
inflammasome activation in iBMDM 58
2.5: Lanthanides coordinately suppress both the caspase-1-dependent PM
permeability change and pyroptotic lysis induced by NLRP3 and Pyrin
inflammasome activation 60
2.6: Lanthanides delay the execution of pyroptotic cell death following
NLRP3 and Pyrin inflammasome activation and do not inhibit Pyrin
inflammasome activation 64
iv 2.7: Lanthanides do not block NLRP3 inflammasome activation or IL-1β
release, whereas Gsdmd deficiency also does not block NLRP3
inflammasome activation but does block IL-1β release 66
2.8: Lanthanides reversibly block the caspase-1-dependent pyroptotic pores
and suppress pyroptosis 71
2.9: Lanthanides exhibit more potent suppression of pyroptotic propidium
influx in the presence of glycine in a dose-dependent manner 72
2.10: Pannexin-1, P2X7R, and certain TRP channel family members are not
required for caspase-1-dependent pyroptotic pore induction 76
Chapter 3
3.1: The absence of Gsdmd promotes redox homeostasis and sustains
cellular bioenergetics during NLRP3 inflammasome activation 102
3.2: WT, Gsdmd-/-, and Nlrp3-/- iBMDMs have similar mitochondrial
superoxide generation profiles in the absence of stimulation or in
response to antimycin A 107
3.3: Extracellular lanthanum delays the perturbation in redox homeostasis
and decline in cellular bioenergetics during NLRP3 inflammasome
activation 110
3.4: Nigericin-induced changes in subcellular localization of Gsdmd is
similar in the presence or absence of lanthanum 111
3.5: Active Gsdmd-mediated perturbation in redox homeostasis contributes
to pyroptotic cell death signaling 114
v 3.6: Nigericin disrupts mitochondrial respiration independent of Gsdmd but
induces an early, rapid lysosomal disruption dependent on Gsdmd 120
3.7: Glycine promotes redox homeostasis but does not maintain cellular
bioenergetics during NLRP3 inflammasome activation 126
Chapter 4
4.1: Murine BMDMs undergo pyroptosis in the presence of punicalagin in
response to nigericin stimulation 143
4.2: FlaTox induces a rapid and robust propidium influx 152
vi List of Tables
Chapter 2
2.1: Physical properties of lanthanides and various DNA-intercalating
cationic dyes 51
vii List of Abbreviations
ANT: Adenine nucleotide translocase
AIM2: Absent in Melanoma 2
ASC: Apoptosis-associated speck-like protein containing a CARD
BMDC: Bone marrow-derived dendritic cell
BMDM: Bone marrow-derived macrophage
BMN: Bone marrow-derived neutrophil
CAPS: Cryopyrinopathy-associated periodic syndrome
CARD: Caspase activation and recruitment domain
CINCA: Chronic infantile neurological, cutaneous and articular syndrome
COX2: Cyclooxygenase 2
DAMP: Danger-associated molecular pattern
DC: Dendritic cell
EM: Electron microscopy
ESCRT: Endosomal sorting complexes required for transport
EthD4+: Ethidium homodimer-2
FCAS: Familial cold auto-inflammatory syndrome
FIIND: Function to Find Domain
FMF: Familial Mediterranean Fever
Gbp: Guanylate binding protein
Gd3+: Gadolinium
Gsdmd: Gasdermin D
HMGB1: High mobility group box 1
viii iBMDM: immortalized bone marrow-derived macrophage
ICAD: Inhibitor of caspase-activated DNase
ICAM-1: Intercellular adhesion molecule-1
IFI16: Interferon inducible protein 16
IFNAR: Type 1 interferon receptor
IFNGR: IFNγ receptor
IL-1β: Interleukin-1β
IL-1AcP: IL-1 receptor accessory protein
IL-1R1: Type 1 IL-1 receptor
ILV: Intraluminal vesicle
IMM: Inner mitochondrial membrane iNOS: Inducible nitric oxide synthase
La3+: Lanthanum
LAMP-1: Lysosomal-associated membrane protein-1
LDH: Lactate Dehydrogenase
LIR: LC3-interacting region
LPS: lipopolysaccharide
MAC: Membrane attack complex
MBL: Mannose binding lectin
MCP-1: Monocyte chemoattractant protein 1
MPT: Mitochondrial permeability transition
MVB: Multivesicular body
MWS: Muckle-Wells syndrome
ix
NAC: N-acetylcysteine
NAIP: NLR family, apoptosis inhibitor protein
NEK7: NIMA-related kinase 7
NG: Nigericin
N-Gsdmd: N-terminal gasdermin D
NLRC4: NOD-like receptor containing a CARD Domain 4
NLRP1: NOD-like receptor containing a Pyrin Domain 1
NLRP3: NOD-like receptor containing a Pyrin Domain 3
OCR: Oxygen consumption rate
OMM: Outer mitochondrial membrane oxPAPC: 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine
PAMP: Pathogen-associated molecular pattern
Panx1: Pannexin-1
PARP-1: Poly-ADP ribose polymerase-1
PF: Perforin
PIT: Pore-induced intracellular trap
PM: Plasma membrane
Pro2+: Propidium2+
PRR: Pattern recognition receptor
PTPC: Permeability transition pore complex
PUN: Punicalagin
PYD: Pyrin Domain
RAGE: Receptor for advanced glycation end products
x
ROCK-1: Rho-effector kinase-1
ROS: Reactive Oxygen Species
TcdB: C. difficile toxin B
TLR: Toll-like receptor
TRIF: TIR-domain-containing adaptor-inducing interferon-β
T3SS: Type III secretion system
UBA: Ubiquitin-associated Domain
VDAC: Voltage-dependent anion channel
Wdr1: WD repeat-containing protein
xi Acknowledgements
I would first like to thank my thesis advisor, Dr. George Dubyak, for his
mentorship and support throughout my PhD. Also, thank you for giving me the
freedom to direct my project the way I wanted; it really helped me develop as an
independent scientist. I would like to thank all of my labmates for providing a supportive environment to share and discuss scientific ideas, which has helped me mature into a critically thinking scientist. I would also like to thank them and
my other friends I have met during this journey for their continual support and for
making graduate school a truly memorable experience. I would like to thank my
mom for cheering me on through every academic and personal hardship and my
dad for always pushing me to work hard in my academic and career pursuits. I
would not be here without you both. Finally, I would like to thank my husband
Cliff for his constant support and keeping me grounded throughout my PhD.
Thank you for giving me the clarity to pursue my passion for scientific research.
xii Active Gasdermin D Forms Plasma Membrane Pores and Disrupts
Intracellular Compartments to Execute Pyroptotic Death in Macrophages
During Canonical Inflammasome Activation
Abstract
by
HANA RUSSO
Pyroptosis is a regulated mode of lytic inflammatory cell death that promotes anti-microbial host defense but may contribute to sepsis. Pyroptosis requires canonical inflammasome assembly to mediate caspase-1 activation. Active caspase-1 cleaves gasdermin D (Gsdmd) to relieve an autoinhibitory interaction
between the N and C-termini enabling N-terminal Gsdmd (N-Gsdmd) to
oligomerize, insert into the plasma membrane (PM) as lytic pores, and execute
pyroptotic cell death. To further characterize N-Gsdmd-dependent changes in
plasma membrane (PM) permeability, we assayed propidium2+ (Pro2+) influx
kinetics during NLRP3/Pyrin inflammasome activation in murine bone marrow-
derived macrophages (BMDM). BMDM were characterized by rapid Pro2+ influx after initiation of NLRP3/Pyrin inflammasomes by nigericin (NG) or C. difficile toxin B (TcdB), respectively. No Pro2+ uptake in response to NG or TcdB was observed in Caspase-1-/- or ASC-/- BMDM. The cytoprotectant glycine profoundly
suppressed NG and TcdB-induced lysis but not Pro2+ influx. The absence of
Gsdmd expression resulted in suppression of NG-stimulated Pro2+ influx and
1 pyroptotic lysis. Extracellular La3+ and Gd3+ reversibly blocked the induced Pro2+ influx and markedly delayed pyroptotic lysis without limiting upstream inflammasome activation. These caspase-1-induced pre-lytic, N-Gsdmd PM pores also facilitated the efflux of cytosolic ATP and influx of extracellular Ca2+.
Whether N-Gsdmd also partitions into membranes of intracellular
organelles to facilitate pyroptotic cell death signaling remains undefined. We
stimulated WT, Gsdmd-/-, and Nlrp3-/- immortalized macrophages (iBMDMs) with
NG, and also used La3+ as an inhibitor of PM pyroptotic pore activity to
investigate the contribution of intracellular PM pore-independent perturbations to
active Gsdmd-mediated cell death. The absence of Gsdmd attenuated NG-
induced decreases in redox homeostasis. Inhibition of N-Gsdmd PM pore activity
with La3+ uncovered a ROS-driven component of pyroptotic cell death that could
be suppressed by the ROS scavenger N-acetylcysteine (NAC). NG perturbed
mitochondrial respiration independently of Gsdmd and NLRP3, but mediated
rapid lysosomal damage in a Gsdmd-dependent manner. These data suggest
that in a setting of suppressed PM pyroptotic pore activity, NG stimulation
induces an active Gsdmd-mediated and ROS-dependent death signaling
cascade. These studies highlight the potentially extensive scope of N-Gsdmd- mediated cellular dysregulation, which should be considered when developing therapies that target Gsdmd-mediated pyroptosis.
2
CHAPTER 1
INTRODUCTION
3 1.1: Clinical relevance of pyroptosis
Pyroptosis is a regulated mode of lytic cell death that culminates in the robust release of various inflammatory mediators which contributes to sepsis.
Sepsis is a systemic inflammatory response to infection and becomes severe sepsis when acute organ dysfunction occurs (1). In the United States, severe sepsis has an annual treated incidence of about 750,000 cases, an annual mortality of 215,000, and an annual cost of $16.7 billion (2). Current therapies have acted to target single inflammatory players, such as lipopolysaccharide
(LPS), a component of gram-negative bacterial membranes, or particular inflammatory cytokines, which have proven ineffective (1). Therefore, targeting pyroptotic cell death could have an enhanced therapeutic benefit by preventing the lytic release of many inflammatory mediators.
1.2: Pyroptosis requires inflammasome activation
Pyroptosis requires the activation of inflammatory caspases, which include caspase-1 and murine caspase-11 and its human orthologs caspase-4/5.
Activation of caspase-1 and caspase-11/4/5 requires the assembly and oligomerization of a canonical or non-canonical inflammasome complex, respectively (Fig 1.1). In addition to facilitating pyroptotic cell death, active caspase-1 also proteolytically processes the inflammatory cytokines IL-1β and IL-
18 into their mature forms.
4 Figure 1.1: Canonical and non-canonical inflammasome complexes
Inflammasomes are multiprotein complexes that assemble in response to microbial stimuli or host-derived danger signals. Canonical inflammasomes consist of a sensor protein (NLRP1b, NLRC4, AIM2/IFI16, and NLRP3), the adaptor protein ASC, and pro-caspase-1. NLRC4 and murine NLRP1b inflammasomes can assemble in the presence or absence of ASC. A non- canonical inflammasome is activated in response to cytosolic LPS binding to pro- caspase-11. The assembly of these complexes results in autocatalytic processing of pro-caspase-1/11. Active caspase-1/11 induces pyroptotic cell death. Caspase-11 can also facilitate secondary NLRP3 inflammasome activation, and caspase-1 additionally generates mature IL-1β and IL-18 for non- classical export. (Ine Jorgensen and Edward A Miao, Immunological Reviews, 2015). Reprint permission obtained from the publisher.
5 1.2a: Non-canonical inflammasome complex
Activation of caspase-11 requires the assembly of a non-canonical
inflammasome complex, which forms in response to the cytosolic delivery of LPS
(Fig. 1.1) (3, 4). The upregulation of pro-caspase-11 is necessary prior to the assembly of a non-canonical inflammasome (5). Caspase-11 priming involves
either toll-like receptor (TLR) signaling through the adaptor protein TRIF (TIR- domain-containing adaptor-inducing interferon-β) to upregulate type 1 interferon
(IFN) followed by type 1 IFN receptor (IFNAR) signaling or IFN-γ receptor
(IFNGR) signaling (6-9). Binding of the CARD domain of pro-caspase-11/4/5 to the lipid A portion of LPS mediates its oligomerization and proximity-induced autocatalytic cleavage to form active caspase-11/4/5 (10). Type 1 IFN-induced guanylate binding proteins (Gbp) promote non-canonical inflammasome activation in response to phagosomal gram-negative bacterial infections (11, 12).
Gbp destabilize intracellular vacuolar membranes resulting in the cytosolic accumulation and detection of these gram-negative bacteria by the non- canonical inflammasome (12, 13). Pilla et al. also demonstrated a role for Gbp downstream of phagosomal disruption in promoting non-canonical inflammasome activation (11).
1.2b: Canonical inflammasome complexes
Canonical inflammasome complexes are commonly composed of a sensor
protein (which includes members of the Nod-like receptor family (NLRP1
(human), NLRP1a/b (mouse), NLRP3, and NLRC4), AIM2, IFI16, and Pyrin), the
6 adaptor protein ASC (apoptosis-associated speck-like protein containing a
CARD), and pro-caspase-1 (Fig. 1.1) (14). In an unstimulated state, these intracellular sensor proteins exist in an autoinhibited conformation (15). In response to a wide variety of stimuli that include microbial components and host- derived danger-associated molecular patterns (DAMPs), these sensor proteins adopt an active conformation. Those containing a pyrin domain (PYD) interact with the PYD of ASC, which then through its CARD domain interacts with pro-
caspase-1 (14). In ASC-containing inflammasome complexes, the activated
sensor protein nucleates the polymerization of ASC into prion-like filaments that
recruit pro-caspase-1 to enable its autocatalytic cleavage and activation and
subsequent proteolytic processing and maturation of IL-1β and IL-18 (16, 17).
Fully processed caspase-1 exists as two heterodimers composed of a 20 kDa
and 10 kDa subunit. This polymerized inflammasome structure is commonly
called an ASC speck.
NLRP1
Murine NLRP1 consists of three paralogs, Nlrp1a/b/c (18). Human NLRP1
contains a PYD, where as Nlrp1a/b/c do not (19). The Nlrp1b inflammasome is
activated in response to anthrax lethal toxin (LT) from Bacillus anthracis and
Toxoplasma gondii (5). LT-induced cleavage within the N-terminal domain of
Nlrp1b (20) and autoproteolytic processing of Nlrp1b’s function to find domain
(FIIND) mediate inflammasome activation (21). During LT stimulation, despite
ASC being required for proteolytic processing of caspase-1, unprocessed
7 caspase-1 within an Nlrp1b inflammasome can efficiently generate mature IL-1β
and induce pyroptosis in the absence of ASC (22). In humans the presence of
ASC and autoproteolytic processing of NLRP1 within the FIIND is necessary for
inflammasome activation (23).
NLRC4
The NLRC4 inflammasome is composed of an NLR family, apoptosis inhibitor protein (NAIP: NAIP in humans and Naip1-7 in mice), NLRC4, and pro- caspase-1 (18). Also, an ASC-independent and ASC-containing NLRC4
inflammasome complex can form (24, 25). An ASC-containing NLRC4
inflammasome is important for effective IL-1β processing (26). NLRC4
inflammasome complex assembly first requires secretion system activity from
phagosome-contained pathogenic bacteria to enable the cytosolic entry of
flagellin or rod/needle proteins of the type III secretion system (T3SS), which are
detected by cytosolic NAIPs (5). Specifically, Naip1 binds the T3SS needle
protein, Naip2 binds the T3SS rod protein, Naip5/6 binds flagellin, and human
NAIP binds the T3SS needle protein to become activated (18). Active NAIPs then
interact with NLRC4 to promote subsequent inflammasome complex assembly
(18). Relevant infectious intracellular bacteria that activate the NLRC4
inflammasome include Salmonella typhimurium, Legionella pneumophila, and
Listeria monocytogenes (5).
8 AIM2/IFI16
The AIM2 inflammasome contains AIM2, ASC, and pro-caspase-1 (18).
Cytosolic double-stranded DNA (dsDNA) binds to the HIN-200 domain on AIM2 and induces complex assembly and activation (27). Pathogenic dsDNA from the cytosol-invasive bacteria Francisella tularensis and Listeria monocytogenes and from cytomegalovirus and vaccinia virus activate the AIM2 inflammasome (18).
Recently, ionizing radiation-induced DNA damage has been identified as a relevant AIM2 inflammasome activator in intestinal epithelial cells and bone marrow-derived macrophages (28).
The human IFI16 inflammasome complex localizes in the nucleus, detects viral DNA, and consists of IFI16, ASC, and pro-caspase-1 (14, 18). dsDNA from
Kaposi Sarcoma-associated herpesvirus and incomplete reverse viral DNA transcripts from non-productively HIV-infected CD4+ T cells bind to the HIN-200 domain on IFI16 to trigger inflammasome complex assembly (29, 30).
Pyrin
The Pyrin inflammasome is composed of Pyrin, ASC, and pro-caspase-1 and is activated in response to bacterial toxins, such as Clostridium difficile toxin
B (TcdB) and Clostridium botulinum C3 toxin, and bacterial effector proteins
(IbpA from Histophilus somni and VopS from Vibrio parahaemolyticus) (14, 31).
Specifically, TcdB is one of the main virulence factors involved in the pathogenesis of C. difficile bacterial infections (32, 33), a major cause of hospital- acquired, antibiotic-associated infectious diarrhea (34, 35). TcdB-induced Pyrin
9 inflammasome activation requires effective cytosolic accumulation of the toxin.
TcdB contains four domains: a C-terminal cell receptor binding domain, a pore-
forming domain, a glucosyltransferase domain, and a cysteine protease domain
(36). To internalize TcdB, it is first endocytosed in response to cell surface
receptor binding (36). Endosomal acidification causes a conformational change
TcdB enabling its pore-forming domain to insert into the endosomal membrane
and facilitate translocation of the toxin into the cytosol (36). Within the cytosol,
the cysteine protease portion of TcdB cleaves and frees the glucosyltransferase
region to glucosylate and inactivate Rho-GTPases (36). Rho-GTPase activity is
required to maintain proper actin cytoskeletal dynamics. Next Pyrin senses a
downstream consequence of Rho-GTPase inactivation (perhaps sensing perturbations in the cytoskeletal framework) to trigger Pyrin inflammasome assembly in macrophages (31). Mice homozygous for a hypomorphic allele of
Wdr1 (WD repeat-containing protein) have impaired actin dynamics and autoinflammation that depends on Pyrin inflammasome activation in monocytes
(37). Pyrin inflammsome activation is suppressed by inhibiting actin polymerization (37), further suggesting that Pyrin senses a disrupted actin cytoskeleton.
NLRP3
The NLRP3 inflammasome assembles in response to a diverse range of stimuli, which encompasses both microbial pathogen-associated molecular patterns (PAMPs) and sterile DAMPs. Some examples of these include ATP,
10 bacterial toxins, bacterial RNA, dsRNA, and particulate stimuli (uric acid crystals, asbestos, silica, and aluminum salts) (18, 38-40). This canonical inflammasome consists of NLRP3, ASC, and pro-caspase-1 (18). Recently, NEK7 (NIMA-related kinase 7) was identified as a critical mediator of NLRP3 inflammasome activation
(41-43). NEK7 is a component of the NLRP3 inflammasome complex and facilitates NLRP3 oligomerization (41). Maximal NLRP3 inflammasome activation requires upregulation of the sensor protein NLRP3, which can be achieved by
TLR, TNF-receptor, or IL-1-receptor signaling (18). Multiple mechanisms downstream of stimulating with an NLRP3 inflammasome agonist have been proposed to mediate complex assembly: 1) a decrease in cytosolic [K+], 2)
lysosomal destabilization, and 3) mitochondrial dysregulation (14).
Many NLRP3 inflammasome stimuli converge on K+ efflux as a common
trigger for inflammasome complex assembly. Núñez and colleagues
demonstrated that bacterial toxins, ATP, and particulate stimuli require K+ efflux
to induce NLRP3 inflammasome activation (44). In particular, nigericin (NG) is a
bacterial ionophore which functions as a K+/H+ exchanger after insertion in the
plasma membrane (PM) and organellar membranes. Insertion of NG into the PM causes a decrease in cytosolic [K+] followed by inflammasome complex
assembly (44, 45). Also, dsRNA-induced NLRP3 inflammasome activation
depends on K+ efflux (40). Secondary NLRP3 inflammasome activation downstream of non-canonical inflammasome signaling requires K+ efflux (46, 47).
In response to particulate matter, lysosomal disruption converges on K+
efflux to trigger NLRP3 inflammasome complex assembly (44). Multiple
11 lysosomal cathepsins released into the cytosol in response to lysosomal
membrane permeabilization are redundantly involved in both the upregulation of
pro-IL-1β and in NLRP3 inflammasome-dependent IL-1β maturation (48).
Phagosomal NADPH oxidase-dependent ROS generation has been implicated in
asbestos-mediated NLRP3 inflammasome activation (49), but has been
demonstrated as dispensable for monosodium urate (MSU) crystal and silica-
induced inflammasome assembly (50).
Under certain contexts an NLRP3-containing inflammasome can
assemble independently of K+ efflux. LPS stimulation alone in human monocytes
engages an NLRP3-containing, alternative inflammasome pathway that is
activated independently of K+ efflux, does not form an ASC speck, and enables the processing and release of IL-1β in the absence of pyroptosis (51). Also, the small nucleoside-analog imiquimod independently of K+ efflux induces NLRP3
inflammasome activation that is dependent on enhanced oxidative stress partly
due to imiquimod’s inhibition of Complex I of the electron transport chain (52).
There is dispute over whether mitochondrial dysfunction is a necessary
signal for NLRP3 inflammasome activation. Mitochondrial damage signals, like
exposed cardiolipin (53), ROS (54-56), and oxidized mitochondrial DNA bound to
NLRP3 (57) promote NLRP3 inflammasome activation. Núñez and colleagues
demonstrated that ROS production is not sufficient for, nor does the presence of
ROS scavengers in response to bacterial pore-forming toxins limit, NLRP3
inflammasome activity (44).
12 1.3: Role of pyroptosis in host defense and disease
Pyroptosis provides an effective innate immune defense mechanism
against intracellular bacterial infections (58-61). It enables the removal of these
bacteria from their replicative niche within macrophages and subsequent
detection and clearance by recruited neutrophils (58, 61). Miao et al. specifically
demonstrated that a strain of Salmonella typhimurium that persistently expresses
flagellin, Legionella pneumophila, and Burkholderia thailandensis are detected by
inflammasome complexes (58). The effective clearance of these bacteria
requires pyroptotic cell death but not the production of mature IL-1β or IL-18 (58).
Jorgensen et al. have provided recent insight that live bacteria remain trapped
within pyroptotic macrophage corpses, termed pore-induced intracellular traps
(PITs) (61). Complement then mediates neutrophil recruitment to PITs and
scavenger receptors on neutrophils in part contribute to the engulfment and
subsequent clearance of bacteria (61).
When host cell pyroptosis becomes uncontrolled, it may contribute to
sepsis and septic shock. Sepsis is a systemic inflammatory response to infection
and becomes severe sepsis when acute organ dysfunction occurs (1). Ultimately,
sepsis can progress to septic shock, which presents as hypotension that is
refractory to fluid resuscitation and/or hyperlactatemia (1). The pathogenesis of
sepsis involves pathogen detection by pattern recognition receptors (PRR) on
host cells, which promotes innate immune cell activation and lytic cell death (1).
A resulting exaggerated systemic inflammatory state causes vasodilation and
increased vascular permeability leading to organ hypoperfusion and shock (1).
13 Vance and colleagues reported that NLRC4 inflammasome-induced
pyroptosis in response to the rapid cytosolic delivery of flagellin involved Ca2+ influx and massive eicosanoid biosynthesis and release, which led to an enhanced vascular permeability and septic shock in mice (62). Septic shock in these mice critically depended on caspase-1-mediated eicosanoid biosynthesis and release, but not on mature IL-1β or IL-18 production (62). In addition caspase-11-dependent pyroptosis mediates LPS-induced lethal sepsis in mice
(3, 4, 63). Notably, Hagar et al. reported that inhibition of eicosanoid biosynthesis protected against LPS-induced lethal sepsis in mice (3). These studies depict inflammasome-dependent eicosanoid biosynthesis and release as a common inflammatory mediator of caspase-1 and caspase-11-induced septic shock.
In the context of chronic inflammatory conditions, pyroptosis provides a mode of ASC speck release, which is an active, canonical inflammasome complex that contains the polymerized adaptor protein ASC (64). These ASC specks enable continued extracellular processing of IL-1β and propagate inflammasome activation following their internalization by phagocytes (64).
Furthermore, patients with autoimmune disease that were positive for anti- nuclear antibodies contained autoantibodies against ASC (64). In this setting, opsonization of extracellular ASC specks by anti-ASC may facilitate phagocytic uptake and potentiate inflammation (64).
During HIV infection, incomplete reverse transcription of viral RNA to DNA from non-productively infected CD4+ T cells within lymphoid tissues can be
14 recognized by the IFI16 inflammasome (30). The resulting pyroptotic cell death causes massive CD4+ T cell loss and chronic inflammation (65).
A germline gain of function mutation in Nlrp1a contributes to
hematopoietic progenitor cell pyroptosis, an enhanced inflammatory state
mediated by IL-1β, and a compromised immune system in mice (66).
Interestingly, a recent report characterized the clinical relevance of
pyroptosis in bone marrow and gastrointestinal (GI) tract damage in response to
ionizing radiation and chemotherapy, which are common cancer therapies (28).
Ionizing radiation and chemotherapeutic agents induce double-stranded DNA
breaks, which trigger AIM2 inflammasome driven pyroptosis in intestinal epithelial
cells and bone marrow-derived macrophages (28).
1.4: N-terminal Gsdmd constitutes the pyroptotic pore
Gasdermin D (Gsdmd) was recently identified as a downstream substrate
of caspase-1/11/4/5 that is sufficient to execute pyroptotic cell death (Fig. 1.2)
(67, 68). Full-length Gsdmd (53kDa) contains 487 amino acids and is a soluble,
cytosolic protein that is constitutively expressed (68). Active caspase-1 and
11/4/5 cleave full-length Gsdmd at aspartate residue 275 in humans and 276 in
mice, which relieves the autoinhibitory interaction between the N- and C-termini
(67). Caspase-1-induced Gsdmd cleavage requires caspase-1 recruitment into
active inflammasomes but not full processing of caspase-1 (69); this is consistent
with an earlier study demonstrating that partially cleaved caspase-1 efficiently
mediates NLRC4 inflammasome-dependent pyroptosis (26).
15 Figure 1.2: N-terminal Gsdmd forms plasma membrane pores and induces pyroptotic cell death
Active inflammatory caspases-1/11/4/5 cleave Gsdmd relieving the autoinhibitory interaction between the N- and C-termini. N-terminal Gsdmd oligomerizes and binds to inner leaflet plasma membrane phospholipids to form pores. This active Gsdmd pore disrupts ion homeostasis and results in osmotic swelling and lysis. Released N-terminal Gsdmd can bind to bacterial cell membranes and may function as an extracellular bactericidal. (Moritz M Gaidt and Veit Hornung, The EMBO Journal, 2016). Reprint permission obtained from the publisher.
16 Removal of the C-terminus (22kDa) exposes four basic residues (RKRR) on cleaved, N-terminal Gsdmd (31kDa) that are responsible for its oligomerization and binding to inner leaflet PM phospholipids, including phosphatidylinositols and phosphatidylserine (70, 71). In addition Cys39 and
Cys192 form intramolecular or intermolecular disulfide bonds that are required for
N-terminal Gsdmd (N-Gsdmd) oligomerization (71). Current studies clarifying the architecture of N-Gsdmd-containing pores have utilized synthetic liposomes and liposomes derived from either bacterial or bovine liver lipid membranes (70-73).
Insertion of N-Gsdmd leads to the formation of arcs, slits, and ring-shaped pores within E. coli polar lipid-derived liposomes (73). The diameter of Gsdmd-
containing pores are about 15 nm within phosphatidylserine liposomes (71), 2-20
nm within cardiolipin liposomes (70), and 10-40 nm within E. coli polar lipid-
containing liposomes (73), potentially permitting the direct permeation of
appropriately sized cytosolic inflammatory mediators.
The heterogeneity of the N-Gsdmd PM pore diameter and shape is
analogous to the membrane attack complex (MAC) and perforin (PF). MAC consists of complement proteins (C5b, C6, C7, C8, C9n) that assemble pores on
bacterial membranes to induce bacterial lysis (74). PF forms pores within its
target cell PM following its release from cytotoxic T cell and NK cell granules
(74). These pore-forming complexes can exist in both a ring-shaped,
proteinaceous pore conformation or an arc-shaped, proteolipidic pore
conformation (75). This stable arc-shaped proteolipidic pore is composed of an
oligomeric protein arc on one side and a toroidal arrangement of lipids (where
17 lipid headgroups adopt a positive membrane curvature that is perpendicular to
the membrane plane and appears donut shaped) on the other side (75). Because
of the heterogeneous shape of these pore-forming complexes, MAC and PF vary
in their effective pore size (75). For example, PF can permit the permeation of
molecules that range from 3-70 kDa (75).
Notably, extracellular N-Gsdmd cannot disrupt eukaryotic host cell
membranes because the outer leaflet of the PM bilayer lacks the appropriate
phospholipid composition (70). However, extracellular N-Gsdmd can disrupt
bacterial cell membranes because it can strongly bind to cardiolipin (70, 71),
suggesting a potential bactericidal role for externalized N-Gsdmd. In addition, Liu et al. demonstrated that cells infected with L. monocytogenes and concurrently expressing active Gsdmd are characterized by a reduced intracellular bacterial burden (71). The absence of Gsdmd also protects against LPS-induced lethal sepsis in mice (68).
Formation of N-Gsdmd PM pores causes a perturbation in ion homeostasis. A rapid flux of osmotically active ions (Na+, K+, Cl-) leads to cell
swelling and lysis (5). In addition caspase-1-dependent Ca2+ influx in tissue-
resident macrophages triggers eicosanoid biosynthesis, which enhances
vascular permeability and leukocyte recruitment (62). DNA fragmentation occurs
during pyroptotic signaling but is not required for the execution of pyroptotic cell
death (76).
Pyroptotic cell lysis causes a massive release of potent inflammatory
mediators, which include ATP, HMGB1, IL-1β, IL-18, and eicosanoids.
18 Extracelluar ATP binds to the P2X7 receptor (P2X7R) on innate immune cells to
further propagate NLRP3 inflammasome activation (77) and promote leukocyte
chemotaxis (78). In addition to HMGB1 promoting inflammation by engaging
RAGE (receptor for advanced glycation end products) and TLRs, HMGB1
endocytosis has also been implicated in promoting pyroptosis in macrophages
(79). In general IL-18 activates TH1 and NK cells and induces their production of
IFNγ (80).
1.5: IL-1β biology and mechanism of release
Interleukin-1β (IL-1β) is an important inflammatory cytokine that promotes
antimicrobial immunity. During the innate immune response, IL-1β induces
inflammation. IL-1β binds to the type 1 IL-1R (IL-1R1), which then associates
with the IL-1 receptor accessory protein (IL-1AcP) (81, 82). Association of the
cytosolic Toll- and IL-1R (TIR) domains leads to the recruitment of MyD88 (82).
IRAK4 binds to MyD88 and autophosphorylates (82). IRAK4 then phosphorylates
IRAK-1 and IRAK-2, which facilitates the recruitment of TRAF6 (82). Further downstream signaling leads to the activation of NFκB, which translocates into the nucleus and leads to the transcription of IL-6, IL-8, monocyte chemoattractant protein 1 (MCP-1) and cyclooxygenase 2 (COX2), which are important inflammatory mediators in innate immunity (82). IL-6 induces the production of acute phase proteins from the liver, like C-reactive protein and mannose binding lectin (MBL), which function as opsonins and activators of complement. IL-8 attracts neutrophils and MCP-1 attracts monocytes to promote inflammation.
19 COX2 activation leads to the production of inflammatory lipid mediators like
prostaglandins, which increase vascular permeability and induce fever. IL-1β also increases the production of adhesion molecules to facilitate leukocyte adhesion and trafficking to the site of injury or infection (83). IL-1β stimulates the production of inducible nitric oxide synthase (iNOS), which allows for the production of nitric oxide, an important mediator of vasodilation (83). IL-1β provides a bridge between innate and adaptive immunity because it promotes T cell co-stimulation (83). Specifically, IL-1 enhances the expansion of tumor antigen-specific CD8+ T cells and their cytotoxicity against tumor cells (84). IL-1
+ also promotes the polarization of CD4 T cells to the TH17 subset (85-87).
Prolonged IL-1β production and release can be detrimental to the host and
cause tissue damage. Elevated IL-1β levels are relevant in the pathogenesis of
various chronic inflammatory diseases that include: type 2 diabetes, atherosclerosis, rheumatoid arthritis, multiple sclerosis, and autoinflammatory diseases, like familial Mediterranean fever (FMF) and cryopyrinopathy- associated periodic syndrome (CAPS) (88, 89).
Active caspase-1 is required to process pro-IL-1β into its mature form. IL-
1β lacks a signal peptide sequence, so it does not undergo conventional secretion, which involves the translocation of a protein containing a signal peptide sequence into the lumen of the endoplasmic reticulum (ER), packaging into cargo-containing coat protein complex II (COPII)-coated vesicles for transport to the golgi apparatus for further processing, and then transport to the plasma membrane for release (90). Inhibition of ER-golgi transport using
20 brefeldin A did not inhibit IL-1β export (91), suggesting that IL-1β undergoes an unconventional mode of release.
In a cell that undergoes pyroptotic death, IL-1β has a distinct nonlytic (92,
93) and eventual lytic (92, 94, 95) mode of release. In this setting, Gsdmd is also required for maximal IL-1β release (67-69).
Under certain conditions, IL-1β can utilize an entirely non-lytic mode of export. Despite inflammasome-induced caspase-1 activation in bone marrow-
derived neutrophils (BMNs), they do not undergo pyroptosis (96, 97). Also, TLR4
signaling in human monocytes results in caspase-1 activation to promote IL-1β
processing and nonlytic release (51). Stimulating dendritic cells (DCs) with LPS
and oxidized phospholipids result in an NLRP3 inflammasome and non-canonical
inflammasome-dependent maturation and release of IL-1β in the absence of
pyroptotic cell death (98). LPS and oxidized phospholipids used as a vaccine
adjuvant improved T cell responsiveness, thus providing an example of how
conditions that support DC survival and nonlytic IL-1β release promote adaptive
immune responses (98).
Depending on cell type and the mode of inflammasome activation, IL-1β
may be released passively as a secondary consequence of pyroptotic cell lysis or
through incompletely defined nonlytic, nonclassical export pathways. Potential
routes of nonlytic IL-1β release include secretory lysosome exocytosis,
microvesicle shedding, multivesicular body (MVB) formation and fusion with the
PM to release IL-1β-containing exosomes, autophagy, and permeation of the N-
Gsdmd PM pore (70, 99, 100).
21 To utilize a secretory lysosome route of export, IL-1β was thought to be transported within secretory lysosomes and then released upon their fusion with the PM (101). Electron microscopy (EM) studies have demonstrated that IL-1β colocalizes with lysosomal-associated membrane protein-1 (LAMP-1) and cathepsin D, a protease within the lysosome, in an endolysosome-enriched fraction (101, 102). More specifically, IL-1β was contained primarily in late endosomes and early lysosomal structures (101). However, Qu et al. demonstrated that IL-1β release can be dissociated from lysosome exocytosis because its release still occurs in the absence of extracellular calcium but lysosome exocytosis does not (103). Bergsbaken et al. also found that in the context of Salmonella infection, IL-1β secretion occurs independently of lysosome exocytosis (104).
IL-1β can be released within microvesicles as a result of entrapment within evaginations of the PM, blebbing, and subsequent microvesicle shedding (100).
The size of microvesicles is heterogeneous, ranging from 100nm-1μm in diameter (105). They also contain a diverse set of membrane markers depending on what is present on the plasma membrane (105). Some relevant markers on microvesicles shed from macrophages and DCs include the P2X7R, phosphatidylserine exposed on the outer leaflet of the microvesicle membrane, major histocompatibility complex II (MHCII), and LAMP-1 (103, 105). The biogenesis of P2X7R-dependent microvesicles involves p38 and the activation of
Rho-effector kinase-1 (ROCK-1), which are involved in the cytoskeletal rearrangement necessary for microvesicle formation (105-107). Studies have
22 shown that ATP activation of the P2X7R leads to release of microvesicles that
contain IL-1β in human THP-1 monocytes (93), microglia (108), and human
dendritic cells (109). Studies have also found that P2X7R-dependent
microvesicle shedding can be dissociated from IL-1β release (92, 103, 106). For
example, inhibition of ROCK-1 prevents microvesicle shedding, but still enables
the release of IL-1β (106). Also, a similar amount of microvesicle release occurs
in the presence of ATP alone compared to LPS priming plus ATP stimulation,
whereas mature IL-1β can only be released in response to LPS priming plus ATP
stimulation (103).
Another potential mode of unconventional IL-1β export involves MVB
fusion with the plasma membrane to release IL-1β contained within exosomes.
