USOO9719119B2

(12) United States Patent (10) Patent No.: US 9,719,119 B2 Beauprez et al. (45) Date of Patent: Aug. 1, 2017

(54) MUTANT MICROORGANISMS TO OTHER PUBLICATIONS SYNTHESIZE COLANIC ACID, MANNOSYLATED AND/OR FUCOSYLATED Waegemann et al. Effect of icIR and arc A deletions on physiology and metabolic fluxes in Escherishia coli BL21 (DE3). Biotechnol OLGOSACCHARDES ogy Letters vol. vol. 34.No2. Oct. 19, 2011, p. 329-337.* Waegemann et al. Effect of icIR and arc A knockouts on biomass (71) Applicant: Universiteit Gent, Ghent (BE) formation and metabolic fluxes in Escherichia colliK12 and its implications on understanding the metabolism of Escherichia coli (72) Inventors: Joeri Beauprez, Bredene (BE): BL21 (DE3) BMC Microbiology 2011.* Waegeman et al (Effect of icIR and arcA knockouts on biomass Gaspard Lequeux, Ghent (BE); Jo formation and metabolic fluxes in Escherichia coli K12 and its Maertens, Ghent (BE) implications on understanding the metabolism of Escherichia coli BL21 (DE3) BMC Microbiol. Apr. 11, 2011; 11:70).* (73) Assignee: Universiteit Gent, Ghent (BE) Aerts, D et al., “A constitutive expression system for high through put screening.” 2011, Eng. Life Sci., 11:10-19. (*) Notice: Subject to any disclaimer, the term of this Alper, H. et al., “Tuning genetic control through promoter engi patent is extended or adjusted under 35 neering.” 2005, PNAS, 102:12678-12683. Aristidou, A. et al., “Metabolic engineering of Escherichia coli to U.S.C. 154(b) by 215 days. enhance recombinant protein production through acetate reduction'. 1995, Biotechnol. Prog., 11: 475-478. (21) Appl. No.: 14/365,063 Beauprez, J. "Metabolic modelling and engineering of Escherichia coli for succinate production.” 2010, PhD thesis, Ghent University. (22) PCT Filed: Dec. 14, 2012 Ghent, Belgium. (301 pages). Bode, L. “Recent Advances on Structure, Metabolism, and Function (86). PCT No.: PCT/EP2012/075639 of Human Milk Oligosaccharides' 2006, J. Nutr. 136:2127-2130. Canton, B. et al., “Refinement and standardization of synthetic S 371 (c)(1), biological parts and devices.” 2008, Nat Biotech 26:787-793. (2) Date: Jun. 12, 2014 Cavallaro, G. et al., Glycosilated Macromolecular Conjugates of Antiviral Drugs with a Polyaspartamide, 2004, Journal of Drug Targeting 12:593-605. (87) PCT Pub. No.: WO2013/087884 Coppa, G. V. et al., “Prebiotics in human milk: a review” 2006, PCT Pub. Date: Jun. 20, 2013 Digestive and Liver Disease 38: S291-S294. Datsenko, K. A. et al., "One-step inactivation of chromosomal genes (65) Prior Publication Data in Escherichia coli K-12 using PCR products,” 2000, PNAS, 97:6640-6645. US 2014/0349348 A1 Nov. 27, 2014 De Mey, M. et al., “Comparison of different strategies to reduce acetate formation in Escherichia coli,” 2007, Biotechnol. Prog. (30) Foreign Application Priority Data 23:1053-1063. De Mey, M. et al., “Construction and model-based analysis of a promoter library for E. coli: an indispensable tool for metabolic Dec. 16, 2011 (EP) ...... 111941.03 engineering.” 2007, BMC Biotechnology, 7:34-48. Deng, M.-D. et al., “Metabolic engineering of Escherichia coli for (51) Int. Cl. industrial production of glucosamine and N-acetylglucosamine.” C07K I4/245 (2006.01) 2005, Metabolic Engineering, 7:201-214. CI2P 19/04 (2006.01) (Continued) CI2P 19/32 (2006.01) CI2N 15/52 (2006.01) Primary Examiner — Kagnew H Gebreyesus CI2P 7/40 (2006.01) (74) Attorney, Agent, or Firm — McDonnell Boehnen CI2P 19/12 (2006.01) Hulbert & Berghoff LLP (52) U.S. Cl. CPC ...... CI2P 19/04 (2013.01); C07K 14/245 (57) ABSTRACT (2013.01); C12N 15/52 (2013.01); C12P 7/40 The present invention relates to mutated and/or transformed (2013.01); C12P 19/12 (2013.01); CI2P 19/32 microorganisms for the synthesis of various compounds. (2013.01) More specifically, the present invention discloses microor (58) Field of Classification Search ganisms mutated in the genes encoding for the regulators CPC ... C07K 14/245; C07K 16/1232; C12P 19/04; ArcA and IclR. The latter mutations result in a significant A61K 39/O258 upregulation of the genes that are part of the collanic acid operon. Hence, said microorganisms are useful for the See application file for complete search history. synthesis of any compound being part of the collanic acid (56) References Cited pathway such as GDP-fucose, GDP-mannose and colanic acid, and/or, can be further used starting form GDP-fucose U.S. PATENT DOCUMENTS as a precursor—to synthesize fucosylated oligosaccharides or—starting from GDP-mannose as a precursor—to synthe 5,858,752 A 1/1999 Seed et al. size mannosylated oligosaccharides. In addition, mutations 5,939,279 A 8, 1999 Smith et al. in the genes coding for the transcriptional regulators ArcA and IclR lead to an acid resistance phenotype in the expo FOREIGN PATENT DOCUMENTS nential growth phase allowing the synthesis of pH sensitive WO 2006.034156 A2 3, 2006 molecules or organic acids. WO 2010 108909 A1 9, 2010 WO 2011083059 A1 T/2011 17 Claims, 15 Drawing Sheets US 9,719,119 B2 Page 2

(56) References Cited Salis, H. M. et al., “Automated design of synthetic ribosome binding sites to control protein expression.” 2009, Nat Biotech, 27.946-950. Sanchez A.M. et al., “Novel pathway engineering design of the OTHER PUBLICATIONS anaerobic central metabolic pathway in Escherichia coli to increase Succinate yield and productivity,” 2005, Metabolic Engineering, Dumon, C. et al., “In vivo fucosylation of lacto-N-neotetraose and T:229-239. lacto-N-neohexaose by heterologous expression of Helicobacter Shalei-Levanon, S. et al., “Effect of AreA and FNR on the expres pylori alpha-1,3 fucosyltransferase in engineered Escherichia coli. sion of genes related to the Oxygen regulation and glycolysis Glycoconjugate Journal, 18:465-474. pathway in Escherichia coli under growth conditions.” 2005, Bio Ebel, W. et al., “Escherichia coli RcsA, a Positive Activator of technology and Bioengineering, 92: 147-159. Colanic Acid Capsular Polysaccharide Synthesis, Functions to Shalei-Levanon, S. et al., “Effect of oxygen on the Escherichia coli Activate Its Own Expression.” 1999, Journal of Bacteriology Area and FNR regulation systems and metabolic responses.” 2005, 181:577-584. Biotechnology and Bioengineering, 89:556-564. Foster, J. W., "Escherichia coli acid resistance: Tales of an amateur acidophile.” 2004, Nature Reviews Microbiology 2:898-907. Smyth, G. K., “Limma: Linear models for microarray data.” 2005, Stevenson, G. et al., Organization of the Escherichia coli K-12 gene In: Bioinformatics and Computational Biology Solutions using R cluster responsible for production of the extracellular polysaccha and Bioconductor, R. Gentleman, V. Carey, S. Dudoit, R. Irizarry, ride collanic acid, 1996, Journal of Bacteriology, 178(16):4885 W. Huber (eds.), Springer, New York, pp. 397–420. 4893. Smyth, G. K., “Linear Models and Empirical Bayes Methods for Hammer, K. et al., “Synthetic promoter libraries-tuning of gene Assessing Differential Expression in Microarray Experiments.” expression.” 2006, Trends in Biotechnology 24(2):53-55. 2004, Statistical Applications in Genetics and Molecular Biology Hanahan, D. et al., “Plasmid transformation of Escherichia coli and 3:1-26. other bacteria,” 1991, Methods in Enzymology 204:63-113. Smyth, G. K. et al., “Normalization of eDNA microarray data.” Hommais, F. et al., “GadE (YhiE): a novel activator involved in the 2003, Methods 31:265-273. response to acid environment in Escherichia coli,” 2004, Microbi Spiess, A.-N. et al., “Highly accurate sigmoidal fitting of real-time ology 150:61-72. PCR data by introducing a parameter for asymmetry,” 2008, BMC Jigami, Y. "Yeast Glycobiology and Its Application.” 2008, Biosci Bioinformatics 9:221. ence, Biotechnology, and Biochemistry 72:637-648. Stevenson, G. et al., “Organization of the Escherichia coli K-12 Keasling, J. D., “Gene-expression tools for the metabolic engineer gene cluster responsible for production of the extracellular poly ing of bacteria,” 1999, Trends in Biotechnology 17:452-460. saccharide collanic acid.” 1996, Journal of Bacteriology, 178:4885 Lee W. H. et al., “Modulation of guanosine 5'-diphosphate-d- 4893. mannose metabolism in recombinant Escherichiacoli for production Stout, V. et al., “RicSA, an unstable positive regulator of capsular of guanosine 5'-diphosphate-l-fucose.” 2006, Bioresource Technol polysaccharide synthesis.” 1991, Journal of Bacteriology 173:1738 ogy, 100:6143-6148. 1747. Lequeux, G. Metabolic modelling and analysis for the optimisation Sunnarborg, A. et al., “Regulation of the glyoxylate bypass operon: of Escherichia coli as a production host. Ph.D. thesis, 2008, Ghent cloning and characterization of IciR.” 1990, Journal of Bacteriol University, Ghent, Belgium (178 pages). ogy 172:2642-2649. Lequeux, G. et al., “Metabolic flux analysis of C- and P-limited Waegeman, H. J. et al., “Effect of icIR and arc A knockouts on shikimic acid producing E. coli,” 2005, Journal of Biotechnology, biomass formation and metabolic fluxes in Escherichia coli K12 118:S121-S121. and its implications on understanding the metabolism of Masuda, N. et al., “Regulatory network of acid resistance genes in Escherichia coli BL21 (DE3).” 2011, BMC Microbiology 11:(70) Escherichia coli.” 2003, Molecular Microbiology 48:699-712. 1-17. Pattyn, F. et al., “RTPrimerDB: The Real-Time PCR primer and Waegeman H. et al., “Effect of iclR and arcAdeletions on physi probe database.” 2006, Nucleic Acids Research 34:D684-D688. ology and metabolic fluxes in Escherichia coli BL21 (DE3).” 2012, Perrenoud, A. et al., “Impact of global transcriptional regulation by Biotechnol Lett., 34:329-337. Area, ArcB, Cra, Crp, Cya, Fnr, and Mlc on glucose catabolism in Waegeman H. et al., “Increasing recombinant protein production in Escherichia coli.” 2005, Journal of Bacteriology 187:3171-3179. Escherichia coli through metabolic and genetic engineering.” 2011, Ringenberg M. et al., “Redirection of sialic acid metabolism in J Ind Microbiol Biotechnol. 38:1891-1910. genetically engineered Escherichia coli,” 2001, Glycobiology, Waegeman H. et al., “Increasing recombinant protein production in 11:533-539. Escherichia coli K12 through metabolic engineering.” 2013, New Ritz, C. et al., “qpcR: an R package for sigmoidal model selection Biotechnology, 30:255-61. in quantitative real-time polymerase chain reaction analysis,” 2008, Warnecke, T. et al., “Organic acid toxicity, tolerance, and production Bioinformatics 24:1549-1551. in Escherichia coli biorefining applications.” 2005, Microbial Cell The International Search Report of the International Searching Factories 4:25. Authority for International Application No. PCT/EP2012/075639; dated Apr. 18, 2013, pp. 1-7. * cited by examiner U.S. Patent Aug. 1, 2017 Sheet 1 of 15 US 9,719,119 B2