These exosomes result from invaginations of endosomes which form intraluminal
vesicles (ILVs) within MVBs (110). Endosomal sorting complexes required for
transport (ESCRT) are important in MVB biogenesis (110). Upon MVB fusion
with the PM, exosomes with a diameter ranging from 40-100nm are released
(110). Important markers of exosomes include TSG101, an ESCRT protein, Alix,
a protein that associates with the ESCRT machinery, intercellular adhesion
molecule-1 (ICAM-1), phosphatidylserine, and various tetraspanins, like CD9,
CD63, CD81, and CD82, which may be involved in exosome biogenesis, sorting,
and intercellular communication (110-112). Exosomes containing MHCII were
shown to be released in an NLRP3 and ASC dependent manner, but
independently of caspase-1(113). Release of MHCII containing exosomes
correlated with IL-1β release, and sucrose density gradient experiments
23 demonstrated that IL-1β was contained within vesicles with a density similar to exosomes (113).
Previous studies have investigated the interplay between autophagy and inflammasome activation. Autophagy is a cellular quality control response to various environmental stressors, including nutrient deprivation, hypoxia, and infection (114, 115). It involves the sequestration of cytosolic components, including dysfunctional organelles, protein aggregates, and invading bacteria, into double membrane structures called autophagosomes, which contain LC3II, the lipidated form of LC3I (115, 116). Autophagosomes can non-selectively or selectively recruit cytosolic cargo (114). To selectively recruit cargo, an autophagic cargo receptor (i.e. p62, NBR1, NDP52, and optineurin) uses its LC3- interacting region (LIR) to bind to autophagosome membrane-associated LC3II and its ubiquitin-associated (UBA) domain to recruit ubiquitinated cargo (114). A damaged phagosome containing intracellular bacteria can be selectively recruited to an autophagosome because it has exposed glycans that recognize galectin-8, which binds to autophagic cargo receptor NDP52 (117). In addition
members of the TRIM family are autophagic cargo receptors that directly select
their cargo for the autophagosome (118). Cargo-loaded autophagosomes then fuse with lysosomes to degrade cytosolic contents, which provide energy and promote cell survival (114, 115). Autophagy has been shown to regulate inflammasome activation by targeting ubiquitinated inflammasome components
(119) and pro-IL-1β (120) for degradation, and by promoting the removal of ROS and mitochondrial DNA that are released from dysfunctional mitochondria (121).
24 Deficiency of autophagy proteins results in enhanced inflammasome activation and processing and release of IL-1β (121, 122). Autophagy has also been characterized as an important secretory pathway (116). Dupont et al. have demonstrated that the autophagy pathway in addition to its role in dampening inflammasome activation can promote the release of IL-1β (123). Recently,
mature IL-1β generated from the co-expression of pro-IL-1β and pro-caspase-1
in HEK293T cells was shown to utilize autophagy for nonclassical export, which
was further potentiated in response to a starvation stimulus (124). To mediate the secretion of free IL-1β, HSP90 facilitated the translocation of IL-1β into the intermembrane space between the double autophagic membrane instead of being trafficked to the autophagic vesicle lumen (124). A recent report by Deretic and colleagues demonstrated that in response to a lysosome-disrupting stimulus,
IL-1β is recruited to the autophagosome by the autophagy cargo receptor
TRIM16 for secretion that does not require autophagosome-lysosome fusion
(125).
1.6: Cell type specificity of pyroptosis
The majority of studies on pyroptosis have been performed in macrophages or dendritic cells (5). Pyroptosis also occurs in non-productively
HIV-infected CD4+ T cells (65). Even though inflammasome-induced caspase-1
activation occurs in BMNs, they do not undergo pyroptotic cell death (96, 97).
Also, LPS stimulation alone in human monocytes results in caspase-1 activation
that mediates IL-1β processing and release in the absence of pyroptosis (51).
25 Non-hematopoietic cells, such as keratinocytes, retinal pigment epithelial
(RPE) cells, lung epithelial cells, fibroblasts, endothelial cells, and intestinal
epithelial cells have been shown to generate active caspase-1 (28, 126-132).
The majority of these studies have focused on caspase-1-induced IL-1β production instead of whether these cells pyroptose. Feldmeyer et al. demonstrated that UVB irradiation induced caspase-1 activation and IL-1β release occurs via a non-lytic mechanism (131). In contrast human RPE cells undergo pyroptosis in response to lysosome disruption-mediated NLRP3 inflammasome activation (132). A recent report characterized AIM2 inflammasome-mediated pyroptosis in intestinal epithelial cells in response to ionizing radiation (28).
1.7: The gasdermin family
In humans, GSDMD is a member of the GSDM gene family, which also includes GSDMA, GSDMB, GSDMC, DFNA5, and DFNB59 (133). The murine genome consists of Gsdma1-3, Gsdmc1-4, Gsdmd, Dfna5h, and Dfnb59 (133).
DFNA5 and DFNB59 are highly expressed in the inner ear (134). The rest of the
GSDM and Gsdm genes are mostly expressed in skin and intestinal epithelial cells (133). In particular murine Gsdmd is highly expressed in the small intestine and spleen (133). Gsdmd-/- mice have normal intestinal morphology and
comparable intestinal epithelial cell type distribution to WT mice, suggesting that
Gsdmd is not involved in the differentiation and development of the GI tract
26 (135). Gsdmd is the only Gsdm family member protein that can be cleaved by
inflammatory caspase-1/11/4/5 (67).
Similar to Gsdmd, other Gsdm family members initially exist in an
autoinhibited state (67), and mutations that relieve the autoinhibitory interaction
between their N- and C-termini reveal the death effector function of their N-
terminal domains (70). Gain of function mutations in the C-terminus of Gsdma3
result in an inflammatory skin phenotype in mice, which involves epidermal
hyperplasia, aberrant hair follicle and epidermis differentiation, and hair loss
(133). These mutations relieve an autoinhibitory interaction between the N- and
C-termini (136). Exposed N-terminal Gsdma3 (N-Gsdma3) is recruited to the
mitochondria to disrupt mitochondrial function and promote epithelial cell death
(136). N-Gsdma3 binds to phosphatidylinositols and cardiolipin, like Gsdmd, and
forms pores within synthetic liposomes that contain either of these phospholipids and within liposomes derived from bovine liver lipid membranes (70). The inner diameter of Gsdma3-containing pores is 10-14 nm within cardiolipin liposomes
(70). Expression of the N-terminal domain of human Gsdma and Gsdmc also induces cell death (137). Gasdermin B (Gsdmb) can also be cleaved by effector caspases; however, cleavage is not required for its phospholipid binding property
(138).
Gain of function mutations in DFNA5, which cause skipping of exon 8 and
truncations in its C-termini, result in autosomal-dominant non-syndromic hearing
loss (134). Expression of a gain of function DFNA5 mutant and the N-terminal
domain of DFNA5 (Exon 2-7) induces cell death (139). Recently, apoptotic
27 executioner caspase-3 was shown to cleave Dfna5 to mediate secondary necrosis (140). Delmanghani et al. revealed a role for the Gsdm family member
Dfnb59 in regulating peroxisomal dynamics in response to noise-induced oxidative stress (141, 142). Dfnb59 is upregulated in response to noise exposure in sensory hair cells of the inner ear, which then localizes to the peroxisome to regulate its proliferation/fission and subsequently promote redox homeostasis
(141, 142).
1.8: Apoptotic signaling during inflammasome activation in the absence of
caspase-1 or Gsdmd
In response to NLRP3 inflammasome activators in the absence of caspase-1 or Gsdmd, macrophages will divert to apoptotic signaling (69, 143).
During prolonged NG stimulation in the absence of caspase-1, murine macrophages and dendritic cells assemble an NLRP3/ASC/pro-caspase-8 inflammasome complex followed by proximity-induced pro-caspase-8 cleavage to its mature form (143, 144). Active caspase-8 then facilitates a delayed NLRP3- dependent apoptosis in contrast to a rapid caspase-1 driven pyroptosis (143,
144). Gsdmd-/- macrophages accumulate active caspase-8 and caspase-3/7
within several hours after assembling a NG-induced NLRP3 inflammasome
complex (69). Because caspase-7 is a substrate of caspase-1 (145), apoptotic
signaling in this setting could potentially result from caspase-1-mediated
caspase-7 activation and/or the assembly of an NLRP3/ASC/pro-caspase-8
platform. Activation of the apoptotic initiator caspase-8 results in the cleavage
28 and activation of executioner caspases-3/7 (146). These executioner caspases
cleave additional substrates that culminate in apoptotic cell death. For example,
they proteolytically process the DNA repair enzyme, poly-ADP ribose polymerase-1 (PARP-1), in addition to the inhibitor of caspase-activated DNase
(ICAD), which relieves the inhibition of CAD (146). Active CAD mediates internucleosomal DNA fragmentation (146). Apoptotic signaling also results in
PM blebbing and formation of apoptotic bodies as well as phosphatidylserine
exposure on the outer leaflet of the PM, which promotes engulfment by
phagocytes and therefore does not elicit an inflammatory response (147). In the
absence of phagocytosis, apoptotic cells undergo secondary necrosis, which
promotes inflammation (147).
1.9: NLRP3 inflammasome-mediated organelle dysfunction
Lysosomal disruption and mitochondrial damage have been depicted as
mediators of NLRP3 inflammasome activation (18). They have also been
implicated as relevant downstream consequences of NLRP3 inflammasome
signaling. Heid et al. revealed an NLRP3 inflammasome-dependent loss in
lysosomal integrity in response to NG (148). The extent of lysosomal membrane
permeabilization dictates the mode of lysosomal-mediated cell death (149). Low
to moderate disruption can promote apoptosis and regulated necrosis, which
includes triggering NLRP3 inflammasome activation and downstream pyroptotic
cell death (149). Maximal lysosomal rupture results in necrotic cell death, which
is mediated by cathepsins and Ca2+ influx (150-152).
29 NLRP3 inflammasome signaling can also mediate mitochondrial dysfunction (153). Yu et al. reported caspase-1-dependent mitochondrial
damage, which included enhanced mitochondrial membrane depolarization and
superoxide generation, in response to NLRP3 inflammasome activation (153).
Disruption of mitochondrial membrane potential has commonly been depicted as
a consequence of inducing apoptotic signaling. During mitochondrial
homeostasis, mitochondria maintain a high transmembrane potential as a result
of mitochondrial respiration (154). In this setting the mitochondrial permeability
transition pore complex (PTPC), which consists of VDAC (voltage-dependent
anion channel) within the outer mitochondrial membrane (OMM), ANT (adenine
nucleotide translocase) within the inner mitochondrial membrane (IMM), and
cyclophilin D within the mitochondrial matrix, has a low conductance (154). In
response to apoptotic stimuli, the pore forming proteins Bak and Bax adopt an
active conformation in the OMM and the PTPC assumes a high conductance
conformation, which results in the loss of mitochondrial membrane potential,
mitochondrial matrix swelling, and the release of pro-apoptotic factors, such as
cytochrome c (154). Dissipation of the H+ electrochemical gradient leads to
inefficient coupling of electron transport to ATP generation. In addition electron transport resorts to enhanced ROS generation instead of reducing oxygen to
water (155).
Both NLRP3 inflammasome signaling-induced mitochondrial and
lysosomal dysfunction can promote oxidative stress. Active
phagosomal/lysosomal NADPH oxidase activity contributes to lysosomal ROS
30 production (156, 157), and perturbed electron transport through the respiratory
chain promotes mitochondrial ROS generation (155). Oxidative stress can
become a relevant contributor to cell death at high cytosolic concentrations (158-
161). Cytotoxic levels of cytosolic ROS result in DNA damage and lipid
peroxidation of membrane-bound organelles and the PM (159-161). Generated
lipid radicals further create toxic aldehydes that react with proteins to severely
damage cell signaling pathways (161).
1.10: Objective of Dissertation Research
The overall objective of my thesis work was to clarify the mechanism of
pyroptotic death signaling. Chapter 2 aimed to characterize the caspase-1-
induced PM permeability change during NLRP3 and Pyrin inflammasome
signaling, which mediates a rapid perturbation in ionic homeostasis followed by osmotic lysis. During this study, N-Gsdmd generated by inflammatory caspase-
mediated cleavage was discovered to be necessary for executing pyroptotic cell
death (67, 68). My study further uncovered that the expression of Gsdmd is
required for the caspase-1-induced pre-lytic PM permeability change that precedes pyroptotic cell lysis. Shortly following Chapter 2’s acceptance for publication, N-Gsdmd was shown to constitute the PM pyroptotic pore (70).
Chapter 3 investigated whether N-Gsdmd, generated in response to NG-induced
NLRP3 inflammasome activation, in addition to forming lytic PM pores also targets membranes of intracellular organelles and perturbs their function to contribute to pyroptotic death signaling.
31
CHAPTER 2
Active caspase-1 induces plasma membrane
pores that precede pyroptotic lysis and are
blocked by lanthanides
Portions of this chapter have been published in:
Russo HM, Rathkey J, Boyd-Tressler A, Katsnelson MA, Abbott DW, Dubyak GR. Active Caspase-1 Induces Plasma Membrane Pores That Precede Pyroptotic Lysis and Are Blocked by Lanthanides. The Journal of Immunology. 2016 Aug. 15; 194 (4), 1353-1367.
Copyright 2016. The American Association of Immunologists, Inc.
32 ABSTRACT:
Canonical inflammasome activation induces a caspase-1/gasdermin D
(Gsdmd) dependent lytic cell death called pyroptosis which promotes anti-
microbial host defense but may contribute to sepsis. The nature of the caspase-
1-dependent change in plasma membrane (PM) permeability during pyroptotic
progression remains incompletely defined. We assayed propidium2+ (Pro2+) influx kinetics during NLRP3 or Pyrin inflammasome activation in murine bone marrow- derived macrophages (BMDM) as an indicator of this PM permeabilization.
BMDM were characterized by rapid Pro2+ influx after initiation of NLRP3 or Pyrin inflammasomes by nigericin or C. difficile toxin B (TcdB), respectively. No Pro2+ uptake in response to nigericin or TcdB was observed in Caspase-1-/- or ASC-/-
BMDM. The cytoprotectant glycine profoundly suppressed nigericin and TcdB-
induced lysis but not Pro2+ influx. The absence of Gsdmd expression resulted in
suppression of nigericin-stimulated Pro2+ influx and pyroptotic lysis. Extracellular
La3+ and Gd3+ rapidly and reversibly blocked the induced Pro2+ influx and
markedly delayed pyroptotic lysis without limiting upstream inflammasome
assembly and caspase-1 activation. Thus, caspase-1 driven pyroptosis requires
induction of initial pre-lytic pores in the PM that are dependent on Gsdmd
expression. These PM pores also facilitated the efflux of cytosolic ATP and influx
of extracellular Ca2+. Although lanthanides and Gsdmd deletion both suppressed
PM pore activity and pyroptotic lysis, robust IL-1β release was observed in
lanthanide-treated BMDM but not in Gsdmd-deficient cells. This suggests roles
33 for Gsdmd in both passive IL-1β release secondary to pyroptotic lysis and in non-
lytic/non-classical IL-1β export.
34 INTRODUCTION:
Caspase-1 and murine caspase-11 (caspase-4/5 in humans) mediate a lytic, inflammatory mode of cell death known as pyroptosis. Active caspase-1 is generated by proximity-induced autocatalytic cleavage of pro-caspase-1 following the assembly and oligomerization of a canonical inflammasome complex which occurs in response to a wide variety of cellular stressors and microbial stimuli. A non-canonical inflammasome involves the direct binding of the lipid A portion of LPS to pro-caspase-11 which facilitates pro-caspase-11 oligomerization and proximity-induced autocatalytic cleavage to form active caspase-11 (10). Caspase-1, but not caspase-11, is also required to process the inflammatory cytokines pro-IL-1β and pro-IL-18 into their mature forms.
Depending on myeloid cell type or mode of inflammasome activation, IL-1β may be released passively as a secondary consequence of pyroptotic cell lysis or through incompletely defined non-classical export pathways that are independent of cell lysis (51, 97, 99, 100).
Pyroptosis is an effective immune defense mechanism against intracellular bacterial infection. It allows for the removal of intracellular bacteria from their replicative niche and their subsequent detection and efficient clearance by recruited neutrophils (58). However, if the extent of host cell pyroptosis becomes excessive, it can contribute to sepsis and septic shock. Vance and colleagues reported that NLRC4 inflammasome-induced pyroptotic signaling in response to the rapid cytosolic delivery of bacterial flagellin involved Ca2+ influx and massive eicosanoid biosynthesis and release which led to enhanced vascular permeability
35 and septic shock in mice (62). Notably, caspase-11-dependent pyroptosis is a critical mediator of LPS-induced lethal sepsis in mice (3, 4, 63).
In the context of HIV infection and chronic inflammatory conditions, pyroptosis can also be deleterious to the host. During HIV infection, incomplete
DNA transcripts from non-productively infected CD4+ T-cells can be recognized
by the IFI16 inflammasome resulting in pyroptosis; this causes massive CD4+ T-
cell loss and chronic inflammation (65). Pyroptosis can also promote chronic
inflammation by providing a lytic pathway for release of ASC specks which are
active inflammasome complexes based on stable polymerized assemblies of the
adaptor protein ASC (64). These externalized ASC specks enable continued
processing of IL-1β and propagate inflammasome activation following their
internalization by bystander phagocytes (64).
Recently, gasdermin D (Gsdmd) was identified as a downstream substrate of
caspase-1/11/4/5 that is sufficient to execute pyroptotic cell death (67, 68).
Gsdmd is a soluble, cytosolic protein with no apparent transmembrane spanning
region. In humans, it is the product of one of four members of the GSDM gene
family (GSDMA, GSDMB, GSDMC, and GSDMD) (133), while the murine
genome includes Gsdma1-3, Gsdmc1-4, and Gsdmd. GSDM and Gsdm genes
are mostly expressed in skin and intestinal epithelial cells (133); murine Gsdmd,
in particular, is highly expressed in the small intestine and spleen (133). GSDMD
is the only human gasdermin-family protein that has a caspase-1/11/4/5 cleavage
site; the cleavage sites in human GSDMD and murine Gsdmd are similar but not
identical (67).
36 Caspase-1/11 cleavage of Gsdmd relieves an autoinhibitory interaction between its N and C-termini, such that the N-terminal fragment can mediate lytic cell death (67). Cleavage of Gsdmd by caspase-1 requires caspase-1 recruitment into active inflammasomes but not full processing of caspase-1 (69);
this is consistent with an earlier study demonstrating that partially cleaved
caspase-1 efficiently mediates NLRC4 inflammasome-dependent pyroptosis (26).
In addition to mediating pyroptotic cell death, Gsdmd is also necessary for
maximal IL-1β release (67-69).
Despite the requirement for Gsdmd in caspase-1/11 dependent pyroptosis,
the specific mechanism(s) by which Gsdmd induces lytic cell death is
incompletely defined. Following caspase-1/11 activation and Gsdmd cleavage,
plasma membrane (PM) integrity becomes compromised leading to a
perturbation in ion homeostasis, osmotic swelling and lysis, and the release of
various inflammatory mediators (5). DNA fragmentation occurs during pyroptosis
but is not required for the execution of pyroptotic cell death (76). Earlier studies
by Cookson and colleagues reported the formation of plasma membrane pores
with a diameter of 1.1-2.4nm during Salmonella Typhimurium dependent
caspase-1 activation in macrophages; formation of the pores correlated with
osmotic swelling and lysis (76). However, the molecular identity of these
caspase-1 induced pyroptotic pore(s) remains unknown.
In this study, we investigated the molecular and pharmacological properties of
the caspase-1 dependent pyroptotic pores by utilizing two canonical
inflammasome model systems – the bacterial ionophore nigericin (NG) to engage
37 NLRP3 inflammasomes and C. difficile toxin B (TcdB) to engage Pyrin inflammasomes – in conjunction with kinetic analysis of propidium2+ dye influx as
a readout of pore activity. We now report that caspase-1 activation rapidly
induces a PM pore that is non-selectively permeable to large organic cations and
anions and is activated prior to pyroptotic cell lysis. Induction of this pore is
critically dependent on the expression of Gsdmd, while its function as an ion
permeable conduit is rapidly and reversibly inhibited by the broadly acting
channel inhibitors, La3+ and Gd3+. These data suggest that caspase-1 cleavage
of Gsdmd licenses its function as either a direct pore-forming protein, a
chaperone that facilitates efficient pyroptotic pore insertion in the PM, or as a
regulator that gates a PM-resident large pore ion channel. Although lanthanides
and Gsdmd deletion both suppressed PM pore activity and pyroptotic lysis,
robust IL-1β release was observed in lanthanide-treated BMDM but not in
Gsdmd-deficient cells. This may indicate roles for Gsdmd in both passive IL-1β release secondary to pyroptotic lysis and in non-lytic/non-classical IL-1β export.
38 MATERIALS AND METHODS:
Reagents - Key reagents and their sources were are follows: Escherichia coli
LPS serotype O1101:B4 (List Biological Laboratories), nigericin (NG; APExBio),
C. difficile Toxin B (TcdB; List Biological Laboratories), glycine (Fisher), GdCl3
(Sigma-Aldrich), LaCl3 (Fisher), trovafloxacin (Sigma-Aldrich), P2X7R
antagonists A10606120 and A438079 (Tocris Bioscience), ruthenium red (Tocris
Bioscience), NS8593 (Sigma-Aldrich), zVAD-fmk and zDEVD-fmk (APExBio),
disuccinimidyl suberate (DSS; Sigma-Aldrich), anti–caspase-1 (p20) mouse mAb
(AG-20B-0042) (Adipogen), anti-GSDMDC1 mouse mAb (A-7), anti-ASC rabbit polyclonal Ab (N-15), anti-β actin goat polyclonal Ab (C-11), and all HRP
conjugated secondary Abs (Santa Cruz Biotechnology), murine IL-1β ELISA kit
(Biolegend), Fluo-4-AM (Life Technologies), probenecid and trovafloxacin
(Sigma-Aldrich), propidium iodide (PI; Life Technologies), YoPro iodide (PI; Life
Technologies) ethidium homodimer-2 iodide (EthD-2; Life Technologies),
adenosine 5’-(α,β-methylene)-diphosphate (APCP) (Jena Bioscience),
phosphoenolpyruvate, lyophilized Firefly luciferase ATP assay mix (FLAAM),
Firefly luciferase ATP assay buffer (FLAAB), pyruvate kinase (P-1506), and
myokinase (M-3003) (Sigma-Aldrich), lactate dehydrogenase (LDH) cytotoxicity
detection kit (Roche). Anti–IL-1β mouse mAb was provided by the Biological
Resources Branch, National Cancer Institute, Frederick Cancer Research and
Development Center (Frederick, MD).
39 Murine macrophage models and cell culture - Wild-type (WT) C57BL/6 mice were
purchased from Jackson Labs. Mice lacking both caspase-1 and caspase-11 on
a C57BL/6 background (Casp1/11−/−) have been previously described (63, 113,
162). ASC-/- and NLRP3-/- (C57BL/6 background) mice were provided by Eric
Pearlman and Amy Hise (Case Western Reserve University). P2X7R-/- mice have
been previously described (97). All experiments and procedures involving mice were approved by the Institutional Animal Care and Use Committee of Case
Western Reserve University. Bone marrow–derived macrophages (BMDM) were
isolated from 9- to 12-wk-old mice euthanized by CO2 inhalation. Femurs and
tibiae were removed and briefly immersed in 70% ethanol. Bones were then
flushed with PBS to remove marrow cavity plugs. Bone marrow cells were
resuspended in DMEM (Sigma-Aldrich) supplemented with 10% bovine calf
serum (HyClone Laboratories), 100 U/mL penicillin, 100 μg/mL streptomycin
(Invitrogen), 2 mM L-glutamine (Lonza), and 30% L-cell conditioned medium
(which contains the M-CSF necessary for BMDM differentiation), and then plated
on 150 mm dishes and cultured in the presence of 10% CO2. Day 3 post-
isolation, 80% of medium containing non-adherent cells was centrifuged at 300 x
g for 5 min and resuspended and replated with fresh BMDM media. Day 5 post-
isolation, BMDM were re-fed, and on day 6, BMDM were detached with PBS
containing 10mM EDTA and 4mg/mL lidocaine, replated on 6-well, 12-well, or 24-
well plates at 1 x 106 cells/mL, and used within 4 days.
NLRP3-FLAG overexpressing, ASC-mCerulean immortalized NLRP3 KO
murine macrophages (iBMDM) were provided by Eicke Latz (University of Bonn,
40 Bonn, Germany). iBMDM were cultured in DMEM (Sigma-Aldrich) supplemented
with 10% heat inactivated bovine calf serum (HyClone Laboratories), 100 U/mL
penicillin, 100 μg/mL streptomycin (Invitrogen), and 2 mM L-glutamine (Lonza).
iBMDM were plated on 6-well or 24-well plates at 1 x 106 cells/mL, and used
within 2 days.
Generation of CRISPR GSDMD-/- iBMDM - A CRISPR-Cas9 guide against
Gsdmd was inserted into the lentiCRISPRv2 plasmid (163, 164) with puromycin
resistance protein replaced with a hygromycin resistance cassette (Chirieleison et al. in preparation). CRISPR Oligonucleotides: Gsdmd guide 1-F 5’-
CACCGCAGAGGCGATCTCATTCCGG-3’, Gsdmd guide 1-R 5’-
AAACCCGGAATGAGATCGCCTCTGC -3’, Gsdmd guide 2-F 5’-
CACCGTGAAGCTGGTGGAGTTCCGC-3’, Gsdmd guide 2-R 5’-
AAACGCGGAACTCCACCAGCTTCAC-3’. Plasmid lentiCRISPRv2 containing
each guide were co-transfected into 293T cells with packaging plasmids PsPax
and PMD2. iBMDM were transduced with virus for 2 days and selected with
hygromycin. Clonal cells were isolated and loss of Gsdmd verified by western
blot.
Priming and stimulation of BMDM and iBMDM - BMDM and iBMDM were primed
with 1 μg/ml LPS for 3-4 h at 37°C. LPS containing media was then replaced with
a Ca2+-containing balanced salt solution (BSS) (130 mM NaCl, 4 mM KCl, 1.5
mM CaCl2, 1 mM MgCl2, 25 mM Na HEPES, 5 mM D-glucose [pH 7.4]). BSS
41 contained 0.1% bovine serum albumin (BSA) for all assays except for western
blot sample preparation, which contained 0.01% BSA. BMDM and iBMDM were
stimulated with 10μM NG or 0.4μg/mL TcdB for varying lengths of time as
indicated. For lanthanide inhibition studies, BMDM and iBMDM were treated with
indicated concentrations of La3+ or Gd3+ upon stimulation with NG or 20 min after
stimulation with TcdB, which is after the toxin has been internalized but prior to
pyroptotic pore opening.
Western blot analyses and ASC oligomerization assay - LPS-primed BMDM and
iBMDM in 6-well plates (2 x 106 cells/well) were treated as indicated in the
presence of BSS containing 0.01% BSA. Following 30 min NG stimulation or 45
min TcdB stimulation, detergent-soluble cell lysates and extracellular medium
(ECM) fractions were prepared as previously described (144) for standard
processing by SDS-PAGE, transfer to PVDF membrane, and Western blot analysis. Briefly, to prepare the detergent-soluble cell lysate, 56uL of RIPA lysis buffer (0.5% sodium deoxycholate, 0.1% SDS, 1% IgePal CA630 in PBS, pH 7.4, plus protease inhibitor mixture) was added to adherent cells on the 6-well plate and incubated on ice for 5 min. Lysed adherent cells were scraped with a rubber policeman and incubated on ice for 15 min. The whole cell lysate was centrifuged at 15,000 x g for 15 min at 4°C to separate the detergent-soluble from insoluble fraction. ASC oligomeric complexes were detected in the insoluble fraction as described previously (144). Primary antibodies were used at the following concentrations: 5μg/mL for IL-1β; 1μg/mL for caspase-1; 0.4μg/mL for ASC;
42 0.2μg/mL for β-Actin; 0.4μg/mL for GSDMD, and HRP-conjugated secondary Abs
were used at a final concentration of 0.13μg/mL. Chemiluminescent images of
Western blots were developed using a FluorChemE processor (Cell
Biosciences).
Propidium2+, YoPro2+, EthD4+ influx assays of pyroptotic plasma membrane
permeabilization - LPS-primed or non-primed (as indicated) BMDM and iBMDM
in 24-well plates (5 x 105 cells/well) were briefly washed with PBS prior to adding
BSS supplemented either with 1μg/mL propidium2+, 2μM EthD4+, or 1 M YoPro2+
to each well. Baseline fluorescence (540 nm excitation −> 620 nm emission for
propidium2+ or EthD4+; 485 nm excitation −> 540 nm emission for YoPro2+ at 30 s intervals) was first recorded with a Synergy HT plate reader (BioTek) preheated to 37°C for 5 min. Cells were routinely stimulated with 10μM NG or 0.4μg/mL
TcdB in the presence or absence of 5mM glycine for 45 or 60 min, respectively, and the changes in fluorescence were recorded every 30 s. In some experiments with Gsdmd-deficient iBMDM, the nigericin stimulation was extended to 2 or 3 h; where indicated, some wells were supplemented with 50 M zVAD-fmk, 50 M zDEVD-fmk, or 30 M trovafloxacin. Dye uptake assays were terminated by permeabilizing the PM with digitonin (50μg/mL) to quantify maximum fluorescence. Fluorescence was expressed as a percentage of maximum fluorescence measured in digitonin-permeabilized cells after subtraction of basal intrinsic fluorescence.
43 For certain propidium2+ assays, BMDM or iBMDM were treated with indicated
concentrations of La3+ or Gd3+ in the presence or absence of 5mM glycine. To
address whether lanthanides reversibly inhibit the pyroptotic pore, wells
containing propidium2+, NG, and La3+/Gd3+ were briefly washed with PBS (to
remove the lanthanides) 15 min post-NG stimulation and replaced with fresh BSS
containing 1μg/mL of propidium2+. To further investigate the mechanism of
lanthanide inhibition of pyroptotic pores, La3+/Gd3+ and propidium2+ were added
at different times during NLRP3 or Pyrin inflammasome signaling, which include the following experimental setups: 1) propidium2+ added at the same time as
NG/TcdB and La3+/Gd3+ added at the same time as NG or 20 min post-TcdB, 2) propidium2+ added at the same time as NG/TcdB and La3+/Gd3+ added 20 min
post-NG or 30 min post-TcdB, or 3) La3+/Gd3+ added 20 min post-NG or 30 min
post-TcdB and propidium2+ added 5 min post-La3+/Gd3+ addition.
Cytotoxicity assay (LDH release) - LPS-primed BMDM and iBMDM in 24-well
plates (5 x 105 cells/well) were treated as indicated at 37°C. Supernatants were removed and centrifuged at 15,000 x g for 15 s to pellet detached cells. Cell-free
supernatants were assayed for LDH activity (Roche Applied Science) according
to the manufacturer’s protocol. The released LDH was expressed as a
percentage of total LDH content following 2% Triton X-100 induced
permeabilization of unstimulated LPS-primed cells.
44 Fluo-4 assay of cytosolic [Ca2+] - LPS-primed BMDM in 24-well plates (5 × 105
cells/well) were loaded with fluo-4-AM and assayed for NG or TcdB-induced
changes in cytosolic [Ca2+] as described previously (165) using the Synergy HT
reader preheated to 37°C. The changes in fluo-4 fluorescence were used to
calculate cytosolic [Ca2+] by standard calibration methods (166).
Measurement of released adenine nucleotides - LPS-primed BMDM in 12-well
plates (1 x 106 cells/well) were stimulated with 10μM NG in the presence of the
CD73 inhibitor APCP (50μM) (to prevent the metabolism of AMP to adenosine)
and in the presence or absence of 5mM glycine at 37°C. At the indicated times,
supernatants were removed and centrifuged at 12,200 x g for 15 s to pellet cells.
Cell-free supernatants were assayed for total adenine nucleotide content
(ATP+ADP+AMP) as described previously (167).
Data processing and analysis - All experiments were repeated 2–8 times with
separate BMDM preparations. Figures illustrating Western blot results are from
representative experiments. Figures illustrating quantified changes in pyroptotic
propidium2+ influx, extracellular LDH activity, cytosolic [Ca2+], or extracellular
[adenine nucleotide] represent the means (±SE) from 1-6 independent
experiments. Quantified data were statistically evaluated by one-way ANOVA
with a Bonferroni post-test using Prism 6.0 software.
45 RESULTS:
A rapidly induced propidium influx is triggered downstream of inflammasome
activation but upstream of pyroptotic cell lysis
Previous studies have assayed the uptake of cationic DNA-intercalating
fluorescent dyes following the activation of a canonical inflammasome complex
as an indicator of caspase-1-induced plasma membrane (PM) permeabilization
or pyroptosis (76, 104, 168). Normally, these dyes are impermeant to an intact
PM. However, upon perturbation of normal PM barrier function, these dyes can
access the nucleus, intercalate with DNA, and fluoresce. PM permeabilization
can occur through 1) frank lysis, 2) the gating of resident large pore channels, or
3) the insertion of large protein pores that can accommodate the molecular
dimensions of these dyes. Case et al. previously used a real-time, kinetic assay
of propidium2+ (MW: 415 Da) influx to track the progression of pyroptosis in
Legionella-infected macrophages (168). We adapted a similar protocol to
investigate the nature and kinetics of caspase-1-induced PM permeabilization
during NLRP3 and Pyrin inflammasome activation in murine bone marrow-
derived macrophages (BMDM).
To activate the NLRP3 inflammasome, BMDM were stimulated with the
bacterial ionophore nigericin (NG), which functions as a K+/H+ exchanger
following insertion in the PM and organellar membranes. Insertion of NG into the
PM results in a decrease in cytosolic [K+] which is a necessary signal for NLRP3
inflammasome complex assembly (44, 45). We previously reported that after an
~12 min delay, NG-stimulated murine bone marrow-derived dendritic cells
46 (BMDC) exhibit robust and rapid caspase-1 dependent propidium2+ influx (165).
WT BMDM stimulated with NG displayed similarly rapid propidium2+ influx
following a 10-12 min delay with ~60% of the BMDM accumulating dye by 45 min
(Fig. 2.1A). Propidium2+ influx was absent in Nlrp3-/-, Asc-/-, and Casp1-/- (also
deficient in caspase-11) BMDM (Fig. 2.1A), demonstrating that propidium2+ uptake is dependent on NLRP3 inflammasome components and caspase-1 activation.
To address whether this caspase-1 dependent PM permeability pathway is conserved among canonical inflammasome platforms, we also utilized a Pyrin inflammasome model. To activate the Pyrin inflammasome, BMDM were stimulated with C. difficile toxin B (TcdB). TcdB is one of the main virulence factors involved in the pathogenesis of a C. difficile bacterial infection (32, 33), a major cause of hospital-acquired, antibiotic-associated infectious diarrhea and pseudomembranous colitis (34, 35). TcdB-induced Pyrin inflammasome activation requires effective internalization of the toxin into the cytosol followed by
TcdB-dependent glycosylation and inactivation of Rho-GTPases (31). Following an ~20 min delay, WT BMDM stimulated with TcdB exhibited rapid and robust propidium2+ influx with ~40% of the cells accumulating dye by 60 min (Fig. 2.1B).
Propidium2+ influx was almost completely suppressed in Asc-/- and Casp1-/-
BMDM throughout the 60 min TcdB stimulation, but remained intact in NLRP3-/-
BMDM (Fig. 2.1B); this demonstrates that TcdB-induced propidium2+ uptake is
dependent on Pyrin inflammasome components.
47
FIGURE 2.1. A rapidly induced propidium influx is triggered downstream of inflammasome activation but upstream of pyroptotic cell lysis (A) WT, ASC-/-, Casp1-/-, and NLRP3-/- bone marrow-derived macrophages (BMDM) were primed with LPS (1μg/mL) for 4 h prior to stimulation with nigericin (NG: 10μM) for 45 min, and the change in plasma membrane permeability to propidium2+ (1μg/mL) and subsequent accumulation of fluorescent propidium2+ (MW: 416Da) complexed with DNA was quantified every 3 min. A 5 min baseline fluorescent read was performed prior to stimulation, and propidium2+ fluorescence was expressed as a percentage of maximum fluorescence after adding digitonin (50μg/mL). These data represent the mean ± SE of 6-12 replicates from 4 (WT) or 2 (ASC-/-, Casp1-/-, and NLRP3-/-) independent experiments. (B) LPS-primed WT, ASC-/-, Casp1-/-, and NLRP3-/- BMDM were stimulated with C. difficile toxin B (TcdB: 0.4μg/mL) for 60 min, and propidium2+ fluorescence was quantified every 4 min as described in (A). These data represent the mean ± SE of 3-9 replicates from 3 (WT), 2 (ASC-/- and Casp1-/-), or 1 (NLRP3-/-) independent experiments. (C) LPS-primed WT BMDM were stimulated with NG or (D) TcdB in the presence or absence of the cytoprotectant glycine (5mM). At the indicated times, supernatants were assayed for lactate dehydrogenase (LDH) activity, which was used as an indicator of lytic LDH release. The absorbance values were expressed as a percentage of maximum absorbance following triton X-100 induced permeabilization of unstimulated LPS-primed cells. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (E) LPS-primed WT BMDM were stimulated with NG for 45 min or (F) TcdB for 60 min in the presence or absence of 5mM glycine, and propidium2+ fluorescence was quantified every 3 or 4 min, respectively. These data represent the mean ± SE of 6 replicates from 2 independent experiments.
48 We next determined whether caspase-1 induced PM permeabilization
indicates a pre-lytic event, like pore/channel opening, or cell lysis. Early studies
by Cookson and colleagues found that the cytoprotectant glycine protected
Salmonella-infected macrophages from end-stage lysis but did not suppress
uptake of ethidium+, a smaller (314 Da) DNA-intercalating dye (76, 169, 170).
We have also reported the use of glycine to suppress caspase-1-induced lysis of macrophages stimulated with maitotoxin (171) or extracellular ATP (172).
Notably, millimolar concentrations of glycine have also been used to characterize maitotoxin and palytoxin-induced changes in PM permeability of endothelial cells
(173, 174), as well as the pyroptotic responses in macrophages (76). In all of these models of regulated cell death, glycine was shown to prevent or greatly delay end-stage lysis (76, 173, 174).
We adapted these protocols to dissociate lytic from non-lytic propidium uptake by BMDM in response to NLRP3 and Pyrin inflammasome activation.
Stimulation of WT BMDM with NG or TcdB in the presence of 5mM glycine prevented the lytic release of the large macromolecule lactate dehydrogenase
(LDH) (140kDa) (Fig. 2.1C,D), but permitted the influx of propidium2+ with a
similar kinetic as in the absence of glycine (Fig. 2.1E, F). This temporal
dissociation between the uptake of propidium2+ and the release of LDH in the
presence of glycine indicates that propidium2+ influx reflects an event before cell
lysis, such as the insertion or opening of a “pyroptotic pore”.
49 NLRP3 and Pyrin inflammasome activation licenses the opening of a large,
nonselective cation- and anion-permeable pyroptotic pore
We next characterized the permeability properties of this putative pyroptotic
pore. Previous studies by Cookson and colleagues on pyroptosis in Salmonella-
infected macrophages indicated the accumulation of 1.1-2.4 nm diameter pores
that facilitated the influx of molecules in the 500-1450 Da mass range (76). A
range of DNA-intercalating cationic dyes with different masses, charges, and
shapes can be employed to probe the dimensions of pyroptotic pores (Table 2.1).
To define the pores induced by NLRP3 or Pyrin inflammasomes, we assessed
permeability to the larger and more highly charged ethidium homodimer-2 dye
(EthD4+; MW: 785 Da). After an ~10-12 min delay, WT BMDM stimulated with NG
exhibited a rapid and robust EthD4+ influx that was absent in Casp1-/- BMDM; this
was similar to the WT BMDM propidium2+ influx response, albeit with a slower
rate of dye uptake (Fig. 2.2A). WT BMDM stimulated with TcdB also exhibited
rapid and robust EthD4+ influx after an ~20 min delay similar to the propidium2+
influx profile (Fig. 2.2B).
We verified that the inflammasome-induced permeability to EthD4+ was also a
pre-lytic event by assessing EthD4+ permeability in the presence of glycine.
Following the stimulation of WT BMDM with NG or TcdB, the EthD4+ uptake
profiles were similar in the presence and absence of glycine (Fig. 2.2C,D); this
indicated that the induced pyroptotic pore is permeable to the larger EthD4+ dye and thus accommodates large organic molecules in the 800 Da mass range. In contrast, Fink and Cookson observed that EthD4+ did not permeate the pyroptotic
50 TABLE 2.1. Physical properties of lanthanides and various DNA-intercalating cationic dyes
Abbreviations: Molecular Mass (Mol Mass)
51 AB C D
WT; PI 80 80 80 WT; PI 80 Utx WT; EthD Utx -/- WT; EthD - Glycine - Glycine Casp1 ; EthD 60 60 60 60 + Glycine (5mM) + Glycine (5mM)
40 40 40 40 TcdB NG TcdB NG 20 20 20 ↓ ↓ 20 ↓ ↓ EthD Uptake (%Max) Uptake EthD Fluorescence (%Max) Fluorescence EthD Uptake(%Max)
Fluorescence (%Max) Fluorescence 0 0 0 0
0 1020304050 0 102030405060 0 1020304050 0 102030405060 Time (min) Time (min) Time (min) Time (min)
EF GH All: + NG 400 Utx WT; +NG -/- Utx WT; -Gly Casp1 ; +NG 1000 1000 Utx NG; - Gly WT; +TcdB 1500 WT; +Gly (5mM) TcdB; - Gly NG; + Gly (5mM) * 800 -/- -/-
] (nM) ] 800 300 (nM) ] Casp1 ; +TcdB Casp1 ; -Gly ] (nM) ] TcdB; + Gly (5mM) 2+ NG 2+ 2+ Casp1-/-; +Gly (5mM) * 600 600 1000 200 NG ↓ TcdB TcdB 400 400 ↓ 100 ↓ 200 ↓ 200 500 Cytosolic [Ca Cytosolic Cytosolic [Ca 0 0 [Ca Cytosolic 0 0 0 102030405060 0 102030405060 0 102030405060 5 Extracellular ATP +ADP+AMP ATPExtracellular (nM) 10 20 30 4 Time (min) Time (min) Time (min) Time (min)
FIGURE 2.2. NLRP3 and Pyrin inflammasome activation licenses the opening of a large, nonselective cation- and anion-permeable pyroptotic pore (A) LPS-primed WT and Casp1-/- BMDM were stimulated with NG (10μM) for 45 min, and propidium2+ (MW: 416Da) and Ethidium homodimer4+ (EthD4+; MW: 788Da, 2μM) fluorescence was quantified every 3 min as described in Fig. 2.1. These data represent the mean ± SE of 5-6 replicates from 2 independent experiments. (B) LPS-primed WT BMDM were stimulated with TcdB (0.4μg/mL) for 60 min, and propidium2+ and EthD4+ fluorescence was quantified every 4 min. These data represent the mean ± SE of 6 replicates from 2 independent experiments. (C) LPS-primed WT BMDM were stimulated with NG for 45 min or (D) TcdB for 60 min in the presence or absence of 5mM glycine, and EthD4+ fluorescence was quantified every 3 or 4 min, respectively. These data represent the mean ± SE of 5-6 replicates from 2 independent experiments. (E) LPS- primed WT and Casp1-/- BMDM were stimulated with NG or (F) TcdB for 60 min, and the change in cytosolic [Ca2+] was determined using the fluo-4-AM (1μM) Ca2+ indicator dye. A 10 min baseline read was taken prior to stimulation. These data represent the mean ± SE of 6 replicates from 2 independent experiments. (G) LPS-primed WT and Casp1-/- BMDM were stimulated with NG and TcdB in the presence or absence of 5mM glycine for 60 min, and the cytosolic [Ca2+] was determined as described in (E,F). These data represent the mean ± SE of 3-4 replicates from 2 independent experiments. (H) LPS- primed WT and Casp1-/- BMDM were stimulated with NG in the presence or absence of 5mM glycine. At the indicated times, supernatants were assayed for extracellular [adenine nucleotide] by first rephosphorylating ATP metabolites to ATP and then using a luciferase-based assay to quantify extracellular [ATP]. These data represent the mean ± SE of 4 replicates from 2 independent experiments. *, p<0.05.
52 pore induced in Salmonella-infected macrophages (76). This discrepancy might indicate that pores of varying dimensions can accumulate during pyroptotic
induction by different inflammasome subtypes or that pyroptotic pore induction
and its dimensions vary dynamically depending on the rate and extent of active caspase-1 accumulation. Indeed, Gaidt et al. (51) recently reported that stimulation of human monocytes with LPS alone induced distinct NLRP3- dependent inflammasomes that did not drive pyroptotic lysis, while stimulation of
the same monocytes with LPS plus nigericin resulted in robust NLRP3 inflammasome-dependent pyroptosis.
Given the pyroptotic pore’s permeability to large organic cations, we next characterized its ability to act as a conduit for inorganic cations or organic anions.
To assess the permeability of the pore to Ca2+, fluo-4 Ca2+ indicator dye was
loaded into BMDM prior to acute induction of NLRP3 or Pyrin inflammasomes.
WT BMDM stimulated with NG exhibited a modest and gradual rise in cytosolic
[Ca2+] after a 10-12 min delay and this response was absent in Casp1-/- BMDM
(Fig. 2.2E). We previously reported similar caspase-1 dependent increases in
cytosolic [Ca2+] in NG-stimulated BMDC and demonstrated that this involved
influx of extracellular Ca2+ rather than mobilization of intracellular Ca2+ stores
(165). WT BMDM stimulated with TcdB also demonstrated a gradual rise in cytosolic [Ca2+] concentration after an ~ 20 min delay that was greatly
suppressed in Casp1-/- BMDM (Fig. 2.2F). The onset of Ca2+ influx temporally
correlated with the onset of propidium2+ influx in both inflammasome models; this
suggests that the rise in cytosolic [Ca2+] is predominantly mediated by the
53 induced pyroptotic pore. That the Ca2+ influx profiles of WT BMDM in response to
NG or TcdB were similar in the presence and absence of glycine (Fig. 2.2G)
indicates that Ca2+ influx, like propidium2+ and EthD4+ uptake, reflects a pre-lytic
change in PM permeability.
To assess if the pyroptotic pore is also permeable to anions, particularly
intracellular metabolites such as ATP, the extracellular medium from WT and
Casp1-/- BMDM stimulated with NG was assayed for total adenine nucleotide
(ATP+ADP+AMP) content. The collected samples were treated with a cocktail of
myokinase, pyruvate kinase, and phosphoenolpyruvate to convert extracellular
AMP and ADP to ATP and a luciferase-based assay was used to determine
[ATP]. We were particularly interested in whether the pyroptotic pore is
permeable to ATP because this nucleotide is an important danger-associated molecular pattern (DAMP) that activates innate immune cells for support of adaptive immune responses (175, 176) and also promotes leukocyte chemotaxis
(78). In the absence or presence of glycine, NG-stimulated WT BMDM progressively released comparable amounts of adenine nucleotides after an ~10 min delay, and this release was absent in Casp1-/- BMDM (Fig. 2.2H). This
indicates that adenine nucleotides are released through a caspase-1-induced
pore rather than as a secondary consequence of cell lysis. Taken together, these
results indicate that caspase-1 activation induces a large non-selective cation- and anion-permeable pore in the macrophage PM that precedes overt cell lysis.
54 Gsdmd is required for caspase-1 induction of both the prelytic pyroptotic pores and subsequent pyroptotic lysis
Because Gsdmd was recently identified as a downstream target of caspase-
1/11 with the resulting N-terminal cleavage product being necessary to execute
pyroptotic cell death (67-69), we hypothesized that Gsdmd was also required to
induce the pyroptotic pore/channel. He et al. (69) used end-point fluorescence
imaging to demonstrate NG-stimulated propidium2+ staining in control but not
Gsdmd-deficient murine macrophages. However, those single time point images at 60 min did not distinguish between pre-lytic versus post-lytic dye accumulation. We utilized Gsdmd-targeting guide RNAs (gRNAs) and immortalized murine bone marrow-derived macrophages (iBMDM) to generate
CRISPR-Cas9 Gsdmd-/- iBMDM cell lines (Fig. 2.3A). Pooled iBMDM clones
generated with two separate gRNA (Gsdmd G1 and Gsdmd G2) lacked immunoreactive Gsdmd protein and were used for subsequent experiments (Fig.
2.3B). In response to NG stimulation, LPS-primed Gsdmd-/- G1 and Gsdmd-/- G2 iBMDM exhibited no propidium2+ uptake at early time points, whereas the
parental WT iBMDM and WT iBMDM transduced with a non-targeting gRNA
(NTG) displayed robust propidium2+ uptake that was markedly suppressed by the
pan-caspase inhibitor zVAD (Fig. 2.3C). As expected, Gsdmd was also
necessary for downstream lysis because Gsdmd-/- G1 and Gsdmd-/- G2 iBMDM
exhibited complete suppression of LDH release following 30 or 60 min of NG
stimulation (Fig. 2.3D); such blockade of pyroptosis is consistent with previous
findings (67, 69). We also verified that glycine retards the lytic release of LDH 30
55 A B NTG NTG Gsdmd G1 G1 Gsdmd Gsdmd G2
Gsdmd CACCGCAGAGGCGATCTCATTCCGG-3’ IP: Gsdmd Blot: Gsdmd AAACCCGGAATGAGATCGCCTCTGC-3’ IgG heavy chain
CACCGTGAAGCTGGTGGAGTTCCGC-3’ WCL AAACGCGGAACTCCACCAGCTTCAC-3’ Blot: actin Actin
-/- G1 CEGsdmd iBMDM
Utx Gsdmd-/- G1 Utx 80 50 WT Gsdmd-/- G2 NG 60 WT+zVAD 40 Trovaflox NTG 30 zVAD 40 DEVD NG 20 20 NG 10 0 0 Propidium Uptake (%Max) Propidium Uptake (%Max) 0 1020304050 Time (min) 0 20406080100120 D Time (min) WT Gsdmd-/- G1 Gsdmd -/- G2 50 * Utx 120 NG * 40 100 *** Trovaflox *** 30 zVAD 80 20 60 NG 10 40 0 20 (%Max) Uptake Yo-Pro
Cytolysis (% LDH Release) LDH (% Cytolysis 0 30 60 0 20406080100120 Time (min) Time (min)
FIGURE 2.3. Gsdmd is required for caspase-1 induction of both the prelytic pyroptotic pores and subsequent pyroptotic lysis (A) The guide RNAs used to generate CRISPR-Cas9 Gsdmd-/- iBMDM. (B) Gsdmd was immunoprecipitated from untreated WT non-targeting guide (NTG), Gsdmd-/- Guide 1 (G1: 4 pooled clones), and Gsdmd-/- Guide 2 (G2: 2 pooled clones) iBMDM whole cell lysates were incubated overnight with anti-GSDMDC-1 and then with protein-G sepharose. Immunoprecipitated samples were probed for Gsdmd and IgG heavy chain, and soluble cell lysates were probed for actin. These data are representative of results from 1 experiment. (C) LPS-primed WT iBMDM in the presence or absence of 50μM zVAD and LPS-primed NTG, Gsdmd-/- Guide 1 (Gsdmd-/- G1) and Gsdmd-/- Guide 2 (Gsdmd-/- G2) were stimulated with NG (10μM) for 45 min, and propidium2+ fluorescence was quantified every 3 min as described in Fig. 2.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (D) LPS-primed WT, Gsdmd-/- G1, and Gsdmd-/- G2 iBMDM were stimulated with NG for 30 and 60 min, and the supernatants were subsequently assayed for LDH activity as described in Fig. 2.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. ***, p<0.001. *, p<0.05. (E) Gsdmd-/- G1 and Gsdmd-/- G2 iBMDM were stimulated with NG (10μM) for 2 or 3 h, and propidium2+ or YoPro2+ fluorescence was quantified every 3 min as described in Fig. 1. Where indicated, the assay medium was supplemented with 50 M zVAD-fmk, 50 M zDEVD-fmk, or 30 M trovafloxacin. These data represent the mean ± SE of 4 replicates from 2 independent experiments.
56 min post-NG stimulation in WT iBMDM similarly to its effect on WT primary
BMDM (Fig. 2.4A). These data demonstrate that Gsdmd is required to induce the upstream pre-lytic pyroptotic pore/channel that mediates propidium2+ influx and
eventually leads to end-stage pyroptotic cell lysis.
During prolonged NLRP3 inflammasome activation in the absence of Gsdmd, macrophages eventually divert to apoptosis (69). Apoptotic caspase-7 is a substrate of caspase-1 (145) and, in the absence of Gsdmd, macrophages accumulated cleaved caspase-3/7 and active caspase-8 within several hours after assembly of caspase-1 inflammasomes. He et al. (69) also reported that
Gsdmd-null macrophages accumulated nuclear propidium2+ after 3h of nigericin
stimulation. The dye accumulation in the Gsdmd-deficient cells may reflect lytic
uptake due to secondary necrosis and/or pre-lytic influx through other large pore ion channels, such as pannexin-1 (Panx1). Núñez and colleagues recently
described an alternative pyroptotic pathway initiated by caspase-11-dependent
cleavage of Panx1 channels in murine macrophages (177). We used NG-
stimulated Gsdmd-deficient iBMDM to define alternative modes by which accumulation of active caspase-1 can alter PM permeability. After an ~60 min delay, the cells began to accumulate propidium2+ and this response was
completely suppressed by the pan-caspase inhibitor zVAD or caspase-3-
selective inhibitor DEVD, but not the Panx1 blocker trovafloxacin (Fig. 2.3E).
Activated Panx1 channels have low permeability to propidium2+ but high permeability to YoPro2+, which has the same charge but smaller mass (375 Da) compared to propidium2+ (Table 2.1) (167, 178-180). In response
57 AB Utx 80 120 - Glycine +NG 100 300uM Gd3+ + Glycine (5mM) 60 1mM Gd3+ 80 3+ 40 1.2mM Gd 60 1.5mM Gd3+ NG 40 NG 20 Gd3+ 20 ↓ ↓ 0 0 Propidium Uptake (%Max) Uptake Propidium Cytolysis (% LDH Release) LDH (% Cytolysis
0 102030405060 0 1020304050 Time (min) Time (min) C D +NG 1.2mM Gd3+ 1.2mM La3+ 80 Utx 120 +NG 3+ 100 60 300uM La * 1mM La3+ 80 ** 3+ 40 1.2mM La 1.5mM La3+ 60 NG 20 La3+ ↓ 40 0 20 Propidium Uptake (%Max) Uptake Propidium
Cytolysis (% LDH Release) LDH (% Cytolysis 0 0 0 1020304050 3 60 Time (min) Time (min)
FIGURE 2.4. Lanthanides coordinately suppress both the Gsdmd-dependent plasma membrane permeability change and pyroptotic lysis induced by NLRP3 inflammasome activation in iBMDM (A) LPS-primed WT iBMDM were stimulated with NG (10μM) in the presence or absence of glycine (5mM). At the indicated times, supernatants were assayed for LDH activity as described in Fig. 2.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (B) LPS-primed WT iBMDM were stimulated with NG in the presence or absence of Gd3+ (0.3, 1, 1.2, 1.5mM) or (C) La3+ (0.3, 1, 1.2, 1.5mM) for 45 min, and propidium2+ fluorescence was quantified every 3 min as described in Fig. 2.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (D) LPS-primed WT iBMDM were stimulated with NG for 30 or 60 min in the presence or absence of 1.2mM Gd3+ or La3+, and the supernatants were subsequently assayed for LDH activity. These data represent the mean ± SE of 4 replicates from 2 independent experiments.
58 to NG, Gsdmd-null iBMDM displayed a delayed and zVAD-sensitive increase in
YoPro2+ accumulation (Fig. 2.3E). Notably, trovafloxacin produced a two-fold
decrease in the rate of YoPro2+ uptake (Fig. 2.3E). This suggests that caspase-
3/7-gated Panx1 channels contribute to the altered PM permeability of
inflammasome-activated macrophages under conditions of suppressed
pyroptosis.
Lanthanides coordinately suppress both the caspase-1-dependent PM
permeability change and pyroptotic lysis induced by NLRP3 and Pyrin
inflammasome activation
To further characterize the molecular and biophysical properties of the
caspase-1-Gsdmd-induced pore and its mechanistic coupling to pyroptotic cell death, we investigated whether the pore could be targeted pharmacologically.
Given its non-selective permeability to large organic and inorganic cations and anions, we tested whether activity of the pyroptotic pore might be blocked by lanthanides (Gd3+ and La3+), which are broadly acting channel inhibitors.
Lanthanides are known to inhibit non-selective cation channels (181) and a broad range of large-pore channels (182). WT BMDM stimulated with NG in the presence of 1mM Gd3+ or La3+ were characterized by modest decreases in the
rate of propidium2+ influx relative to that observed in lanthanide-free medium (Fig.
2.5A,B). The rate and magnitude of suppression was much greater as the lanthanide concentration increased to 1.2mM (Gd3+: ~60% mean suppression,
La3+: 100%) and 1.5mM (Gd3+: ~90% mean suppression, La3+: 100%) (Fig.
59 A Nigericin -/+ Gd 3+ B Nigericin -/+ La 3+ C TcdB -/+ Gd 3+ D TcdB -/+ La3+ 80 Utx 1.2mM La3+ 3+ 80 Utx 1.2mM La3+ 80 Utx 1.2mM Gd3+ 80 Utx 1.2mM Gd 3+ 3+ 0 La 3+ 0 Gd 3+ 3+ 0 La 1.5mM La3+ 0 Gd 3+ 1.5mM Gd3+ 1.5mM La 1.5mM Gd 60 3+ 60 60 1mM La 60 1mM Gd3+ 1mM La3+ 1mM Gd3+ 40 40 40 40 NG NG TcdB La3+ Gd3+ La3+ TcdB Gd3+ 20 20 ↓ 20 ↓ 20 ↓ ↓ ↓ ↓ 0 0 0 0 PropidiumUptake (%Max) Propidium Uptake (%Max) Propidium Uptake (%Max) Uptake Propidium PropidiumUptake (%Max)
0 1020304050 0 1020304050 0 204060 0 204060 Time (min) Time (min) Time (min) Time (min)
EF30 min Post-Nigericin 45 min Post-TcdB GH30 min Post-Nigericin 45 min Post-TcdB *** 100 100 * 100 100 * 80 80 80 ** 80 *** ** 60 60 60 60 *
40 40 40 40
20 20 20 20 Cytolysis (% LDH Release) LDH (% Cytolysis PropidiumUptake (%Max) PropidiumUptake (%Max) 0 Release) LDH (% Cytolysis 0 0 0 + + + 3 3 + + + + + + + + 3 3 3 3 3+ 3 3 3 3 3 a La La d La La d a / L La a G + / G L + d + / d L + / 3 M M 3 G M 3 G M 3 M d m m d M d M m d M .2 .2 m 1m m .2 m 1m G 1 1 G 1 G .2 1 G 1 0 0 0 1 0
FIGURE 2.5. Lanthanides coordinately suppress both the caspase-1-dependent PM permeability change and pyroptotic lysis induced by NLRP3 and Pyrin inflammasome activation (A) LPS-primed WT BMDM were stimulated with NG (10μM) in the presence or absence of Gd3+ (1, 1.2, and 1.5mM) or (B) La3+ (1, 1.2, 1.5mM) for 45 min, and propidium2+ fluorescence was quantified every 3 min as described in Fig. 2.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (C) LPS-primed WT BMDM were stimulated with TcdB (0.4μg/mL) in the presence or absence of Gd3+ (1, 1.2, and 1.5mM) or (D) La3+ (1, 1.2, 1.5mM) for 60 min, and propidium2+ fluorescence was quantified every 4 min. Gd3+ and La3+ were added 20 min after TcdB (after the toxin has been internalized but prior to pyroptotic propidium2+ influx). These data represent the mean ± SE of 2-8 replicates from 6 independent experiments. (E) LPS-primed WT BMDM were stimulated with NG for 30 min in the presence or absence of 1.2mM Gd3+ or La3+, and the supernatants were subsequently assayed for LDH activity as described in Fig. 2.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (F) LPS-primed WT BMDM were stimulated with TcdB for 45 min in the presence or absence of 1mM Gd3+ or La3+, and the supernatants were subsequently assayed for LDH activity. Gd3+ and La3+ were added 20 min after TcdB. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (G) LPS- primed WT BMDM were stimulated as in (E). Propidium2+ fluorescence was quantified 30 min post-NG. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (H) LPS-primed WT BMDM were stimulated as in (F). Propidium2+ fluorescence was quantified 45 min post-TcdB. These data represent the mean ± SE of 8 replicates from 6 independent experiments. *, p<0.05. **, p<0.01. ***, p<0.001.
60 2.5A,B). Thus, the inhibitory effects of lanthanides on pyroptosis-induced PM permeabilization were defined by very steep concentration-response relationships with La3+ as a modestly more potent suppressor compared to Gd3+.
We verified that the lanthanides similarly suppressed the pyroptotic PM
permeability change induced by pyrin inflammasomes. In these experiments, the
BMDM were treated with increasing concentrations of Gd3+ or La3+ added 20 min
post-TcdB, which is after the toxin has been internalized but prior to initiation of
propidium2+ influx. 1mM Gd3+ or La3+ induced a marked suppression in the rate and magnitude of propidium2+ influx (Gd3+: ~30% mean suppression, La3+: ~60% mean suppression) (Fig. 2.5C,D). The efficacy of blockade was increased as the concentrations were increased to 1.2mM (Gd3+: ~60% mean suppression, La3+:
~70% mean suppression) and 1.5mM (Gd3+: ~90% mean suppression, La3+:
~90% mean suppression) (Fig. 2.5C,D). These results demonstrate that the lanthanides suppress pyroptotic propidium2+ influx downstream of two distinct
inflammasome signaling pathways.
We next determined whether the lanthanides also suppress the downstream
execution of pyroptotic cell death by assaying LDH release as an indicator of
lysis. WT BMDM stimulated with NG for 30 min (a time point corresponding to
active pyroptotic propidium2+ influx) in the presence of 1.2mM Gd3+ or La3+ released markedly less LDH compared to cells stimulated with NG in lanthanide- free medium (Fig 2.5E). In the presence of 1.2mM Gd3+ or La3+, the percent
suppression of LDH release (Gd3+: 67% mean suppression, La3+: 86% mean
suppression) was comparable to the percent suppression of NG-induced
61 propidium2+ influx (Gd3+: 70% mean suppression, La3+: 99% mean suppression)
over 30 min test periods (Fig. 2.5E,G). Pyroptotic cell death induced by TcdB-
stimulated pyrin inflammasome activation was similarly attenuated by the
lanthanides (Fig. 2.5F,H). In the presence of 1mM Gd3+ or La3+, the percent
suppression of LDH release (Gd3+: 48% mean suppression, La3+: 58% mean
suppression) was comparable to the percent suppression of propidium2+ influx
(Gd3+: 45% mean suppression, La3+: 71% mean suppression) (Fig. 2.5F,H).
Taken together these data demonstrate that – similar to the phenotype of
Gsdmd-deficient macrophages – inflammasome-activated WT BMDM are
characterized by a profound suppression in both caspase-1-mediated PM
permeabilization and downstream pyroptotic cell lysis in the presence of
lanthanides.
Lanthanides have previously been used to probe inflammatory signaling
responses in other inflammasome models. Yang et al. (177) found that Gd3+ did
not suppress LDH release in their model of caspase-11/Panx1-mediated
pyroptosis. However, that study tested only 100 μM Gd3+, a concentration that was also submaximal for blocking propidium2+ influx and LDH release in our
model of caspase-1/Gsdmd-mediated pyroptosis (Fig. 2.4). Compan et al. (183)
used 2 mM Gd3+ or 2 mM La3+ to block IL-1β release and YoPro2+ uptake in
response to hypotonicity-stimulated NLRP3 inflammasome activation. In that model, the lanthanides were employed to block activity of the TRPM7 and
TRPV2 ion channels, which functioned as upstream regulators of the volume-
sensitive caspase-1 activation response. This contrasts with our use of the
62 lanthanides to block downstream responses to caspase-1 activation by canonical
inflammasome stimuli. Lee et al. (184) employed 1 mM extracellular Gd3+ as an agonist for the G protein-coupled calcium-sensing receptor (CaSR) that was linked to NLRP3 inflammasome activation. In contrast, we observed no stimulatory effects of the lanthanides per se on pyroptotic signaling or inflammasome activation when added alone in the absence of nigericin (data not shown). A caveat in interpretation of the Lee et al. finding is that the Gd3+ was added to phosphate-containing medium, which can result in formation of insoluble gadolinium phosphate particles, phagocytosis of the particles, and subsequent lysosome destabilization, a known NLRP3 activation stimulus (44).
Interestingly, there was an escape from lanthanide suppression of lytic LDH release as the duration of NLRP3 or pyrin inflammasome stimulation was prolonged (Fig. 2.6A-C). Also, there was a more rapid escape from pyroptotic suppression in the presence of 1mM versus 1.2mM concentrations of Gd3+ or
La3+ during NG stimulation (Fig. 2.6A, B). This suggests either a time-dependent
loss in efficacy of lanthanide suppression and/or that signaling events
downstream of caspase-1/Gsdmd target the integrity of intracellular organelle
compartments, as well as the PM to facilitate the execution of pyroptotic cell
death.
In contrast to the escape from lanthanide suppression of LDH release with
longer duration (60 min) NG stimulation in WT BMDM (Fig. 2.6A, B), Gsdmd-/- C1 and Gsdmd-/- C2 iBMDM maintained complete suppression of LDH release at 60
min post-NG stimulation (Fig. 2.3D). Sustained suppression of lytic
63
FIGURE 2.6. Lanthanides delay the execution of pyroptotic cell death following NLRP3 or Pyrin inflammasome activation and do not inhibit Pyrin inflammasome activation (A) LPS-primed WT BMDM were stimulated with NG (10μM) in the presence or absence of 1mM Gd3+ or La3+ or (B) 1.2mM Gd3+ or La3+. At the indicated times, supernatants were assayed for LDH activity as described in Fig. 2.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (C) LPS-primed WT BMDM were stimulated with TcdB (0.4μg/mL) in the presence or absence of 1mM Gd3+ or La3+. Gd3+ and La3+ were added 20 min after TcdB. At the indicated times, supernatants were assayed for LDH activity. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (D) LPS-primed WT BMDM were stimulated with TcdB (0.4μg/mL) for 45 min in the presence or absence of Gd3+ or La3+ (0.3mM and 1mM). Gd3+ and La3+ were added 20 min after TcdB. The ECM and soluble lysate were analyzed on western blot for the presence of caspase-1. The soluble lysate was also probed for actin. The detergent insoluble fraction was DSS crosslinked and analyzed on western blot for the presence of oligomerized ASC. These data are representative of results from 3 experiments.
64 death in the absence of Gsdmd further suggests that, in addition to PM pyroptotic pore induction, Gsdmd may target other intracellular signaling responses that contribute to the pyroptotic cell death process.
We verified that lanthanides attenuate caspase-1 dependent pyroptotic signaling in iBMDM similarly to their actions in primary BMDM. As in primary WT
BMDM, concentrations of Gd3+ or La3+ greater than 1mM markedly attenuated
propidium2+ influx in WT iBMDM in response to NG (Fig. 2.4B, C). Likewise,
1.2mM Gd3+ or La3+ suppressed downstream lytic LDH release at 30 min post-
NG stimulation in WT iBMDM (Fig. 2.4D). However, at 60 min following NG stimulation, WT iBMDM exhibited an escape from lanthanide-suppression of LDH release similarly to primary WT BMDM (Fig. 2.4D).
Lanthanides do not block NLRP3 inflammasome activation or IL-1β release, whereas Gsdmd deficiency also does not block NLRP3 inflammasome activation but does block IL-1β release
To test whether the lanthanides might suppress downstream pyroptotic signaling by inhibiting upstream inflammasome assembly or activity, we assayed various indices of inflammasome activation in response to NG (Fig. 2.7) or TcdB
(Fig. 2.6D) stimulation in the presence of Gd3+ or La3+. Following 30 min of NG stimulation in the presence of 1, 1.2, 1.5mM Gd3+ or La3+ (concentrations that
suppress pyroptotic propidium2+ influx in a dose-dependent manner), WT BMDM
displayed intact ASC oligomerization (Fig. 2.7A), suggesting the assembly of an
ASC-containing inflammasome complex. Control experiments (data not shown)
65 A 30 min Post-Nigericin B 30 min Post-Nigericin C 30 min Post-Nigericin No Glycine + 5 mM Glycine No Glycine 5mM Glycine Primary BMDM Primary BMDM WTG1G2 WT G1 G2
Actin Actin Actin 53kDa Pro-Casp1 Pro-Casp1 Gsdmd Casp1, p20 Casp1, p20 31kDa Cell Lysate Cell Cell Cell Lysate
IL-1β, 17kDa Lysate Cell Casp1, p20 IL-1β, 17kDa * IL-1β, 17kDa
ASC ASC oligomers oligomers ASC oligomers
ASC dimer ASC dimer
ASC
Detergent Insoluble Pellet ASC ASC dimer monomer Detergent Insoluble Pellet monomer
Pro-Casp1 Pro-Casp1 Detergent Insoluble Pellet ASC Casp1, p20 Casp1, p20 monomer ECM ECM IL-1β, 17kDa IL-1β, 17kDa Casp1, p20
Nigericin (10uM) - + + + + + - + + + + + Nigericin (10uM) - + + + + + - + + + + + ECM IL-1β, 17kDa Gd3+ (mM) - - 0.3 1 1.2 1.5 ------Gd3+ (mM) - - 0.3 1 1.2 1.5 ------Nigericin (10μM) - + - + - + - + - + - + La3+ (mM) ------0.3 1 1.2 1.5 La3+ (mM) ------0.3 1 1.2 1.5
FIGURE 2.7. Lanthanides do not block NLRP3 inflammasome activation or IL-1β release, whereas Gsdmd deficiency also does not block NLRP3 inflammasome activation but does block IL-1β release (A) LPS-primed WT BMDM were stimulated with NG (10μM) for 30 min in the presence or absence of Gd3+ or La3+ (0.3, 1, 1.2, and 1.5mM). The ECM and soluble cell lysates were processed and analyzed on western blot for the presence of caspase-1 and IL-1β. The detergent insoluble fraction was DSS crosslinked and analyzed on western blot for the presence of oligomerized ASC. Western blot analysis of the soluble lysate for actin was also performed. These data are representative of results from 2 experiments. (B) LPS-primed WT BMDM were treated as in (A) in the presence of 5mM glycine. The ECM, soluble lysate, and detergent insoluble fraction were analyzed on western blot as described in (A). These data are representative of results from 2 separate experiments. (C) LPS-primed WT, Gsdmd-/- G1 (G1), and Gsdmd-/- G2 (G2) iBMDM were stimulated with NG for 30 min. The extracellular media (ECM) and soluble lysates were processed and analyzed on western blot for the presence of caspase-1 and IL-1β. Western blot analysis of the soluble lysate for Gsdmd and actin were also performed. The detergent insoluble fraction of the cell lysates were incubated with the chemical cross-linker disuccinimidyl suberate (DSS) and analyzed on western blot for the presence of ASC monomers, dimers, and oligomers. These data are representative of results from 2 experiments. *: non-specific band.
66 indicated that treatment of the BMDM with lanthanides alone produced no stimulatory or inhibitory effects on ASC oligomerization, caspase-1 activation, or
IL-1β release.
Increasing concentrations of Gd3+ or La3+ resulted in an enhanced retention of
processed caspase-1 in the cell lysate during 30 min incubations with NG (Fig.
2.7A). The production of processed caspase-1 in the presence of Gd3+ and La3+
further demonstrated that the lanthanides do not limit NLRP3 inflammasome
complex assembly and downstream caspase-1 activation. Notably, at the 1, 1.2,
and 1.5mM concentrations of Gd3+ or La3+, pro-caspase-1 was predominantly
retained in the cell lysate, whereas in the absence of Gd3+ and La3+ (or at the 300
μM concentration that does not suppress pyroptosis), some pro-caspase-1 was
released into the extracellular medium (ECM) (Fig. 2.7A).
We also examined the effect of lanthanide treatment on the extent of mature
IL-1β production as an additional index of inflammasome activation. Western blot analysis revealed that WT BMDM, stimulated with NG for 30 min in the presence of concentrations (>1 mM) of Gd3+ and La3+ that inhibit pyroptotic dye uptake,
generated and released mature IL-1β in amounts comparable to that observed in
the absence of lanthanides (Fig. 2.7A). This marked production of mature IL-1β
in the presence of Gd3+ and La3+ further demonstrates that the lanthanides do not
limit NLRP3 inflammasome activation. Importantly, the additional presence of
glycine to attenuate cell lysis did not modulate the effects of the lanthanides on
NG-stimulated NLRP3 inflammasome signaling and IL-1β export (Fig. 2.7B).
67 The inhibitory effects of lanthanides on pyroptotic signaling responses
downstream of inflammasome activation mostly mimicked the effects of Gsdmd
knockout with the following notable exception: release of caspase-1 processed
mature IL-1β to the extracellular compartment. We confirmed previous findings
(69) that Gsdmd-deficiency does not limit upstream inflammasome activation in
response to NG. WT, Gsdmd-/- G1, and Gsdmd-/- G2 iBMDM were stimulated with
NG for 30 min, and the formation of mature caspase-1 and IL-1β and the
oligomerization of ASC were assayed by western blot. The cell lysates of
unstimulated WT iBMDM, but not the Gsdmd-/- cells, contained full-length 53 kDa
Gsdmd that was extensively processed to the 31kDa N-terminal fragment
following NG stimulation; this is consistent with previous reports that active
caspase-1 cleaves Gsdmd to produce a 31kDa N-terminal pro-pyroptotic product
(67-69). Both WT and Gsdmd-/- iBMDM exhibited intact ASC oligomerization and
robust accumulation of processed caspase-1 and IL-1β (Fig. 2.7C), indicating
that Gsdmd mediates downstream pyroptosis but not upstream NLRP3
inflammasome activation.
Notably, mature IL-1β and caspase-1 were completely retained in the cell
lysates of the Gsdmd-/- iBMDM but were predominantly released into the
extracellular medium (ECM) fraction of WT iBMDM (Fig. 2.7C). Non-lytic IL-1β and caspase-1 release represented a major mode of export because comparable amounts of mature IL-1β and caspase-1 were present in the ECM fractions of
WT iBMDM in the presence or absence of glycine (Fig. 2.7C). Therefore, the
absence of Gsdmd does not simply prevent release of caspase-1 and IL-1β as a
68 consequence of blocked pyroptotic lysis, but also suppresses the non-lytic export of these cytosolic proteins that has been previously described in multiple models of inflammasome function (99, 100).