Figure 1

CpSG cpsB gmd fo ugd WZa rCSA gene WT O arCA icr arcAicir U.S. Patent Aug. 1, 2017 Sheet 2 of 15 US 9,719,119 B2

Figure 2

-10 cpSG cpsB gmd fo ugd WZa rCSA gene U.S. Patent Aug. 1, 2017 Sheet 3 of 15 US 9,719,119 B2

Figure 3

LZj/9999 U.S. Patent Aug. 1, 2017 Sheet 4 of 15 US 9,719,119 B2

Figure 4 Fructose-6-P man A Mannose-6- cpSG Galactose Mannose-1-P - ATP E. gal K RS Galactose-1-SADP Glucose-1-phosphate GDP-mannosePP, in mannose galT - UDP-glucose gall, galF gmd Ho l) DP-galactoseGlucose-1-P UDP-glucose* PP, GDP-4-dehydro-deoxymannosew - 2 NAD", H2O NADP galE ugal I -- Y 2 NADH fel NADP UDP-glucose UDP-gluconate GDP-fucose Acetyl CoA Pyruvate — Transfer of G1 P to Und-P carrier wica.JP Sequentialw o transfer of other sugars "": CaEw Cal 1'cal ? Acetylation J.P. Prusylation sigk Export of the E unit to the periplasm wz.x? polymerisation agp Export of collanic acid to the extracellular wza W2b space 2C2 Extracellular collanic acid 3-gal 3 or 6 -galactose4. Y Pyruvyl B-glucosate p-galaciose Acctyl - ?uchye-fucose-folucose. . -1. n US 9,719,119 B2

Figure 5

Y - Cd w

Y w s -

NNY Yat C AV i-NY s NN N a. N NAN- tAN W U.S. Patent Aug. 1, 2017 Sheet 6 of 15 US 9,719,119 B2

Figurc 6 GTP PP, HO NADPH NADP Mannose-6-P Mannose-1-P - GDP-mannose A GDP-4-dehydro-6- N - y GDP-fucose cpsG cpSB gmd deoxy-mannose fel

2

C c $ -z2 CD CD C Old

d did -4 2 t c) Y -6 -

-8 --- T cpsG cpsB gmd foc Gene WT arcA iclR L J arcAicr U.S. Patent Aug. 1, 2017 Sheet 7 Of 15 US 9,719,119 B2

Figure 7 Glucose glk

Glucose-6-P pgi x

pfkA, p?kB ^ Fructose-1,6-bisp Pentose phosphate Fructose-6-P pathway

man A Mannose-6-P Biomass

is PP, gmm Upregulation arca GDP-mannose X- OS gulf iR H.O lactoseextracellular GDP-4-dehydro-6-deoxy-mannose - NADPH lacy fel NADP' lactoseintracellular GDP-fucose Colanic acid - - - - WCaA, wcaB, w 2., WCaD, wca E, lacz O-1,2-ficosyltransferase WCaF, WCal, wCal J, wcaK, wca L., wCaM o-1,2-fucosyllactose Galactose Glucose

U.S. Patent Aug. 1, 2017 Sheet 9 Of 15 US 9,719,119 B2

Figure 9 Glucose glk

Glucose-6-P PX × Y SJ pfkA, p-B A. Fructose-1,6-bisp''x' Fructose-6-P Pentosepathway phosphate

main A Mannose-6-P Biomass cpSG f Mannose-1-P -...if GTP Y PP, gmm Upregulation arCA GDP-mannose X OS r iclR gmd f | HO lactose extracellular GDP-4-dehydro-6-deoxy-mannosc NADPH lacy ? fel f NADP lactoseintracellular GDP-fucose —X- y Colanic acid lac2x O-1,2-fucosyltransferaseN------0-1,2-fucosyllactose Galactose Glucose U.S. Patent Aug. 1, 2017 Sheet 10 of 15 US 9,719,119 B2

Figure 10 D-Glucose - ATP glk Y ADP gi D-Gluc ose-6-P-X-P – - NADPH zwf NADP' D-Glucono-6-lactone-6-P pg/ | HO 6-phosphogluconate NADP's l gned NADPH, CO D-ribulose-5-P rpe / N rpiA. als M 10.66 N 0.33 Glyceraldehyde-3-P D-xylulose-5-P D-ribose-5-P w w tktA, tRtB/ ().33 w --0.33 --- ItktA,--- tRtB - w \ Glycerald ehyde-3-P Dsedoheptulose-7-P A 0.33 N ------y 0.33--- ItalA. talB -- a Fructose-6-P D-erythrose-4-P Fru ctose-6-P | 0.66 Fructose-6-P - Mannose-6-P pfkA,ATP- pfkBX man A (),66 cpsG ADP Mannose-1-P Fructose-1,6-bis P - GTP ().66 cps B S. P. GDP-mannose 0.66 HO gmd ADP GDP-4-dehydro-6-deox -a0S \? indk NADPH (). 66 fel N ATP NADP' GDP-fucose lactose 0.66 Biomass Fucosyllactose-- GDP U.S. Patent Aug. 1, 2017 Sheet 11 of 15 US 9,719,119 B2

Figure | 1 Sucrose Sucrose phosphorylase - N u?- y Fructose Glucose-1-P - ATP - ATP mak pgn pfkA, pfkB ADP Rgi | ADP Fructose-1,6-bis e X Fructose-6-P sGlucose-6-P

mana Y. Mannose-6-P Pentose phosphate pathway - Biomass cpsGf } Mannose-1-P Upregulation arca - GTP iclR o, if H OS k f DP-mannosePP gndX- O GDP-1-dehydro-1-deoxy-mann.NADPH xcl NADP'GDP-fucose

acceptor--- Y, X i nosyltransferase Colanic acid Mannosylated oligosaccharides

Sucrose

intertase

Fructose Glucose - ATP - ATP (mak ( glk p?kA. pfkB ADP JYADP Fructose-1,6-bisCObse S P : X Fructose 6 P G COS -6-P man A N Mannose-6-P Pentose phosphate Biomass cpsG7 pathway Mannose-1-P Upregulation arCA -GTP icIR

chif H OS SKf GDP-mannosePP, X-ng O GDP-4-dehydro-6-deoxy-mannoseNADPH 's- c NADP- GDP-fucose acceptor- X mannosyltransferase Colanic acid Mannosylated oligosaccharides U.S. Patent Aug. 1, 2017 Sheet 12 of 15 US 9,719,119 B2

Figure 12:

|

-4

-6

- 10 ydeP ydeO hdea haeD gadB gadC gadE gadX gadW slp gene

U.S. Patent Aug. 1, 2017 Sheet 13 of 15 US 9,719,119 B2

Figure 13:

1. C 1.34

15.

15.5 1. 182 SO F. FOO 1725

1.36 &

1575 18O 1S25 1 S5) 1SF5 1FOO 1.25

A 1.

s

5.75 SO 3.25 15. 13.5 OO 17.5 U.S. Patent Aug. 1, 2017 Sheet 14 of 15 US 9,719,119 B2

Figure 14:

48744 m.

48744 m.a.

48744 miz A

s

8. 88 U.S. Patent Aug. 1, 2017 Sheet 15 of 15 US 9,719,119 B2

Figure 15:

UTR sequence part (SEO ID N° 3) TGTTTATTTATCACTTTGGCAGAGTAATTATCCTGTGCACTATTAATAGCAATGTCGCCA TGCACATTTACCTTGCAGTTAATTGAATAAAAATTTAACTGGCATCAGTCCTAAAAAAAT TGATTTCATCCGCAGGCTATTGACAGAATAATTCAGACTGGTCTTTCAGGCATCCAGACA CGCTACCCCCCCTGGCTTTTTAGCTACCAAT ACACTGATTTAGTTTAATTTTTCACACCC TCTCAGCATGCAGTCGTTGATGAGAAAGGGTTATTACGGAAATTAACTTCCGAATATAAG GTGACATTATGGTAATTGAATATTGGCTTTCCAATAATGC Artificial promoter sequence part (SEQ ID N 4) CGAGGTCGACGGATCCCAAGCTTCTTCTAGAGCGGCCGCCATGGAAATTTCCCTATTATA CCATATGCCGGCCAAGATGTCAAGAAACTTATAGAATGAAG Regulon sequence part SEQ ID N 5) TAAGTGTCATTCAATATGGTTTTTAGGAGTTTCTTTAGGTTGAC Complete promoter sequence (SEQ ID N 6): TGTTTATTTATCACTTTGGCAGAGTAATTATCCTGTGCACTATTAATAG CAATGTCGCCAT GCACATTTAC CTTGCAGTTAATTGAATAAAAATTTAACTGGCATCAGTCCTAAAAAAATTG ATTTCATCCGCAGGCTATTGACAGAATAATTCAGACTGGTCTTTCAGGCATCCAGACACGC TACCGCCCCTGGCTTTTTAGCTACCAATACACTGATTTAGTTTAATTTTTCACACCCTCTC AGCATGCAGTCGTTGATGAGAAAGGGTTATTACGGAAATTAACTTCCGAATATAAGGTGAC ATTATGGTAATTGAATATTGGCTTTCCAATAATGCCGAGGTCGACGGATCCCAAGCTTCTT CTAGAGCGGCCGCCATGGAAATTTCCCTATTATAC CATATGCCGGCCAAGATGTCAAGAAA CTTATAGAATGAAGTAAGTGTCATTCAATATGGTTTTTAGGAGTTTCTTTAGGTTGAC US 9,719,119 B2 1. 2 MUTANT MICROORGANISMS TO GDP-mannose is important for the humanization of protein SYNTHESIZE COLANIC ACID, glycosylations, which is essential for the production of MANNOSYLATED AND/OR FUCOSYLATED certain therapeutic proteins (18, 30). Mannosylated oli OLGOSACCHARDES gosaccharides and mannosylated glycoconjugates are also used for drug targeting, for instance mannosylated antivirals This application is a US national phase of International can specifically target the liver and kidneys (7). Application No. PCT/EP2012/075639 filed on Dec. 14, The present invention provides microorganisms which are 2012, which claims the benefit of European patent applica genetically changed in Such a manner that they can effi tion 11 194101.5, filed Dec. 16, 2011, the disclosures of ciently produce the latter compounds. which are incorporated herein by reference in their entirety. 10 Moreover, the synthesis of pH sensitive molecules, such as—but not limited to glucosamine, and organic acids, FIELD OF THE INVENTION Such as but not limited to pyruvic acid, Succinic acid, The present invention relates to mutated and/or trans adipic, sialic acid, sialylated oligosaccharides . . . are pref formed microorganisms for the synthesis of various com 15 erably produced at low pH, either to stabilize the product or pounds. More specifically, the present invention discloses for downstream processing reasons (4, 12, 40). Therefore, microorganisms mutated in the genes encoding for the strains that can grow at low pH are beneficial for these regulators ArcA and IclR. The latter mutations result in a production processes. E. coli is an organism that can adapt significant upregulation of the genes that are part of the easily to various conditions, for instance it can easily adapt collanic acid operon. Hence, said microorganisms are useful to the harsh pH conditions in the stomach, which is about pH for the synthesis of any compound being part of the collanic 2 (14). Nonetheless, E. coli does not seem to grow at these acid pathway such as GDP-fucose, GDP-mannose and col conditions, but induces its acid resistance mechanisms in the anic acid, and/or, can be further used—starting from GDP stationary phase (40). During this phase the cell does not fucose as a precursor—to synthesize fucosylated oligosac multiply anymore and therefore hampers productivity. Up to charides or—starting from GDP-mannose as a precursor— 25 now, no solution was found to this problem. However, in the to synthesize mannosylated oligosaccharides. In addition, present invention, a genetically engineered microorganism mutations in the genes coding for the transcriptional regu is provided that can induce acid resistance mechanisms in lators ArcA and IclR lead to an acid resistance phenotype in the exponential growth phase, which is the phase that is the exponential growth phase allowing the synthesis of pH mostly used for production of organic acids and pH instable sensitive molecules and organic acids. 30 products.