Whereas NG-stimulated Gsdmd-/- macrophages were characterized by
intracellular retention of both mature IL-1β and the p20 subunit of active capase-
1 (Fig. 2.7C), WT BMDM treated with NG in the presence of lanthanides retained
the active p20 caspase-1 in the cytosol but released mature IL-1β to the ECM. To
clarify how the absence of Gsdmd, but not the presence of lanthanides,
completely suppressed the release of IL-1β, we further investigated the effect of
lanthanide treatment on caspase-1 and IL-1β export. Interestingly, concentrations
of Gd3+ and La3+ that inhibit caspase-1-induced PM permeabilization (1, 1.2,
1.5mM) also greatly suppressed caspase-1 release but permitted robust IL-1β
release in response to 30 min of NG stimulation (Fig. 2.7A). Also, similar
amounts of 20 kDa caspase-1 and mature IL-1β were present in the ECM fraction in the presence and absence of the cytoprotectant glycine, which prevents cell lysis (Fig. 2.7A, B). These data suggest that Gsdmd knockout per se and lanthanide blockade of the Gsdmd-dependent PM permeability change regulate non-lytic caspase-1 and IL-1β export in distinct ways. Lanthanide inhibition of Gsdmd-induced PM permeabilization markedly limits non-lytic caspase-1 release; however, it permits robust IL-1β release, which further underscores an apparent role for Gsdmd in the non-lytic vesicular trafficking and export of IL-1β.
69 Similarly, following 45 min of TcdB stimulation in the presence of 1mM Gd3+ or La3+ (concentrations that suppress pyroptotic propidium2+ influx), WT BMDM also displayed intact ASC oligomerization and caspase-1 activation (Fig. 2.6D).
Although the presence of 1mM Gd3+ or La3+ did not prevent the formation of
processed caspase-1, the p20 fragment of caspase-1 and pro-caspase-1 were
retained in the cell lysate (Fig. 2.6D). Taken together these data demonstrate
that Gd3+ and La3+ do not suppress NLRP3 and Pyrin inflammasome activation or
caspase-1 activity, but rather inhibit the downstream pyroptotic signaling
processes.
Lanthanides reversibly block the caspase-1-dependent pyroptotic pores and
suppress pyroptosis
Given that Gd3+ and La3+ inhibit caspase-1-dependent PM permeabilization
without limiting inflammasome activation, we next investigated the mechanism by
which lanthanides target this PM permeability change. Because there is a narrow
time window between pyroptotic pore opening and subsequent lysis, we first
verified that lanthanides suppress pre-lytic pyroptotic propidium2+ influx prior to
end-stage lysis by stimulating WT BMDM with NG in the presence of glycine ±
1.5mM Gd3+ or 1.2mM La3+. A total of 1.5mM Gd3+ and 1.2mM La3+ almost
completely suppressed pyroptotic propidium2+ influx in the presence of glycine,
similar to the responses in the absence of glycine (Fig. 2.8A, B). Interestingly, the lanthanides were more potent as suppressors of pyroptosis-induced propidium2+
influx in the presence of glycine than in its absence (Fig. 2.9A-D). For example,
70 A B C D 80 Utx Utx 1.5mM Gd3+; -W Utx 1.2mM La3+; -W 80 Utx -Gly +NG +Gly +NG -Gly +NG +Gly +NG 80 80 3+ +NG; -W 1.5mM Gd3+; +W +NG; -W 1.2mM La3+; +W -Gly; 1.5mM Gd3+ -Gly; 1.2mM La 60 +Gly; 1.2mM La3+ +NG; +W +NG; +W 60 +Gly; 1.5mM Gd3+ 60 60 40 40 NG NG 40 NG 40 NG Gd3+ La3+ Gd3+ La3+ 20 ↓ 20 ↓ 20 ↓ 20 ↓ 0 0 0 0 Propidium Uptake (%Max) Uptake Propidium Propidium Uptake (%Max) Uptake Propidium PropidiumUptake (%Max) Wash(W) +PI PropidiumUptake (%Max) Wash(W) +PI 0 1020304050 0 1020304050 0 1020304050 0 1020304050 Time (min) Time (min) Time (min) Time (min) EF G H 3+ 80 Utx +TcdB 1.5mM Gd3+ T=20 80 Utx +TcdB 1.5mM La T=20 3+ 3+ 3+ 80 Utx +NG 1.5mM Gd T=0 80 Utx +NG 1.2mM La T=0 1.5mM Gd3+ T=30 1.5mM La T=30 1.5mM Gd3+ T=20 3+ 3+ 1.2mM La T=20 60 1.5mM Gd3+ T=30* 60 1.5mM La T=30* 1.5mM Gd3+ T=20* 3+ 60 60 1.2mM La T=20* 40 40 40 40 NG NG TcdB Gd3+ T=20 La3+ T=20 Gd3+ T=0 La3+ T=0 20 20 TcdB 20 ↓ 20 ↓ ↓ ↓ ↓ ↓ 0 0 0 0 PropidiumUptake (%Max) Propidium Uptake (%Max) Propidium Uptake (%Max) Uptake Propidium +Gd3+ T=20 +PI* +La3+ T=20 +PI* +Gd3+ T=30 +PI* (%Max) Uptake Propidium +La3+ T=30 +PI* 01020304050 0 1020304050 0204060 0204060 Time (min) Time (min) Time (min) Time (min)
FIGURE 2.8. Lanthanides reversibly block the caspase-1-dependent pyroptotic pores and suppress pyroptosis (A) LPS-primed WT BMDM were stimulated with NG (10μM) in the presence or absence of 5mM glycine and +/- 1.5mM Gd3+ or (B) 1.2mM La3+ for 45 min, and propidium2+ fluorescence was quantified every 3 min as described in Fig. 2.1. These data represent the mean ± SE of 4-6 replicates from 2-3 independent experiments. (C) LPS-primed WT BMDM were stimulated with NG in the presence or absence of 1.5mM Gd3+ or (D) 1.2mM La3+ for 45 min. At 15 min post-NG stimulation, wells containing WT BMDM, propidium2+, NG, and Gd3+/La3+ were either washed with PBS (+W) and replaced with fresh NaCl balanced salt solution (BSS) plus 1μg/mL of propidium2+ or not washed (-W). Propidium2+ fluorescence was quantified every 3 min. These data represent the mean ± SE of 4-6 replicates from 2-3 independent experiments. (E) LPS-primed WT BMDM were stimulated with NG in the presence or absence of 1.5mM Gd3+ or (F) 1.2mM La3+ for 45 min. Propidium2+ and lanthanides (Gd3+ or La3+) were added at different times during NLRP3 inflammasome activation, which included 1) propidium2+ and lanthanides added at the same time as NG (T=0; blue curve), 2) propidium2+ added at the same time as NG, and lanthanides added 20 min post-NG (T=20; green curve), or 3) lanthanides added 20 min post-NG, and propidium2+ added 5 min post-lanthanide addition (T=20*; magenta curve). Propidium2+ fluorescence was quantified every 3 min. These data represent the mean ± SE of 4-6 replicates from 3 (E) or 2 (F) separate experiments. (G) LPS-primed WT BMDM were stimulated with TcdB in the presence or absence of 1.5mM Gd3+ or (H) La3+ for 60 min. Propidium2+ and lanthanides were added at different times during Pyrin inflammasome activation, which included 1) propidium2+ added at the same time as TcdB, and lanthanides added 20 min post-TcdB (T=20; blue curve), 2) propidium2+ added at the same time as TcdB, and lanthanides added 30 min post-TcdB (T=30; green curve), or 3) lanthanides added 30 min post-TcdB, and propidium2+ added 5 min post-lanthanide addition (T=30*; magenta curve). Propidium2+ fluorescence was quantified every 4 min. These data represent the mean ± SE of 2-8 replicates from 2 independent experiments.
71 A B Utx Utx 80 80 3+ No glycine added 0 Gd 3+ No glycine added 0 La 3+ 3+ 60 300uM Gd 60 300uM La 600uM Gd3+ 600uM La3+ 40 800uM Gd3+ 40 NG 800uM La3+ NG La3+ 3+ Gd3+ 1mM Gd3+ 1mM La 20 20 ↓ 1.2mM Gd3+ ↓ 1.2mM La3+ 3+ 0 1.5mM Gd3+ 0 1.5mM La PropidiumUptake (%Max) Propidium Uptake(%Max)
0 1020304050 0 1020304050 C Time (min) D Time (min) 80 Utx 80 +5mM glycine Utx +5mM glycine 0 La3+ 0 Gd3+ 60 300uM La3+ 60 300uM Gd3+ 600uM La3+ 600uM Gd3+ 40 40 NG 3+ NG 3+ 800uM La 800uM Gd La3+ Gd3+ 20 1mM La3+ 20 1mM Gd3+ ↓ 1.2mM La3+ ↓ 1.2mM Gd3+ 0 3+ 0 3+ 1.5mM La 1.5mM Gd Uptake(%Max) Propidium Propidium Uptake (%Max) Uptake Propidium
0 1020304050 0 1020304050 Time (min) Time (min) EF G H 3+ 3+ 3+ 3+ 3+ 3+ 80 Utx -Gly 0 Gd +Gly 0 Gd 80 Utx -Gly 0 La +Gly 0 La 80 Utx -Gly 0 Gd +Gly 0 Gd 80 Utx -Gly 0 La3+ 3+ 3+ +Gly 0 La -Gly; 800uM Gd -Gly; 800uM La3+ -Gly; 1mM Gd3+ -Gly; 1mM La3+ 3+ 3+ 60 +Gly; 800uM Gd 60 +Gly; 800uM La 60 +Gly; 1mM Gd3+ 60 +Gly; 1mM La3+ NG NG 40 40 NG 40 40 NG Gd3+ La3+ Gd3+ La3+ 20 ↓ 20 ↓ 20 ↓ 20 ↓ 0 0 0 0 Propidium Uptake (%Max) Uptake Propidium Propidium Uptake (%Max) Uptake Propidium Propidium Uptake (%Max) Uptake Propidium Propidium Uptake (%Max) Uptake Propidium
0 1020304050 0 1020304050 0 1020304050 0 1020304050 Time (min) Time (min) Time (min) Time (min)
FIGURE 2.9. Lanthanides exhibit more potent suppression of pyroptotic propidium influx in the presence of glycine in a dose-dependent manner (A,C) LPS-primed WT BMDM were stimulated with NG (10μM) for 45 min in the presence of increasing Gd3+ and (B,D) La3+ concentrations in the (A,B) absence or (C,D) presence of 5mM glycine. Propidium2+ fluorescence was quantified every 3 min as described in Fig. 2.1. These data represent the mean ± SE of 4-8 replicates from 2-4 independent experiments. (E) LPS-primed WT BMDM were stimulated with NG (10μM) in the presence or absence of 5mM glycine and with or without 800μM Gd3+ or (F) La3+ for 45 min, and propidium2+ fluorescence was quantified every 3 min. (G) WT BMDM were stimulated as in (E) in the presence or absence of 1mM Gd3+ or (H) La3+, and propidium2+ fluorescence was quantified every 3 min. These data represent the mean ± SE of 4-6 replicates from 2-3 independent experiments.
72 800μM Gd3+ and La3+ partially suppressed the rate and magnitude of NG-
induced propidium2+ influx in the presence of glycine, but not in the absence of
glycine (Fig. 2.9E,F). Also, 1mM Gd3+ and La3+ were more efficacious in reducing the rate and magnitude of NG-induced propidium2+ influx in the presence of glycine versus in its absence (Fig. 2.9G,H). Together these data indicate that lanthanides target the pre-lytic PM permeability change induced by upstream caspase-1/Gsdmd signaling that may include: 1) gating of large pore channels already resident in the PM or 2) insertion of pore-forming proteins into the PM.
Previous studies have demonstrated that lanthanides can inhibit channels by either acting as competitive pore blockers (185-187) or by binding to anionic phospholipids to induce lateral compression of channels (188, 189). Lanthanides have similar cationic radii as Ca2+ enabling them to compete for binding within the selectivity filter of Ca2+ channels (185-187). Sukharev and colleagues have
reported that Gd3+ reversibly inhibits the large mechanosensitive channel (MscL) of E. coli by binding to anionic phospholipids (188). Gd3+ binding then alters
phospholipid packing and greatly increases the lateral pressure within the PM,
which forces MscL to adopt a closed conformation (188).
We designed experiments to determine whether the lanthanides reversibly
inhibit the pyroptotic pore/channel. After stimulating WT BMDM for 15 min with
NG in the presence of propidium2+ and 1.5mM Gd3+ or 1.2mM La3+, the
lanthanide-containing extracellular media was removed and replaced with fresh
propidium2+ containing media. The removal of Gd3+ and La3+ rapidly restored the
73 NG-induced propidium2+ influx (Fig 2.8C, D), suggesting that lanthanides
reversibly block the Gsdmd-dependent pyroptotic pore/channel.
Next, Gd3+/La3+ and propidium2+ were added at different times during the
course of NLRP3 or Pyrin inflammasome activation to investigate whether
lanthanides inhibit the presumed assembly/activation of the pyroptotic pore or the flux of permeant ions through an already assembled/activated pore. When
1.5mM Gd3+ or 1.2mM La3+ was added to WT BMDM during NG-induced
pyroptotic propidium2+ influx (T=20; 20 min post-NG), further dye uptake was
prevented (Fig. 2.8E,F). Similarly, adding 1.5mM Gd3+ or La3+ to WT BMDM
during TcdB-induced pyroptotic propidium2+ influx (T=30; 30 min post-TcdB)
prevented further dye uptake (Fig. 2.8G,H). Also, if 1.5mM Gd3+ or 1.2mM La3+ was added after NG-induced pyroptotic pore opening (20 min post-NG) and propidium2+ was added 5 min later (T=20*; propidium2+ added 5 min post- lanthanide addition), dye uptake was almost completely suppressed (Fig.
2.8E,F). Similarly, adding 1.5mM Gd3+ or La3+ after TcdB-induced pyroptotic pore opening (30 min post-TcdB) and then adding propidium2+ 5 min later (T=30*;
propidium2+ added 5 min post-lanthanide addition) also almost completely suppressed dye uptake (Fig. 2.8G,H). Residual dye uptake could reflect BMDM
that have already progressed to lytic cell death. Because Gd3+ and La3+
prevented further pyroptotic dye uptake and almost completely prevented any
pyroptotic dye uptake if propidium2+ was added after Gd3+ and La3+, direct pore
blockade and/or lateral compression of a pore/channel are plausible mechanisms
for how lanthanides reversibly inhibit activity of the pyroptotic pore/channel.
74 Utilizing the lanthanides as a tool to characterize the nature of the caspase-1
dependent PM permeability change suggests that Gd3+ and La3+ may reversibly
inhibit an already active Gsdmd-containing pore or pyroptotic pore/channel(s)
regulated by Gsdmd.
Pannexin-1, P2X7R, and certain TRP channel family members are not required
for caspase-1-dependent pyroptotic pore induction
Given the observed permeability characteristics and lanthanide sensitivity of
the pyroptotic pore/channels, we investigated the potential role of known large-
pore channels in mediating caspase-1-dependent pyroptosis. For example,
Panx1 is an important ATP release channel that adopts a large-pore
conformation upon activation and is also permeable to large DNA-intercalating
fluorescent dyes (182, 190). Interestingly, Panx1 channels can be gated by
apoptotic executioner caspases that excise an autoinhibitory domain from the
Panx1 cytosolic C-terminus (190). Núñez and colleagues recently reported that
Panx1 is also cleaved by caspase-11 to mediate caspase-11 dependent
pyroptosis in macrophages that accumulate cytosolic LPS (177). However, we
found that the Panx1 inhibitor trovafloxacin did not suppress NG-induced
pyroptotic propidium2+ influx in WT BMDM (Fig. 2.10A), suggesting that Panx1 is
not required for caspase-1-Gsdmd dependent pre-lytic pore activation in the context of canonical inflammasome-driven pyroptosis.
P2X7R is an ATP-gated non-selective cation channel that can adopt a large- pore conformation that is both permeable to large DNA-intercalating fluorescent
75 ABCD Utx No Inhibitor Utx No Inhibitor 80 80 A10606120 (10uM) WT 80 80 WT Trovaflox (30uM) A438079 (10uM) P2X7R-/- 60 P2X7R-/- 60 60 60 40 40 40 40 NG NG TcdB 20 20 20 NG 20 ↓ ↓ ↓ ↓ 0 0 0 0 PropidiumUptake (%Max) Propidium Uptake (%Max) PropidiumUptake (%Max) Propidium Uptake (%Max) Uptake Propidium
0 1020304050 0 1020304050 0 1020304050 0 1020304050 Time (min) Time (min) Time (min) Time (min) EFG Utx 100 WT 80 Utx No Inhibitor 80 1uM RR No Inhibitor 80 P2X7R-/- 60 30uM NS8593 60 1uM RR 60 30uM NS8593 40 40 40 NG TcdB NG 20 20 20 ↓ ↓ ↓ 0 0 0 PropidiumUptake (%Max) PropidiumUptake (%Max) Propidium Uptake (%Max) Cytolysis (% LDH Release) LDH (% Cytolysis
0 102030405060 0 1020304050 0204060 Time (min) Time (min) Time (min)
FIGURE 2.10. Pannexin-1, P2X7R, and certain TRP channel family members are not required for caspase-1-dependent pyroptotic pore induction (A) LPS-primed WT BMDM were stimulated with NG (10μM) for 45 min in the presence or absence of the pannexin-1 inhibitor trovafloxacin (30μM). These data represent the mean ± SE of 4 replicates from 2 independent experiments. (B) LPS-primed WT BMDM were stimulated with NG for 45 min in the presence of the P2X7R antagonists A10606120 (10μM) or A438079 (10μM). These data represent the mean ± SE of 4 replicates from 2 independent experiments. (C) LPS-primed WT or P2X7R-/- BMDM were stimulated with NG or (D) TcdB (0.4μg/mL) for 45 min. These data represent the mean ± SE of 3 replicates from 1 experiment. (A-D) Propidium2+ fluorescence was quantified every 3 (NG) or 4 (TcdB) min as described in Fig. 2.1. (E) LPS-primed WT or P2X7R-/- BMDM were stimulated with NG. At the indicated times, supernatants were assayed for LDH activity as described in Fig. 2.1. These data represent the mean ± SE of 2 replicates from 1 experiment. (F) LPS-primed WT BMDM were stimulated with NG for 45 min or (G) TcdB for 60 min in the presence of the TRPV channel inhibitor ruthenium red (RR: 1μM) or the TRPM7 channel inhibitor NS8593 (30μM). These data represent the mean ± SE of 2-4 replicates from 2 (F) or 1 (G) independent experiments. (F-G) Propidium2+ fluorescence was quantified every 3 (NG) or 4 (TcdB) min as described in Fig. 2.1.
76 dyes and inhibited by Gd3+ (182). ATP gating of the P2X7R also mediates
NLRP3 inflammasome activation by facilitating K+ efflux (44, 45, 191). Autocrine
activation of P2X7R by ATP released through Panx1 channels has also been implicated in mediating caspase-11 dependent pyroptosis (177). However, we found that the P2X7R antagonists A10606120 and A439079 did not suppress
NG-induced propidium2+ influx in WT BMDM (Fig. 2.10B). Similarly, P2rx7-/-
BMDM stimulated with NG or TcdB exhibited comparable rates and magnitudes of propidium2+ influx to those observed in WT BMDM (Fig. 2.10C,D). Consistent
with this, the absence of P2X7R did not suppress downstream LDH release in
response to NG (Fig. 2.10E). These data suggest that the P2X7R is also not
required for the caspase-1- and Gsdmd-dependent pre-lytic pore induction or
ensuing pyroptotic lysis downstream of canonical inflammasomes.
We also evaluated the roles of certain members of the TRP channel family,
which are non-selective ion channels in mediating caspase-1/Gsdmd-induced
pyroptosis given their expression in hematopoietic cells, sensitivity to
lanthanides, activation by multiple cell stressors, and roles in innate immunity
(181). Specifically, TRPV2 and TRPM7 have been implicated in NLRP3
inflammasome activation in response to hypotonic stress (183). TRPM7 can also
be proteolytically gated by apoptotic caspases and is involved in Fas-induced
apoptosis (192). TRPM2 is gated in response to oxidative stress (193), and
mitochondrial ROS production has been implicated in NLRP3 inflammasome
activation (56). In particular, mitochondrial ROS dependent-TRPM2 activation
was shown to mediate liposome/particulate induced NLRP3 inflammasome
77 activation (194). We observed that neither the broad TRP channel inhibitor ruthenium red nor the selective TRPM7 inhibitor NS8593 (195, 196) suppressed
NG- or TcdB-induced pyroptotic propidium2+ uptake (Fig. 2.10F,G). In another
recent study (197), we reported that Trpm2-/- BMDC stimulated with NG did not
exhibit reduced propidium2+ influx compared to that in WT cells. Taken together,
these experiments indicate that TRPV, TRPM7, or TRPM2 channels are not
required components of the caspase-1/Gsdmd-dependent pyroptotic pores.
DISCUSSION:
The identity of the caspase-1/11-induced pyroptotic pore/channel(s) remains
an elusive component of the pyroptotic cell death signaling cascade. Our findings
provide new and mechanistically significant insights regarding the nature of this
caspase-1 mediated PM permeability change. We have shown that caspase-1
dependent pyroptosis requires an initial non-lytic permeabilization of the PM that
involves the opening of a large, non-selective cation and anion permeable
pore/channel(s). Pyroptotic pore activation requires Gsdmd and the activity of the
pores can be reversibly inhibited by lanthanides. Furthermore, lanthanide
suppression of the caspase-1-and Gsdmd-dependent PM pore/channel has
uncovered potential roles for Gsdmd at other intracellular compartments to
facilitate pyroptotic cell death and modulate non-classical vesicular trafficking and
export of IL-1β.
Recent studies have demonstrated that the cleaved N-terminus of Gsdmd is
required for end-stage pyroptotic cell lysis (67-69). We have shown that Gsdmd
78 is not only necessary for the execution of pyroptotic cell death but is also
required for upstream pyroptotic pore induction because pyroptotic propidium2+
uptake does not occur in the absence of Gsdmd (Fig. 2.3C). Possible
mechanisms by which cleaved Gdsmd may induce the pyroptotic pore include: 1)
Gsdmd forms the pore, 2) Gsdmd functions as a chaperone that enables the
effective insertion of the pore into the PM, or 3) Gsdmd directly or indirectly
regulates the gating of a pyroptotic channel(s).
Activated caspase-1/11 cleaves cytosolic Gsdmd, which relieves the
autoinhibitory interaction between the N and C-terminus such that the N-terminus
can execute pyroptotic cell death (67-69). Necroptosis, a caspase-1/11-
independent mode of inflammatory lytic cell death, involves RIP3-mediated
phosphorylation of the cytosolic protein mixed lineage kinase domain-like
(MLKL). This drives MLKL oligomerization and insertion into the PM to execute
necroptotic cell death (198-200). Phosphorylation of the MLKL C-terminus
enables its dissociation from the N-terminal helical protein core, freeing the N-
terminus to oligomerize with other MLKL subunits and to insert into the PM to
form a death pore (201). This relief of an intramolecular interaction between the
C and N-termini of MLKL so that the N-terminus can serve a death executioner
function may be analogous to the possible mechanism(s) underlying Gsdmd-
mediated cell death. In such a model, cleaved Gsdmd N-terminal fragments may
similarly oligomerize and form pyroptotic pores to execute lytic cell death. Future
studies are necessary to address whether Gsdmd forms oligomers, localizes to
the PM, and can bind membrane lipids. If oligomers of Gsdmd form the pyroptotic
79 pores, it is possible that the pore size could vary under different conditions. Such
a scenario might explain the differential rates of propidium2+ versus EthD4+ dye uptake in response to stimulation with TcdB versus NG (Fig. 2.2A,B). Another similarity between the PM permeability changes induced by necroptosis and pyroptosis is that La3+ also suppresses necroptotic propidium2+ accumulation
(198). Therefore, lanthanides may function to broadly inhibit large oligomerized
protein pores, such as MLKL during necroptotic signaling and, possibly, Gsdmd-
containing pores during pyroptotic signaling.
We used the lanthanides Gd3+ and La3+ as reagents to characterize the
caspase-1-Gsdmd dependent change in PM permeability. Gd3+ and La3+ are known to broadly target large-pore, non-selective cation permeable channels
(181, 182). Because lanthanides have similar cationic radii as Ca2+, they
competitively block the selectivity filter of Ca2+ channels (185-187). Gd3+ can
reversibly inhibit mechanosensitive bacterial channels (188) by a mechanism that
involves binding to anionic phospholipid head groups to exert lateral compression
on the channels and thereby result in a closed-pore conformational state (188).
We found that millimolar concentrations of lanthanides rapidly and reversibly
inhibit the non-lytic, pyroptosis-induced propidium2+ influx (Fig. 2.8A-D). The
presence of glycine also enhanced the potency of lanthanides as suppressors of
pyroptotic propidium2+ uptake (Fig. 2.9A-D); this could reflect a selective blocking
effect of extracellular lanthanides on activity of the PM pyroptotic pore but not
intracellular signaling processes that also contribute to pyroptotic lysis. In the
absence of glycine, a higher concentration of Gd3+ and La3+ is required to
80 effectively inhibit propidium2+ influx and corresponding downstream lysis. If
pyroptotic propidium2+ uptake has already been initiated, La3+ and Gd3+ act to
prevent further dye uptake; lanthanides also completely block influx of dye added
after assembly/activation of the PM pore (Fig. 2.8E-H). Taken together these
pharmacologic studies suggest a model of the pyroptotic pore as either an
inserted pore-forming protein or a PM resident channel that is gated by
accumulation of cleaved Gsdmd. The data further suggest that lanthanides act
either to directly block or to laterally compress the pore to a closed conformation
upon binding to anionic phospholipid head groups.
Other than functioning as a direct pore-forming protein, Gsdmd may be
involved in regulating intrinsic PM proteins that act as pyroptotic pore/channel(s).
Núñez and colleagues recently identified P2X7R and Panx1 as important
mediators of caspase-11 dependent pyroptosis (177). They showed that
intracellular LPS-induced activation of non-canonical inflammasome signaling
involved caspase-11-dependent Panx1 cleavage that enabled both K+ efflux and
ATP release (177). K+ efflux subsequently triggered NLRP3 inflammasome activation and caspase-1 dependent IL-1β processing and release (177).
Autocrine P2X7R activation by the released ATP was required to mediate caspase-11 dependent pyroptosis because LDH release was suppressed in the absence of P2X7R expression or the presence of P2X7R antagonists (177).
However, in our model of caspase-1 dependent pyroptosis, the absence of
P2X7R, the presence of P2X7R antagonists, or the presence of trovafloxacin (a
selective Panx1 inhibitor) did not suppress pyroptotic propidium2+ uptake (Fig.
81 2.10A-D). Because the absence of P2X7R also did not prevent downstream LDH
release (Fig. 2.10E), these data indicate that neither P2X7R nor Panx1 is an
obligatory component of the caspase-1-Gsdmd-mediated pyroptotic cascade.
Given that Gsdmd is a substrate of caspase-11 and necessary for caspase-11 mediated pyroptosis (67, 68), future studies should investigate whether Gsdmd
regulates Panx1 and/or P2X7R activation as part of the caspase-11 triggered
non-canonical inflammasome pathway. Dixit and colleagues demonstrated that caspase-1 activation and processing of IL-1β downstream of non-canonical inflammasome activation depend on Gsdmd (68), suggesting that Gsdmd may regulate or mediate the Panx1-dependent K+ efflux that drives NLRP3
inflammasome activation secondary to LPS-induced caspase-11 activation.
We investigated TRPM2, TRPV2, and TRPM7 as potential pyroptotic channel
candidates due to their known sensitivity to lanthanides and their reported links to
NLRP3 inflammasome regulation (183, 194). Additionally, TRPM7 can be
proteolytically gated by apoptotic caspases (192). However, we found no critical
roles for any of these TRP-family channels in pyroptotic pore function based on either genetic or pharmacologic approaches (Fig. 2.10F,G). However, TRP channels comprise a large superfamily of non-selective cation channels with 27 members in humans. Therefore, an as-of-yet untested TRP-family channel may be involved in pyroptosis.
Members of the CALHM channel family represent other plausible pyroptotic channel candidates given the known function of CALHM1 as a large pore channel. The CALHM family includes six human homologs. CALHM1 is a
82 voltage-sensitive channel that is responsive to the removal of extracellular
calcium and implicated in cortical neuronal excitability (202). It is a non-selective cation- and anion-permeable, large-pore channel with a diameter of 14 angstroms (1.4nm) (203) which is similar to the estimated size range of the pyroptotic pore. It is also sensitive to Gd3+ and is an important ATP-release
channel that is involved in taste perception (204).
In addition to Gsdmd’s role in mediating the permeability change at the PM,
our experiments suggest that it may also regulate intracellular functions that
contribute to pyroptotic cell lysis. Although lanthanides markedly delayed
pyroptotic lysis of WT BMDM and iBMDM, the cells slowly progressed to lytic
collapse with prolonged (60 min) NG-stimulated NLRP3 inflammasome signaling
despite complete blockade of ionic flux through the PM pore (Figs. 2.4, 2.6). In
contrast, Gsdmd-/- iBMDM did not exhibit escape from suppression of lytic LDH
release during similar prolonged NG stimulation (Fig. 2.3D). After >2 h of
stimulation, Gsdmd-/- iBMDM increasingly progress to apoptosis and then
secondary necrosis (Fig. 2.3E). This difference between the effects of Gsdmd
knockout and lanthanide blockade of the pyroptotic pore on the rate of pyroptotic
lysis indicates multiple roles for Gsdmd in integrating pyroptotic signaling downstream of inflammasome activation. Another member of the Gsdm family
Gsdma3 has been shown to facilitate mitochondria-dependent cell death (136).
Gain of function mutations in the C-terminus of Gsdma3 relieve its autoinhibitory interaction with the N-terminus (136). The N-terminal exposed Gsdma3 is recruited to mitochondria to mediate mitochondrial permeability transition (MPT)
83 and ROS production which disrupts mitochondrial ATP production and drives cell
death (136). It is relevant to note that activation of NLRP3 or AIM2
inflammasomes leads to a similar caspase-1-dependent mitochondrial damage
(increased ROS production and dissipation of mitochondrial membrane potential)
(153). Therefore, cleaved Gsdmd may associate with mitochondria, similar to
activated Gsdma3, which disrupts mitochondrial homeostasis and accelerates
cell death. Phosphorylated MLKL, which accumulates during the execution of
necroptotic lysis, also associates with intracellular organelles, like the
mitochondria, lysosome, and ER, in addition to the PM (199). If Gsdmd functions
similarly to MLKL, it is possible that cleaved Gsdmd may localize to various
organelles to perturb their homeostatic function and thereby modulate
progression of pyroptotic cell death.
In contrast to lanthanides, which inhibit the PM pyroptotic pore but not the
additional intracellular functions that may contribute to pyroptosis, glycine does not suppress the altered PM permeability to ions and large dyes (Figs. 2.1, 2.2) but does dramatically delay end-stage lytic pyroptotic cell death. In previous
studies of maitotoxin-induced oncotic/necrotic cell death of endothelial cells,
glycine was shown to permit non-lytic PM permeability increases to Ca2+ and cationic dyes, as well as extensive cell swelling, but to prevent end-stage lysis as assayed through LDH release or GFP loss (173). Because glycine did not suppress the pre-lytic PM permeability to propidium2+, EthD4+, Ca2+, or adenine
nucleotides during inflammasome activation (Figs. 2.1, 2.2), but did prevent LDH release, our data suggest that glycine may preserve the functional integrity of
84 intracellular organelles to greatly delay progression to end-stage pyroptotic lysis.
Mootha and colleagues demonstrated that rapidly proliferating cancer cells
exhibited a high extent of glycine consumption (205). If enzymes involved in
glycine biosynthesis were knocked down, the proliferative capacity of these
cancer cells would decrease (205). They also demonstrated that glycine supports
a high proliferative capacity of cancer cells by promoting synthesis of purine
nucleotides, including ATP (205). During pyroptosis, the caspase-1- and Gdsmd-
dependent PM permeabilization will disrupt normal ionic homeostasis and
thereby place a large osmotic stress on macrophages. The resulting ionic and
osmotic dysregulation will result in enhanced ATP-driven Na+/K+ pump activity
which, in turn, will place a large metabolic stress on the cell. Future studies
should test whether the presence of glycine may sustain ATP synthesis and
thereby preserve cellular energetics to delay end-stage pyroptotic cell lysis.
In addition to Gsdmd’s role in the execution of pyroptotic cell death, it was also critical for the release of mature caspase-1 and IL-1β into the extracellular environment, but not the intracellular processing of these proteins (Fig. 2.7C).
Shao and colleagues also observed that the absence of Gsdmd prevented IL-1β
export without affecting its processing following canonical inflammasome
activation (67). Gsdmd may be critical for IL-1β release as a secondary
consequence of mediating end-stage pyroptotic lysis; however, our experiments with glycine, which preserves IL-1β and caspase-1 release while suppressing macrophage lysis (Fig. 2.7), suggest that Gsdmd may additionally regulate non- lytic IL-1β export. Potential modes of non-lytic release of IL-1β include secretory
85 lysosome exocytosis, microvesicle shedding, multivesicular body formation and fusion with the PM to release exosomes, and autophagy (99, 100). Cookson and colleagues also suggested that direct IL-1β efflux via pyroptotic pores may represent a potential non-lytic release mechanism (76). We tested this possibility
by assaying IL-1β and caspase-1 release in the presence of Gd3+ and La3+, which block ionic fluxes through the pyroptotic pore. At concentrations that inhibit
pyroptotic pore function, lanthanides markedly suppressed the release of mature
caspase-1 but not the export of IL-1β (Fig. 2.7A,B). This suggests that IL-1β and
caspase-1 are exported via distinct pathways. In an early investigation of IL-1β
and caspase-1 export mechanisms, Kostura and colleagues used electron
microscopy of monocytes stimulated with heat-killed Staphylococcus aureus to
show that immunogold labeled precursor and processed caspase-1 and IL-1β
decorated the external surface of the PM (206). This suggested that caspase-1 and IL-1β may associate with PM pores to facilitate their export. Taken together,
our comparisons of how Gsdmd-knockout versus the presence of lanthanides or glycine differentially affect IL-1β and caspase-1 export suggest that Gsdmd regulates both non-lytic and lytic mechanisms of release of these inflammatory proteins. In terms of non-lytic export, Gsdmd-dependent pyroptotic pore formation may facilitate caspase-1 and IL-1β permeation through the pore. IL-1β may utilize additional Gsdmd-dependent vesicular trafficking mechanisms because robust IL-1β release is observed during pyroptotic pore inhibition by lanthanides, while the absence of Gsdmd greatly reduces IL-1β export. If cleaved
Gsdmd traffics to intracellular organelles, such as mitochondria, to facilitate
86 pyroptotic cell death, analogous to activated Gsdma3 recruitment to mitochondria
(136), it is plausible that Gsdmd may also traffic to the recycling endosomal compartments implicated in non-canonical IL-1β release.
In summary, we have characterized the nature of the caspase-1 dependent
PM permeability change as a lanthanide-sensitive, Gsdmd-dependent non- selective pore or channel permeable to relatively large organic cations and anions. Gsdmd protein may either comprise the critical subunits of such pores or regulate other proteins that comprise the pyroptotic pores. Gsdmd also facilitates the non-lytic vesicular trafficking and release of IL-1β and may modulate the integrity of intracellular organelles that contribute to the execution of pyroptotic cell death. Whether Gsdmd specifically localizes at the PM and/or other intracellular organelles and how that impacts cellular function and execution of cell death remains to be defined.
87
CHAPTER 3
Active Gasdermin D mediates ROS-dependent
pyroptotic death signaling during NLRP3
inflammasome activation
88 ABSTRACT:
Active caspase-1 cleaves gasdermin D (Gsdmd) to relieve an autoinhibitory
interaction between the N and C-termini enabling N-terminal Gsdmd (N-Gsdmd)
fragments to oligomerize, insert into the plasma membrane (PM) as lytic pores, and execute pyroptotic cell death. Whether N-Gsdmd also partitions into the membranes of intracellular organelles to facilitate pyroptotic cell death signaling remains undefined. We stimulated WT, Gsdmd-/-, and Nlrp3-/- immortalized
macrophages (iBMDMs) with the NLRP3 inflammasome activator nigericin (NG), and also used lanthanum (La3+) as an inhibitor of PM pyroptotic pore activity to
investigate the contribution of intracellular PM pore-independent perturbations to
active Gsdmd-mediated cell death. The absence of Gsdmd expression
attenuated NG-induced decreases in redox homeostasis and intracellular ATP
content. Inflammasome activation of WT iBMDMs in the presence of La3+
demonstrated that N-Gsdmd disrupts redox homeostasis and causes a decline in
intracellular ATP content via PM pore-dependent and -independent mechanisms.
Inhibition of N-Gsdmd PM pore activity with La3+ uncovered a ROS-driven
component of pyroptotic cell death that could be suppressed by the ROS
scavenger N-acetylcysteine (NAC). NG perturbed mitochondrial respiration
independently of Gsdmd and NLRP3, but mediated rapid lysosomal damage in a
Gsdmd-dependent manner. Together these data suggest that in a setting of
suppressed PM pyroptotic pore activity, NG stimulation induces an active
Gsdmd-mediated and ROS-dependent death signaling cascade that may in part
be driven by N-Gsdmd-dependent lysosomal disruption. This study highlights the
89 potentially extensive scope of active Gsdmd-mediated cellular dysregulation,
which should be considered in developing therapies that target Gsdmd-mediated
pyroptosis.
90 INTRODUCTION:
Inflammatory caspases, including caspase-1, murine caspase-11 and its human orthologs caspase-4/5, drive a lytic mode of cell death called pyroptosis.
Activation of caspase-1 requires the assembly and oligomerization of multi- protein canonical inflammasome complexes, which occurs in response to a wide variety of cellular stressors and microbial stimuli (207). Caspase-11/4/5 activation requires the oligomerization of their pro-forms following direct binding to intracellular LPS (10). Productive pyroptotic cell death allows for proper host defense against intracellular bacterial infections (58). Jorgensen et al. have provided recent insight that bacteria remain trapped within pyroptotic macrophage corpses, termed pore-induced intracellular traps (PITs); this facilitates efficient bacterial clearance by recruited neutrophils that phagocytose the dead macrophage plus entrapped bacteria (61). However, hyperactive pyroptotic responses can contribute to sepsis and septic shock (208).
Recently, multiple studies have characterized the role of gasdermin D
(Gsdmd) in executing pyroptotic cell death (67-73, 209, 210). Active caspase-1 and 11/4/5 cleave full-length Gsdmd relieving the autoinhibitory interaction between the N and C-termini (67). This exposes four basic residues (RKRR) on cleaved N-terminal Gsdmd that are responsible for its oligomerization and binding to inner leaflet plasma membrane (PM) phospholipids, including phosphatidylinositols and phosphatidylserine (70, 71). Current studies clarifying the architecture of N-terminal Gsdmd (N-Gsdmd)-containing pores have utilized synthetic liposomes and liposomes derived from either bacterial or bovine lipid
91 membranes (70-73). Insertion of N-Gsdmd leads to the formation of arcs, slits, and ring-shaped pores within E. coli polar lipid-derived liposomes (73). The diameters of Gsdmd-containing pores are about 15 nm within phosphatidylserine liposomes (71), 2-20 nm within cardiolipin liposomes (70), and 10-40 nm within
E. coli polar lipid-containing liposomes (73); this size potentially permits the direct permeation of macromolecular inflammatory mediators such as IL-1β, which accumulates in the cytosol during proteolytic processing into its mature form by active caspase-1. Formation of N-Gsdmd PM pores also enables a rapid disruption in ionic homeostasis, osmotic swelling and lysis, and a massive release of normally cytosolic DAMPs (Danger-Associated Molecular Patterns) that are potent inflammatory mediators (211). The absence of Gsdmd protects
against LPS-induced lethal sepsis in mice (68).
Interestingly, extracellular N-Gsdmd cannot disrupt eukaryotic host cell membranes because the outer leaflet of the PM bilayer lacks the appropriate phospholipid composition (70). However, extracellular N-Gsdmd can disrupt bacterial cell membranes because it strongly binds to cardiolipin (70, 71), suggesting a potential bactericidal role for externalized N-Gsdmd. In addition, Liu et al. demonstrated that cells infected with L. monocytogenes and concurrently expressing active Gsdmd are characterized by a reduced intracellular bacterial burden (71).
In humans, GSDMD is a member of the GSDM gene family, which also includes GSDMA, GSDMB, GSDMC, DFNA5, and DFNB59 (133). The murine genome consists of Gsdma1-3, Gsdmc1-4, Gsdmd, Dfna5h, and Dfnb59 (133).
92 Gsdmd is the only Gsdm family member protein that can be cleaved by
inflammatory caspase-1/11/4/5 (67). Recently, apoptotic executioner caspase-3
was shown to cleave Dfna5 to mediate secondary necrosis (140). Gasdermin B
(Gsdmb) can also be cleaved by effector caspases; however, cleavage is not
required for its phospholipid binding property (138).
We recently reported that extracellular lanthanides (La3+, Gd3+) can be
used as pharmacological inhibitors of pyroptotic Gsdmd pore activity in primary
bone marrow-derived macrophages (BMDMs) (refer to Chapter 2). Although
lanthanides initially suppress lytic death during inflammasome activation, the
BMDMs eventually progress to pyroptotic cell lysis (210). This finding suggests
that N-Gsdmd may disrupt the homeostatic functions of other intracellular
membrane-bound compartments to contribute to pyroptotic cell death. For
example, cardiolipin is a major component of the inner mitochondrial membrane.
Agents that disrupt mitochondrial homeostasis result in the cytosolic exposure
and externalization of cardiolipin on the outer mitochondrial membrane (212). In
a study performed prior to the identification of Gsdmd as a critical pyroptotic
executioner, Horng and colleagues demonstrated that activation of AIM2 and
NLRP3 inflammasomes results in caspase-1-dependent mitochondrial damage
(153). It is now relevant to consider whether this action of caspase-1 is more
directly mediated by Gsdmd. Notably, the N-terminal domain of another member
of the Gsdm family, Gsdma3, was shown to drive a mitochondrial and ROS-
dependent cell death (136, 137). In addition to mitochondria, NLRP3
93 inflammasome activation has been linked to NLRP3-dependent lysosomal
disruption (148).
In this study, we reveal another role for active Gsdmd besides its function
as a lytic pore in the PM. In the setting of nigericin-induced NLRP3
inflammasome signaling, N-Gsdmd can also disrupt intracellular compartment(s)
to enhance oxidative stress and contribute to pyroptotic cell death. The absence
of Gsdmd promoted redox homeostasis and helped maintain intracellular ATP
content. Pharmacologically inhibiting the Gsdmd-containing PM pore with
lanthanum demonstrated that active Gsdmd disrupts redox homeostasis via PM
pore-dependent and -independent mechanisms. This inhibition of pyroptotic pore
activity uncovered a ROS-dependent component of Gsdmd-mediated lytic cell
death that can be suppressed by the ROS scavenger N-acetylcysteine (NAC). In
the context of nigericin-induced NLRP3 inflammasome signaling, an intracellular
compartment other than the mitochondria is likely contributing to Gsdmd-
mediated oxidative stress since disruption of mitochondrial respiration was
Gsdmd-independent. Although the overall extent of lysosomal disruption was
similar in the presence and absence of Gsdmd, NLRP3 inflammasome signaling
did result in an early stage, rapid lysosomal damage that was Gsdmd-dependent,
suggesting that Gsdmd-mediated lysosomal damage may in part contribute to
pyroptotic cell death.
94 MATERIALS AND METHODS:
Reagents - Key reagents and their sources were: Escherichia coli LPS serotype
O1101:B4 (List Biological Laboratories), nigericin (NG; APExBio), glycine
(Fisher), LaCl3 (Fisher), N-acetylcysteine (NAC: Sigma), zDEVD-fmk (APExBio),
H-Leu-Leu-OMe HBr (LLOMe: Bachem), ouabain (OB: Sigma), anti-P2X7R (C-
term: Alomone), anti-GAPDH (Sigma), anti-GSDMDC1 mouse mAb (A-7), anti-
Tom20 (FL-145), and all HRP conjugated secondary Abs (Santa Cruz
Biotechnology), alamarBlue® cell viability reagent (Life Technologies/Invitrogen),
MitoSOX™ Red mitochondrial superoxide indicator (Molecular
Probes/Invitrogen), propidium iodide (Pro2+; Life Technologies), CellTiter-Glo® luminescent cell viability assay (Promega), lactate dehydrogenase (LDH) cytotoxicity detection kit (Takara Bio Inc), and XFp cell mito stress test kit (Agilent
Technologies/Seahorse Bioscience).
Murine iBMDM model and cell culture - NLRP3-FLAG overexpressing, ASC- mCerulean immortalized NLRP3 KO murine macrophages (iBMDMs) were provided by Eicke Latz (University of Bonn, Bonn, Germany). Nlrp3-/- iBMDMs
were provided by Edward Greenfield (Case Western University). iBMDMs were
cultured in DMEM (Sigma-Aldrich) supplemented with 10% heat inactivated
bovine calf serum (HyClone Laboratories), 100U/mL penicillin, 100μg/mL
streptomycin (Invitrogen), and 2mM L-glutamine (Lonza). iBMDMs were plated
on 10cm, 24-well, or 96-well plates at 1 x 106 cells/mL, and used within 2 days.
95 Generation of CRISPR GSDMD-/- iBMDMs - A CRISPR-Cas9 guide against
Gsdmd was inserted into the lentiCRISPRv2 plasmid (163, 164) with puromycin
resistance protein replaced with a hygromycin resistance cassette (213).
CRISPR Oligonucleotides: Gsdmd guide 1-F 5’-
CACCGCAGAGGCGATCTCATTCCGG-3’, Gsdmd guide 1-R 5’-
AAACCCGGAATGAGATCGCCTCTGC -3’, Gsdmd guide 2-F 5’-
CACCGTGAAGCTGGTGGAGTTCCGC-3’, Gsdmd guide 2-R 5’-
AAACGCGGAACTCCACCAGCTTCAC-3’. Plasmid lentiCRISPRv2 containing
each guide were co-transfected into 293T cells with packaging plasmids PsPax
and PMD2. iBMDMs were transduced with virus for 2 days and selected with
hygromycin. Clonal cells were isolated and loss of Gsdmd verified by western
blot (210).
Priming and stimulation of iBMDMs - iBMDMs were primed with 1μg/ml LPS for
2-4 h at 37°C. LPS containing media was then replaced with a Ca2+-containing
balanced salt solution (BSS) (130mM NaCl, 4mM KCl, 1.5mM CaCl2, 1mM
MgCl2, 25mM Na HEPES, 5mM D-glucose [pH 7.4]). BSS contained 0.1% bovine serum albumin (BSA) for all assays except for western blot sample preparation, which contained 0.01% BSA. iBMDMs were stimulated with 10μM NG for varying
lengths of time as indicated. For La3+ and NAC inhibition studies, iBMDMs were treated with 2.5mM NAC and/or 1.2mM La3+ immediately prior to stimulation with
NG. For DEVD or OB inhibition studies, iBMDMs were pre-treated with 50μM
DEVD or 125μM OB for 5 min prior to NG stimulation.
96
Subcellular Fractionation and Western blot analysis – Subcellular Fractionation
was adapted from a previously described protocol by Abcam:
http://www.abcam.com/ps/pdf/protocols/ subcellular_fractionation.pdf. Briefly,
WT iBMDMs were plated in iBMDM culture media on a 10cm plate (10 x 106 cells/plate). Day 1 post-plating, fresh media was added. Day 2 post-plating, WT iBMDMs were in the presence or absence of LPS for 4 h. The cells then remained untreated or were stimulated with NG for 30 min in the presence of
0.01% BSA, Ca2+-containing BSS. Next, the supernatant was removed and
replaced with a sucrose-containing isotonic subcellular fractionation buffer (SF
buffer: 250mM sucrose, 20mM HEPES (pH 7.4), 10mM KCl, 1.5mM MgCl2, 1mM
EDTA, 1mM EGTA, 1mM DTT, plus protease inhibitor mixture). Samples
underwent Dounce homogenization followed by differential centrifugation as
described in the Fig. 1A schematic. 45μL of RIPA lysis buffer (0.5% sodium deoxycholate, 0.1% SDS, 1% IgePal CA630 in PBS, pH 7.4, plus protease inhibitor mixture) was added to the P10 and P100 sedimentable fractions. The
P10, P100, and S100 faction underwent standard processing by SDS-PAGE, were transferred to a PVDF membrane, and Western blot analysis was
performed. Primary antibodies were used at the following concentrations:
0.4μg/mL for Gsdmd, 0.4μg/mL for Tom20, 0.6μg/mL for P2X7R, 1:50,000
dilution for GAPDH, and HRP-conjugated secondary Abs were used at a final
concentration of 0.13μg/mL. Chemiluminescent images of Western blots were developed using a FluorChemE processor (Cell Biosciences).
97
Alamar blue metabolism assay – iBMDMs were plated on black, clear-bottom 96-
well plates (1 x 105 cells/well). Alamar blue metabolism was measured and
quantified as previously described (144).
MitoSOX fluorescence assay – LPS-primed iBMDMs in 24-well plates (5 x 105
cells/well) were briefly washed with PBS prior to adding Ca2+-containing or Ca2+- free BSS supplemented with 5μM MitoSOX. Baseline fluorescence (508 nm excitation −> 600 nm emission at 30 s intervals) was first recorded with a
Synergy HT plate reader (BioTek) preheated to 37°C for 10 min. iBMDMs were treated as indicated, and the changes in fluorescence were recorded every 30 s.
Intracellular ATP content assay – iBMDMs were plated on clear 96-well plates (1 x 105 cells/well). They were treated as indicated and intracellular ATP content
was measured using a CellTiter-Glo luminescent cell viability assay (Promega)
according to the manufacturer’s protocol. Samples were transferred to a 96-well
opaque-walled plate prior to measuring luminescence with a Synergy HT plate
reader (BioTek) at room temperature. Luminescence was normalized to the
values measured in control, LPS-primed iBMDMs.
Propidium2+ influx assay of pyroptotic plasma membrane permeabilization - LPS- primed iBMDMs in 24-well plates (5 x 105 cells/well) were briefly washed with
PBS prior to adding Ca2+-containing BSS supplemented with 1μg/mL propidium
98 iodide (Pro2+). Baseline fluorescence (540 nm excitation −> 620 nm emission at
30 s intervals) was first recorded with a Synergy HT plate reader (BioTek) preheated to 37°C for 5 min. Cells were stimulated with 10μM NG in the presence or absence of 2.5mM NAC for 45 min, and the changes in fluorescence were recorded every 30 s. Dye uptake assays were terminated by permeabilizing the PM with 1% Triton X-100 to quantify maximum fluorescence. Fluorescence was expressed as a percentage of maximum fluorescence measured in Triton X-
100-permeabilized cells after subtraction of basal intrinsic fluorescence.
Cytotoxicity assay (LDH release) - LPS-primed iBMDMs in 24-well plates (5 x 105 cells/well) were treated as indicated at 37°C. Supernatants were removed and centrifuged at 15,000 x g for 15 s to pellet detached cells. Cell-free supernatants were assayed for LDH activity (Takara Bio Inc) according to the manufacturer’s protocol. The released LDH was expressed as a percentage of total LDH content following 2% Triton X-100 induced permeabilization of unstimulated LPS-primed cells.
Mitochondrial oxygen consumption analyses – iBMDMs were plated in 8-well
XFp miniplates (80,000 cells/well) in 200μL of iBMDM culture media with the top and bottom well containing no cells. A mito stress test was performed in the presence and absence of NG stimulation using an XFp analyzer (Agilent
Technologies/Seahorse Bioscience) according to the manufacturer’s protocol.
Briefly, a utility plate containing calibrant solution together with a sensor cartridge
99 was placed in a CO2-free incubator at 37°C overnight. The next day, media was
removed from LPS-primed iBMDMs and replaced with XF base media
supplemented with 10mM glucose, 1mM pyruvate, and 2mM glutamine. iBMDMs
were then placed in a CO2-free incubator at 37°C for 1 h. Mitochondrial inhibitors
(oligomycin, FCCP, and rotenone/antimycin A) and NG were added to the appropriate injector ports of the sensor cartridge. The sensor cartridge together with the utility plate was run on the XFp analyzer for calibration. The utility plate was then replaced with the XFp miniplate containing plated iBMDMs and run on the XFp analyzer. Also, the change in oxygen consumption rate (OCR) in response to the presence or absence of NG was measured for 90 min followed
by the addition of rotenone/antimycin A.
Lysosomal membrane permeabilization assay – iBMDMs were plated in 24-well plates (5 × 105 cells/well), and the next day were loaded with FITC-dextran and
assayed for LLOMe and NG-induced changes in FITC-dextran fluorescence as
described previously (151) using the Synergy HT reader preheated to 37°C.
FITC-dextran fluorescence was expressed as a percentage of maximum fluorescence measured in iBMDMs treated with 3mM LLOMe, which is a lysosomotropic detergent that maximally permeabilizes lysosomes, after subtraction of basal intrinsic fluorescence.
Data processing and analysis - All experiments were repeated 2–5 times with
separate iBMDM preparations. The figure illustrating Western blot results is
100 representative of 5 separate experiments. Figures illustrating quantified changes
in alamar blue metabolism, MitoSOX fluorescence, intracellular ATP content,
pyroptotic Pro2+ influx, extracellular LDH activity, OCR, or FITC-dextran fluorescence represent the means (±SE) from 2-4 independent experiments.
Quantified data were statistically evaluated by one-way ANOVA with a Bonferroni post-test using Prism 6.0 software.
RESULTS:
The absence of Gsdmd promotes redox homeostasis and sustains cellular bioenergetics during NLRP3 inflammasome activation
Recent studies have characterized cleaved N-terminal Gsdmd (N-Gsdmd)
as a pore forming protein that oligomerizes and inserts into the plasma
membrane (PM) to disrupt ion homeostasis and ultimately execute lytic,
pyroptotic cell death (70-73). To address whether active Gsdmd functionally
disrupts other intracellular compartments, subcellular fractionation studies were
performed to identify the locations of full-length Gsdmd versus N-Gsdmd before
and after inflammasome activation. LPS-primed WT immortalized macrophages
(iBMDMs) were stimulated with the NLRP3 inflammasome activator nigericin
(NG) for 30 minutes. Subcellular fractionation was then performed according to
the schematic in Fig. 3.1A. In the absence of NG stimulation, full-length Gsdmd
(53kDa) was found primarily in the cytosol, which correlates with the presence of
the cytosolic marker GAPDH (36kDa) (Fig. 3.1B). However, GAPDH was not
found in the cytosolic fraction following 30 minutes of NG stimulation, likely due
101 ABWhole cell 30 min Post-Nigericin homogenate P10 P100 S100 700 x g , 5min 53kDa
Gsdmd P0.7 S0.7 31kDa 10k x g , 10min Tom20
P10 S10 P2X7R
Mitochondria/ Lysosome/ 100k x g , 1h GAPDH Peroxisome enriched LPS (1µg/mL) - + + - + + - + + P100 S100 Nigericin (10µM) - - + - - + - - + Microsomal Cytosol membrane C WT NTG NLRP3-/- D -/- G1 -/- G2 Gsdmd Gsdmd 12000 WT: AA 10000 WT: NG 160 **** **** Gsdmd-/- G1: NG 140 **** **** 8000 120 6000 NG/AA 100 4000 80 60 2000
(% utx control) 40 MitoSOX Fluorescence (RFU) Fluorescence MitoSOX 0 20
% Alamar blue metabolism blue Alamar % 0 0 102030405060708090 5 0 0 20 3 60 9 Time (min) Time post-NG (min) E F WT Gsdmd-/- G1 NLRP3-/- 8000 WT: AA *** WT: NG -/- **** 6000 NLRP3 : NG 100 **** **** *** 80 **** 4000 NG/AA **** 60 2000 40
20 % Intracellular ATP % Intracellular
MitoSOX Fluorescence (RFU) Fluorescence MitoSOX 0
0 0 102030405060708090 5 0 0 0 0 2 3 6 9 Time (min) Time post-NG (min)
FIGURE 3.1. The absence of Gsdmd promotes redox homeostasis and sustains cellular bioenergetics during NLRP3 inflammasome activation (A) A schematic representation of the subcellular fractionation Western blot shown in (B). (B) WT iBMDMs were primed with LPS (1μg/mL) for 2-4 h and stimulated with NG (10μM) for 30 min. Whole cell homogenates were prepared and the shaded subcellular fractions depicted in (A) were processed and analyzed on Western blot for the presence of Gsdmd, Tom20, P2X7R, and GAPDH. This data is representative of results from 5 experiments. (C) LPS-primed WT, Nlrp3-/-, NTG, and CRISPR-Cas9 generated Gsdmd-/- Guide 1 (Gsdmd-/- G1) and Gsdmd-/- Guide 2 (Gsdmd-/- G2) iBMDMs were stimulated with NG. At the indicated times, wells containing plated cells were assayed for alamar blue fluorescence. Alamar blue fluorescence values were normalized to unstimulated LPS- primed controls. These data represent the mean ± SE of 4-11 replicates from 2-5 independent experiments. (D) LPS-primed WT and Gsdmd-/- G1 iBMDMs were stimulated with NG or antimycin A (AA: 40μg/mL) for 80 min, and MitoSOX fluorescence, which is a
102 fluorescent indicator of mitochondrial superoxide, was quantified every 4 min. A 10 min baseline fluorescent read was performed before stimulation. These data represent the mean ± SE of 4-6 replicates from 2-3 independent experiments. (E) LPS-primed WT and Nlrp3-/- iBMDMs were stimulated with NG or AA for 80 min, and MitoSOX fluorescence was quantified as described in (D). These data represent the mean ± SE of 4 replicates from 2 independent experiments. (F) LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs were stimulated with NG. At the indicated times, wells containing plated cells were assayed for intracellular ATP content using a CellTiter-Glo assay, which is a luciferase- based assay used to quantify intracellular ATP content. Luminescence values were normalized to unstimulated, LPS-primed controls. These data represent the mean ± SE of 4-12 replicates from 2-4 independent experiments. ****p < 0.0001, ***p < 0.001.
103 to lytic release. Interestingly, after 30 minutes of NG stimulation, cleaved N-
Gsdmd (31kDa) localized solely in sedimentable fractions. This included the P10 pool, classically enriched in mitochondria, lysosomes, peroxisomes, and heavy
PM-derived vesicles, as well as the P100 microsomal membranes (light PM vesicles, ER, Golgi, vacuolar membranes, and endosomal vesicles (Fig. 3.1B).
Thus, accumulation of active N-Gsdmd in the P10 fraction correlated with the presence of the mitochondrial marker, Tom20, and the PM marker, P2X7R (Fig.
3.1B). N-Gsdmd localization in the P100 microsomal membrane fraction is consistent with studies demonstrating that N-Gsdmd oligomerizes to form a PM pore (70-73). These data suggest that active Gsdmd concentrates in sedimentable fractions that include both organellar membranes and PM-derived vesicles. The increased content of P2X7R in the P10 fraction from NG-stimulated iBMDMs likely reflects the significant microvesicular blebbing of the PM triggered during NLRP3 inflammasome activation (113).
Disruption of various intracellular organelles, including mitochondria, peroxisomes, the ER in response to ER stress, and lysosomes, results in oxidative stress (155, 157). Because N-Gsdmd enriches in organellar membrane- containing subcellular fractions, we investigated whether accumulation of active
Gsdmd perturbs cellular redox state during NLRP3 inflammasome activation.
These experiments used Gsdmd-/- iBMDMs, generated by CRISPR-Cas9 editing, which were characterized in our previous report (210) (refer to Chapter 2, Fig.
2.3). WT iBMDMs, WT iBMDMs transduced with a nontargeting gRNA (NTG),
Gsdmd-/- Guide 1 (Gsdmd-/- G1), and Gsdmd-/- Guide 2 (Gsdmd-/- G2) iBMDMs
104 were primed with LPS, stimulated with NG, and then assayed for altered
fluorescence of alamar blue, a membrane-permeant metabolic redox sensor dye
that is converted to a fluorescent product in the presence of a highly reducing
environment. At 5 minutes post-NG stimulation (which is prior to pyroptotic pore
induction) there was no decline in alamar blue fluorescence in WT and NTG
iBMDMs (Fig. 3.1C). The reducing capacity of WT and NTG iBMDMs began to
decline at 20 minutes post-NG stimulation, which correlates with the initiation of
pyroptotic pore activation (210), and continued to decrease over the subsequent
90 minutes (Fig. 3.1C). In contrast, the cellular reducing capacity was enhanced and then remained stable throughout 90 minutes of NG stimulation in Gsdmd-/- G1
and Gsdmd-/- G2 iBMDMs. This suggests that the absence of Gsdmd protects
against a disruption in redox homeostasis during NLRP3 inflammasome activation. Nlrp3-/- iBMDMs similarly maintained high alamar blue fluorescence
during 90 minutes of NG stimulation because upstream NLRP3 inflammasome
signaling, and consequent downstream Gsdmd activation is absent (Fig. 3.1C).
The extent of alamar blue fluorescence provides a general readout of
cellular redox state. We also specifically examined mitochondrial superoxide
production following NLRP3 inflammasome activation. Mitochondria represent a
major source of ROS (214) and are therefore important regulators of cellular
redox state. Yu et al. reported that NLRP3 and AIM2 inflammasome activation
resulted in a caspase-1 driven mitochondrial damage that was in part
demonstrated by an increase in ROS production (153). We considered that these
previous observations may actually indicate a direct role for cleaved N-Gsdmd in
105 mediating the mitochondrial damage. Exposure of the N-terminal domain of
Gsdma3, another Gsdm family member, in fibroblasts, resulted in its recruitment
to the mitochondria, facilitation of mitochondrial permeability transition, and
enhanced ROS production to drive cell death (136). MitoSOX was used as a
fluorescent indicator of mitochondrial superoxide because it selectively targets
the mitochondria. At 10-12 minutes post-NG stimulation, WT iBMDMs
demonstrated a robust increase in MitoSOX fluorescence (Fig. 3.1D, E), which
kinetically tracked with PM pyroptotic pore activity as indicated by propidium2+ dye influx measurements described in our previous study (210) (refer to Chapter
2) (also see Fig. 3.5D). Although WT, Gsdmd-/- G1 and Nlrp3-/- iBMDMs exhibited
similar basal rates of mitochondrial superoxide production (Fig. 3.2A), a NG-
induced increase in MitoSox was only observed in WT iBMDMs, but not in
Gsdmd-/- G1 (Fig. 3.1D) or Nlrp3-/-(Fig. 3.1E) iBMDMs. Addition of antimycin A, as
a positive control stimulus for mitochondrial superoxide generation, resulted in similarly robust increases in MitoSOX fluorescence in WT iBMDMs (Fig. 3.1D, E),
Gsdmd-/- G1, and Nlrp3-/- iBMDMs (Fig. 3.2B). These data suggest that the
absence of Gsdmd protects macrophages from an elevation in NLRP3
inflammasome-induced mitochondrial superoxide generation.
To determine how active Gsdmd affects cellular bioenergetics, intracellular
ATP content was measured following NLRP3 inflammasome activation.
Intracellular ATP began to markedly decline at 30 minutes post-NG stimulation in
LPS-primed WT iBMDMs but not iBMDMs lacking Gsdmd or NLRP3 (Fig. 3.1F).
Even at 60 minutes post-NG, intracellular ATP content was significantly higher in
106 A
10000 WT: NG 8000 WT: No stim 6000 Gsdmd-/- G1 NG NLRP3-/- 4000 2000
MitoSOX Fluorescence (RFU) Fluorescence MitoSOX 0
0 20406080100120 Time (min)
B
14000 WT 12000 Gsdmd-/- G1 10000 NLRP3-/- 8000 6000 AA 4000 2000
MitoSOX Fluorescence (RFU) Fluorescence MitoSOX 0
0 20406080100120 Time (min)
FIGURE 3.2. WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs have similar mitochondrial superoxide generation profiles in the absence of stimulation or in response to antimycin A (A) MitoSOX fluorescence was quantified in LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs without NG stimulation and in LPS-primed WT iBMDMs with NG stimulation for 2 h as described in Fig. 3.1. These data represent the mean ± SE of 2-6 replicates from 1-3 independent experiments. No stim (No stimulus). (B) LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs were stimulated with AA for 2 h as described in Fig. 3.1. These data represent the mean ± SE of 2 replicates from 1 experiment.
107 Gsdmd-/- G1 iBMDMs (and Nlrp3-/- cells) compared to WT iBMDMs, which is
consistent with previous findings (67). Potential mechanisms for the preservation of intracellular ATP in the Gsdmd-deficient cells include: A) reduced efflux of intracellular ATP due to the absence of ATP-permeable N-Gsdmd-based PM
pyroptotic pores, B) reduced disruption of mitochondrial ATP generation due to
an absence of mitochondria-localized N-Gsdmd, and/or C) reduced ATP
consumption via the Na+/K+ ATPase due to the absence of enhanced Na+ and K+
fluxes via N-Gsdmd pyroptotic pores in the PM.
Interestingly, intracellular ATP content began to decline in Gsdmd-/- G1
iBMDMs at 60 minutes post-NG stimulation, while remaining elevated in Nlrp3-/- iBMDMs throughout 90 minutes of NG stimulation (Fig. 3.1F). These findings are consistent with previous reports by us and others that, during prolonged NLRP3 inflammasome activation in the absence of Gsdmd, macrophages eventually divert to apoptotic signaling (69, 210). In part, loss of intracellular ATP in the absence of Gsdmd likely reflects efflux via pannexin-1 (Panx1) channels.
Executioner apoptotic caspases efficiently cleave the C-terminal regulatory domain from Panx1 protein (190), and we previously reported that an enhanced permeability to YoPro2+ in Gsdmd-/- G1 iBMDMs during prolonged NLRP3
inflammasome activation was blocked by the Panx1 channel inhibitor
trovafloxacin (210). In contrast, Nlrp3-/- iBMDMs do not undergo a marked decline
in intracellular ATP during NG stimulation because engagement of apoptotic
signaling is NLRP3 inflammasome-dependent.
108 Extracellular lanthanum delays the perturbation in redox homeostasis and
decline in cellular bioenergetics during NLRP3 inflammasome activation
As described in Chapter 2, lanthanum (La3+) as a rapid and reversible
inhibitor of N-Gsdmd PM pyroptotic pore activity (210). Therefore, we used La3+ as a tool to investigate the contribution of N-Gsdmd PM pores in perturbing redox homeostasis and cellular bioenergetics during NLRP3 inflammasome activation.
1.2mM La3+ markedly delayed the NG-induced decline in alamar blue
fluorescence observed in LPS-primed WT iBMDMs (Fig. 3.3A) but diminution of
the reducing capacity was evident with prolonged NG stimulation even in the
presence of La3+. Notably, during the first 60 minutes after NG addition to LPS-
primed WT iBMDMs, 1.2mM La3+ also markedly suppressed mitochondrial superoxide production to levels similar to those observed in identically stimulated
Gsdmd-/- G1 iBMDMs (Fig. 3.3B). Comparable to the alamar blue fluorescence
time course, superoxide levels eventually began to increase at 60 minutes post-
NG stimulation in WT iBMDMs despite the presence of La3+ (Fig. 3.3B). Taken together, these observations suggest that active Gsdmd disrupts redox homeostasis via mechanisms that are initially PM pore-dependent but then transition to a PM pore-independent pathway. It is important to note that the addition of extracellular La3+ before or after (15 min post-NG) PM pyroptotic pore
activation did not alter the patterns of increased accumulation of N-Gsdmd
protein in the P10 or P100 subcellular fractions from NG-stimulated WT iBMDMs
(Fig. 3.4). This underscores the pharmacologic action of La3+ as a reversible
inhibitor of assembled N-Gsdmd pores already inserted in the PM bilayer.
109 A Nigericin +/- La3+ B 0mM La3+ 1.2mM La3+ **** WT * 12000 100 WT: 1.2mM La3+ 10000 Gsdmd-/- G1 80 8000 6000 60 NG 4000 40 2000 (% utx control) 20
MitoSOX Fluorescence (RFU) MitoSOX 0
% Alamar blue metabolism % 0 0 0 0 0 0 20406080100120 2 3 6 9 Time post-NG (min) Time (min)
C Nigericin +/- La3+ D 3+ 3+ 0mM La 1.2mM La 6000 1.5mM Ca2+ 100 **** ** 5000 0mM Ca2+ ** 80 4000 3000 NG 60 2000 40 ** 1000 20 MitoSOX Fluorescence (RFU) Fluorescence MitoSOX 0 % Intracellular ATP % Intracellular
0 0 10203040506070 0 20 30 60 9 Time (min) Time post-NG (min)
FIGURE 3.3. Extracellular lanthanum delays the perturbation in redox homeostasis and decline in cellular bioenergetics during NLRP3 inflammasome activation (A) LPS-primed WT iBMDMs were stimulated with NG in the presence or absence of 1.2mM La3+. At the indicated times, wells containing plated cells were assayed for alamar blue fluorescence as described in Fig. 3.1. These data represent the mean ± SE of 6 replicates from 3 independent experiments. ****p < 0.0001, *p < 0.05. (B) LPS- primed Gsdmd-/- G1 iBMDMs and LPS-primed WT iBMDMs in the presence or absence of 1.2mM La3+ were stimulated with NG for 2 h, and MitoSOX fluorescence was quantified as described in Fig. 3.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (C) LPS-primed WT iBMDMs were stimulated with NG in the presence or absence of 1.2mM La3+. At the indicated times, wells containing plated cells were assayed for intracellular ATP content as described in Fig. 3.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. ****p < 0.0001, **p < 0.01. (D) LPS-primed WT iBMDMs in the presence or absence of 1.5mM Ca2+ were stimulated with NG for 60 min, and MitoSOX fluorescence was quantified as described in Fig. 3.1. These data represent the mean ± SE of 6 replicates from 3 independent experiments.
110 30 min Post-Nigericin P10 P100 S100
53kDa
Gsdmd 31kDa
Tom20
P2X7R
GAPDH
Nigericin (10µM) - + + + - + + + - + + + 1.2mM La3+ (min post-NG) 0 - 0 15 0 - 0 15 0 - 0 15
FIGURE 3.4. Nigericin-induced changes in subcellular localization of Gsdmd is similar in the presence or absence of lanthanum LPS-primed WT iBMDMs were stimulated with NG for 30 min in the presence and absence of La3+ added either 0 or 15 min post-NG. Whole cell homogenates were prepared and the shaded subcellular fractions depicted in Fig. 3.1A were processed and analyzed on Western blot for the presence of Gsdmd, Tom20, P2X7R, and GAPDH. This data is representative of results from 1 experiment.
111 The presence of 1.2mM La3+ also delayed the NG-induced decline in
intracellular ATP content in WT iBMDMs (Fig. 3.3C). This suggests that La3+
blocks ATP efflux via the N-Gsdmd-mediated pyroptotic pores and is consistent
with our previous report that La3+ suppresses the enhanced accumulation of
extracellular adenine nucleotides in culture medium from NG-stimulated BMDMs
(210). At 30-90 minutes post-NG stimulation, WT iBMDMs increasingly exhibited
profound declines in intracellular ATP content that were only modestly attenuated
in the presence of La3+ (Fig. 3.3C). The attenuated NG-induced decline in intracellular ATP content in the presence of La3+ was similar to the decreases
noted in Gsdmd-/- G1 iBMDMs after prolonged NG treatment (Fig. 3.1F).
Because we previously characterized La3+ as a PM pyroptotic pore blocker
(210), we were interested in identifying potential mechanisms by which La3+
suppression of pyroptotic pore permeability delays the increase in oxidative
stress during inflammasome signaling. Our previous experiments unsurprisingly
showed that the PM pyroptotic pore is permeable to Ca2+ (210) (refer to Chapter
2, Fig. 2.2). Because Ca2+ overload in the mitochondrial matrix is known to
enhance mitochondrial ROS generation (215), we tested whether Ca2+ influx
through N-Gsdmd PM pores might enhance mitochondrial ROS generation.
MitoSOX fluorescence was assayed in LPS-primed WT iBMDMs in the presence
or absence of extracellular Ca2+ during inflammasome stimulation by NG. The
absence of extracellular Ca2+ did not delay the rise in mitochondrial superoxide
following NG stimulation in WT iBMDMs (Fig. 3.3D). This suggests that
enhanced Ca2+ influx via N-Gsdmd pores in the PM does not drive the Gsdmd-
112 dependent perturbation in mitochondrial redox homeostasis during inflammasome activation.