BACKGROUND OF THE INVENTION BRIEF DESCRIPTION OF FIGURES The genes arcA encoding for the aerobic respiration FIG. 1: Relative gene expression pattern of the wild type, control protein and iclR encoding the isocitrate lyase regu 35 the AiclR and AarcA mutant strain to the AarcAAiclR mutant lator are known to regulate the central carbon metabolism. strain of genes involved in collanic acid biosynthesis in batch ArcA is a global transcriptional regulator that regulates a fermentation conditions. The genes involved in collanic acid wide variety of genes, while IclR is a local transcriptional biosynthesis are presented in FIGS. 3 and 4. regulator that regulates the glyoxylate pathway. ArcA is FIG. 2: Gene expression pattern of the collanic acid operon known to regulate the central carbon metabolism in response 40 of the wild type, the AiclR and Aarc A mutant strain in to oxygen deprivation and has no connection with IclR other chemostat fermentation conditions relative to the than that it also regulates the glyoxylate pathway (24, 28, 29. AarcAAiclR mutant strain. 37, 38). In an earlier study the combined effect of FIG. 3: The gene organisation of the collanic acid operon AiclRAarcA mutant strains on the central carbon metabolism and an overview of the function of these genes: has been observed. Increased fluxes were shown in the 45 tricarboxylic acid (TCA) cycle and glyoxylate pathway and an interesting and Surprising phenotype appeared when both Gene: Function: genes where knocked out, namely the double mutant strain WZ8 Component of capsular polysaccharide export formed biomass with a yield that approached the maximal apparatus theoretical yield (4,39). 50 wzb Tyrosine phosphatase Some compounds, such as GDP-fucose, are in high WZC. Tyrosine kinase demand. The latter compound is indeed a precursor of wca.A Glycosyltransferase wcaB Acyltransferase fucosylated oligosaccharides Such as fucosyllactose, fuco wcaC Glycosyltransferase syllactoNbiose and lewis X oligosaccharides, or, of fucosy wcaD Colanic acid polymerase lated proteins. These Sugars are components of human 55 wcaE Glycosyltransferase mother milk in which they have anti-inflammatory and wcaF Acyltransferase gmd GDP-mannose-4,6-dehydratase prebiotic effects and/or have applications in therapeutics as fc GDP-fucose synthase nutraceutical, anti-inflammatory agent or prebiotic, in addi gmm GDP-mannose hydrolase tion, fucosylated proteins find applications in the pharma wcal Glycosyltransferase 60 cpsB Mannose-1-phosphate guanylyltransferase ceutics (5, 8, 27). However, an efficient method to produce cpsG Phosphomannomutase the latter high-value compounds is still needed. wcal UDP-glucose lipid carrier transferase In addition GDP-mannose is also an intermediate of the wzXC Putative transporter pathway towards GDP-fucose. Interrupting the pathway wcaK Pyruvyltransferase prematurely leads to the accumulation of this compound, wcaL Glycosyltransferase which is a precursor of mannosylated oligosaccharides. 65 wcaM Predicted protein in collanic acid biosynthesis These oligosaccharides find for example applications in the treatment of gram-negative bacterial infections, in addition, US 9,719,119 B2 3 4 FIG. 4: The collanic acid biosynthesis pathway. activity of the transcriptional regulators the aerobic respira FIG. 5: Regulatory network of the collanic acid operon. tion control protein ArcA and the isocitrate lyase regulator This network was constructed with Pathway tools V 13.0. IclR to upregulate at least one of the genes of the collanic FIG. 6: Effect of the AarcAAiclR mutations on the GDP acid operon, wherein said operon comprises the genes cpSG, fucose biosynthesis route. cpSB, gmd and fel that code for a phosphomannomutase, a FIG. 7: Overview of the genetic modifications needed to mannose-1-phosphate guanylyltransferase, GDP-mannose enhance fucosyllactose and fucosylated oligosaccharides 4,6-dehydratase and GDP-fucose synthase, respectively. The production starting from glucose as a Substrate. latter operon may also comprise the genes cpSG, cpsB, gmd. FIG. 8: Starting from sucrose, fucosylated sugar derivates fel and WZa. In addition the expression of the genercSA is Such as fucosyllactose and more specifically 1.2-fucosyllac 10 increased. This gene is a transcriptional regulator of the tose are produced. The strain is modified to force the cell to collanic acid operon. Enhanced expression of this gene produce frucose-6-phosphate which is an intermediate in the increases transcription of the collanic acid operon (13, 36). synthesis of GDP-fucose. Glucose or glucose-1-phosphate Hence the present invention relates to the usage of a (if the starting enzyme is either a Sucrase or a Sucrose mutated and/or transformed microorganism comprising a phosphorylase) is then fed to the central carbon metabolism 15 genetic change leading to a modified expression and/or via the pentose phosphate pathway. activity of the transcriptional regulator, the aerobic respira FIG. 9: Overview of the genetic modifications needed to tion control protein, ArcA and the isocitrate lyase regulator enhance fucosyllactose and fucosylated oligosaccharides IclR to upregulate the transcriptional regulator of the collanic production starting from glucose as a Substrate in a split acid operon, rcSA, which in turn upregulates at least one of metabolism. the genes of the collanic acid operon. FIG. 10: Detail of the pentose phosphate pathway flux in Hence, the present invention relates to a mutated and/or a strain in which the genes coding for phosphoglucose transformed microorganism Such as but not limited to isomerase and phosphofructokinase are knocked out. Enterobacteriaceae such as an Escherichia coli (E. coli) FIG. 11: Starting from Sucrose, mannosylated Sugar deri strain comprising a genetic change leading to a modified vates are produced. The strain is modified to force the cell 25 expression of the transcriptional regulators: the aerobic to produce frucose-6-phosphate which is an intermediate in respiration control protein ArcA and the isocitrate lyase the synthesis of GDP-fucose. Glucose or glucose-1-phos regulator IclR. phate (if the starting enzyme is either a Sucrase or a Sucrose A mutated and/or transformed microorganism such as E. phosphorylase) is then fed to the central carbon metabolism coli as used here can be obtained by any method known to via the pentose phosphate pathway. 30 the person skilled in the art, including but not limited to UV FIG. 12: Gene expression pattern acid resistance related mutagenesis and chemical mutagenesis. A preferred manner genes of the wild type, the AiclR and AarcA mutant strain in to obtain the latter microorganism is by disrupting (knock batch culturing conditions relative to the AarcAAiclR mutant ing-out) the genes (arcA and iclR) encoding for the proteins strain. ArcA and IclR, or, by replacing the endogenous promoters FIG. 13: LC MSMS analysis chromatograms of culture 35 of said genes by artificial promoters or replacing the endog broth and a 2-fucosyllactose standard. A. LCMSMS analy enous ribosome binding site by an artificial ribosome bind sis of the standard, B. LCMSMS analysis of a sample of the ing site. The term artificial promoters relates to heterolo culture broth of a mutant strain expressing a H. pylori gous or non-natural or in silico designed promoters with fucosyltransferase, C. LCMSMS analysis of a sample of the known expression strength, these promoters can be derived culture broth of a mutant strain expressing a H. pylori 40 from libraries as described by Alper et al. (2005), Hammer fucosyltransferase. et al. (2006), or De Mey et al. (2007) (3, 11, 15). The term FIG. 14: LC MSMS analysis mass spectrum from the heterologous promoter refers to any promoter that does not chromatograms shown in FIG. 13 of culture broth and a naturally occur in front of the gene. The term “artificial 2-fucosyllactose standard. A. Mass (m/z) of the standard, B. promoter may also refer to promoters with DNA sequences Mass (m/z) of the sample of the culturing broth of a mutant 45 that are combinations of the native (autologous) promoter strain expressing a H. pylori fucosyltransferase, C. Mass sequence with parts of different (autologous or heterolo (m/z) of the sample of the culturing broth of a mutant strain gous) promoter sequences as for example shown further in expressing a H. pylorifucosyltransferase. the examples. Sequences of Such artificial promoters can FIG. 15: The sequence of the artificial hybrid promoter as be found in databases Such as for example partsregistry.org given by SEQ ID No. 6 (the combination of the native and 50 (6). The term artificial ribosome binding site relates to an artificial promoter) that was cloned in front of the collanic heterologous or non-natural or in silico designed ribosome acid operon. binding sites with known or measurable translation rates, these libraries can be derived from libraries or designed via DESCRIPTION OF INVENTION algorithms as described by Salis etal (2009) (26). Hence, the 55 present invention specifically relates to a mutated and/or The present invention provides microorganisms such as transformed microorganism as indicated above wherein said Enterobacteriaceae which are genetically changed in Such a genetic change is disrupting the genes encoding for ArcA manner that they can efficiently produce compounds which and IclR, or, reducing or eliminating the function of ArcA are part of the collanic acid pathway. A particular compound and IclR via mutations in the coding sequence of the genes of interest is GDP-fucose which is used as a precursor to 60 coding for ArcA and IclR, or, is replacing the endogenous synthesize fucosylated oligosaccharides. The latter have promoters of the genes encoding for ArcA and IclR by health-promoting effects as indicated above but there is no artificial promoters; or, is replacing the endogenous ribo efficient production method available to produce said com Some binding site by an artificial ribosome binding site. It is pounds. further clear that the mutant and/or transformant according The present invention thus provides for the usage of a 65 to the present invention may further comprise additional mutated and/or transformed microorganism comprising a genetic changes in one or more other genes within its genetic change leading to a modified expression and/or genome as is also described further. The term microorgan US 9,719,119 B2 5 6 ism specifically relates to a bacterium, more specifically a for promoter sequences and the transcription rate of genes. bacterium belonging to the family of Enterobacteriaceae. The present invention provides microorganisms which are The latter bacterium preferably relates to any strain belong genetically changed in Such a manner that they can effi ing to the species Escherichia coli such as but not limited to ciently produce compounds which are part of the collanic Escherichia coli B, Escherichia coli C, Escherichia coli W. acid pathway. The terms compounds which are part of the Escherichia coli K12, Escherichia coli Nissle. More spe collanic acid pathway refer to all compounds as indicated on cifically, the latter term relates to cultivated Escherichia coli FIG. 4 starting from fructose-6-P and resulting in extracel strains—designated as E. coli K12 strains—which are well lular collanic acid. More specifically the latter terms refer to adapted to the laboratory environment, and, unlike wild type the compounds mannose-6-P, mannose-1-P GDP-mannose, strains, have lost their ability to thrive in the intestine. 