Active Gsdmd-mediated perturbation in redox homeostasis contributes to pyroptotic cell death signaling
To elucidate whether active Gsdmd-mediated disruption of redox homeostasis contributes to pyroptotic cell death, we assayed lactate dehydrogenase (LDH) release as a read-out of lytic cell death in the absence or presence of the ROS scavenger N-acetylcysteine (NAC). During NG stimulation,
LPS-primed WT iBMDMs did not exhibit a significant attenuation of LDH release
in the presence of 2.5mM NAC (Fig. 3.5A), which suggests that NAC alone does
not inhibit upstream NLRP3 inflammasome activation or suppress pyroptotic cell death. These results are consistent with a previous report that the presence of
NAC does not interfere with NG-induced caspase-1 activation (44). However, it is germane to note that, during pyroptotic signaling, accumulation of N-Gsdmd PM pores leads to rapid disruption of ionic gradients and eventual osmotic lysis, which may mask the contribution of additional pro-pyroptotic signaling players, such as ROS. Therefore, to separate PM pyroptotic pore contributions to lytic death from potential roles for intracellular Gsdmd-dependent ROS signaling, pyroptotic cell death was assessed in the presence of La3+. Consistent with our
previously reported findings (210), the presence of 1.2mM La3+ completely
suppressed LDH release from LPS-primed WT iBMDMs during the initial 30
minutes of NG stimulation, but this was followed by a developing escape from
113 AB*** **** 100 **** No inhib **** 100 No inhib 2.5mM NAC 80 ** *** 2.5mM NAC 3+ 80 ** 1.2mM La 1.2mM La3+ 60 NS 3+ 60 La +NAC La3++NAC 40 40
20 (% control) utx 20 % Alamarblue metabolism% Cytolysis Cytolysis (% LDH Release) 0 0 0 0 0 0 0 0 3 6 9 3 6 9 Time post-NG (min) Time post-NG (min) CD AA NG 2.5mM NAC+NG 1.2mM La3++NG La3++NAC+NG 80 2.5mM NAC 8000 NG 60 NG+2.5mM NAC 6000 40 NG/AA 4000 NG (% Max) 20 2000 PI Fluorescence 0
MitoSOX Fluorescence (RFU) 0
0 20406080100120 0 1020304050 Time (min) Time (min) E F
100 100 **** No inhib *** No inhib 80 **** 2.5mM NAC 80 NS DEVD 3+ 1.2mM La3+ 1.2mM La 60 60 3+ La3++NAC La +DEVD 40 40
20 20 % Intracellular ATP % Intracellular
0 LDH Release) (% Cytolysis 0 0 0 0 0 0 0 3 6 9 3 6 9 Time post-NG (min) Time post-NG (min)
FIGURE 3.5. Active Gsdmd-mediated perturbation in redox homeostasis contributes to pyroptotic cell death signaling (A) LPS-primed WT iBMDMs were stimulated with NG in the presence or absence of 1.2mM La3+ and/or the reactive oxygen species scavenger N-acetylcysteine (NAC: 2.5mM). At the times indicated, supernatants were assayed for LDH activity, which was used as an indicator of lytic LDH release. The absorbance values were expressed as a percentage of maximum absorbance after Triton X-100-induced permeabilization of unstimulated LPS-primed cells. These data represent the mean ± SE of 4 replicates from 3 independent experiments. No inhib (No inhibitor). (B) LPS-primed WT iBMDMs were stimulated with NG in the presence or absence of 1.2mM La3+ and/or 2.5mM NAC. At the indicated times, wells containing plated cells were assayed for alamar blue fluorescence as described in Fig. 3.1. These data represent the mean ± SE of 5-6 replicates from 3 independent experiments. (C) LPS-primed WT iBMDMs in the presence or absence of 1.2mM La3+ and/or 2.5mM NAC were stimulated with NG or AA for 2 h, and MitoSOX fluorescence was quantified as described in Fig. 3.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (D) LPS- primed WT iBMDMs were stimulated with NG for 45 min in the presence or absence of 2.5mM NAC, and the change in PM permeability to Pro2+ (1μg/mL) and subsequent accumulation of fluorescent Pro2+ (molecular mass 416 Da) complexed with DNA was
114 quantified every 3 min. A 5 min baseline fluorescent read was performed before stimulation, and Pro2+ fluorescence was expressed as a percentage of maximum fluorescence after adding 1% Triton X-100. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (E) LPS-primed WT iBMDMs were stimulated with NG in the presence or absence of 1.2mM La3+ and/or 2.5mM NAC. At the indicated times, wells containing plated cells were assayed for intracellular ATP content as described in Fig. 3.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (F) LPS-primed WT iBMDMs were stimulated with NG in the presence or absence of 1.2mM La3+ and/or caspase-3 inhibitor DEVD (50μM). At the times indicated, supernatants were assayed for LDH activity as described in (A). These data represent the mean ± SE of 4-5 replicates from 3 independent experiments. ****p < 0.0001, ***p < 0.001, **p < 0.01, NS (not statistically significant).
115 LDH release suppression over the next 30-60 minutes of sustained NG treatment
(Fig. 3.5A). This temporal profile of La3+ action on inflammasome-driven LDH
release -- initial suppression followed by escape -- correlated with its biphasic
inhibitory effects on the NG-induced decrease in alamar blue fluorescence (Fig.
3.3A) and increase in mitochondrial superoxide levels (Fig. 3.3B). These data
indicate that blockade of PM pyroptotic pore activity is not sufficient to completely
retard progression to final pyroptotic cell death due to contributions from
additional pro-pyroptotic factors, such as ROS. To further assess the role of ROS
signaling during pyroptotic cell death, LPS-primed WT iBMDMs were stimulated
with NG in the presence of both 1.2mM La3+ and 2.5mM NAC. Remarkably, co-
incubation of WT iBMDM with La3+ and NAC completely suppressed LDH release
even during prolonged (60 and 90 minutes) NG stimulation. This anti-pyroptotic
action reflected synergy between La3+ and NAC because robust LDH release at these later times points was observed in cells treated with either NAC or La3+
alone (Fig. 3.5A). These data indicate that intracellular Gsdmd-mediated ROS
signaling contributes to pyroptotic cell death in a setting of suppressed N-Gsdmd
PM pyroptotic pore activity.
To demonstrate that NAC acts as a ROS scavenger to suppress pyroptosis, alamar blue fluorescence was measured in LPS-primed WT iBMDMs following NG stimulation in the presence of 2.5mM NAC and 1.2mM La3+. Alamar blue fluorescence remained elevated throughout NG stimulation in the presence of both NAC and La3+ and was significantly higher than in WT iBMDMs
stimulated for 90 minutes with NG in the presence of only La3+ (Fig. 3.5B). This
116 suggests that NAC acts to maintain a high reducing capacity in the presence of
La3+ to suppress lytic death. Notably, co-treatment of iBMDMs with NAC and La3+
did not suppress NG-induced mitochondrial superoxide generation beyond the
inhibition produced by La3+ alone (Fig. 3.5C). This suggests that NAC does not
specifically or exclusively scavenge mitochondrial superoxide to inhibit pyroptotic
cell death.
To verify that NAC does not directly target the N-Gsdmd PM pyroptotic
pores, pore activity was assayed utilizing the cationic DNA-intercalating
fluorescent dye propidium2+ (Pro2+). We have previously used Pro2+ influx
following inflammasome activation as a real-time, kinetic readout of PM
pyroptotic pore activity (210) (refer to Chapter 2, Fig. 2.1). The rates of NG-
induced Pro2+ influx into LPS-primed WT iBMDMs were comparable in the
presence or absence of 2.5mM NAC (Fig. 3.5D), indicating that NAC does not
directly target the assembly or activity of N-Gsdmd-based pyroptotic pores.
Additionally, the temporal profiles of intracellular ATP depletion following NG
stimulation were similar in the presence or absence of 2.5mM NAC (Fig. 3.5E),
further suggesting that NAC alone does not limit PM pyroptotic pore activity or
progression to pyroptotic cell death.
Interestingly, the temporal profiles of intracellular ATP depletion following
NG stimulation were similar in the presence of 1.2mM La2+ alone versus the co-
presence of 1.2mM La2+ and 2.5mM NAC (Fig. 3.5E). This may reflect the
engagement of apoptotic signaling and ATP-permeable Panx1 channels that
occurs in Gsdmd-deficient BMDMs during NLRP3 inflammasome activation (69,
117 210). This is also consistent with the loss in intracellular ATP content that begins in Gsdmd-/- G1 iBMDMs at ~60 minutes post-NG (Fig. 3.1F). Additionally, in the presence of La3+alone, the marked loss in intracellular ATP is co-temporal with escape from suppression of LDH release (Fig. 3.3C, Fig. 3.5A, Fig. 3.5E). In contrast, the additional presence of NAC at 90 minutes post-NG particularly dissociates the marked decline in intracellular ATP content from progression to pyroptotic lysis as indicated by LDH release (compare Figs. 3.5A and 3.5E). This indicates a remarkable resistance to terminal lysis despite the 90% reduction in intracellular ATP levels and likely reflects active Gsdmd-mediated death processes driven by the uncovered intracellular ROS signaling.
Because apoptotic signaling can be engaged during NG-induced NLRP3 inflammasome activation (143, 144), we also tested whether treatment with La3+ might reveal NLRP3-dependent apoptotic signaling that contributes to lytic cell death. No synergistic suppression of NG-induced LDH release was evident in
LPS-primed WT iBMDMs co-treated with 1.2mM La3+ and 50μM of the caspase-3 inhibitor DEVD; the observed kinetic of delayed LDH release was similar to that in cells treated with only La3+ (Fig. 3.5F). This suggests that the escape from
LDH release suppression in La3+-treated BMDMs is not due to secondary necrosis, but rather may reflect Gsdmd-mediated ROS signaling.
Taken together, these observations support a hierarchy of pyroptotic signaling reactions that contribute to lytic cellular collapse during NG-induced
NLRP3 inflammasome activation: N-Gsdmd PM pyroptotic pores > N-Gsdmd- mediated elevation in oxidative stress > NLRP3-inflammasome driven apoptotic
118 signaling. More specifically, in the setting of suppressed N-Gsdmd PM pyroptotic pore activity, an intracellular N-Gsdmd-mediated and ROS-dependent cell death signaling pathway is unmasked.
Nigericin disrupts mitochondrial respiration independent of Gsdmd but induces
an early, rapid lysosomal disruption dependent on Gsdmd
We next investigated potential sources of the oxidative stress that
enhances pyroptotic cell death. Mitochondria represent a major source of intracellular ROS, in particular ROS that is generated as a result of oxidative phosphorylation (155). NLRP3 and AIM2 inflammasome signaling has been
linked to caspase-1-dependent mitochondrial damage and enhanced mitochondrial ROS production, but it is unclear whether these effects may directly involve Gsdmd-mediated mitochondrial dysfunction (153). If electron
transport through the mitochondrial respiratory chain is disrupted – conceivably
by N-Gsdmd binding to exposed cardiolipin on mitochondrial membranes – then
more electron flux may be diverted toward generating superoxide anions rather
than reduction of oxygen to water. To test whether active Gsdmd disrupts
mitochondrial respiration, we utilized a Seahorse XFp analyzer which measures
oxygen consumption rate (OCR) as a readout of aerobic respiration. We first
performed mitochondrial stress tests on LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs under basal conditions (Fig. 3.6A) and during NG-stimulated NLRP3 inflammasome activation (Fig. 3.6C). This involves treatment with a series of inhibitors that target particular steps of mitochondrial electron transport and
119 FCCP A R/AA B NG Oligo 500 WT WT -/- G1 500 400 Gsdmd -/- G1 R/AA -/- 400 Gsdmd NLRP3 300 NLRP3-/- 300 200 200 100 OCR (pmol/min)
OCR (pmol/min) OCR 100
0 0
0 20406080 0 20406080100120 Time (min) Time (min)
C D 60 WT NG 500 WT 50 Gsdmd-/- G1 NG 400 Oligo Gsdmd-/- G1 FCCP 40 NLRP3-/- NLRP3-/- 300 R/AA 30 200 20 FITC-dextran 100 10 OCR(pmol/min) Fluorescence (% Max) 0 0
0 20406080100 0 5 10 15 20 30 40 50 60 70 80 90 Time (min) Time (min)
FIGURE 3.6. Nigericin disrupts mitochondrial respiration independent of Gsdmd but induces an early, rapid lysosomal disruption dependent on Gsdmd (A) A mitochondrial stress test was performed on LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs and analyzed using a Seahorse XFp analyzer. Arrows indicate when mitochondrial electron transport chain inhibitors were added (Oligo: Oligomycin, R: Rotenone, AA: Antimycin A). These data represent the mean ± SE of 4 replicates from 2 independent experiments. (B) The oxygen consumption rate (OCR) was measured at baseline for 18 min and in response to NG for 90 min on LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs using a Seahorse XFp analyzer. Arrows indicate when NG and R/AA (0.5μM) were added. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (C) A mitochondrial stress test was performed following 30 min of NG stimulation on LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs and analyzed using a Seahorse XFp analyzer. Arrows indicate when NG and electron transport chain inhibitors were added. These data represent the mean ± SE of 3-6 replicates from 1-2 independent experiments. (D) Lysosomal membrane disruption was assayed in FITC-dextran loaded LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs that were stimulated with NG for 90 min by measuring pH-dependent changes in FITC- dextran fluorescence. A 5 min baseline fluorescent read was performed before stimulation, and FITC-dextran fluorescence was expressed as a percentage of maximum fluorescence after adding 3mM LLOMe, a lysosomotropic detergent that maximally and rapidly disrupts lysosomes. These data represent the mean± SE of 4 replicates from one experiment and are representative of 3 separate experiments.
120 coupled oxidative phosphorylation: 1) oligomycin as an ATP synthase inhibitor, 2)
FCCP as a proton ionophore that collapses the transmembrane H+
electrochemical gradient to uncouple electron transport from oxidative
phosphorylation, and 3) rotenone/antimycin A as Complex I/III inhibitors. LPS-
primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs exhibited similar patterns and
magnitudes of altered OCR in response to each mitochondrial inhibitor and
similarly intact bioenergetic profiles (Fig. 3.6A). In response to oligomycin, WT,
Gsdmd-/- G1, and NLRP3-/- iBMDMs displayed similar declines in OCR as an index
of the coupling between electron transport and ATP generation. During
subsequent treatment with FCCP, WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs
exhibited comparable increases in OCR, which indicates similar capacities for
maximal mitochondrial oxygen utilization to meet an energy demand.
To address whether active Gsdmd disrupts basal mitochondrial respiration to enhance ROS generation, changes in OCR during prolonged NG stimulation were compared in LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs.
Each genotype displayed similarly sustained declines in OCR over the course of
90 min of NG stimulation (Fig. 3.6B), suggesting that NG-induced perturbation in
mitochondrial respiration is independent of NLRP3 inflammasome signaling and
active Gsdmd. Therefore, in the setting of NG-induced NLRP3 inflammasome
signaling, active Gsdmd likely perturbs an alternative ROS store to enhance
pyroptotic cell death.
Given this ability of NG per se to similarly repress mitochondrial
respiration in LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs, we next tested
121 how NG treatment affected the OCR responses of the three macrophage
genotypes to oligomycin and FCCP (Fig. 3.6C). Notably, the typical decreased
OCR in response to oligomycin and increased OCR elicited by FCCP were
similarly absent in all three iBMDM genotypes. Because NG is a K+/H+
ionophore, it can act directly and rapidly to dissipate the mitochondrial proton
gradient and this likely underlies the similar absence of typical OCR responses to
mitochondrial stress test stimuli in WT, Gsdmd-/- G1, and NLRP3-/- iBMDMs. This
makes it difficult to unequivocally address the specific contribution of active
Gsdmd to disruption of mitochondrial respiration and cellular capacity to meet an
energy demand. Heid et al. similarly observed that NG treatment ablated the
typical OCR responses to oligomycin and FCCP in LPS-primed WT and Nlrp3-/-
primary BMDMs (148).
We also tested the potential contribution of intracellular N-Gsdmd
accumulation to perturbation of lysosome integrity during NLRP3 inflammasome
activation. Following phagocytosis or engagement of Toll-like receptors (TLR), IL-
1 receptors, or TNF receptor signaling, ROS-generating NADPH oxidases are
activated on phagosomal/endosomal membranes that eventually traffic to
lysosomes (157). Heid et al. recently described an NLRP3-dependent lysosomal
membrane permeabilization that correlated with NG-induced ROS generation
(148). However, we considered that active Gsdmd might directly induce
lysosomal membrane disruption. If so, this may mediate the direct release of
lysosomally stored ROS and/or result in the cytosolic accumulation of lysosomal
mediators that potentiate subsequent ROS release from additional organelles. To
122 test whether active Gsdmd contributes to NLRP3-dependent lysosomal
membrane disruption, LPS-primed WT, Gsdmd-/- G1, and Nlrp3-/- iBMDMs were
pre-loaded with FITC-dextran (10 kDa), which accumulates within
phagosomal/lysosomal compartments, and then stimulated with NG. In healthy
cells, intralysosomal FITC-dextran has low fluorescence due to the acidic pH
environment. Dissipation of the lysosomal pH gradient per se increases the
fluorescence of this entrapped FITC-dextran. With complete collapse of
lysosomal integrity, entrapped FITC-dextran is released into the neutral (pH 7.2) cytosol to further increase fluorescence. We have previously described a plate-
reader based assay which facilitates the kinetic analysis of these two phases of
lysosomal dysregulation in monolayers of myeloid leukocytes during
inflammasome activation (151). Because NG is a direct H+/K+ ionophore, WT,
Gsdmd-/- G1, and Nlrp3-/- iBMDMs exhibited similar step increases in FITC-dextran
fluorescence within minutes after NG addition due to rapid dissipation of the
trans-lysosomal membrane pH gradient (Fig. 3.6D). After an 8-10 min lag
following this step increase, WT iBMDMs were characterized by a second phase
of rapidly increasing FITC-dextran fluorescence which did not occur in Gsdmd-/-
G1 or Nlrp3-/- iBMDMs (Fig. 3.6D). Interestingly, this second phase of lysosomal
disruption was initiated at a slightly earlier time than the Pro2+ influx indicative of
N-Gsdmd-mediated PM pyroptotic pore activation in WT iBMDM (Fig. 3.5D); this
suggests that accumulation of N-Gsdmd directly perturbs lysosomal membrane
integrity. While Nlrp3-/- iBMDMs did not exhibit any additional rise in FITC-dextran
fluorescence even after 90 minutes of NG stimulation, Gsdmd-/- G1 iBMDMs
123 underwent a delayed (after ~20 min) and very gradual increase in FITC-dextran
fluorescence (Fig. 3.6D). The extent of phagosomal/lysosomal disruption
eventually reached the same level as in WT iBMDMs. However, the markedly
different kinetics of lysosomal damage, early onset and rapid in WT versus delayed and gradual in Gsdmd-/- G1 iBMDMs, suggest that Gsdmd-mediated lysosomal disruption may in part contribute to enhanced oxidative stress and lytic
cell death.
Glycine promotes redox homeostasis but does not maintain cellular bioenergetics
during NLRP3 inflammasome activation
Glycine exerts a dramatic cytoprotective effect on various modes of rapid
lytic cell death via poorly understood mechanisms (216). In the context of
pyroptosis, glycine does not interfere with N-Gsdmd PM pyroptotic pore activity,
including the pore’s permeability to large, cationic fluorescent dyes, Ca2+, and
ATP, but markedly delays progression to end-stage lytic cell death (210) (refer to
Chapter 2, Fig. 2.1 and 2.2). Glycine also has antioxidant properties and is a component of glutathione by serving as a substrate for glutathione synthase that catalyzes addition of free glycine to γ-glutamylcysteine (216). Because we have demonstrated that oxidative stress is an important factor in pyroptotic cell death signaling, we investigated whether glycine’s cytoprotective effect involves promotion of redox homeostasis. During the early phases of NG-induced NLRP3 inflammasome signaling, the presence of 5mM glycine maintained a modestly elevated intracellular reducing capacity (as indicated by alamar blue
124 fluorescence) relative to that observed in the absence of glycine (Fig. 3.7A).
Glycine also markedly attenuated the NG-stimulated increase in mitochondrial superoxide production (Fig. 3.7B). Interestingly, the MitoSOX fluorescence profile observed in LPS-primed/ NG-stimulated WT iBMDMs in the presence of glycine was similar to the basal rise in mitochondrial superoxide assayed in the absence of NG stimulation (Fig. 3.7B). As expected, WT iBMDMs maintained in the presence of glycine exhibited a marked suppression in LDH release throughout
90 minutes of NG stimulation compared to the robust lysis noted in the absence of glycine. Nonetheless, the glycine-treated WT iBMDMs began to show an
escape from LDH release suppression over time (Fig. 3.7C). To investigate
whether the escape occurred because glycine does not suppress PM pyroptotic
pore activity, WT iBMDMs were stimulated with NG in the presence of glycine
and La3+. The additional presence of 1.2mM La3+ did not result in enhanced
suppression of LDH release (Fig. 3.7C), suggesting that the slowly developing
pyroptotic cell death in the presence of glycine may not be dependent on PM
pyroptotic pore activity. When comparing the effects of glycine on cellular redox
state versus pyroptotic cell lysis, it was striking that glycine maintained a strong
cytoprotective effect despite the developing decrease in cellular reducing
capacity at 60-90 minutes post-NG stimulation (Fig. 3.7A,C). Notably, the
presence of glycine did maintain a lower magnitude of mitochondrial superoxide
with prolonged NG stimulation (Fig. 3.7B). These data demonstrate that while
glycine protects against oxidative stress during NLRP3 inflammasome activation,
this is unlikely to be the primary mechanism of glycine’s cytoprotective effect.
125 AB -Gly -NG 100 -Gly 5mM Gly 10000 -Gly +NG ** +5mM Gly +NG 8000 80 * 6000 60 NG NS 4000 40 2000
(% utx control) utx (% 20
MitoSOX Fluorescence (RFU) Fluorescence MitoSOX 0
% Alamar% blue metabolism 0 0 0 20406080100120 20 30 60 9 Time post-NG (min) Time (min) C D **** No inhib -Gly 5mM Gly 100 **** 100 NS NS 5mM Gly 80 1.2mM La3+ 80 * 3+ 60 La +Gly 60
40 40
20 20 % Intracellular ATP % Intracellular
Cytolysis (% LDH Release) (% Cytolysis 0 0 0 0 0 0 0 0 0 3 6 9 2 3 6 9 Time post-NG (min) Time post-NG (min) E
-Gly: OB 100 -Gly: NG -Gly: OB+NG 80 +Gly: NG 60 +Gly: OB+NG
40 NG 20 0 Cytolysis (% LDH Release) LDH (% Cytolysis
0 102030405060708090 Time (min)
FIGURE 3.7. Glycine promotes redox homeostasis but does not maintain cellular bioenergetics during NLRP3 inflammasome activation (A) LPS-primed WT iBMDMs were stimulated with NG in the presence or absence of the cytoprotectant glycine (5mM). At the indicated times, wells containing plated cells were assayed for alamar blue fluorescence as described in Fig. 3.1. These data represent the mean ± SE of 6 replicates from 3 independent experiments. **p < 0.01, *p < 0.05, NS (not statistically significant). (B) LPS-primed WT iBMDMs in the presence or absence of 5mM glycine were stimulated with or without NG for 2 hr, and MitoSOX fluorescence was quantified as described in Fig. 3.1. These data represent the mean ± SE of 4-6 replicates from 2-3 independent experiments. (C) LPS-primed WT iBMDMs were stimulated with NG in the presence or absence of 1.2mM La3+ and/or 5mM glycine. At the indicated times, supernatants were assayed for LDH activity as described in Fig. 3.5. These data represent the mean ± SE of 6 replicates from 3 independent experiments. ****p < 0.0001, *p < 0.05, NS (not statistically significant). No inhib (No inhibitor). (D) LPS-primed WT iBMDMs were stimulated with NG in the presence or absence of 5mM glycine. At the indicated times, wells containing plated cells were assayed for intracellular ATP content as described in Fig. 3.1. These data represent the mean ± SE of 4 replicates from 2 independent experiments. (E) LPS-primed WT iBMDMs were stimulated with NG and/or ouabain (OB: 125μM) in the presence or absence of 5mM glycine. At the indicated times, supernatants were assayed for LDH activity as described in Fig. 3.5. These data represent the mean ± SE of 2-3 replicates from 2 independent experiments.
126 Glycine also promotes nucleotide synthesis to support the high
proliferative capacity of cancer cells (205). In the context of pyroptosis,
accumulation of N-Gsdmd PM pyroptotic pores disrupts normal ionic
homeostasis and thus places a large osmotic stress on macrophages. The
resulting ionic and osmotic dysregulation will result in enhanced ATP-driven
Na+/K+ pump activity, which, in turn, will place a large metabolic stress on the
cell. We tested whether the presence of glycine might sustain ATP synthesis and
preserve cellular energetics to delay end-stage pyroptotic cell lysis by measuring
changes in intracellular ATP content during NG stimulation in the absence or
presence of glycine. However, we observed no significant differences in the
kinetics of intracellular ATP depletion (Fig. 3.7D). This is consistent with our
previous report that glycine does not interfere with the activity of pyroptotic pores
and their permeability to ATP (210) (refer to Chapter 2). Because ATP is lost
through active pyroptotic pores per se, it is difficult to ascertain whether glycine
might support enhanced local ATP synthesis sufficient to power the Na+/K+
ATPase despite the decrease in global intracellular [ATP]. We attempted to address whether glycine promotes ATP synthesis during NLRP3 inflammasome activation by stimulating LPS-primed WT iBMDMs with NG in the presence or absence of 5mM glycine and/or the Na+/K+ ATPase inhibitor ouabain. In the
absence of glycine, the presence of ouabain modestly accelerated the
development of NG-induced LDH release (Fig. 3.7E), which suggests that the
Na+/K+ ATPase helps to resist the osmotic swelling that leads to cellular collapse.
However, in the presence of ouabain, glycine retained its robust cytoprotective
127 function (Fig. 3.7E), suggesting that glycine does not serve as a substrate for local ATP synthesis to power the Na+/K+ ATPase and thereby delay pyroptotic cell lysis.
DISCUSSION:
This study provides several new mechanistic insights into how intracellular accumulation of active Gsdmd N-terminal cleavage products executes pyroptotic death of murine macrophages during inflammasome activation. Based on a NG- induced NLRP3 inflammasome model, our data indicate that in addition to its well-defined ability to form PM pores, N-Gsdmd also disrupts multiple homeostatic functions of intracellular organelles to enhance oxidative stress, compromise bioenergetics, and thereby contribute to lytic cell death. N-Gsdmd- mediated and PM pore-independent disruption of intracellular compartments was particularly evident in a setting of suppressed PM pyroptotic pore activity by lanthanum. More specifically, during NG stimulation, N-Gsdmd disrupts lysosomal integrity and potentiates mitochondrial generation of superoxide radicals. Together, these perturbations correlate with a ROS-dependent component of Gsdmd-mediated pyroptotic cell lysis that is prevented by the ROS scavenger N-acetylcysteine (NAC) (Fig. 3.5A). These findings underscore the importance of considering the extent of N-Gsdmd’s disruptive effects on intracellular homeostatic functions when investigating potential therapies that target Gsdmd to combat pyroptosis-related pathology, such as sepsis.
128 Current studies on Gsdmd biology have focused on its PM pyroptotic pore
function. Immunofluorescence imaging has demonstrated that active N-Gsdmd enriches within the PM (70, 71, 209). However, most analyses of Gsdmd’s pore forming ability have utilized recombinant Gsdmd and liposomes composed of
synthetic or bacterial membrane-derived lipids (70-73). These biophysical studies along with lipid strip binding assays have shown that N-Gsdmd pores can form within membranes containing cardiolipin, phosphatidylinositols, and phosphatidylserine (70, 71) thereby indicating that active Gsdmd may perturb intracellular organelles and compartments with appropriate membrane phospholipid composition. We confirmed previous observations that, during inflammasome-mediated proteolytic processing, the N-Gsdmd fragments rapidly became enriched in sedimentable fractions (Fig. 3.1B) that included both a mitochondrial/lysosomal/peroxisomal-enriched fraction (P10 fraction) and a microsomal membrane fraction (P100). Although this supports the possibility that intracellular membrane-bound compartments may be relevant targets for N-
Gsdmd-mediated disruption, rigorous purification of N-Gsdmd-containing mitochondria and lysosomes from NG-treated cells will be required for unequivocal demonstration.
The ability of La3+, as an inhibitor of PM pyroptotic pore activity, to strongly
synergize with the ROS scavenger NAC for near-complete suppression of macrophage lysis even during prolonged inflammasome activation raises
important mechanistic questions regarding the nature of this synergistic action.
Contention exists regarding the role of ROS in NLRP3 inflammasome signaling.
129 Some studies have implicated ROS production as an important trigger (49, 54-
56), while others indicated oxidative stress as dispensable for NLRP3
inflammasome activation (44, 50). Our results indicated a role for ROS
downstream of NG-induced NLRP3 inflammasome assembly that contributes to
pyroptotic cell death signaling. The absence of Gsdmd protected iBMDMs from
oxidative stress following NG stimulation (Fig. 3.1C,D). Notably, the presence of
2.5mM NAC alone did not limit inflammasome activation, PM pore activity (Fig.
3.5D), or pyroptotic cell death (Fig. 3.5A). Rather, NAC had a cytoprotective effect only in the setting of suppressed N-Gsdmd PM pyroptotic pore activity (Fig.
3.5A). Together, these findings indicate that intracellular active Gsdmd, independently of its PM pore function, mediates a ROS-driven component to the lytic cell death process. Potential organellar sources of ROS include mitochondria, lysosomes, peroxisomes, and the ER (155).
Mitochondria represent a major intracellular source of ROS which mostly results from electron transport through the respiratory chain. Mitochondrial ROS can also be generated by enzymes within the mitochondrial matrix (2- oxoglutarate dehydrogenase and pyruvate dehydrogenase) and inner
mitochondrial membrane (glycerol 3-phosphate dehydrogenase and flavoprotein-
ubiquinone oxidoreductase) (155). To counter the multiple superoxide free
radical-generating reactions by mitochondria, Cu/Zn-superoxide dismutase
(Cu/Zn-SOD) is present in the intermembrane space, and Mn-SOD is present in
the mitochondrial matrix; together these act to convert superoxide into hydrogen
peroxide (215). In the setting of NG-induced NLRP3 inflammasome signaling, we
130 have shown that NG itself produces equivalent disruption of mitochondrial
respiration in WT, Gsdmd-/- G1, and NLRP3-/- iBMDMs (Fig. 3.6B,C). However, the
absence of Gsdmd did protect against a potentiation in mitochondrial superoxide production following NG stimulation (Fig. 3.1D). Because Gsdmd is not required for the NG-induced perturbation in mitochondrial respiration, this finding could
indicate an active Gsdmd-dependent enhancement in ROS generation from
mitochondrial enzymes. Another possibility is that active Gsdmd-mediated
mitochondrial dysregulation results in a disruption of SOD localization or activity,
which reduces superoxide consumption to cause an increase in mitochondrial
superoxide levels. Yu et al. demonstrated caspase-1 dependent mitochondrial
damage (as indicated by enhanced mitochondrial membrane depolarization and
ROS generation) following ATP and NG-induced NLRP3 inflammasome
activation (153), but this could more directly reflect Gsdmd-mediated
mitochondrial disruption. Relief of the autoinhibitory interaction between the N
and C-termini of Gsdma3 enables its localization at mitochondria to mediate a
ROS-dependent death in non-myeloid cell types (136, 137). This suggests that,
like other Gsdm family members, activated N-Gsdmd may also track to the
mitochondria to facilitate cell death signaling. Nonetheless, in the context of NG-
driven NLRP3 inflammasome signaling, the added cytoprotective effect of NAC in
the presence of La3+ was not due to NAC scavenging of mitochondrial
superoxide because NAC plus La3+ did not afford further protection against
mitochondrial superoxide generation compared to La3+ alone (Fig. 3.5A,C).
Overall, our findings imply a potential role for active Gsdmd in disrupting
131 mitochondrial function, but the exact manner and effect on cell fate remain
unclear because NG alone disrupts mitochondrial respiration independently of
Gsdmd or NLRP3 (Fig. 3.6B,C). Future studies that utilize rapidly acting
inflammasome activators which do not per se directly disrupt mitochondrial
homeostasis may clarify likely roles for Gsdmd in mediating mitochondrial
damage.
Active NADPH oxidase complexes associated with the
phagosomal/lysosomal compartment represent another source of ROS (155,
157). Heid et al. demonstrated an NLRP3-dependent loss in lysosomal integrity
in response to NG, which could reflect a more direct role for Gsdmd-mediated
lysosomal damage (148). We demonstrated an active Gsdmd-mediated
lysosomal disruption in response to NG stimulation (Fig. 3.6D). The initiation of
lysosomal disruption occurred somewhat earlier than N-Gsdmd PM pyroptotic
pore activation (Fig. 3.6D and Fig. 3.5D, respectively), suggesting that the
accumulating N-Gsdmd protein may associate with both lysosomal and PM lipids
to directly form pores within their lipid bilayers. The observed differential time
courses of lysosomal damage in WT iBMDMs, defined by early onset and rapid
increase, versus Gsdmd-/- G1 iBMDMs, defined by delayed onset and gradual increase, indicate that lysosomal disruption may contribute to the ROS- dependent component of pyroptotic cell death in a setting of suppressed pyroptotic PM pore activity. Although NADPH oxidase activity has been shown to be dispensable for NLRP3 inflammasome activation (157, 217), it may contribute to downstream pyroptotic signaling. Interestingly, the delayed and gradual
132 lysosomal damage observed in Gsdmd-/- G1 iBMDMs was not present in Nlrp3-/- iBMDMs (Fig. 3.6D). NLRP3-dependent apoptotic signaling, which can occur in the absence of caspase-1 (143, 144) or Gsdmd (69, 210), may mediate this gradual lysosomal disruption via other channels or pore-forming proteins.
Because WT and Gsdmd-/- G1 iBMDMs eventually exhibit similar extents of
lysosomal disruption in response to NG in an NLRP3-dependent manner (Fig.
3.6D), intracellular organelles other than lysosomes may additionally contribute
to active Gsdmd-mediated oxidative stress. Peroxisomes, which are derived from
the ER, generate ROS as a result of their metabolism of long chain fatty acids
(155). Interestingly, a recent report revealed a role for the Gsdm family member
Dfnb59 in regulating peroxisomal dynamics in response to noise-induced oxidative stress (141, 142). Dfnb59 is upregulated in response to noise exposure in sensory hair cells of the inner ear; it then localizes to the peroxisome to regulate its proliferation/fission and subsequently promotes redox homeostasis
(141, 142). Another pore-forming protein BAK, which is involved in intrinsic apoptotic signaling, exhibits increased localization at peroxisomes in the absence of VDAC2 and thereby drives the loss of peroxisomal integrity (218, 219). These studies highlight how regulation of peroxisomal dynamics and integrity can impact cellular redox state and cell fate. Perhaps during pyroptotic signaling, N-
Gsdmd can bind to peroxisomal membranes to compromise peroxisomal integrity and enhance oxidative stress.
ROS generation can also occur in response to ER stress (155, 220). ER stress is characterized by an accumulation of unfolded and misfolded proteins
133 and triggers oxidative protein folding, a component of the unfolded protein response (UPR), which results in enhanced ROS production (220). Previous reports have described ER stress as a trigger of NLRP3 inflammasome activation
(221-223), but not as a downstream consequence of NLRP3 inflammasome assembly. It would be relevant to test whether N-Gsdmd can associate with ER membranes with consequent disruption of proper protein folding and subsequent oxidative stress as a byproduct of UPR-regulated oxidative protein folding.
The ability of glycine to exert robust cytoprotective effects during pyroptosis and other modes of regulated cell death remains mechanistically undefined. Results from our analyses of NG-mediated pyroptotic signaling argue against simple protective effects of glycine at the levels of reduced oxidative stress or sustained cellular bioenergetics. Glycine delayed but did not prevent the loss of redox homeostasis (Fig. 3.7A) during prolonged NG-stimulation. This was particularly evident at times (≥60min) when Gsdmd-mediated oxidative stress became a relevant death effector under suppressed PM pyroptotic pore activity
(compare Figs. 3.5A and 3.7A). Because glycine did not prevent the loss of intracellular ATP (Fig. 3.7D) and maintained its cytoprotective effect in the presence of ouabain (Fig. 3.7E), glycine likely does not promote local ATP synthesis to power the Na+/K+ ATPase and thereby resist PM pyroptotic pore- induced osmotic stress. Glycine has been identified as a robust cytoprotectant under many forms of necrotic cell death, including pore-forming toxin-mediated, oxidant injury, hypoxia, pyroptosis, and secondary necrosis (216). The presence of glycine under these multiple modes of lytic cell death does not block early-
134 stage, non-lytic PM permeability changes, but does suppress end-stage lysis
(173, 174, 216). This suggests a common final pathway in necrotic forms of cell
death (216). We previously demonstrated that the presence of glycine during
caspase-1-induced pyroptosis does not block PM pyroptotic pore activity and its
permeability to large cationic fluorescent dyes, adenine nucleotides, and Ca2+
(210). Although glycine does not limit the gross permeability characteristics of N-
Gsdmd PM pyroptotic pores, it may modulate the final architecture of these
Gsdmd-containing PM pores and/or the extent of active Gsdmd dysregulation of
intracellular compartments to affect cell fate. Future studies should investigate
the effect of glycine on PM/organelle integrity and phospholipid and cytoskeletal
dynamics during inflammasome signaling as possible mechanisms that underlie
its remarkable cytoprotective capacity.
In summary, we have elucidated a role for active Gsdmd in disrupting the
homeostatic functions of intracellular organelles to induce a ROS-dependent
component of pyroptotic cell death signaling. The ability of N-Gsdmd to bind to
membranes enriched in phosphatidylinositol, phosphatidylserine, and cardiolipin
(70, 71) suggests that appropriate levels of these phospholipids within the
cytosol-facing bilayer leaflets of intracellular organelles may permit rapid N-
Gsdmd disruption. Whether particular inflammasome activators and/or signaling
platforms influence which intracellular organelle(s), other than the PM, for
progression of the pyroptotic cascade remains to be defined. Our study reveals
the potentially extensive range of Gsdmd-mediated cell death executioner
135 functions, which is important to consider when investigating Gsdmd as a therapeutic target.
136
CHAPTER 4
FUTURE DIRECTIONS
137 RESEARCH SUMMARY:
Chapter 2 characterized the caspase-1-induced PM permeability change during NLRP3 and Pyrin inflammasome activation in murine BMDMs. This permeability change is initially pre-lytic and requires Gsdmd expression. Shortly after this study was accepted for publication, Ding et al. identified cleaved N- terminal Gsdmd as the PM pore that executes pyroptotic death (70). We further demonstrated that the pyroptotic pore is permeable to large organic cation dyes
(propidium2+ and EthD4+), Ca2+, and ATP. Lanthanides (Gd3+ and La3+) rapidly and reversibly inhibit pyroptotic pore activity and delay lytic cell death. Finally, even though Gsdmd deficiency and lanthanides suppress pyroptotic pore activity and pyroptotic cell death, the presence of lanthanides permits robust IL-1β release but the absence of Gsdmd does not. This suggests that Gsdmd may be involved in both passive IL-1β release secondary to pyroptotic lysis in addition to nonlytic, non-classical IL-1β export.
Chapter 2 also demonstrated that pyroptotic signaling macrophages eventually experience an escape from suppressed pyroptotic lysis in the presence of lanthanides, which may indicate an intracellular role for active
Gsdmd in promoting pyroptotic death. Chapter 3 depicted a role for active
Gsdmd independent of its PM pore function in perturbing intracellular compartments to enhance oxidative stress and contribute to pyroptotic lysis during NG-induced NLRP3 inflammasome activation in murine iBMDMs. The absence of Gsdmd promotes redox homeostasis and delays a decline in intracellular ATP content. In a setting of suppressed pyroptotic pore activity in the
138 presence of La3+, a ROS-mediated component of pyroptotic death signaling is
uncovered that can be further suppressed by the ROS scavenger N-
acetylcysteine (NAC). More specifically, NG induces a Gsdmd-dependent
lysosomal disruption, which may in part contribute to ROS-mediated pyroptotic signaling during NLRP3 inflammasome activation. These findings highlight the importance of investigating the extent of N-Gsdmd’s disruptive effects on intracellular homeostatic functions when developing potential therapies that target Gsdmd activity.
Also, in Chapter 3 the robust cytoprotective agent glycine delays but does not prevent the loss of redox homeostasis and likely does not promote ATP synthesis that powers the Na+/K+ ATPase to resist osmotic lysis. This suggests
that glycine utilizes an alternate cytoprotective mechanism during pyroptosis.
Understanding glycine’s mechanism of cytoprotection may provide further insight into how to effectively target pyroptotic death.
Future directions aim to address the role of Gsdmd in IL-1β release and in IL-
1β-mediated pathology, the mechanism by which lanthanides suppress pyroptotic signaling, the role of Gsdmd in mediating organelle dysfunction, and
the mechanism of glycine cytoprotection during pyroptotic signaling.
139 FUTURE DIRECTIONS:
4.1: Gsdmd-mediated regulation of IL-1β release
In an inflammasome-activated cell that will ultimately undergo pyroptotic
death, IL-1β has a distinct initial nonlytic phase of release (92, 93), and an
eventual mode of pyroptotic release (92, 94, 95). The initial nonlytic phase occurs
prior to significant lytic LDH release (92, 93), and also robust IL-1β secretion
occurs in the presence of the cytoprotectant glycine in the absence of LDH
release (172, 210). Gsdmd is also required for IL-1β release in response to
canonical inflammasome-dependent pyroptotic signaling (67-69). This implies that either pyroptotic signaling is the main contributor to IL-1β release, or that perhaps Gsdmd also regulates nonlytic, vesicular trafficking and secretion of IL-
1β. Since glycine does not limit pyroptotic pore activity (Figs. 2.1 and 2.2) (210)
and the pore’s inner diameter is large enough to accommodate mature IL-1β
(70), it is possible that the pre-lytic IL-1β release mechanism involves passive
permeation through the N-Gsdmd PM pore. Therefore, it becomes challenging to
utilize a pyroptotic signaling model system to investigate the role of Gsdmd in nonlytic, non-classical IL-1β export.
Recently, nonlytic model systems of mature IL-1β release have been characterized (51, 96-98). Human monocytes in response to LPS stimulation alone engage an alternative NLRP3 signaling platform that results in the maturation and release of IL-1β in the absence of pyroptotic cell death (51).
NLRP3 and NLRC4 inflammasome activation drives robust IL-1β release in
140 murine bone marrow-derived neutrophils (BMNs) that do not experience
pyroptotic cell death (96, 97). In addition LPS-primed murine bone marrow- derived dendritic cells (BMDCs) stimulated with oxidized phospholipids, which are abundant in areas of tissue damage, engage both an NLRP3 and non- canonical inflammasome-signaling pathway that promotes DC survival and nonlytic IL-1β release (98). Since BMDCs have the capacity to pyroptose depending on environmental cues and so far BMNs have not been shown to pyroptose under classical pyroptotic stimuli, both of these model systems will be used to address the role of Gsdmd in nonlytic IL-1β export and if the mode of IL-
1β secretion is cell type specific. First, the amount of IL-1β released in the presence or absence of Gsdmd will be compared in response to LPS plus oxidized phospholipids derived from 1-palmitoyl-2-arachidonyl-sn-glycero-3- phosphorylcholine (oxPAPC) in BMDCs and in response to the NLRP3 inflammasome activator nigericin (NG) in BMNs. To investigate the relevant vesicular trafficking pathway of IL-1β under these nonlytic conditions, subcellular fractionation will be performed prior to significant IL-1β release to address intracellular mature IL-1β compartmentalization. These studies will be complemented with electron microscopy (EM), which will include immunogold labeling of both Gsdmd and IL-1β. Whether secreted IL-1β is contained within a vesicular fraction or released as free protein will also be determined with differential ultracentrifugation of the supernatants. The microvesicle and exosome-sized fractions will then be prepared for western blot and EM analysis.
Markers of secretory lysosomes (LAMP1), exosomes (CD63 and CD9),
141 autophagic vesicles (LC3II), and microvesicles (P2X7R) will be used to identify
IL-1β’s relevant route of secretion. Follow-up studies will be performed that
specifically target the secretory pathways utilized based on the results obtained
from these IL-1β localization studies.
At concentrations that inhibit pyroptotic pore activity and suppress
downstream pyroptotic cell death, lanthanides still permit the release of IL-1β
(compare Fig. 2.5 and Fig. 2.7) (210), suggesting that actively pyroptosing cells also engage in nonlytic vesicular trafficking and secretion of IL-1β. To investigate this, intracellular compartmentalization of IL-1β in murine WT and Gsdmd-/- macrophages in response to the pyroptosis-inducing stimulus NG prior to significant IL-1β export will be determined. In addition whether secreted IL-1β is contained within a vesicular fraction or released as free protein will be addressed.
Given that it may be difficult to accurately time when mature IL-1β is maximally retained within the cell prior to export, punicalagin (PUN) will be used to inhibit IL-1β release. PUN is a polyphenolic compound found in pomegranates.
Pelegrín and colleagues demonstrated that the presence of PUN results in almost complete cytosolic retention of mature IL-1β in response to 30min of NG stimulation in macrophages and neutrophils (224). In addition PUN attenuates lipid raft movement and suppresses membrane blebbing in response to ATP
(224). We have demonstrated that PUN does not prevent pyroptotic pore activity, as shown by intact propidium2+ influx and LDH release in murine BMDMs in
response to NG (Fig. 4.1A and 4.1B, respectively). An initial modest
142 A B 45 min Post-NG 80 Utx 100 No Inhibitor 60 25uM PUN 80
40 60 NG 20 40 0 20 Propidium Uptake (%Max)Propidium
Cytolysis (%Cytolysis LDH Release) 0 0 1020304050
Time (min) ibitor PUN h M n I o 25u N
Figure 4.1: Murine BMDMs undergo pyroptosis in the presence of punicalagin in response to nigericin stimulation. (A) WT BMDMs were primed with LPS (1μg/mL) for 4 h before stimulation with NG (10μM) for 45 min in the presence or absence of punicalagin (PUN: 25μM), and the change in PM permeability to propidium2+ (1μg/mL) and subsequent accumulation of fluorescent propidium2+ complexed with DNA was quantified every 3 min. A 5 min baseline fluorescent read was performed before stimulation, and propidium2+ fluorescence was expressed as a percentage of maximum fluorescence after adding 1% Triton X-100. These data represent the mean ± SE of 2 replicates from 1 experiment. (B) LPS-primed WT BMDMs were stimulated with NG in the presence or absence of PUN for 45 min. Supernatants were assayed for LDH activity, which was used as an indicator of lytic LDH release. The absorbance values were expressed as a percentage of maximum absorbance after Triton X- 100-induced permeabilization of unstimulated LPS-primed cells. These data represent the mean ± SE of 2 replicates from 1 experiment.
143 suppression of propidium2+ influx occurs in the presence of PUN that escapes by
30min Post-NG stimulation (Fig. 4.1A). These findings together dissociate PUN’s
inhibitory effect on IL-1β secretion from pyroptosis. In pyroptotic signaling
macrophages, PUN will be combined with glycine to investigate intracellular
compartmentalization of IL-1β in the absence of lytic cell death. In the nonlytic IL-
1β release model systems, PUN will be utilized to achieve maximal intracellular
IL-1β levels. In general PUN will be used to promote the enrichment of the intracellular pool of processed IL-1β.
In addition to a potential role of Gsdmd in regulating nonlytic IL-1β release,
Gsdmd may also broadly contribute to non-classical export during inflammasome signaling. Therefore, in response to NLRP3 inflammasome activation, the relative
amount of exosomes and microvesicles released will be compared between WT
and Gsdmd-/- macrophages.
Overall these future studies aim to investigate if Gsdmd contributes to
nonlytic, non-classical IL-1β export, and if so, how the absence of Gsdmd
perturbs IL-1β release.
4.2: Role of Gsdmd in IL-1β-mediated pathology
Since Gsdmd is involved in IL-1β release, it may prove a beneficial target for
IL-1β-mediated pathologies. Cryopyrin-associated periodic fever syndromes
(CAPS) are autosomal dominant conditions that are a result of gain of function
mutations in Nlrp3, resulting in elevated IL-1β levels (89). This group of diseases
includes, familial cold auto-inflammatory syndrome (FCAS), Muckle-Wells
144 syndrome (MWS), and chronic infantile neurological, cutaneous and articular
syndrome (CINCA) (89). They are characterized by an IL-1β-mediated pathology
that in general consists of recurrent fever, elevated acute phase proteins,
myalgias, and leukocytosis (89). IL-1β targeting therapies have proven beneficial
to patients with these conditions (225).
Future studies will investigate how the absence of Gsdmd impacts these
autoinflammatory conditions, especially as it pertains to regulating IL-1β release,
by utilizing genetic mouse models of CAPS (226). Brydges et al. has previously
generated knock-in mouse strains of MWS and FCAS using the Cre-Lox system,
whose mutations in Nlrp3 are strongly associated with MWS and FCAS patients,
respectively (226). They generated a global, myeloid-specific, and tamoxifen-
inducible knock-in mouse strain and demonstrated that these diseases were
primarily dependent on myeloid cells, an intact NLRP3 inflammasome, and
independent of T cells (226). In particular, the myeloid specific MWS mouse
(Nlrp3A350V/+/CreL) exhibited severe skin inflammation, neutrophilia, leukocytic
infiltrates in various tissues, elevated IL-1β, IL-18, and IL-6, and died during the
neonatal period. In the myeloid specific MWS mouse model, the effect of the additional absence of Gsdmd on the amount of IL-1β released will be determined in addition to its impact on skin inflammation (testing for IL-1β presence in skin lesions) and blood cell counts. If IL-1β release still occurs in the absence of
Gsdmd, the relevant cell type will be investigated. A Gsdmd-/- tamoxifen-inducible
MWS mouse strain will be utilized to characterize cell-type specificity of IL-1β release. The amount of IL-1β release will be characterized in BMDCs, BMDMs,
145 peripheral blood monocytes, and BMNs in the presence and absence of Gsdmd in response to LPS priming alone and compared with LDH release.
If nonlytic IL-1β release is intact in the absence of Gsdmd, then targeting
Gsdmd may be a useful way to dissociate the lytic from the nonlytic contribution to IL-1β release, which can then be related to severity of disease. Despite minimal side effects and the absence of any severe limitation with respect to host defense against infection, patients under chronic IL-1 targeting therapy do experience an increased amount of upper respiratory viral infections (225).
Therefore, perhaps targeting Gsdmd activity may provide a way to limit the harmful effects of IL-1β while maintaining a beneficial IL-1β response to infection.
Also, in addition to investigating the impact of Gsdmd on IL-1β release and disease severity, its effect on IL-18 release will also be addressed since IL-18 has also been shown to contribute to the pathogenesis of murine models of
CAPS (227).
If the presence or absence of active Gsdmd influences the profile of IL-1β release, this may prove a useful tool to investigate the biological relevance of a lytic vs. nonlytic mode of IL-1β secretion. The influenza virus induces NLRP3 inflammasome activation (228). IL-1 is a necessary component of host defense against influenza infection (229). IL-1R-/- mice have reduced survival in response to influenza infection (229). Despite this, IL-1 has both beneficial and harmful effects on the host during influenza infection (229). IL-1 induces inflammatory lung pathology in mice but is also important in enhancing IgM antibody responses and in the activation and recruitment of CD4+ T cells to the lung (229).
146 Therefore, perhaps eliminating the lytic mode of IL-1β release will remove the
harmful effects of IL-1β while preserving a regulated, nonlytic mode of IL-1β
secretion that is beneficial to host defense against influenza. The severity of
influenza infection in Gsdmd-/- mice will be compared to WT mice in terms of lung pathology and survival. The amount of IL-1β in circulation and in the lung, the
IgM response, and CD4+ T cell activation and recruitment to the lung will be
determined. WT and Gsdmd-/- myeloid cell types will also be infected with
influenza virus and the amount of IL-1β release will be compared to LDH release.
Innate immune cells may require interaction with CD4+ T cells to support nonlytic
IL-1β export that then primes CD4+ T cells. A previous study demonstrated that
dendritic cell interaction with alloreactive T cells resulted in pro-IL-1β synthesis,
processing and release of the mature cytokine (230). Therefore, a co-culture
between Gsdmd-/- or WT BMDCs infected with influenza virus and CD4+ T cells
isolated from mice infected with influenza will be performed and the amount of IL-
1β release will be compared to LDH release.
In the context of certain intracellular bacterial infections, like a strain of
Salmonella that persistently expresses flagellin, pyroptosis is required to properly resolve infection, but IL-1β is not necessary for host defense (58). Perhaps in a setting where pyroptosis dominates to remove the replicative niche of these
intracellular pathogens, a predominantly lytic profile of IL-1β release occurs that may have adverse consequences on the host. In these conditions, it is important to address whether the absence of Gsdmd eliminates the majority of IL-1β release.
147 Taken together Gsdmd may represent an important tool in understanding how
the mode of IL-1β release impacts the host’s response to infection or chronic
inflammatory disease and therefore also provides an additional relevant therapeutic target for IL-1β-mediated pathologies.
4.3: Mechanism by which lanthanides suppress pyroptosis and
promote redox homeostasis during inflammasome activation
We have demonstrated that millimolar concentrations of lanthanides (La3+
and Gd3+) rapidly and reversibly block N-Gsdmd PM pyroptotic pore activity,
including permeability to propidium2+ and ATP (Fig. 2.8C,D and Fig. 3.3C), to delay pyroptotic cell death (Figs. 2.4 and 2.6) (210). Future studies will be performed to clarify how lanthanides suppress pyroptotic pore activity to provide insight on how to target N-Gsdmd PM pores. First it is important to verify that lanthanides act to block the permeability of osmotically active ions (K+, Na+, and
Cl-) using fluorescent indicators of these ions. Also, lanthanides exhibit a steep
dose-dependent inhibition of propidium2+ uptake in response to NG (Fig. 2.5A,B
and Fig. 2.9) (210). This finding is in contrast to a shallower lanthanide dose- dependent inhibition of Ca2+ channels that ranges from 1-100μM (185-187).
Lanthanides act to competitively block the selectivity filter of Ca2+ channels
because they have similar cationic radii as Ca2+ (185, 187). The mechanism of
lanthanide blockade of N-Gsdmd PM pores is likely different given the
contrasting dose response curves and pore sizes, which is under 1nm for Ca2+
channels (231) compared to an average of 15nm for the pyroptotic pore (211).
148 Therefore, perhaps lanthanides complex with an additional factor to promote
blockade of the significantly larger N-Gsdmd PM pore. First whether a component of the media used is forming a complex with lanthanides to facilitate pyroptotic pore inhibition will be determined. A basal salt solution that contains
0.1% BSA and 25mM HEPES was previously used for lanthanide inhibition
studies (210). The concentrations of BSA and HEPES will be lowered in addition
to utilizing a bicarbonate-containing solution to investigate if the media impacts
lanthanide inhibition of the pyroptotic pore in response to NG. Another possibility
is that the lanthanides are complexing with a cell-derived factor. Sborgi et al.
used 6-carboxyfluorescein-loaded liposomes to demonstrate that active Gsdmd
forms functional pores (73). Similar experiments will be performed in the
presence or absence of Gd3+ or La3+ to determine whether they block the
pyroptotic pore in the absence of cells. Lanthanides also can bind to anionic
phospholipid head groups to impact membrane dynamics (188). Therefore,
liposomes stimulated with recombinant active Gsdmd in the presence of Gd3+ or
La3+ will be imaged with EM to test if lanthanides affect the architecture and size of Gsdmd pores.
Lanthanum (La3+) initially promotes redox homeostasis during NLRP3
inflammasome activation (Fig. 3.3A,B). We demonstrated that lanthanum’s
suppression of the pyroptotic pore’s permeability to Ca2+ does not promote
mitochondrial redox homeostasis (Fig. 3.3D). Whether the influx of Ca2+
contributes to a general perturbation in redox state in response to NG will be
assessed by assaying alamar blue fluorescence in the presence and absence of
149 extracellular Ca2+. La3+ may also suppress the release of critical mediators of
redox homeostasis that are small enough to permeate the pyroptotic pore.
Therefore, the extent of NADPH, glutathione (1kDa), thioredoxin (12kDa), and
glutaredoxin (12kDa) release will be measured in the presence and absence of
La3+ in response to NG since they are smaller than mature IL-1β (18kDa), which
has been predicted to permeate the N-Gsdmd PM pore (70).
The reversible blockade of pyroptotic pore activity by lanthanides (Fig.
2.8C,D) suggests a predominantly extracellular effect on suppressing pyroptotic
cell lysis. However, it remains important to clarify lanthanum’s ability to exert
intracellular effects that inhibit pyroptosis. First atomic absorption spectroscopy
will be used to assay the intracellular content of La3+ in response to NG in the
presence of La3+ and glycine, which would allow La3+ uptake through the
pyroptotic pore rather than as a result of lysis. As a potential positive control for
La3+ accumulation in the cytosol without a dramatic loss of cytosolic protein or
organellar integrity, staphylococcal α-toxin, which forms 2-3nm in diameter pores
in the PM that are permeable to molecules up to 1kDa, will be used. If α-toxin
permits intracellular accumulation of La3+, additional studies will be performed to
address whether intracellular accumulation of La3+ in response to α-toxin impacts
redox state. Studies with α-toxin will be performed in Nlrp3-/- macrophages without LPS-priming since α-toxin stimulation results in NLRP3 inflammasome activation (232).
150 4.4: Active Gsdmd-mediated organelle dysfunction independent of
its plasma membrane pore function
We have revealed a role for active N-Gsdmd in perturbing intracellular compartments during NLRP3 inflammasome activation to mediate a ROS- dependent component of pyroptotic death signaling. Future studies will elucidate which organelles are subject to Gsdmd dysregulation and contribute to pyroptotic death in iBMDMs and primary BMDMs in response to NG and the rapidly acting
NLRC4 inflammasome agonist FlaTox. A non-NLRP3 inflammasome activator will be used since NG perturbs mitochondrial respiration independently of inflammasome signaling (Fig. 3.6B,C) and mitochondrial dysregulation has been implicated in NLRP3 inflammasome activation (54-56). It is also important to use another stimulus besides NG to address whether the inflammasome activator primes certain organelles to be more sensitive to Gsdmd-mediated dysregulation.
FlaTox is a fusion protein that consists of flagellin and the Bacillus anthracis lethal factor (62). To activate an NLRC4 inflammasome, FlaTox is added with the anthrax protective antigen channel (PA), which are endocytosed (62). Endosomal acidification results in a conformational change in PA to facilitate cytosolic delivery of FlaTox, which can then engage an NLRC4 inflammasome platform
(62). Utilizing propidium2+ dye uptake as a readout of pyroptotic pore activity,
FlaTox induced rapid and robust propidium2+ influx after about 15 min (Fig. 4.2).
Our previous studies depicting an active Gsdmd-mediated disruption in redox homeostasis in iBMDMs in response to NG will also be verified in WT and
Gsdmd-/- primary BMDMs. These studies will also be performed in response to
151 80 Utx NG 60 FlaTox
40 NG 20 0 Propidium Uptake Propidium (%Max)
0 1020304050 Time (min)
Figure 4.2: FlaTox induces a rapid and robust propidium influx. WT BMDMs were primed with LPS (1μg/mL) for 4 h before stimulation with NG (10μM) or FlaTox (3μg/mL) and PA (6μg/mL) for 45 min, and propidium2+ fluorescence was quantified every 2 min as described in (Fig. 4.1A). These data represent the mean ± SE of 2-6 replicates from 1-3 independent experiments.
152 FlaTox stimulation in both iBMDMs and primary BMDMs. To complement the
alamar blue assay, which was used as a general indicator of cellular redox state,
other fluorescent probes of ROS will be used to assay the nature and extent of
oxidative stress in response to NG and FlaTox in WT and Gsdmd-/-
macrophages. Different ROS scavengers will also be used to address the source
and type of ROS involved in pyroptotic signaling. For example, ebselen, a
peroxide scavenger, will be used to determine whether peroxides are relevant in
pyroptotic signaling. Specifically, whether active N-Gsdmd disrupts mitochondria,
lysosomes, peroxisomes, and the ER independently of its PM pore function in
response to NG and FlaTox will be investigated since dysregulation of these
organelles can contribute significantly to oxidative stress (155, 157, 220).
4.4a: Mitochondria
A closer analysis of active Gsdmd localization at the mitochondria will be
performed in response to NG and FlaTox in WT iBMDMs and primary BMDMs,
and Gsdmd-/- cells will be used as a negative control. Immunofluorescence
imaging of Gsdmd and mitochondria with a mitotracker fluorescent probe will be assessed. The P10 fraction (enriched in mitochondria/lysosomes/peroxisomes)
obtained from subcellular fractionation with differential centrifugation, which contains a robust amount of active Gsdmd (Fig. 3.1A,B), will be further processed with density gradient centrifugation to obtain a purer mitochondrial population. These mitochondrial samples will be analyzed for the presence of
Gsdmd by EM and Western blot. The mitochondria will also be sub-fractionated
153 into an outer and inner mitochondrial membrane (OMM and IMM) fraction. Then the localization of Gsdmd and the extent of cardiolipin externalization to the OMM
will be determined in response to NG and FlaTox.
Whether mitochondrial ROS significantly contributes to pyroptotic cell death,
and if so, the mechanism of Gsdmd-mediated mitochondrial disruption and
subsequent enhanced ROS production will be investigated. The mitochondrial
superoxide ROS scavenger MitoTempo or MnTBAP (a superoxide dismutase
mimetic) will be used in combination with La3+ (to inhibit N-Gsdmd PM pore
activity), and LDH release will be assayed in response to NG and FlaTox to
address if mitochondrial ROS contributes to pyroptotic cell death. We have
previously demonstrated that NG stimulation perturbs mitochondrial respiration
independently of NLRP3 inflammasome signaling (Fig. 3.6B,C), making it difficult
to ascertain a role for active Gsdmd in disrupting mitochondrial function.
Therefore, mitochondrial respiration in response to FlaTox alone or in
combination with a mitochondrial stress test in WT vs. Gsdmd-/- iBMDMs will be
assayed with a Seahorse XFp analyzer to investigate whether active Gsdmd
directly perturbs mitochondrial function. Additional readouts of mitochondrial
disruption, including the extent of mitochondrial membrane depolarization and
cytosolic accumulation of cytochrome c, will be determined in response to NG
and FlaTox in WT vs. Gsdmd-/- macrophages.
154 4.4b: Lysosome
Future studies will investigate N-Gsdmd localization at lysosomes in response
to NG and FlaTox in WT iBMDMs and primary BMDMs, and Gsdmd-/- cells will be
used as a negative control. Immunofluorescence imaging of Gsdmd and the
lysosomal membrane marker LAMP1 will be performed. The P10 fraction
obtained from subcellular fractionation with differential centrifugation (Fig. 3.1A)
will be further processed with density gradient centrifugation to obtain a purer
lysosomal population. To validate lysosomal purity, beta-hexosoaminidase (a
lysosomal enzyme) activity will be assessed (101). These lysosomal samples will
be analyzed for the presence of Gsdmd by EM (using LAMP1 as a lysosomal
marker) and Western blot.
We have demonstrated that active Gsdmd facilitates lysosomal disruption
during NG stimulation (Fig. 3.6D), using changes in fluorescence of the
phagosomal/lysosomal compartment loaded with FITC-dextran to track
lysosomal disruption. To investigate if lysosomal disruption promotes oxidative
stress rather than being a consequence of elevated cytosolic ROS, lysosomal
membrane permeabilization will be assessed in WT iBMDMs stimulated with NG
in the presence of 2.5mM NAC. Also, to address whether lysosomal disruption is
mediated directly by intracellular active Gsdmd, WT iBMDMs will be stimulated with NG in the presence of 1.2mM La3+. The kinetic profile and extent of
lysosomal disruption will be imaged in WT vs. Gsdmd-/- iBMDMs in response to
NG. Gsdmd-mediated lysosomal disruption will also be evaluated in response to
FlaTox.
155 Active NADPH oxidase complexes internalized within the
phagosomal/lysosomal compartment contribute to lysosomal ROS (156, 157). To
investigate whether the NADPH oxidase complex is a relevant source of ROS
involved in pyroptotic signaling, the NADPH oxidase inhibitor
diphenyleneiodonium (DPI) and primary BMDMs that lack components of the
NADPH oxidase complex will be utilized in combination with La3+ to test for reduced ROS production and suppressed pyroptotic cell death in response to NG and FlaTox. DPI has been shown to exhibit off target effects at higher concentrations and a dose-dependent increase in ROS generation (233). In addition Núñez and colleagues have demonstrated that 10μM DPI, a concentration that maximally inhibits NADPH oxidase, does not limit NG-induced
NLRP3 inflammasome activation (44). Therefore, this concentration will be used to assess the involvement of NADPH oxidase-mediated ROS generation in pyroptotic signaling.
4.4c: Peroxisome
Active Gsdmd localization studies at peroxisomes will be performed in response to NG and FlaTox in WT iBMDMs and primary BMDMs, and Gsdmd-/-
cells will be used as a negative control. Immunofluorescence imaging of Gsdmd
and PMP70 (a peroxisomal membrane marker) will be assessed. The P10
fraction obtained from subcellular fractionation with differential centrifugation will
be further processed with density gradient centrifugation to obtain a purer
peroxisomal population. To validate peroxisomal purity, catalase (a peroxisomal
156 enzyme) activity will be assessed. These purified peroxisomal samples will be analyzed for the presence of Gsdmd by EM (using PMP70 as a peroxisomal marker) and Western blot. EM will additionally be performed on ultrathin cryosections from fixed frozen cell pellets to assess peroxisomal integrity in WT vs. Gsdmd-/- cells in response to NG and FlaTox; these experiments will also be
performed in the presence of glycine to limit lytic death. To investigate active
Gsdmd-mediated peroxisomal membrane disruption, the accumulation of
cytosolic and extracellular catalase will be assessed in response to NG and
FlaTox in WT and Gsdmd-/- macrophages.
4.4d: Endoplasmic Reticulum
ER stress triggers the unfolded protein response (UPR), which results in
enhanced ROS generation (220). Future studies will investigate whether active
Gsdmd disrupts ER homeostasis to trigger ER stress in response to NG. Since
ER stress has been shown to contribute to NLRP3 inflammasome activation
(222, 234), FlaTox will also be used as a non-NLRP3 inflammasome activator.
EM will be performed on ultrathin cryosections from fixed frozen cell pellets of
WT iBMDMs and primary BMDMs to first demonstrate whether active Gsdmd
localizes at the ER in response to NG and FlaTox; these experiments will also be
performed in the presence of glycine to limit lytic death. EM will also be used to
assay the extent of ER lumen dilation as a readout of ER stress in WT vs.
Gsdmd-/- cells. To test whether active Gsdmd directly disrupts ER membranes, cytosolic accumulation of proteins normally located in the ER lumen will be
157 analyzed by Western blot, including BiP (binding immunoglobulin protein),
ERp57, and PDI (protein disulfide isomerase). Activation of major signaling
players during the UPR will also be evaluated in response to NG and FlaTox in
WT and Gsdmd-/- macrophages.
4.5: Mechanism of glycine cytoprotection during pyroptotic signaling
Glycine provides rapid and robust cytoprotection during NG-mediated pyroptotic signaling. We have demonstrated that glycine does not limit the pyroptotic pore’s permeability to adenine nucleotides, Ca2+, and large organic
cation dyes (propidium2+ and EthD4+) (Figs. 2.1 and 2.2) (210); however, we
have not tested whether glycine suppresses the pyroptotic pore’s permeability to
osmotically active ions, including Na+ and Cl-. Therefore, fluorescent indicators of
cytosolic Na+ and Cl- will be utilized to test if the presence of glycine suppresses
the rapid influx of these ions in response to NG. In addition the effect of the
presence of glycine on the architecture of the N-Gsdmd PM pore will be
investigated. WT iBMDMs and primary BMDMs will be loaded with different sized
FITC-dextrans to test whether the presence of glycine influences the Gsdmd PM
pore’s permeability to these FITC-dextrans in response to NG. FITC-dextran
fluorescence will then be measured from cell-depleted supernatants.
Based on our current studies, glycine appears to suppress end-stage lytic cell death (210). Other modes of necrotic cell death (mediated by pore-forming toxins, oxidant injury, hypoxia, and secondary necrosis) also permit early-stage,
nonlytic PM permeability changes but suppress end-stage lysis (173, 174, 216).
158 Understanding the mechanism of glycine-mediated cytoprotection may uncover a
common therapeutic target among these multiple forms of lytic cell death. Our
studies also suggest that glycine’s primary mode of cytoprotection does not
involve promoting redox homeostasis (Fig. 3.7A) or supporting ATP synthesis to power the Na+/K+ ATPase (Fig. 3.7D,E). Future studies will investigate if
extracellular glycine alters phospholipid and cytoskeletal dynamics to promote cell integrity and resistance to osmotic collapse. Fluorescent labeling and imaging of the PM will be performed in the presence or absence of glycine to investigate alterations in the morphology of the PM in response to NG. Plasma membrane rigidity will be pharmacologically induced to address whether glycine supports enhanced PM deformability to resist osmotic lysis. Following NG stimulation, lytic cell death will be assayed in the presence of glycine and soraphen A, which inhibits acetyl-CoA carboxylase to alter the PM to a more rigid composition (235), to determine if glycine loses its cytoprotective effect under this condition. To investigate the effect that extracellular glycine has on actin cytoskeletal dynamics, macrophages will be stained for actin filaments in the presence and absence of glycine in response to NG stimulation. If there is a difference in actin cytoskeletal architecture, then follow-up studies addressing the
mechanism of altered actin cytoskeletal dynamics will be performed. In addition macrophages will be treated with pharmacologic agents that disrupt cytoskeletal dynamics, including colchicine and latrunculin-b, in combination with glycine to determine whether this causes glycine to lose its cytoprotective effect in response to NG.
159 Also, imaging N-Gsdmd pore localization at the PM with immunofluorescence
microscopy has proven challenging due to rapid progression to lytic death (70).
Therefore, perhaps glycine’s cytoprotective effect can serve as a useful tool to
improve the imaging of N-Gsdmd at the PM and at relevant intracellular
compartments during inflammasome activation.
CONCLUDING REMARKS
These future directions will provide important insights regarding how
lanthanides target PM pyroptotic pore activity and the role of active Gsdmd in
perturbing organelle function and in regulating IL-1β export. Clarifying these
areas of Gsdmd biology will improve our understanding of Gsdmd-mediated
diseases and how to therapeutically target Gsdmd.
160
161 BIBLIOGRAPHY:
1. Angus DC & van der Poll T (2013) Severe sepsis and septic shock. The New England journal of medicine 369(21):2063. 2. Angus DC, et al. (2001) Epidemiology of severe sepsis in the United States: analysis of incidence, outcome, and associated costs of care. Critical care medicine 29(7):1303‐1310. 3. Hagar JA, Powell DA, Aachoui Y, Ernst RK, & Miao EA (2013) Cytoplasmic LPS activates caspase‐11: implications in TLR4‐independent endotoxic shock. Science 341(6151):1250‐1253. 4. Kayagaki N, et al. (2013) Noncanonical inflammasome activation by intracellular LPS independent of TLR4. Science 341(6151):1246‐1249. 5. Jorgensen I & Miao EA (2015) Pyroptotic cell death defends against intracellular pathogens. Immunological reviews 265(1):130‐142. 6. Schauvliege R, Vanrobaeys J, Schotte P, & Beyaert R (2002) Caspase‐11 gene expression in response to lipopolysaccharide and interferon‐gamma requires nuclear factor‐kappa B and signal transducer and activator of transcription (STAT) 1. The Journal of biological chemistry 277(44):41624‐41630. 7. Gurung P, et al. (2012) Toll or interleukin‐1 receptor (TIR) domain‐ containing adaptor inducing interferon‐beta (TRIF)‐mediated caspase‐11 protease production integrates Toll‐like receptor 4 (TLR4) protein‐ and Nlrp3 inflammasome‐mediated host defense against enteropathogens. The Journal of biological chemistry 287(41):34474‐34483. 8. Broz P, et al. (2012) Caspase‐11 increases susceptibility to Salmonella infection in the absence of caspase‐1. Nature 490(7419):288‐291. 9. Rathinam VA, et al. (2012) TRIF licenses caspase‐11‐dependent NLRP3 inflammasome activation by gram‐negative bacteria. Cell 150(3):606‐619. 10. Shi J, et al. (2014) Inflammatory caspases are innate immune receptors for intracellular LPS. Nature 514(7521):187‐192. 11. Pilla DM, et al. (2014) Guanylate binding proteins promote caspase‐11‐ dependent pyroptosis in response to cytoplasmic LPS. Proceedings of the National Academy of Sciences of the United States of America 111(16):6046‐ 6051. 12. Meunier E, et al. (2014) Caspase‐11 activation requires lysis of pathogen‐ containing vacuoles by IFN‐induced GTPases. Nature 509(7500):366‐370. 13. Meunier E & Broz P (2015) Interferon‐induced guanylate‐binding proteins promote cytosolic lipopolysaccharide detection by caspase‐11. DNA and cell biology 34(1):1‐5. 14. Broz P & Dixit VM (2016) Inflammasomes: mechanism of assembly, regulation and signalling. Nature reviews. Immunology 16(7):407‐420. 15. Ruland J (2014) Inflammasome: putting the pieces together. Cell 156(6):1127‐1129. 16. Cai X, et al. (2014) Prion‐like polymerization underlies signal transduction in antiviral immune defense and inflammasome activation. Cell 156(6):1207‐ 1222.
162 17. Lu A, et al. (2014) Unified polymerization mechanism for the assembly of ASC‐dependent inflammasomes. Cell 156(6):1193‐1206. 18. Man SM & Kanneganti TD (2015) Regulation of inflammasome activation. Immunological reviews 265(1):6‐21. 19. Boyden ED & Dietrich WF (2006) Nalp1b controls mouse macrophage susceptibility to anthrax lethal toxin. Nature genetics 38(2):240‐244. 20. Levinsohn JL, et al. (2012) Anthrax lethal factor cleavage of Nlrp1 is required for activation of the inflammasome. PLoS pathogens 8(3):e1002638. 21. Frew BC, Joag VR, & Mogridge J (2012) Proteolytic processing of Nlrp1b is required for inflammasome activity. PLoS pathogens 8(4):e1002659. 22. Guey B, Bodnar M, Manie SN, Tardivel A, & Petrilli V (2014) Caspase‐1 autoproteolysis is differentially required for NLRP1b and NLRP3 inflammasome function. Proceedings of the National Academy of Sciences of the United States of America 111(48):17254‐17259. 23. Finger JN, et al. (2012) Autolytic proteolysis within the function to find domain (FIIND) is required for NLRP1 inflammasome activity. The Journal of biological chemistry 287(30):25030‐25037. 24. Mariathasan S, et al. (2004) Differential activation of the inflammasome by caspase‐1 adaptors ASC and Ipaf. Nature 430(6996):213‐218. 25. Miao EA, et al. (2006) Cytoplasmic flagellin activates caspase‐1 and secretion of interleukin 1beta via Ipaf. Nature immunology 7(6):569‐575. 26. Broz P, von Moltke J, Jones JW, Vance RE, & Monack DM (2010) Differential requirement for Caspase‐1 autoproteolysis in pathogen‐induced cell death and cytokine processing. Cell host & microbe 8(6):471‐483. 27. Hornung V, et al. (2009) AIM2 recognizes cytosolic dsDNA and forms a caspase‐1‐activating inflammasome with ASC. Nature 458(7237):514‐518. 28. Hu B, et al. (2016) The DNA‐sensing AIM2 inflammasome controls radiation‐ induced cell death and tissue injury. Science 354(6313):765‐768. 29. Kerur N, et al. (2011) IFI16 acts as a nuclear pathogen sensor to induce the inflammasome in response to Kaposi Sarcoma‐associated herpesvirus infection. Cell host & microbe 9(5):363‐375. 30. Monroe KM, et al. (2014) IFI16 DNA sensor is required for death of lymphoid CD4 T cells abortively infected with HIV. Science 343(6169):428‐432. 31. Xu H, et al. (2014) Innate immune sensing of bacterial modifications of Rho GTPases by the Pyrin inflammasome. Nature 513(7517):237‐241. 32. Carter GP, Rood JI, & Lyras D (2012) The role of toxin A and toxin B in the virulence of Clostridium difficile. Trends in microbiology 20(1):21‐29. 33. Lyras D, et al. (2009) Toxin B is essential for virulence of Clostridium difficile. Nature 458(7242):1176‐1179. 34. Kelly CP & LaMont JT (2008) Clostridium difficile‐‐more difficult than ever. The New England journal of medicine 359(18):1932‐1940. 35. Voth DE & Ballard JD (2005) Clostridium difficile toxins: mechanism of action and role in disease. Clinical microbiology reviews 18(2):247‐263. 36. Aktories K (2011) Bacterial protein toxins that modify host regulatory GTPases. Nature reviews. Microbiology 9(7):487‐498.