10 GDP-4-dehydro-6deoxy-mannose, GDP-fucose and collanic Well-known examples of the E. coli K12 strains are K12 acid. Hence the present invention specifically relates to the Wild type, W3110, MG1655, M182, MC1000, MC1060, usage as indicated for the synthesis of collanic acid and/or for MC1061, MC4100, JM101, NZN 111 and AA200. Hence, the synthesis of GDP-fucose. As GDP-fucose is a precursor the present invention specifically relates to a mutated and/or for fucosylated oligosaccharides such as fucosyllactose, transformed Escherichia coli strain as indicated above 15 fucosyllactoNbiose and lewis X oligosaccharide or fucosy wherein said E. coli strain is a K12 strain. More specifically, lated proteins, and as these Sugars have therapeutical, nutra the present invention relates to a mutated and/or transformed ceutical, anti-inflammatory and prebiotic effects, the present Escherichia coli strain as indicated above wherein said K12 invention specifically relates to the usage as described above Strain is E. coli MG 1655. for the synthesis of fucosylated oligosaccharides. In other The terms leading to a modified expression or activity words, the present invention relates to a process for the indicates that the above described mutations/transformations synthesis of collanic acid and/or GDP-fucose and/or fucosy affects the transcription and/or translation and/or post-trans lated oligosaccharides comprising genetically changing the lational modification of said genes (arcA and iclR) into the transcriptional regulators the aerobic respiration control transcriptional regulator proteins of the present invention protein ArcA and the isocitrate lyase regulator IclR to (ArcA and IclR) in such a way that the latter transcription 25 upregulate at least one of the genes of the collanic acid has significantly decreased or has even been completely operon, wherein said operon comprises the genes cpSG, abolished compared to a wild type strain, which has not been cpSB, gmd and fel or genes cpSG, cpsB, gmd, fel and WZa. mutated or transformed with regard to both particular genes More specifically, the present invention relates to a process of the present invention. Hence, the present invention relates as described wherein the mutations for ArcA and IclR are to a mutated and/or transformed microorganism Such as an 30 applied in combination with at least one mutation that Escherichia coli strain as indicated above wherein said enhances the production of fucosylated compounds. In order modified expression is a decreased expression, and, to a to efficiently produce fucosylated oligosaccharides (see mutated and/or transformed microorganism Such as an FIGS. 1, 2 and 5-10), the above described mutations in arcA Escherichia coli strain as indicated above wherein said and iclR can be applied in combination with other mutations decreased expression is an abolished expression. 35 which further enhance the production of fucosylated com The terms upregulating at least one of the genes of the pounds. Some of these—non-limiting—other mutations are: collanic acid operon indicates that the expression of at least a) the deletion of wealJ from the collanic operon, stopping the 1, 2, 3, 4, . . . . or all of the genes belonging to the colanic initiation of the collanic acid biosynthesis and thus allowing acid operon are significantly (=P-0.05) upregulated when the accumulation of GDP-fucose; b) the introduction of a compared to the expression of said genes within a corre 40 fucosyltransferase to link fucose with different acceptor sponding wild type microorganism which is cultivated under molecules Such as lactose; c) for the accumulation of the the same conditions as the mutated and/or transformed precursor of the GDP-fucose biosynthetic pathway and microorganism. The genes which belong to the collanic acid additional to the deletion of wealJ, at least one of the operon are WZa, WZb, WZc, wcaA, wcaB, wcaC, wcal), following collanic acid operon genes that do not code for wcaE, wcaF, gmd, fel, gmm, wcal, cpsB, cpSG, wca, WZXC, 45 GDP-fucose biosynthesis is knocked out: gmm, wcaA, wcaK, wcal and wcaM as indicated in FIG. 3 and/or as wcaB, wcaC, wcal), wcaE, wcaF, wcal, wca.J. WCaK, wcal, described in (35). Furthermore, the genercsA, coding for the wZX, wza, wzb, wzc, and/or, wcaM; d) for the production of transcriptional regulator of the collanic acid operon is fucosyllactose, lacZ coding for B-galactosidase, is knocked upregulated (13, 36). More specifically the terms upregu out to avoid lactose degradation; e) to accumulate the lating at least one of the genes of the collanic acid operon’ or 50 precursor fructose and fructose-6-phosphate, a Sucrose phos the transcriptional regulator of the collanic acid operon phorylase or invertase is introduced: f) because fructose-6- indicates that at least one of the genes of the collanic acid phosphate is easily degraded in the glycolysis, the glycolysis operon is 6 to 8 times upregulated in comparison to the has to be interrupted in order to steer all fructose-6-phos expression of the genes of the colanic acid operon in the phate in the direction of GDP-fucose and the genes pgi, corresponding wild type microorganism. In addition the 55 pfkA and pfkB (coding for glucose-6-phosphate isomerase present invention relates to upregulating genes of the collanic and phosphofructokinase A and B) are thus knocked out; g) acid operon as described above by replacing the native reducing protein degradation by knocking out a protease promoter by an artificial promoter. More specifically, the coded by a gene Such as Ion; h) By constitutively expressing present invention relates to a combination of the sequence of a lactose permease, Subpopulations are avoided in the pro the native promoter with sequences of other artificial pro 60 duction process which are common for lactose induced gene moter sequences. The combination of the sequence of the expression systems (19). In other words, the present inven native promoter with the sequence of other artificial pro tion relates to a process as described above for the synthesis moter sequences is more specifically the replacement of the of fucosylated oligosaccharides wherein said at least one sigma factor binding site of the native promoter with a mutation that enhance the production of fucosylated com stronger Sigma factor binding site. Sigma factors, such as but 65 pounds is: the deletion of the wcal gene, and/or, knocking not limited to Sigma70, sigmaS, sigma24, ..., are described out the collanic acid operon genes gmm, wcaA, wcaB, wcaC. (41), subunits of RNA polymerase that determine the affinity wcalD, wcaE, wcaF, wcal, wca.J. WCaK, wcal, WZX, WZa, US 9,719,119 B2 7 8 WZb, WZc, and/or, wcaM, and/or, knocking-out lacZ, and/or, collanic acid operon genes fel, gmd, gmm, wcaA, wcaB, introducing a Sucrose phosporylase or invertase, and/or, wcaC, wcal), wcaE, wcaF, wcal, wca.J. WCaK, wcal, WZX, knocking out the genes pgi, pfkA and pfkB, and/or, knocking WZa, WZb, WZc, and/or, wcaM are knocked out and/or, d) out the gene Ion, and/or introducing a fucosyltransferase, wherein a gene encoding for a Sucrose phosphorylase or an and/or a lactose permease. The term introducing a fucosyl invertase is introduced, and/or, e) wherein the genes pgi, transferase relates to upregulating or heterologous expres pfkA and pfkB are deleted, and/or, f) knocking out the gene sion of fucosyltransferases which are within, but not limited Ion, and/org) wherein a gene encoding for a mannosyltrans to the enzymes in enzyme classes classes EC2.4.1.65. ferase is introduced. The term introducing a mannosyltrans 2.4.1.6.8, 2.4.1.69, 2.4.1.152, 2.4.1.214, and/or 2.4.1.221 ferase relates to upregulating or heterologous expression of and/or the glycosyltransferase families GT1, GT2, GT 10 10 GT11, GT23, GT37, GT65, GT68, and/or GT74 and/or mannosyltransferases which are within, but not limited to originating from but not limited to Helicobacter pylori, the enzymes in enzyme classes EC 2.4.1.32, 2.4.1.B27. Campylobacter jejuni, Dictyostellium discoideum, Mus mus 2.4.1.B44, 2.4.1.48, 2.4.1.54, 2.4.1.57, 2.4.1.83, 2.4.1.109, culus, Homo sapiens, . . . and these fucosyltransferases 2.4.1.110, 2.4.1.119, 2.4.1.130, 2.4.1.131, 2.4.1.132, catalyse the formation of O(1.2), C(1.3), C(1.4), or O(1.6) 15 2.4.1.142, 2.4.1.199, 2.4.1.217, 2.4.1.232, 2.4.1.246, bonds on other Sugars such as but not limited to galactose, 2.4.1.251, 2.4.1.252, 2.4.1.257, 2.4.1.258, 2.4.1.259, lactose, lactoNbiose, lactoNtetraose, lactosamine, lactoN tet 2.4.1.260, 2.4.1.265, and/or 2.4.1.270 and/or the glycosyl raose, sialyllactoses, disialyllactoses, or fucosylated pro transferase families GT1, GT2, GT4, GT15, GT22, GT32, teins, or fucosylated fatty acids., or fucosylated aglycons GT33, GT39, GT50 and/or GT58 and/or originating from Such as, but not limited to, antivirals, antibiotics. . . . . but not limited to Helicobacter pylori, Campylobacter The present invention provides for the usage of a mutated jejuni, Dictyostellium discoideum, Mus musculus, Homo and/or transformed microorganism comprising a genetic sapiens, . . . and these mannosyltransferases catalyse the change leading to a modified expression and/or activity of formation of C.(1,2), C.(1,3), C.(1,4), or C.