163 37. Kim ML, et al. (2015) Aberrant actin depolymerization triggers the pyrin inflammasome and autoinflammatory disease that is dependent on IL‐18, not IL‐1beta. The Journal of experimental medicine 212(6):927‐938. 38. Sander LE, et al. (2011) Detection of prokaryotic mRNA signifies microbial viability and promotes immunity. Nature 474(7351):385‐389. 39. Kanneganti TD, et al. (2006) Bacterial RNA and small antiviral compounds activate caspase‐1 through cryopyrin/Nalp3. Nature 440(7081):233‐236. 40. Franchi L, et al. (2014) Cytosolic double‐stranded RNA activates the NLRP3 inflammasome via MAVS‐induced membrane permeabilization and K+ efflux. Journal of immunology 193(8):4214‐4222. 41. He Y, Zeng MY, Yang D, Motro B, & Nunez G (2016) NEK7 is an essential mediator of NLRP3 activation downstream of potassium efflux. Nature 530(7590):354‐357. 42. Shi H, et al. (2016) NLRP3 activation and mitosis are mutually exclusive events coordinated by NEK7, a new inflammasome component. Nature immunology 17(3):250‐258. 43. Schmid‐Burgk JL, et al. (2016) A Genome‐wide CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) Screen Identifies NEK7 as an Essential Component of NLRP3 Inflammasome Activation. The Journal of biological chemistry 291(1):103‐109. 44. Munoz‐Planillo R, et al. (2013) K(+) efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter. Immunity 38(6):1142‐1153. 45. Petrilli V, et al. (2007) Activation of the NALP3 inflammasome is triggered by low intracellular potassium concentration. Cell death and differentiation 14(9):1583‐1589. 46. Ruhl S & Broz P (2015) Caspase‐11 activates a canonical NLRP3 inflammasome by promoting K(+) efflux. European journal of immunology 45(10):2927‐2936. 47. Schmid‐Burgk JL, et al. (2015) Caspase‐4 mediates non‐canonical activation of the NLRP3 inflammasome in human myeloid cells. European journal of immunology 45(10):2911‐2917. 48. Orlowski GM, et al. (2015) Multiple Cathepsins Promote Pro‐IL‐1beta Synthesis and NLRP3‐Mediated IL‐1beta Activation. Journal of immunology 195(4):1685‐1697. 49. Dostert C, et al. (2008) Innate immune activation through Nalp3 inflammasome sensing of asbestos and silica. Science 320(5876):674‐677. 50. Hornung V, et al. (2008) Silica crystals and aluminum salts activate the NALP3 inflammasome through phagosomal destabilization. Nature immunology 9(8):847‐856. 51. Gaidt MM, et al. (2016) Human Monocytes Engage an Alternative Inflammasome Pathway. Immunity 44(4):833‐846. 52. Gross CJ, et al. (2016) K+ Efflux‐Independent NLRP3 Inflammasome Activation by Small Molecules Targeting Mitochondria. Immunity 45(4):761‐ 773.
164 53. Iyer SS, et al. (2013) Mitochondrial cardiolipin is required for Nlrp3 inflammasome activation. Immunity 39(2):311‐323. 54. Cruz CM, et al. (2007) ATP activates a reactive oxygen species‐dependent oxidative stress response and secretion of proinflammatory cytokines in macrophages. The Journal of biological chemistry 282(5):2871‐2879. 55. Hewinson J, Moore SF, Glover C, Watts AG, & MacKenzie AB (2008) A key role for redox signaling in rapid P2X7 receptor‐induced IL‐1 beta processing in human monocytes. Journal of immunology 180(12):8410‐8420. 56. Zhou R, Yazdi AS, Menu P, & Tschopp J (2011) A role for mitochondria in NLRP3 inflammasome activation. Nature 469(7329):221‐225. 57. Shimada K, et al. (2012) Oxidized mitochondrial DNA activates the NLRP3 inflammasome during apoptosis. Immunity 36(3):401‐414. 58. Miao EA, et al. (2010) Caspase‐1‐induced pyroptosis is an innate immune effector mechanism against intracellular bacteria. Nature immunology 11(12):1136‐1142. 59. Maltez VI, et al. (2015) Inflammasomes Coordinate Pyroptosis and Natural Killer Cell Cytotoxicity to Clear Infection by a Ubiquitous Environmental Bacterium. Immunity 43(5):987‐997. 60. Aachoui Y, et al. (2015) Canonical Inflammasomes Drive IFN‐gamma to Prime Caspase‐11 in Defense against a Cytosol‐Invasive Bacterium. Cell host & microbe 18(3):320‐332. 61. Jorgensen I, Zhang Y, Krantz BA, & Miao EA (2016) Pyroptosis triggers pore‐ induced intracellular traps (PITs) that capture bacteria and lead to their clearance by efferocytosis. The Journal of experimental medicine 213(10):2113‐2128. 62. von Moltke J, et al. (2012) Rapid induction of inflammatory lipid mediators by the inflammasome in vivo. Nature 490(7418):107‐111. 63. Kayagaki N, et al. (2011) Non‐canonical inflammasome activation targets caspase‐11. Nature 479(7371):117‐121. 64. Franklin BS, et al. (2014) The adaptor ASC has extracellular and 'prionoid' activities that propagate inflammation. Nature immunology 15(8):727‐737. 65. Doitsh G, et al. (2014) Cell death by pyroptosis drives CD4 T‐cell depletion in HIV‐1 infection. Nature 505(7484):509‐514. 66. Masters SL, et al. (2012) NLRP1 inflammasome activation induces pyroptosis of hematopoietic progenitor cells. Immunity 37(6):1009‐1023. 67. Shi J, et al. (2015) Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature 526(7575):660‐665. 68. Kayagaki N, et al. (2015) Caspase‐11 cleaves gasdermin D for non‐canonical inflammasome signalling. Nature 526(7575):666‐671. 69. He WT, et al. (2015) Gasdermin D is an executor of pyroptosis and required for interleukin‐1beta secretion. Cell research 25(12):1285‐1298. 70. Ding J, et al. (2016) Pore‐forming activity and structural autoinhibition of the gasdermin family. Nature 535(7610):111‐116. 71. Liu X, et al. (2016) Inflammasome‐activated gasdermin D causes pyroptosis by forming membrane pores. Nature 535(7610):153‐158.
165 72. Aglietti RA, et al. (2016) GsdmD p30 elicited by caspase‐11 during pyroptosis forms pores in membranes. Proceedings of the National Academy of Sciences of the United States of America 113(28):7858‐7863. 73. Sborgi L, et al. (2016) GSDMD membrane pore formation constitutes the mechanism of pyroptotic cell death. The EMBO journal 35(16):1766‐1778. 74. McCormack R & Podack ER (2015) Perforin‐2/Mpeg1 and other pore‐ forming proteins throughout evolution. Journal of leukocyte biology 98(5):761‐768. 75. Gilbert RJ, Dalla Serra M, Froelich CJ, Wallace MI, & Anderluh G (2014) Membrane pore formation at protein‐lipid interfaces. Trends in biochemical sciences 39(11):510‐516. 76. Fink SL & Cookson BT (2006) Caspase‐1‐dependent pore formation during pyroptosis leads to osmotic lysis of infected host macrophages. Cellular microbiology 8(11):1812‐1825. 77. Rathinam VA, Vanaja SK, & Fitzgerald KA (2012) Regulation of inflammasome signaling. Nature immunology 13(4):333‐342. 78. Arandjelovic S & Ravichandran KS (2015) Phagocytosis of apoptotic cells in homeostasis. Nature immunology 16(9):907‐917. 79. Xu J, et al. (2014) Macrophage endocytosis of high‐mobility group box 1 triggers pyroptosis. Cell death and differentiation. 80. Smith DE (2011) The biological paths of IL‐1 family members IL‐18 and IL‐ 33. Journal of leukocyte biology 89(3):383‐392. 81. Henderson C & Goldbach‐Mansky R (2010) Monogenic IL‐1 mediated autoinflammatory and immunodeficiency syndromes: finding the right balance in response to danger signals. Clinical immunology 135(2):210‐222. 82. Weber A, Wasiliew P, & Kracht M (2010) Interleukin‐1 (IL‐1) pathway. Science signaling 3(105):cm1. 83. Dinarello CA (2009) Immunological and inflammatory functions of the interleukin‐1 family. Annual review of immunology 27:519‐550. 84. Baxevanis CN, Dedoussis GV, Gritzapis AD, Stathopoulos GP, & Papamichail M (1994) Interleukin 1 beta synergises with interleukin 2 in the outgrowth of autologous tumour‐reactive CD8+ effectors. British journal of cancer 70(4):625‐630. 85. Acosta‐Rodriguez EV, Napolitani G, Lanzavecchia A, & Sallusto F (2007) Interleukins 1beta and 6 but not transforming growth factor‐beta are essential for the differentiation of interleukin 17‐producing human T helper cells. Nature immunology 8(9):942‐949. 86. Lalor SJ, et al. (2011) Caspase‐1‐processed cytokines IL‐1beta and IL‐18 promote IL‐17 production by gammadelta and CD4 T cells that mediate autoimmunity. Journal of immunology 186(10):5738‐5748. 87. Zielinski CE, et al. (2012) Pathogen‐induced human TH17 cells produce IFN‐ gamma or IL‐10 and are regulated by IL‐1beta. Nature 484(7395):514‐518. 88. Dinarello CA (1996) Biologic basis for interleukin‐1 in disease. Blood 87(6):2095‐2147. 89. Dinarello CA (2011) A clinical perspective of IL‐1beta as the gatekeeper of inflammation. European journal of immunology 41(5):1203‐1217.
166 90. Nickel W & Rabouille C (2009) Mechanisms of regulated unconventional protein secretion. Nature reviews. Molecular cell biology 10(2):148‐155. 91. Rubartelli A, Cozzolino F, Talio M, & Sitia R (1990) A novel secretory pathway for interleukin‐1 beta, a protein lacking a signal sequence. The EMBO journal 9(5):1503‐1510. 92. Brough D & Rothwell NJ (2007) Caspase‐1‐dependent processing of pro‐ interleukin‐1beta is cytosolic and precedes cell death. Journal of cell science 120(Pt 5):772‐781. 93. MacKenzie A, et al. (2001) Rapid secretion of interleukin‐1beta by microvesicle shedding. Immunity 15(5):825‐835. 94. Le Feuvre RA, Brough D, Iwakura Y, Takeda K, & Rothwell NJ (2002) Priming of macrophages with lipopolysaccharide potentiates P2X7‐mediated cell death via a caspase‐1‐dependent mechanism, independently of cytokine production. The Journal of biological chemistry 277(5):3210‐3218. 95. Monack DM, Detweiler CS, & Falkow S (2001) Salmonella pathogenicity island 2‐dependent macrophage death is mediated in part by the host cysteine protease caspase‐1. Cellular microbiology 3(12):825‐837. 96. Chen KW, et al. (2014) The neutrophil NLRC4 inflammasome selectively promotes IL‐1beta maturation without pyroptosis during acute Salmonella challenge. Cell reports 8(2):570‐582. 97. Karmakar M, Katsnelson MA, Dubyak GR, & Pearlman E (2016) Neutrophil P2X7 receptors mediate NLRP3 inflammasome‐dependent IL‐1beta secretion in response to ATP. Nature communications 7:10555. 98. Zanoni I, et al. (2016) An endogenous caspase‐11 ligand elicits interleukin‐1 release from living dendritic cells. Science 352(6290):1232‐1236. 99. Carta S, Lavieri R, & Rubartelli A (2013) Different Members of the IL‐1 Family Come Out in Different Ways: DAMPs vs. Cytokines? Frontiers in immunology 4:123. 100. Dubyak GR (2012) P2X7 receptor regulation of non‐classical secretion from immune effector cells. Cellular microbiology 14(11):1697‐1706. 101. Andrei C, et al. (1999) The secretory route of the leaderless protein interleukin 1beta involves exocytosis of endolysosome‐related vesicles. Molecular biology of the cell 10(5):1463‐1475. 102. Andrei C, et al. (2004) Phospholipases C and A2 control lysosome‐mediated IL‐1 beta secretion: Implications for inflammatory processes. Proceedings of the National Academy of Sciences of the United States of America 101(26):9745‐9750. 103. Qu Y, Franchi L, Nunez G, & Dubyak GR (2007) Nonclassical IL‐1 beta secretion stimulated by P2X7 receptors is dependent on inflammasome activation and correlated with exosome release in murine macrophages. Journal of immunology 179(3):1913‐1925. 104. Bergsbaken T, Fink SL, den Hartigh AB, Loomis WP, & Cookson BT (2011) Coordinated host responses during pyroptosis: caspase‐1‐dependent lysosome exocytosis and inflammatory cytokine maturation. Journal of immunology 187(5):2748‐2754.
167 105. Turola E, Furlan R, Bianco F, Matteoli M, & Verderio C (2012) Microglial microvesicle secretion and intercellular signaling. Frontiers in physiology 3:149. 106. Verhoef PA, Estacion M, Schilling W, & Dubyak GR (2003) P2X7 receptor‐ dependent blebbing and the activation of Rho‐effector kinases, caspases, and IL‐1 beta release. Journal of immunology 170(11):5728‐5738. 107. Morelli A, et al. (2003) Extracellular ATP causes ROCK I‐dependent bleb formation in P2X7‐transfected HEK293 cells. Molecular biology of the cell 14(7):2655‐2664. 108. Bianco F, et al. (2005) Astrocyte‐derived ATP induces vesicle shedding and IL‐1 beta release from microglia. Journal of immunology 174(11):7268‐7277. 109. Pizzirani C, et al. (2007) Stimulation of P2 receptors causes release of IL‐ 1beta‐loaded microvesicles from human dendritic cells. Blood 109(9):3856‐ 3864. 110. Simons M & Raposo G (2009) Exosomes‐‐vesicular carriers for intercellular communication. Current opinion in cell biology 21(4):575‐581. 111. Thery C, Ostrowski M, & Segura E (2009) Membrane vesicles as conveyors of immune responses. Nature reviews. Immunology 9(8):581‐593. 112. Hemler ME (2003) Tetraspanin proteins mediate cellular penetration, invasion, and fusion events and define a novel type of membrane microdomain. Annual review of cell and developmental biology 19:397‐422. 113. Qu Y, et al. (2009) P2X7 receptor‐stimulated secretion of MHC class II‐ containing exosomes requires the ASC/NLRP3 inflammasome but is independent of caspase‐1. Journal of immunology 182(8):5052‐5062. 114. Mizushima N & Komatsu M (2011) Autophagy: renovation of cells and tissues. Cell 147(4):728‐741. 115. Levine B, Mizushima N, & Virgin HW (2011) Autophagy in immunity and inflammation. Nature 469(7330):323‐335. 116. Deretic V, Jiang S, & Dupont N (2012) Autophagy intersections with conventional and unconventional secretion in tissue development, remodeling and inflammation. Trends in cell biology. 117. Randow F & Youle RJ (2014) Self and nonself: how autophagy targets mitochondria and bacteria. Cell host & microbe 15(4):403‐411. 118. Kimura T, Mandell M, & Deretic V (2016) Precision autophagy directed by receptor regulators ‐ emerging examples within the TRIM family. Journal of cell science 129(5):881‐891. 119. Shi CS, et al. (2012) Activation of autophagy by inflammatory signals limits IL‐1beta production by targeting ubiquitinated inflammasomes for destruction. Nature immunology 13(3):255‐263. 120. Harris J, et al. (2011) Autophagy controls IL‐1beta secretion by targeting pro‐ IL‐1beta for degradation. The Journal of biological chemistry 286(11):9587‐ 9597. 121. Nakahira K, et al. (2011) Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nature immunology 12(3):222‐230.
168 122. Saitoh T, et al. (2008) Loss of the autophagy protein Atg16L1 enhances endotoxin‐induced IL‐1beta production. Nature 456(7219):264‐268. 123. Dupont N, et al. (2011) Autophagy‐based unconventional secretory pathway for extracellular delivery of IL‐1beta. The EMBO journal 30(23):4701‐4711. 124. Zhang M, Kenny SJ, Ge L, Xu K, & Schekman R (2015) Translocation of interleukin‐1beta into a vesicle intermediate in autophagy‐mediated secretion. eLife 4. 125. Kimura T, et al. (2017) Dedicated SNAREs and specialized TRIM cargo receptors mediate secretory autophagy. The EMBO journal 36(1):42‐60. 126. Yazdi AS, Drexler SK, & Tschopp J (2010) The role of the inflammasome in nonmyeloid cells. Journal of clinical immunology 30(5):623‐627. 127. Xiao H, et al. (2013) Sterol regulatory element binding protein 2 activation of NLRP3 inflammasome in endothelium mediates hemodynamic‐induced atherosclerosis susceptibility. Circulation 128(6):632‐642. 128. Artlett CM, et al. (2011) The inflammasome activating caspase 1 mediates fibrosis and myofibroblast differentiation in systemic sclerosis. Arthritis and rheumatism 63(11):3563‐3574. 129. Hirota JA, et al. (2012) The airway epithelium nucleotide‐binding domain and leucine‐rich repeat protein 3 inflammasome is activated by urban particulate matter. The Journal of allergy and clinical immunology 129(4):1116‐1125 e1116. 130. Peeters PM, Perkins TN, Wouters EF, Mossman BT, & Reynaert NL (2013) Silica induces NLRP3 inflammasome activation in human lung epithelial cells. Particle and fibre toxicology 10:3. 131. Feldmeyer L, et al. (2007) The inflammasome mediates UVB‐induced activation and secretion of interleukin‐1beta by keratinocytes. Current biology : CB 17(13):1140‐1145. 132. Tseng WA, et al. (2013) NLRP3 inflammasome activation in retinal pigment epithelial cells by lysosomal destabilization: implications for age‐related macular degeneration. Investigative ophthalmology & visual science 54(1):110‐120. 133. Tamura M, et al. (2007) Members of a novel gene family, Gsdm, are expressed exclusively in the epithelium of the skin and gastrointestinal tract in a highly tissue‐specific manner. Genomics 89(5):618‐629. 134. Aglietti RA & Dueber EC (2017) Recent Insights into the Molecular Mechanisms Underlying Pyroptosis and Gasdermin Family Functions. Trends in immunology. 135. Fujii T, et al. (2008) Gasdermin D (Gsdmd) is dispensable for mouse intestinal epithelium development. Genesis 46(8):418‐423. 136. Lin PH, Lin HY, Kuo CC, & Yang LT (2015) N‐terminal functional domain of Gasdermin A3 regulates mitochondrial homeostasis via mitochondrial targeting. Journal of biomedical science 22:44. 137. Shi P, et al. (2015) Loss of conserved Gsdma3 self‐regulation causes autophagy and cell death. The Biochemical journal 468(2):325‐336. 138. Chao KL, Kulakova L, & Herzberg O (2017) Gene polymorphism linked to increased asthma and IBD risk alters gasdermin‐B structure, a sulfatide and
169 phosphoinositide binding protein. Proceedings of the National Academy of Sciences of the United States of America. 139. Op de Beeck K, et al. (2011) The DFNA5 gene, responsible for hearing loss and involved in cancer, encodes a novel apoptosis‐inducing protein. European journal of human genetics : EJHG 19(9):965‐973. 140. Rogers C, et al. (2017) Cleavage of DFNA5 by caspase‐3 during apoptosis mediates progression to secondary necrotic/pyroptotic cell death. Nature communications 8:14128. 141. Delmaghani S, et al. (2015) Hypervulnerability to Sound Exposure through Impaired Adaptive Proliferation of Peroxisomes. Cell 163(4):894‐906. 142. Mardones P & Hetz C (2015) Peroxisomes Get Loud: A Redox Antidote to Hearing Loss. Cell 163(4):790‐791. 143. Sagulenko V, et al. (2013) AIM2 and NLRP3 inflammasomes activate both apoptotic and pyroptotic death pathways via ASC. Cell death and differentiation 20(9):1149‐1160. 144. Antonopoulos C, et al. (2015) Caspase‐8 as an Effector and Regulator of NLRP3 Inflammasome Signaling. The Journal of biological chemistry 290(33):20167‐20184. 145. Lamkanfi M, et al. (2008) Targeted peptidecentric proteomics reveals caspase‐7 as a substrate of the caspase‐1 inflammasomes. Molecular & cellular proteomics : MCP 7(12):2350‐2363. 146. Lamkanfi M & Dixit VM (2010) Manipulation of host cell death pathways during microbial infections. Cell host & microbe 8(1):44‐54. 147. Aachoui Y, Sagulenko V, Miao EA, & Stacey KJ (2013) Inflammasome‐ mediated pyroptotic and apoptotic cell death, and defense against infection. Current opinion in microbiology 16(3):319‐326. 148. Heid ME, et al. (2013) Mitochondrial reactive oxygen species induces NLRP3‐ dependent lysosomal damage and inflammasome activation. Journal of immunology 191(10):5230‐5238. 149. Kavcic N, Pegan K, & Turk B (2016) Lysosomes in programmed cell death pathways: from initiators to amplifiers. Biological chemistry. 150. Guicciardi ME & Gores GJ (2013) Complete lysosomal disruption: a route to necrosis, not to the inflammasome. Cell cycle 12(13):1995. 151. Katsnelson MA, Lozada‐Soto KM, Russo HM, Miller BA, & Dubyak GR (2016) NLRP3 inflammasome signaling is activated by low‐level lysosome disruption but inhibited by extensive lysosome disruption: roles for K+ efflux and Ca2+ influx. American journal of physiology. Cell physiology 311(1):C83‐ C100. 152. Lima H, Jr., et al. (2013) Role of lysosome rupture in controlling Nlrp3 signaling and necrotic cell death. Cell cycle 12(12):1868‐1878. 153. Yu J, et al. (2014) Inflammasome activation leads to Caspase‐1‐dependent mitochondrial damage and block of mitophagy. Proceedings of the National Academy of Sciences of the United States of America 111(43):15514‐15519. 154. Fulda S, Galluzzi L, & Kroemer G (2010) Targeting mitochondria for cancer therapy. Nature reviews. Drug discovery 9(6):447‐464.
170 155. Holmstrom KM & Finkel T (2014) Cellular mechanisms and physiological consequences of redox‐dependent signalling. Nature reviews. Molecular cell biology 15(6):411‐421. 156. Gardiner GJ, et al. (2013) A role for NADPH oxidase in antigen presentation. Frontiers in immunology 4:295. 157. Latz E (2010) NOX‐free inflammasome activation. Blood 116(9):1393‐1394. 158. Forman HJ & Torres M (2001) Redox signaling in macrophages. Molecular aspects of medicine 22(4‐5):189‐216. 159. Kerksick C & Willoughby D (2005) The antioxidant role of glutathione and N‐ acetyl‐cysteine supplements and exercise‐induced oxidative stress. Journal of the International Society of Sports Nutrition 2:38‐44. 160. Panieri E, et al. (2013) Reactive oxygen species generated in different compartments induce cell death, survival, or senescence. Free radical biology & medicine 57:176‐187. 161. Trachootham D, Lu W, Ogasawara MA, Nilsa RD, & Huang P (2008) Redox regulation of cell survival. Antioxidants & redox signaling 10(8):1343‐1374. 162. Li P, et al. (1995) Mice deficient in IL‐1 beta‐converting enzyme are defective in production of mature IL‐1 beta and resistant to endotoxic shock. Cell 80(3):401‐411. 163. Sanjana NE, Shalem O, & Zhang F (2014) Improved vectors and genome‐wide libraries for CRISPR screening. Nature methods 11(8):783‐784. 164. Shalem O, et al. (2014) Genome‐scale CRISPR‐Cas9 knockout screening in human cells. Science 343(6166):84‐87. 165. Katsnelson MA, Rucker LG, Russo HM, & Dubyak GR (2015) K+ efflux agonists induce NLRP3 inflammasome activation independently of Ca2+ signaling. Journal of immunology 194(8):3937‐3952. 166. Grynkiewicz G, Poenie M, & Tsien RY (1985) A new generation of Ca2+ indicators with greatly improved fluorescence properties. The Journal of biological chemistry 260(6):3440‐3450. 167. Boyd‐Tressler A, Penuela S, Laird DW, & Dubyak GR (2014) Chemotherapeutic drugs induce ATP release via caspase‐gated pannexin‐1 channels and a caspase/pannexin‐1‐independent mechanism. The Journal of biological chemistry 289(39):27246‐27263. 168. Case CL, et al. (2013) Caspase‐11 stimulates rapid flagellin‐independent pyroptosis in response to Legionella pneumophila. Proceedings of the National Academy of Sciences of the United States of America 110(5):1851‐ 1856. 169. Fink SL & Cookson BT (2007) Pyroptosis and host cell death responses during Salmonella infection. Cellular microbiology 9(11):2562‐2570. 170. Brennan MA & Cookson BT (2000) Salmonella induces macrophage death by caspase‐1‐dependent necrosis. Mol Microbiol 38(1):31‐40. 171. Verhoef PA, Kertesy SB, Estacion M, Schilling WP, & Dubyak GR (2004) Maitotoxin induces biphasic interleukin‐1beta secretion and membrane blebbing in murine macrophages. Molecular pharmacology 66(4):909‐920. 172. Verhoef PA, Kertesy SB, Lundberg K, Kahlenberg JM, & Dubyak GR (2005) Inhibitory effects of chloride on the activation of caspase‐1, IL‐1beta
171 secretion, and cytolysis by the P2X7 receptor. Journal of immunology 175(11):7623‐7634. 173. Estacion M, Weinberg JS, Sinkins WG, & Schilling WP (2003) Blockade of maitotoxin‐induced endothelial cell lysis by glycine and L‐alanine. American journal of physiology. Cell physiology 284(4):C1006‐1020. 174. Schilling WP, Snyder D, Sinkins WG, & Estacion M (2006) Palytoxin‐induced cell death cascade in bovine aortic endothelial cells. American journal of physiology. Cell physiology 291(4):C657‐667. 175. Ghiringhelli F, et al. (2009) Activation of the NLRP3 inflammasome in dendritic cells induces IL‐1beta‐dependent adaptive immunity against tumors. Nature medicine 15(10):1170‐1178. 176. Aymeric L, et al. (2010) Tumor cell death and ATP release prime dendritic cells and efficient anticancer immunity. Cancer research 70(3):855‐858. 177. Yang D, He Y, Munoz‐Planillo R, Liu Q, & Nunez G (2015) Caspase‐11 Requires the Pannexin‐1 Channel and the Purinergic P2X7 Pore to Mediate Pyroptosis and Endotoxic Shock. Immunity 43(5):923‐932. 178. Poon IK, et al. (2014) Unexpected link between an antibiotic, pannexin channels and apoptosis. Nature 507(7492):329‐334. 179. Chiu YH, Ravichandran KS, & Bayliss DA (2014) Intrinsic properties and regulation of Pannexin 1 channel. Channels 8(2):103‐109. 180. Chekeni FB, et al. (2010) Pannexin 1 channels mediate 'find‐me' signal release and membrane permeability during apoptosis. Nature 467(7317):863‐867. 181. Wu LJ, Sweet TB, & Clapham DE (2010) International Union of Basic and Clinical Pharmacology. LXXVI. Current progress in the mammalian TRP ion channel family. Pharmacological reviews 62(3):381‐404. 182. Hansen DB, et al. (2014) Activation, permeability, and inhibition of astrocytic and neuronal large pore (hemi)channels. The Journal of biological chemistry 289(38):26058‐26073. 183. Compan V, et al. (2012) Cell volume regulation modulates NLRP3 inflammasome activation. Immunity 37(3):487‐500. 184. Lee GS, et al. (2012) The calcium‐sensing receptor regulates the NLRP3 inflammasome through Ca2+ and cAMP. Nature 492(7427):123‐127. 185. Lansman JB (1990) Blockade of current through single calcium channels by trivalent lanthanide cations. Effect of ionic radius on the rates of ion entry and exit. The Journal of general physiology 95(4):679‐696. 186. Mlinar B & Enyeart JJ (1993) Block of current through T‐type calcium channels by trivalent metal cations and nickel in neural rat and human cells. The Journal of physiology 469:639‐652. 187. Malasics A, Boda D, Valisko M, Henderson D, & Gillespie D (2010) Simulations of calcium channel block by trivalent cations: Gd(3+) competes with permeant ions for the selectivity filter. Biochimica et biophysica acta 1798(11):2013‐2021. 188. Ermakov YA, Kamaraju K, Sengupta K, & Sukharev S (2010) Gadolinium ions block mechanosensitive channels by altering the packing and lateral pressure of anionic lipids. Biophys J 98(6):1018‐1027.
172 189. Anishkin A, Loukin SH, Teng J, & Kung C (2014) Feeling the hidden mechanical forces in lipid bilayer is an original sense. Proceedings of the National Academy of Sciences of the United States of America 111(22):7898‐ 7905. 190. Sandilos JK, et al. (2012) Pannexin 1, an ATP release channel, is activated by caspase cleavage of its pore‐associated C‐terminal autoinhibitory region. The Journal of biological chemistry 287(14):11303‐11311. 191. Latz E, Xiao TS, & Stutz A (2013) Activation and regulation of the inflammasomes. Nature reviews. Immunology 13(6):397‐411. 192. Desai BN, et al. (2012) Cleavage of TRPM7 releases the kinase domain from the ion channel and regulates its participation in Fas‐induced apoptosis. Developmental cell 22(6):1149‐1162. 193. Knowles H, Li Y, & Perraud AL (2013) The TRPM2 ion channel, an oxidative stress and metabolic sensor regulating innate immunity and inflammation. Immunologic research 55(1‐3):241‐248. 194. Zhong Z, et al. (2013) TRPM2 links oxidative stress to NLRP3 inflammasome activation. Nature communications 4:1611. 195. Chubanov V, et al. (2012) Natural and synthetic modulators of SK (K(ca)2) potassium channels inhibit magnesium‐dependent activity of the kinase‐ coupled cation channel TRPM7. British journal of pharmacology 166(4):1357‐ 1376. 196. Chubanov V, Schafer S, Ferioli S, & Gudermann T (2014) Natural and Synthetic Modulators of the TRPM7 Channel. Cells 3(4):1089‐1101. 197. Katsnelson MA, Lozada‐Soto KM, Russo HM, Miller BA, & Dubyak GR (2016) NLRP3 Inflammasome Signaling is Activated by Low‐Level Lysosome Disruption but Inhibited by Extensive Lysosome Disruption: Roles for K+ Efflux and Ca2+ Influx. American journal of physiology. Cell physiology:ajpcell 00298 02015. 198. Cai Z, et al. (2014) Plasma membrane translocation of trimerized MLKL protein is required for TNF‐induced necroptosis. Nature cell biology 16(1):55‐65. 199. Wang H, et al. (2014) Mixed lineage kinase domain‐like protein MLKL causes necrotic membrane disruption upon phosphorylation by RIP3. Molecular cell 54(1):133‐146. 200. Dondelinger Y, et al. (2014) MLKL compromises plasma membrane integrity by binding to phosphatidylinositol phosphates. Cell reports 7(4):971‐981. 201. Su L, et al. (2014) A plug release mechanism for membrane permeation by MLKL. Structure 22(10):1489‐1500. 202. Ma Z, et al. (2012) Calcium homeostasis modulator 1 (CALHM1) is the pore‐ forming subunit of an ion channel that mediates extracellular Ca2+ regulation of neuronal excitability. Proceedings of the National Academy of Sciences of the United States of America 109(28):E1963‐1971. 203. Siebert AP, et al. (2013) Structural and functional similarities of calcium homeostasis modulator 1 (CALHM1) ion channel with connexins, pannexins, and innexins. The Journal of biological chemistry 288(9):6140‐6153.
173 204. Taruno A, et al. (2013) CALHM1 ion channel mediates purinergic neurotransmission of sweet, bitter and umami tastes. Nature 495(7440):223‐ 226. 205. Jain M, et al. (2012) Metabolite profiling identifies a key role for glycine in rapid cancer cell proliferation. Science 336(6084):1040‐1044. 206. Singer, II, et al. (1995) The interleukin‐1 beta‐converting enzyme (ICE) is localized on the external cell surface membranes and in the cytoplasmic ground substance of human monocytes by immuno‐electron microscopy. The Journal of experimental medicine 182(5):1447‐1459. 207. Lamkanfi M & Dixit VM (2014) Mechanisms and Functions of Inflammasomes. Cell 157(5):1013‐1022. 208. Aziz M, Jacob A, & Wang P (2014) Revisiting caspases in sepsis. Cell death & disease 5:e1526. 209. Chen X, et al. (2016) Pyroptosis is driven by non‐selective gasdermin‐D pore and its morphology is different from MLKL channel‐mediated necroptosis. Cell research 26(9):1007‐1020. 210. Russo HM, et al. (2016) Active Caspase‐1 Induces Plasma Membrane Pores That Precede Pyroptotic Lysis and Are Blocked by Lanthanides. Journal of immunology 197(4):1353‐1367. 211. Gaidt MM & Hornung V (2016) Pore formation by GSDMD is the effector mechanism of pyroptosis. The EMBO journal 35(20):2167‐2169. 212. Chu CT, et al. (2013) Cardiolipin externalization to the outer mitochondrial membrane acts as an elimination signal for mitophagy in neuronal cells. Nature cell biology 15(10):1197‐1205. 213. Chirieleison SM, et al. (2017) Nucleotide‐binding oligomerization domain (NOD) signaling defects and cell death susceptibility cannot be uncoupled in X‐linked inhibitor of apoptosis (XIAP)‐driven inflammatory disease. The Journal of biological chemistry. 214. Starkov AA (2008) The role of mitochondria in reactive oxygen species metabolism and signaling. Annals of the New York Academy of Sciences 1147:37‐52. 215. Brookes PS, Yoon Y, Robotham JL, Anders MW, & Sheu SS (2004) Calcium, ATP, and ROS: a mitochondrial love‐hate triangle. American journal of physiology. Cell physiology 287(4):C817‐833. 216. Weinberg JM, Bienholz A, & Venkatachalam MA (2016) The role of glycine in regulated cell death. Cellular and molecular life sciences : CMLS 73(11‐ 12):2285‐2308. 217. van Bruggen R, et al. (2010) Human NLRP3 inflammasome activation is Nox1‐4 independent. Blood 115(26):5398‐5400. 218. Chipuk JE & Luna‐Vargas MP (2017) The peroxisomes strike BAK: Regulation of peroxisome integrity by the Bcl‐2 family. The Journal of cell biology. 219. Hosoi KI, et al. (2017) The VDAC2‐BAK axis regulates peroxisomal membrane permeability. The Journal of cell biology. 220. Cao SS & Kaufman RJ (2014) Endoplasmic reticulum stress and oxidative stress in cell fate decision and human disease. Antioxidants & redox signaling 21(3):396‐413.
174 221. Lerner AG, et al. (2012) IRE1alpha induces thioredoxin‐interacting protein to activate the NLRP3 inflammasome and promote programmed cell death under irremediable ER stress. Cell metabolism 16(2):250‐264. 222. Menu P, et al. (2012) ER stress activates the NLRP3 inflammasome via an UPR‐independent pathway. Cell death & disease 3:e261. 223. Oslowski CM, et al. (2012) Thioredoxin‐interacting protein mediates ER stress‐induced beta cell death through initiation of the inflammasome. Cell metabolism 16(2):265‐273. 224. Martin‐Sanchez F, et al. (2016) Inflammasome‐dependent IL‐1beta release depends upon membrane permeabilisation. Cell death and differentiation 23(7):1219‐1231. 225. Dinarello CA & van der Meer JW (2013) Treating inflammation by blocking interleukin‐1 in humans. Seminars in immunology 25(6):469‐484. 226. Brydges SD, et al. (2009) Inflammasome‐mediated disease animal models reveal roles for innate but not adaptive immunity. Immunity 30(6):875‐887. 227. Brydges SD, et al. (2013) Divergence of IL‐1, IL‐18, and cell death in NLRP3 inflammasomopathies. The Journal of clinical investigation 123(11):4695‐ 4705. 228. Franchi L, Munoz‐Planillo R, & Nunez G (2012) Sensing and reacting to microbes through the inflammasomes. Nature immunology 13(4):325‐332. 229. Schmitz N, Kurrer M, Bachmann MF, & Kopf M (2005) Interleukin‐1 is responsible for acute lung immunopathology but increases survival of respiratory influenza virus infection. Journal of virology 79(10):6441‐6448. 230. Gardella S, et al. (2000) Secretion of bioactive interleukin‐1beta by dendritic cells is modulated by interaction with antigen specific T cells. Blood 95(12):3809‐3815. 231. Cataldi M, Perez‐Reyes E, & Tsien RW (2002) Differences in apparent pore sizes of low and high voltage‐activated Ca2+ channels. The Journal of biological chemistry 277(48):45969‐45976. 232. Craven RR, et al. (2009) Staphylococcus aureus alpha‐hemolysin activates the NLRP3‐inflammasome in human and mouse monocytic cells. PloS one 4(10):e7446. 233. Riganti C, et al. (2004) Diphenyleneiodonium inhibits the cell redox metabolism and induces oxidative stress. The Journal of biological chemistry 279(46):47726‐47731. 234. Anthony TG & Wek RC (2012) TXNIP switches tracks toward a terminal UPR. Cell metabolism 16(2):135‐137. 235. Braig S, et al. (2015) Pharmacological targeting of membrane rigidity: implications on cancer cell migration and invasion. New Journal of Physics 17.
175