(1,6) bonds on other the transcriptional regulators the aerobic respiration control Sugars such as but not limited to galactose, N-acetylglu protein ArcA and the isocitrate lyase regulator IclR to 25 cosamine, Rhamnose, lactose, lactoNbiose, lactoN tetraose, upregulate at least one of the genes of the collanic acid lactosamine, lactoN tetraose, sialyllactoses, disialyllactoses, operon, wherein said operon comprises the genes cpSG and or mannosylated proteins, or mannosylated fatty acids, or cpSB, coding for phosphomannomutase and mannose-1- mannosylated aglycons such as, but not limited to, antivi phosphate guanylyltransferase, which are needed for the rals, antibiotics. . . . . biosynthesis of GDP-mannose. As GDP-mannose is a pre 30 The term heterologous expression relates to the expres cursor for mannosylated oligosaccharides and mannosy sion of genes that are not naturally present in the production lated glycoconjugates. These oligosaccharides and glyco host, genes which can be synthesized chemically or be conjugates find for example applications in the treatment of picked up from their natural host via PCR, genes which can gram-negative bacterial infections, in addition, GDP-man be codon optimized for the production host or in which point nose is important for the humanization of protein glycosy 35 mutation can be added to enhance enzyme activity or lations, which is essential for the production of certain expression. Expressing heterologous and/or native genes can therapeutic proteins (18, 30). Mannosylated oligosaccha either be done on the chromosome, artificial chromosomes rides and mannosylated glycoconjugates are also used for or plasmids and transcription can be controlled via induc drug targeting, for instance mannosylated antivirals can ible, constitutive, native or artificial promoters and transla specifically target the liver and kidneys (7). In order to 40 tion can be controlled via native or artificial ribosome efficiently produce mannosylated oligosaccharides (see binding sites. FIGS. 1, 2, 5, 6 and 11), the above described mutations in Consequently, the present invention further relates to arcA and iclR can be applied in combination with other mutated and/or transformed organisms in which the regula mutations which further enhance the production of manno tors ArcA and IclR as describe above, in combination with Sylated compounds. Some of these—non-limiting—other 45 the genes encoding for the enzymes phosphoglucose mutations are: a) the genegmd of the colanic acid operon is isomerase and phosphofructokinase, are knocked out or are deleted, and/or, b) wherein the gene gmm coding for GDP rendered less functional. More specifically, the present mannose hydrolase is deleted, and/or, c) wherein the collanic invention relates to the latter organisms wherein the enzyme acid operon genes that do not code for GDP-mannose phosphoglucose isomerase is encoded by the gene pgi and biosynthesis reactions, the genes gmm, wcaA, wcaB, wcaC. 50 wherein the enzyme phosphofructokinase is encoded by the wcal), wcaE, wcaF, wcal, wca.J., wcaK, wcal, fel, gmd, WZX. gene(s) pfkA and/or pfkB. wza, wzb and/or, wcaM, are deleted, and/or, d) wherein a The terms genes which are rendered less-functional or gene encoding for a Sucrose phosphorylase or an invertase is non-functional refer to the well-known technologies for a introduced, and/or, e) wherein the genes pgi, pfkA and pfkB, skilled person such as the usage of siRNA, RNAi, miRNA, coding for phosphoglucose isomerase, phosphofructokinase 55 asRNA, mutating genes, knocking-out genes, transposon A and phosphofructokinase B respectively, are deleted, mutagenesis, etc. . . . which are used to change the genes in and/or, f) knocking out the gene Ion encoding for a protease, Such a way that they are less able (i.e. statistically signifi and/or f) wherein a gene encoding for a mannosyltransferase cantly less able compared to a functional wild-type gene) is introduced. In other words, the present invention relates to or completely unable (such as knocked-out genes) to pro a process as described above for the synthesis of collanic acid 60 duce functional final products. The term (gene) knock out and/or GDP-fucose and/or fucosylated oligosaccharides for thus refers to a gene which is rendered non-functional. The the synthesis of GDP-mannose and/or for the synthesis of term 'deleted gene' or gene deletion also refers to a gene mannosylated oligosaccharides. The present invention fur which is rendered non-functional. ther relates to said process wherein the genes cpSG and cpsB The present invention further relates to a mutated and/or of the collanic acid operon are upregulated and wherein: a) 65 transformed organism as described in the latter paragraph the gene gmd of the collanic acid operon is deleted, and/or, wherein said organism is further transformed with a gene b) wherein the gene gmm is deleted, and/or c) wherein the encoding for a Sucrose phosphorylase. US 9,719,119 B2 9 10 The present invention also relates to a mutated and/or oligosaccharides (chitins, chitosans, . . . ), Sulfonated oli transformed organism as described above wherein, in addi gosaccharides (heparans and heparosans) . . . are preferably tion, the activity and/or expression of the gene encoding for produced at low pH for downstream processing purposes a lactose permease is made constitutive and/or increased. (4). In other words, the present invention relates to a process Said activity can be increased by over-expressing said gene for the synthesis of acids, sialic acid, Sialylated oligosac and/or by transforming said organisms with a gene encoding charides or glucosamine comprising genetically changing for a lactose permease. the transcriptional regulators the aerobic respiration control The present invention further relates to any mutated protein ArcA and the isocitrate lyase regulator IclR to and/or transformed organism as described above wherein at upregulate at least one of the following acid resistance least one of the following genes is knocked out or is 10 related genes: ydeP, ydeO. hdea, hde), gadB, gadC, gadE. rendered less functional: gadX, gadW and/or slp. a gene encoding for a beta-galactosidase, a gene encoding The present invention will now be illustrated by the for a glucose-1-phosphate adenylyltransferase, a gene following non-limiting examples. encoding for a glucose-1-phosphatase, a gene encoding for phosphogluconate dehydratase, a gene encoding for 2-keto 15 EXAMPLES 3-deoxygluconate-6-phosphate aldolase, a gene encoding for a glucose-1-phosphate uridyltransferase, a gene encod A high throughput RT-qPCR screening of the microor ing for an UDP-glucose-4-epimerase, a gene encoding for an ganisms of the present invention has been setup with UDP-glucose:galactose-1-phosphate uridyltransferase, a Biotrove OpenArray(R) technology. In this experiment the gene encoding for an UDP-galactopyranose mutase, a gene transcription of 1800 genes were measured in 4 strains (wild encoding for an UDP-galactose: (glucosyl)lipopolysaccha type, AarcA, AiclR, AarcA AiclR) in two conditions (che ride-1,6-galactosyltransferase, a gene encoding for an UDP mostat and batch). The data was processed using a curve galactosyltransferase, a gene encoding for an UDP-gluco fitting toolbox in R (25,34) and Quantile Normalization, the Syltransferase, a gene encoding for an UDP-glucuronate error on the data was calculated using Bayesian statistics transferase, a gene encoding for an UDP-glucose lipid 25 (20, 21, 31). carrier transferase, a gene encoding for a GDP-mannose Material and Methods hydrolase, a gene encoding for an UDP-Sugar hydrolase, a Strains and Plasmids gene encoding for a mannose-6-phosphate isomerase, a gene Escherichia coli MG1655, F, rph-1 was obtained encoding for an UDP-N-acetylglucosamine enoylpyruvoyl from the Netherlands Culture Collection of Bacteria transferase, a gene encoding for an UDP-N-acetylglu 30 (NCCB). Escherichia coli BL21 (DE3) was obtained from cosamine acetyltransferase, a gene encoding for an UDP Novagen. Escherichia coli MG 1655 ackA-pta, poxB, pppc Nacetylglucosamine-2-epimerase, a gene encoding for an ppc-p37 (10), the single knock-outs E. coli MG1655 arcA undecaprenyl-phosphate alfa-N-acetylglucosaminyl trans and E. coli MG 1655 iclR and the double knock-out E. coli ferase, a gene encoding for a glucose-6-phosphate-1-dehy MG 1655 arcA, iclR were constructed in the Laboratory of drogenase, and/or, a gene encoding for a L-glutamine:D- 35 Genetics and Microbiology (MICR) using the method of fructose-6-phosphate aminotransferase, a gene encoding for Datsenko & Wanner (9). a mannose-6-phosphate isomerase, a gene encoding for a Media Sorbitol-6-phosphate dehydrogenase, a gene encoding for a The Luria Broth (LB) medium consisted of 1% tryptone mannitol-1-phosphate 5-dehydrogenase, a gene encoding peptone (Difco, Erembodegem, Belgium), 0.5% yeast for a allulose-6-phosphate 3-epimerase, a gene encoding for 40 extract (Difico) and 0.5% sodium chloride (VWR. Leuven, an invertase, a gene encoding for a maltase, a gene encoding Belgium). Shake flask medium contained 2 g/1 NHCl, 5 g/1 for a trehalase, a gene encoding for a Sugar transporting (NH)SO, 2.993 g/l KHPO, 7.315 g/l KHPO, 8.372g/1 phosphotransferase, a gene encoding for a protease, or a MOPS, 0.5 g/l NaCl, 0.5 g/l MgSO.7H2O, 16.5 g/1 gene encoding for a hexokinase. The term at least one glucose.H.O. 1 ml/l vitamin solution, 100 ul/l molybdate indicated that at least 1, but also 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 45 Solution, and 1 ml/l selenium solution. The medium was set 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, to a pH of 7 with 1M KOH. 28, 29, 30, 31, 32 or all 33 genes is (are) knocked out or is Vitamin solution consisted of 3.6 g/l FeC14H2O, 5 g/1 (are) rendered less functional. CaCl2HO, 1.3 g/l MnC12H2O, 0.38 g/l CuCl2.H2O, 0.5 The present invention further relates also to the usage of g/l CoCl2.6HO, 0.94 g/l ZnCl, 0.0311 g/l HBO, 0.4 g/1 a mutated and/or transformed microorganism Such as an 50 Na-EDTA.2H2O and 1.01 g/l thiamine.HC1. The molybdate Escherichia coli strain comprising a genetic change leading solution contained 0.967 g/l Na MoC).2H2O. The selenium to a modified expression of the transcriptional regulators the Solution contained 42 g/l SeC). aerobic respiration control protein ArcA and the isocitrate The minimal medium for fermentations contained 6.75 g/1 lyase regulator IclR to upregulate at least one of the follow NHCl, 1.25 g/l (NH)SO 1.15 g/l KHPO, 0.5 g/l NaCl, ing acid resistance related genes: ydeP, ydeO. hdea, hde), 55 0.5 g/l MgSO4.7H2O, 16.5 g/l glucose.H.O. 1 ml/l vitamin gadB, gadC, gadE, gadX, gadW and/or slip (17. 22). These solution, 100 ul/l molybdate solution, and 1 ml/l selenium genes are normally expressed in stationary phase conditions; Solution with the same composition as described above. however, the present mutated and/or transformed microor Cultivation Conditions ganism is able to enhance the expression of these acid A preculture, from a single colony on a LB-plate, in 5 ml resistance related genes in the exponential growth phase. 60 LB medium was incubated during 8 hours at 37° C. on an Hence, the present invention relates to the usage as orbital shaker at 200 rpm. From this culture, 2 ml was described above for the synthesis of acids or pH sensitive transferred to 100 ml minimal medium in a 500 ml shake molecules such as but not limited to glucosamine which is flask and incubated for 16 hours at 37° C. on an orbital pH sensitive and should be produced at low pH (12). shaker at 200 rpm. 4% inoculum was used in a 2 1 Biostat Organic acids, such as but not limited to pyruvic acid, 65 B Plus culture vessel with 1.5 1 working volume (Sartorius Succinic acid, adipic, sialic acid, sialylated oligosaccharides Stedim Biotech, Melsungen, Germany). The culture condi (e.g. sialyllactose, sialyl Lewis X Sugars. . . . ), acetylated tions were: 37°C., stirring at 800 rpm, and a gas flow rate US 9,719,119 B2 11 12 of 1.5 l/min. Aerobic conditions were maintained by sparg Pluronic RF68 (10% stock, Invitrogen), 2.64 ul BSA (Sigma ing with air, anaerobic conditions were obtained by flushing A7906), 26.4 ul magnesium chloride (25 mM stock solution, the culture with a mixture of 3% CO, and 97% of N. The supplied in the LightCycler(R) kit of Roche applied Science), pH was maintained at 7 with 0.5 MH 504 and 4 M KOH. 21.1 ul HildiTM formamide (Applied biosystems), and 94.66 The exhaust gas was cooled down to 4°C. by an exhaust ul RNase free sterile water resulting in a 186.4 ul mastermix, cooler (Frigomix 1000, Sartorius Stedim Biotech, Melsun which is enough to load 1 OpenArrayTM. For 1 SubArray gen, Germany). 10% solution of silicone antifoaming agent (each OpenArray is subdivided in 48 SubArrays on which 1 (BDH331512K, VWR Int Ltd., Poole, England) was added sample can be loaded) 1.5 ul sample (with a concentration when foaming raised during the fermentation (approxi of 100 ng/ul) was mixed with 3.5ul of mastermind, as a no mately 10 ul). The off-gas was measured with an EL3020 10 template control, water was used as blanc. The sample off-gas analyser (ABB Automation GmbH, 60488 Frankfurt mastermix mixture was loaded in a Loader plate (Matri am Main, Germany). PlateTM 384-well black low volume polypropylene plate, All data was logged with the Sartorius MFCS/win v3.0 Biotrove) in a RNase free hood. A full loader plate was system (Sartorius Stedim Biotech, Melsungen, Germany). loaded with an AutoLoader (Biotrove) and loader tips onto All strains were cultivated at least twice and the given 15 the OpenArrays. These OpenArrays were then submerged in standard deviations on yields and rates are based on at least OpenArrayTM immersion fluid in an OpenArrayTM Real 10 data points taken during the repeated experiments. Time qPCR case. The case was sealed with Case sealing Sampling Methodology glue and incubated in the Case Sealing station, which The bioreactor contains in its interior a harvest pipe (BD polymerizes the glue with UV light. Spinal Needle, 1.2x152 mm (BDMedical Systems, Franklin Analytical Methods Lakes, N.J.- USA) connected to a reactor port, linked Cell density of the culture was frequently monitored by outside to a Masterflex-14 tubing (Cole-Parmer, Antwerpen, measuring optical density at 600 nm (Uvikom 922 spectro Belgium) followed by a harvest port with a septum for photometer, BRS, Brussel, Belgium). Cell dry weight was sampling. The other side of this harvest port is connected obtained by centrifugation (15 min, 5000 g, GSA rotor, back to the reactor vessel with a Masterflex-16 tubing. This 25 Sorvall RC-5B, Goffin Meyvis, Kapellen, Belgium) of 20 g system is referred to as rapid sampling loop. During Sam reactor broth in pre-dried and weighted falcons. The pellets pling, reactor broth is pumped around in the sampling loop. were Subsequently washed once with 20 ml physiological It has been estimated that, at a flow rate of 150 ml/min, the solution (9 g/l NaCl) and dried at 70° C. to a constant reactor broth needs 0.04s to reach the harvest port and 3.2 weight. To be able to convert ODoo, measurements to s to re-enter the reactor. At a pCO2 level of 50%, there is 30 biomass concentrations, a correlation curve of the ODoo around 3 mg/l of oxygen in the liquid at 37° C. The pCO2 to the biomass concentration was made. The concentrations level should never drop below 20% to avoid micro-aerobic of glucose and organic acids were determined on a Varian conditions. Thus 1.8 mg/l of oxygen may be consumed Prostar HPLC system (Varian, Sint-Katelijne-Waver, Bel during transit through the harvesting loop. Assuming an gium), using an Aminex HPX-87H column (Bio-Rad, Eke, oxygen uptake rate of 0.4 g oxygen/g biomasS/h (the maxi 35 Belgium) heated at 65°C., equipped with a 1 cm precolumn, mal oxygen uptake rate found at L.), this gives for 5 g/1 using 5 mM H2SO4 (0.6 ml/min) as mobile phase. A biomass, an oxygen uptake rate of 2 g/1/h or 0.56 mg/l/s, dual-wave UV-VIS (210 nm and 265 nm) detector (Varian which multiplied by 3.2 s (residence time in the loop) gives Prostar 325) and a differential refractive index detector 1.8 mg/l oxygen consumption. (Merck LaChrom L-7490, Merck, Leuven, Belgium) was In order to quench the metabolism of cells during the 40 used for peak detection. By dividing the absorptions of the sampling, reactor broth was Sucked through the harvest port peaks in both 265 and 210 nm, the peaks could be identified. in a syringe filled with 62 g stainless steel beads pre-cooled The division results in a constant value, typical for a certain at -20°C., to cool down 5 ml broth immediately to 4°C. compound (formula of Beer-Lambert). Sampling was immediately followed by cold centrifugation Glucose, fructose, Sucrose, fucosyllactose and glucose-1- (15000 g, 5 min, 4° C.). During the batch experiments, a 45 phosphate were measured by HPLC with a Hypercarb sample for ODoo, and RT-qPCR measurements was taken column and were detected with an MSMS detector (Antonio using the rapid sampling loop and the cold stainless bead et al., 2007; Nielsen et al., 2006). sampling method. Genetic Methods RT-qPCR All mutant strains were constructed via the methods mRNA was extracted with the RNeasy kit (Qiagen, Venlo, 50 described below. The Netherlands). RNA quality and quantity was checked Plasmids were maintained in the host E. coli DH5C. (F, with a nanodrop ND-1000 spectrophotometer (Nanodrop (p80dlaczAM15, A(laczYA-argF)U169, deoR, recA1, technologies, Wilmingto, USA). The ratios 260:280 (nm) end A1, hsdR17(rk, mk"), phoA, supE44, w, thi-1, gyrA96, and 260:230 (nm) were between 1.8 and 2 and at least 100 relA1). ng/ul was needed for further analysis. cDNA was synthe 55 Plasmids. pKD46 (Red helper plasmid, Ampicillin resis sised with random primers with the RevertAidTM H minus tance), pKD3 (contains an FRT-flanked chloramphenicol first strand cDNA synthesis kit (Fermentas, St. Leon-Rot, resistance (cat) gene), pKD4 (contains an FRT-flanked Germany). Finally, the gene expression of 1800 genes was kanamycin resistance (kan) gene), and pCP20 (expresses measured with the Biotrove OpenArray Real time PCR FLP recombinase activity) plasmids were used for the platform. The primers for the RT-PCR assay were designed 60 mutant construction. The plasmid pBluescript (Fermentas, with Primer design tools from the Primer database (23). St. Leon-Rot, Germany) was used to construct the derivates The reaction mixture was composed as described in the of pKD3 and pKD4 with a promoter library, or with alleles Biotrove OpenArrayTM Real-Time qPCR system users’ carrying a point mutation. manual. In short, a mastermix was made with 26.4 ul Mutations. The mutations consisted in gene disruption LightCycler R DNA Master SYBR(R) Green I (Roche applied 65 (knock-out, KO). They were introduced using the concept of Science), 1.1 ul SYBR GREEN I (100x stock solution, Datsenko and Wanner (9). The primers for the mutation Sigma S9430), 8.8 ul glycerol (Sigma G5150), 5.3 ul strategies are described in Table 1. US 9,719,119 B2 13 14 Transformants carrying a Red helper plasmid were grown TABLE 1- Continued in 10 ml LB media with amplicillin (100 mg/l) and L-arab Primers used to create E. coli inose (10 mM) at 30° C. to an ODoo of 0.6. The cells MG1655 arcA. E. coli MG1655 iclR and were made electrocompetent by washing them with 50 ml of the double knock-out E. coli MG1655 ice-cold water, a first time, and with 1 ml ice-cold water, a 5 arca, iclR and all other genetic second time. Then, the cells were resuspended in 50 ul of knock outs and knock ins ice-cold water. Electroporation was done with 50 ul of cells Primer name Sequence and 10-100 ng of linear double-stranded-DNA product by glgC using a Gene PulserTM (BioRad) (600C2, 25 uFD, and 250 10 volts). Agaccgc.cggittittaag cagogggaac atc After electroporation, cells were added to 1 ml LB media tctgaacatacatgitaaaacctgcagtgta incubated 1 h at 37° C., and finally spread onto LB-agar ggctggagctgctitc (SEQ ID N° 11 containing 25 mg/l of chloramphenicol or 50 mg/l of Gtctggcagggacctgcacacggattgttgt 15 gtgttc.ca.gagatgataaaaaaggagttag kanamycin to select antibiotic resistant transformants. The tccatatgaatat cct c cittag selected mutants were verified by PCR with primers (SEO ID No 12) upstream and downstream of the modified region and were grown in LB-agar at 42° C. for the loss of the helper Gcgaat atcgggaaatgcagg plasmid. The mutants were tested for amplicillin sensitivity. (SEO ID No 13) Linear Double-Stranded-DNA. The linear ds-DNA ampli RV-glgC-out Cagagattgttttacctgctgg cons were obtained by PCR using pKD3, pKD4 and their (SEO ID No 14) derivates as template. The primers used had a part of the ago sequence complementary to the template and another part FW agp P1 CATATTTCTGTCACACTCTTTAGTGATTGA complementary to the side on the chromosomal DNA where 25 TAACAAAAGAGGTGCCAGGAgtgtaggctg the recombination has to take place (Table 1). For the KO. gagctgctitc (SEQ ID No 15 the region of homology was designed 50-nt upstream and RV agp P2 TAAAAACGTTTAACCAGCGACTCCCCCGCT 50-nt downstream of the start and stop codon of the gene of TCTCGCGGGGGAGTTTTCTGcatatgaata interest. For the KI, the transcriptional starting point (+1) tocticcittag (SEQ ID No 16) had to be respected. PCR products were PCR-purified, 30 digested with Dpnl repurified from an agarose gel, and FW agp out GCCACAGGTGCAATTATC suspended in elution buffer (5 mM Tris, pH 8.0). (SEO ID No 17) Elimination of the Antibiotic Resistance Gene. The RV agp out CATTTTCGAAGTCGCCGGGTACG selected mutants (chloramphenicol or kanamycin resistant) (SEO ID No 18) were transformed with pCP20 plasmid, which is an ampi 35 pgi cillin and chloramphenicol resistant plasmid that shows GGCGCTACAATCTTCCAAAGTCACAATTCT temperature-sensitive replication and thermal induction of CAAAATCAGAAGAGTATTGCdtgtaggctg FLP synthesis. The ampicillin-resistant transformants were gagctgctitc (SEQ ID No 19 selected at 30°C., after which a few were colony purified in 40 GGTTGCCGGATGCGGCGTGAACGCCTTATC LB at 42° C. and then tested for loss of all antibiotic CGGCCTACATATCGACGATGcatatgaata resistance and of the FLP helper plasmid. The gene knock tocticcittag (SEQ ID No 20 outs and knock ins are checked with control primers (Fw/ Fw pgi out (2) GGCTCCTCCAACACCGTTAC RV-gene-out). These primers are given in Table 1. (SEO ID No 21) 45 TABLE 1. RV pgi out (2) TACATATCGGCATCGACCTG (SEO ID No 22) Primers used to create E. coli MG1655 arcA. E. coli MG1655 iclR and pfkA the double knock-out E. coli MG1655 arcA, iclR and all other genetic 50 Fw-pfkA-out TACCGCCATTTGGCCTGAC knock outs and knock ins (SEO ID No 23)

Primer name Sequence Rv-pfkA- out AAAGTGCGCTTTGTCCATGC (SEO ID No 24) lacZ 55 GACTTCCGGCAACAGATTTCATTTTGCATT FW Lac Z P1 CATAATGGATTTCCTTACGCGAAATACGGG CCAAAGTTCAGAGGTAGTCgtgtaggctgg CAGACATGGCCTGCCCGGTTATTAgtgtag agctgcttc (SEQ ID No 25) gctggagctgctitc (SEQ ID No 7) GCTTCTGTCATCGGTTTCAGGGTAAAGGAA TCTGCCTTTTTCCGAAATC catatgaatat RV Lacz P2 GTATGTTGTGTGGAATTGTGAGCGGATAAC cctcct tag (SEQ ID No 26) AATTTCACACAGGAAACAGCT catatgaat 60 atcct cottag (SEQ ID No 8) pfkB

FW Lac Z out GCGGTTGGAATAATAGCG TAGCGTCCCTGGAAAGGTAAC (SEO ID No 9) (SEO ID No 27)

RV Lac Z out CAGGTTTCCCGACTGGAAAG 65 Rv-pfkB- out TCCCTCATCATCCGTCATAG (SEO ID No 1 O) (SEO ID No 28)

US 9,719,119 B2 17 18 TABLE 1- Continued TABLE 1 - continued

Primers used to create E. coli Primers used to create E. coli MG1655 arcA. E. coli MG1655 iclR and MG1655 arcA. E. coli MG1655 iclR and the double knock-out E. coli MG1655 the double knock-out E. coli MG1655 arca, iclR and all other genetic arcA, iclR and all other genetic knock outs and knock ins knock outs and knock ins

Primer name Sequence Primer name Sequence Fw basP seq CGCCATGTTGGAATGGGAGG Rw-ldhA CGCGTAATGCGTGGGCTTTC (SEO ID No 63) 10 long homol (SEO ID No 81) Fw pfkA. H1 ext TGATTGTTATACTATTTGCACATTCGTTGG promcA: P14 ATCACTTCGATGTGCAAGAAGACTTCCGGC AACAGATTTC (SEO ID No 64) pCXP14 SP Fw CCGGCATATGGTATAATAGGG (SEO ID No 82) Rv pfkA H2 ext AATTGCAGAATTCATGTAGGCCTGATAAGC 15 GAAGCGCATCAGGCATTTTTGCTTCTGTCA yegH rc pure rv ACGGCTTGCTGGCCATCA TCGGTTTCAG (SEO ID No 65) (SEO ID No 83)

Fw-pfkA-out TACCGCCATTTGGCCTGAC fw P14- CGAATATAAGGTGACATTATGGTAATTGAA (SEO ID No 66) CA KI tetA TATTGGCTTTCCAATAATGCTACGGCCCCA AGGTCCAA (SEO ID No 84) Rv-pfkA-out AAAGTGCGCTTTGTCCATGC (SEO ID No 67) rv P14- AATATTGTCAACCTAAAGAAACTCCTAAAA CA KI tetA ACCATATTGAATGACACTTATTGGCTTCAG adh: P22 - GGATGAGGCG (SEQ ID No 85 frk fw P14- TCCCGACTACGTGGACCTTG ATCGGCATTGCCCAGAAGGGGCCGTTTATG 25 CA KI overl (SEO ID No 86) TTGCCAGACAGCGCTACTGAgtgtaggctg apA gagctgctitc (SEQ ID No 68 rv P14- CATATGGTATAATAGGGAAATTTCCATGGC Rw-adhe ATTCGAGCAGATGATTTACTAAAAAAGTTT CA KI overl GGCCGCTCTAGAAGAAGCTTGGGATCCGTC pCXP22-P2 AACATTATCAGGAGAGCATTaagcttgcat apA GACCTCGGCATTATTGGAAAGCCAATATTC gcctgcatcc (SEQ ID No 69 30 (SEO ID No 87)

AAGCCGTTATAGTGCCTCAGTTTAAGGATC fw P14- GCCGCCATGGAAATTTCCCTATTATACCAT GGTCAACTAATCCTTAACTGATCGGCATTG CA. K. ATGCCGGCCAAGATGTCAAGAAACTTATAG CCCAGAAG (SEO ID No 7 O apB AATGAAGTAAGTGTCATTCAATATGG (SEO ID No 88) TTGATTTTCATAGGTTAAGCAAATCATCAC 35 CGCACTGACTATACTCTCGTATTCGAGCAG fw P14- AATATTGTCAACCTAAAGAAACTCCTAAAA ATGATTTACTAAAAAAG CA KI H1 ACCATATTGAATGACACTTACTTCATTCTA (SEO ID No 71) TAAGTTTCTTGAC (SEQ ID No 89) FW adhE out GCGTCAGGCAGTGTTGTATC rv P14- CGAATATAAGGTGACATTATGGTAATTGAA (SEO ID No 72) CA KI H2 TATTGGCTTTCCAATAATGCCGAGGTCGAC 40 GGATCCCAAGCTTC (SEO ID No 9 O) RV adhE out CTGGAAGTGACGCATTAGAG (SEO ID No 73) Transformation. Plasmids were transformed in CaCl2 ldhA: P14 competent cells using the simplified procedure of Hanahan FT. H. pylori 45 (16) or via electroporation as described above. Calculation Methods FW lahA out tgtcattact tacacatc.ccgc Introduction (SEO ID No 74) Different experiments with different strains were per RV lahA out gcattcaatacggg tattgttgg formed. In total 8 different conditions were tested. There was (SEO ID No 75) 50 variation in the genetic background (WT, iclR knock-out, CATTGGGGATTATCTGAATCAGCTCCCCTG arcAknock-out, and combined iclR-arcAknock-out) and the pCXP22 P1 GAATGCAGGGGAGCGGCAAGgtgtaggctg mode of fermentation (batch, and chemostat). Each experi gagctgctitc (SEQ ID No 76) ment was repeated twice. When running the samples through the BioTrove appa Rw-ldhA TATTTTTAGTAGCTTAAATGTGATTCAACA 55 pCXP22 P2 TCACTGGAGAAAGTCTTATGaagcttgcat ratus, a qPCR curve (fluorescences in function of cycle gcctgcatcc (SEQ ID No 77 number) and a melt curve (fluorescences in function of the temperature) is obtained for each sample. Those data were CAATTACAGTTTCTGACT CAGGACTATTTT exported from the BioTrove software and further analysed in AAGAATAGAGGATGAAAGGTCATTGGGGAT TATCTGAATCAG (SEO ID No 78) R. The analysis was divided in two steps: first the qPCR 60 curves were fitted and Ct values were calculated and in the GAATTTTTCAATATCGCCATAGCTTTCAAT second step the Ct values were converted to expression data. TAAATTTGAAATTTTGTAAAATATTTTTAG Calculating the qPCR Curves TAGCTTAAATGTGATTCAAC The raw qPCR curve data were extracted from the (SEO ID No 79) BioTrove software and imported in R (1). The curves were Fw-ldhA TTCACCGCTAAAGCGGTTAC 65 fitted to a 5 parameter sigmoidal model, with the R package long homol (SEO ID No 8 O) qPCR (25, 34). The maximum of the second derivative of those curves was used as Ct value. No normalisation was US 9,719,119 B2 19 20 applied to the data prior to the curve fitting. However, (25)). Therefore, all data-points for which the difference outliers were removed. The detection of the outliers was between D1 and D2 is larger than an arbitrary value (7 was done using the following procedure: used) were discarded. Fit the model to the data. For each primer-pair, a qPCR experiment was performed Calculate the residuals (defined as the measured fluores without adding DNA. Only water was added. Normally no cences minus the model-calculated ones). expression should be observed in those samples. However, Assuming the residuals are normally distributed, calculate amplification is detected in water for some primer-pairs. the mean and standard deviation of the residuals. Genes for which the Ct value (as mentioned before, D2 was Using this mean and standard deviation, the 95% interval used) is more than the Ct value of water minus 5, are is calculated. 10 discarded, as it cannot be excluded that the fluorescence All data-points for which the residuals fall out of this 95% comes from the amplification of the primers and not the interval are considered as outliers. added DNA. The curve is refitted without the outliers. Normalising and Calculating the Contrasts This is repeated until no outliers are detected anymore. 15 Prior to calculating the expression differences, the Ct Using this procedure, the data do not have to be values have to be normalised. As so many genes were normalised prior to fitting, neither must the first data measured (1800), quantile normalisation could be used (33). points be removed. The 1800 genes measured, were divided over 3 types of Many curves have to be fitted (1800 genes for one arrays, each containing 600 genes. Quantile normalisation experiment). Therefore, it is undoable to manually check was done for each type of array separately. A table was each curve and automated methods have to be applied to constructed where the rows represent the different genes and reject bad curves. For this different parameters are extracted the columns the different experiments (T1, see Equations 1). from the curves: the cycle number value at which the Each column was sorted independently (T2) and the original maximum of the first derivative occurs (D1), the cycle position of the elements was saved. The values in this new number value at which the maximum of the second deriva 25 table were replaced with the mean value over the different tive occurs (D2), the minimal fluorescence (Fmin), and the rows (T3). And finally this table was transformed so that the maximal fluorescence (Fmax). Combining the values of positions of the values corresponded again to the original those parameters, the validity of the curve and the extent of positions (T4). expression is assessed. How this is done is explained in the 30 next section. Example of a quantile normalisation Equations 1 Filtering the Data For some gene-experiment combinations, no amplifica 2 4 2 4 3 3 tion is detected. This can be due to a variety of reasons: T = 6 8 T = 6 8 T = 6 6 Expression is too low and 32 cycles (the number of cycles 4 12 4 12 9 9 for all BioTrove arrays was set to 32) is not enough to 35 detect the expression. In this case, the real Ct cannot be 3 3 determined and is somewhere between 32 and infinity. T = 6 No expression. In this case, the real Ct is infinite. 9 9 Technical failures: primers not suitable, wrong loading (it 40 is very difficult to uniformly load the BioTrove arrays, Differential expressions were calculated with the nor especially the holes at the sides of the array are fre malised data. This was done with the R package limma, quently empty), etc. In this case the real Ct can vary which uses a Bayesian approach to calculate the statistical between 0 and infinity. relevances of the differences (31. 32). Limma was adapted Some genes are genuinely not expressed and setting their 45 to be able to cope with missing data: the original limma Ct value to something else than infinity is not correct. For package discards all expression values from a gene over the genes that are expressed, but for which the expression value, different experiments, when one value in one experiment is due to technical failures or limitations, are not known, not available. This hampers the analysis when one has many setting the Ct value to infinity is not correct. Furthermore, different conditions, as for each gene for which one of the using arbitrary values that are outside the range of expres 50 experimental conditions produces no expression values, a sion complicates the calculation routines and visualisation different contrast matrix has to be generated omitting that routines. Therefore it was opted to remove the gene-experi experimental condition. Therefore the function for fitting the ment combinations for which no correct expression data was contrasts was adapted to drop data-points with missing data. detected. Differential expressions were calculated between Ct val An obvious case of gene-experiment pairs for which no 55 ues and the mean Ct value for a certain gene. Thus, the expression is detected, are those for which no curve could be higher the value, the lower the expression. For each gene, fitted to the qPCR data. Less obvious cases are detailed plots were generated showing those differences. However, in below. those plots, the Ct values were inversed, so that the higher Typically for expressed genes, is that the fluorescence the value, the higher the expression. values cover a certain range. Data points for which this 60 range was not high enough, were discarded, as they pointed Example 1 to very poorly fitted curves and generally bad data. The minimal fluorescence range was set to 400 (thus Fmax Effect of arcA and iclR Gene Deletions on the Fmin>400). Gene Expression of the Colanic Acid Biosynthesis In a good amplification curve, the first (D1) and second 65 (D2) derivative are quite close to each other (see the FIGS. 1 and 2 show the expression pattern of genes documentation of the SOD function in the qpcR package involved in collanic acid biosynthesis (35). Single arc A or US 9,719,119 B2 21 22 iclR knock out mutations did not affect the expression of the is introduced. Because fructose-6-phosphate is easily operon in comparison of the wild type strain in batch and degraded in the glycolysis, the glycolysis is interrupted in chemostat conditions. The double mutant strain, order to steer all fructose-6-phosphate in the direction of AarcAAiclR, however upregulates the genes of the collanic GDP-fucose. The genes pgi, pfkA and pfkB are thus acid operon 6 to 8 times in comparison to the wild type and 5 knocked out, coding for glucose-6-phosphate isomerase and the single mutant strains in both chemostat and batch phosphofructokinase A and B. Finally a fucosyltransferase is conditions. Both regulators have thus a Surprisingly coop introduced to link fucose to an acceptor molecule. erative effect on the expression of this operon which is independent from the culturing condition that is applied. The growth rate of the wild type strain is somewhat Looking at the regulatory network of this operon, no direct 10 affected when grown on Sucrose after introduction of a link could be found between both ArcA and IclR and the sucrose phosphorylase (BaSP) (plasmid with sequence SEQ transcription factor that controls the operon, Rcs.A (FIG. 5). ID No 2) (Table 2), however the introduction of pgi muta Only ArcA is connected with Rcs.A via 3 other transcription tions and pfkA and pfkB double mutations led to significant factors, which are all upregulated as well. However the reduction of growth rate, the latter was extremely low (0.02 Aarc A single gene deletion mutant strain did not affect the 15 h'). The combination of all mutations (Apgi and ApfkA and transcription of the operon. ApfkB) led to the lowest growth rate, however, the growth rate on both Sucrose and glucose was Surprisingly similar to Example 2 that of the pgi single mutant.

Effect of arcA and iclR Gene Deletions on the TABLE 2 Gene Expression of the GDP-Fucose Biosynthesis Genes specific growth rates of the glycolysis knock out strains on a minimal medium with glucose and Sucrose FIGS. 4 and 6 show the relationship of the collanic acid Growth rate on sucrose (h) operon with GDP-fucose biosynthesis. In FIG. 6 the upregu 25 Growth rate on (strains transformed with lation of GDP-fucose biosynthesis specific genes is shown. Strain glucose (h') plasmid containing BaSP) These mutations thus enhance the biosynthesis of GDP Wild type O.64 O41 fucose, which is a precursor for fucosylated oligosaccha Apgi O.18 O.23 rides such as fucosyllactose, fucosyllactoNbiose and lewis X ApfkAApfkB O.O2 n.d. oligosaccharide or fucosylated proteins. These Sugars and 30 ApgiApfkAApfkB O.23 O.24 proteins, as already indicated above, have applications in therapeutics as nutraceutical, as components in human mother milk in which they have anti-inflammatory and prebiotic effects (5, 8, 27). SEQ ID No 2 : Plasmid sequence with sucrose 35 phosphorylase BaSP Example 3 AATTCGGAGGAAACAAAGATGGGGGGTTCTCATCATCATCATCATCAT GGTATGGCTAGCATGAAAAACAAGGTGCAGCTCATCACTTACGCCGAC Enhancement of GDP-Fucose and Fucosylated Oligosaccharide Biosynthesis CGCCTTGGCGACGGCACCATCAAGTCGATGACCGACATTCTGCGCACC 40 CGCTTCGACGGCGTGTACGACGGCGTTCACATCCTGCCGTTCTTCACC The mutations AarcAAiclR applied in combination with other mutations enhance the production of fucosylated com CCGTTCGACGGCGCCGACGCAGGCTTCGACCCGATCGACCACACCAAG pounds. A first, other genetic modification that enhances said production is the deletion of wealJ from the collanic GTCGACGAACGTCTCGGCAGCTGGGACGACGTCGCCGAACTCTCCAAG operon, stopping the initiation of the collanic acid biosyn 45 ACCCACAACATCATGGTCGACGCCATCGTCAACCACATGAGTTGGGAA thesis and thus the accumulation of GDP-fucose. Further, a fucosyltransferase has to be introduced to link fucose with TCCAAGCAGTTCCAGGACGTGCTGGCCAAGGGCGAGGAGTCCGAATAC different acceptor molecules Such as lactose. The metabo TATCCGATGTTCCTCACCATGAGCTCCGTGTTCCCGAACGGCGCCACC lism is then engineered further to accumulate the precursor of the GDP-fucose biosynthetic pathway. These modifica 50 GAAGAGGACCTGGCCGGCATCTACCGTCCGCGTCCGGGCCTGCCGTTC tions are shown in FIG. 7. Additional to wealJ, the collanic acid operon genes that do not code for GDP-fucose biosyn ACCCACTACAAGTTCGCCGGCAAGACCCGCCTCGTGTGGGTCAGCTTC thesis reactions are knocked out, such as gmm, wcaA, wcaB, ACCCCGCAGCAGGTGGACATCGACACCGATTCCGACAAGGGTTGGGAA wcaC, wcal), wcaE, wcaF, wcal, wcaK, wcal and/or, wcaM. For the production of fucosyllactose, lacZ coding for B-ga 55 TACCTCATGTCGATTTTCGACCAGATGGCCGCCTCTCACGTCAGCTAC lactosidase, is knocked out to avoid lactose degradation and the expression of lacY, coding for a lactose permease, is ATCCGCCTCGACGCCGTCGGCTATGGCGCCAAGGAAGCCGGCACCAGC enhanced by means of a strong constitutive promoter. TGCTTCATGACCCCGAAGACCTTCAAGCTGATCTCCCGTCTGCGTGAG GAAGGCGTCAAGCGCGGTCTGGAAATCCTCATCGAAGTGCACTCCTAC Example 4 60 TACAAGAAGCAGGTCGAAATCGCATCCAAGGTGGACCGCGTCTACGAC Enhancement of GDP-Fucose and Fucosylated Oligosaccharide Production Via a Split Metabolism TTCGCCCTGCCTCCGCTGCTGCTGCACGCGCTGAGCACCGGCCACGTC with Sucrose as a Substrate GAGCCCGTCGCCCACTGGACCGACATACGCCCGAACAACGCCGTCACC 65 To accumulate the GDP-fucose precursor fructose and GTGCTCGATACGCACGACGGCATCGGCGTGATCGACATCGGCTCCGAC fructose-6-phosphate, a Sucrose phosphorylase or invertase

US 9,719,119 B2 25 26 pentose phosphate pathway. Due to the biochemical prop Example 8 erties of this pathway, fructose-6-phosphate is formed (FIGS. 9 and 10). To form biomass glyceraldehyde-3-phos Enhancement of GDP-Mannose and Mannosylated phate has to be formed, which is formed by the transketolase Oligosaccharide Production Via a Split Metabolism reactions coded by thatA and tktB in E. coli. This Glyceral with Sucrose as Substrate dehyde-3-phosphate is formed together with fructose-6- phosphate from Xylulose-5-phosphate and erythrose-5-phos To accumulate the GDP-mannose precursors fructose and phate. The latter is in turn formed together with fructose-6- fructose-6-phosphate, a Sucrose phosphorylase or invertase phosphate from glyceraldehyde-3-phosphate and is introduced. Because fructose-6-phosphate is easily Sedoheptulose-7-phosphate via transaldolase reactions 10 degraded in the glycolysis, the glycolysis is interrupted in coded by talA and talB. To balance all of these reactions order to steer all fructose-6-phosphate in the direction of together the flux has to be distributed between xylulose-5- GDP-fucose. The genes pgi, pfkA and pfkB are thus phosphate and ribose-5-phosphate, as such that from 1 mole knocked out, coding for glucose-6-phosphate isomerase and glucose, 2/3 mole of xylulose-5-phosphate and 1/3 mole phosphofructokinase A and B. Finally a mannosyltransferase ribose-5-phosphate is formed. To drive these equilibrium 15 is introduced to link mannose to an acceptor molecule. To reactions, fructose-6-phosphate is pulled out of the pentose avoid GDP-mannose degradation the genes gmm and gmd phosphate pathway by the GDP-fucose and fucosyllacted have to be knocked out in the collanic acid operon. In oligosaccharide biosynthesis pathway. Additional to wealJ. addition, the genes that do not code for GDP-mannose biosynthesis reactions are knocked out, such as weaA, the collanic acid operon genes that do not code for GDP wcaB, wcaC, wcal), wcaE, wcaF, wcal, wca.J. WcaK, wcal fucose biosynthesis reactions are knocked out, such as gmm, and/or, wcaM. wcaA, wcaB, wcaC, wcalD, wcaE, wcaF, wcal, wcaK, wcal and/or, wcaM. For the production of fucosyllactose, lacz Example 9 coding for B-galactosidase, is knocked out to avoid lactose degradation and the expression of lacY, coding for a lactose 25 Upregulation of Acid Resistance Related Genes permease, is enhanced by means of a strong constitutive promoter. Similar to the collanic acid operon upregulation, acid resistance related genes are also upregulated in a Example 6 AarcAAiclR double mutant strain in comparison to the wild 30 type strain and the single mutant strains. These genes make Fermentative 2-Fucosyllactose Production with a a strain more resistant to low pH, which is beneficial for the Fucosyltransferase Originating from Helicobacter production of acids (4) or the production of glucosamine pylori (12) which is not stable at neutral and high pH. FIG. 12 presents the gene expression pattern of these acid resistance The mutant strain in which the genes lacZ, glgC, agp, 35 related genes and indicates up to 8 fold expression increase pfkA, pfkB, pgi, arcA, ic/R, wcal are knocked out and lacY in the double mutant strain. was expressed via constitutive expression to ensure expres sion under all culturing conditions, was transformed further Example 10 with a fucosyltransferase originating from Helicobacter pylori and a Sucrose phosphorylase originating from Bifi 40 Fed Batch Production of 2-Fucosyllactose dobacterium adolescentis, which were also constitutively expressed. The constitutive promoters originate from the A mutant strain was constructed via the genetic engineer promoter library described by De Mey et al. 2007. This ing methodologies described above with the following geno strain was cultured in a medium as described in the materials type: and methods, however with 30 g/l of sucrose and 50 g/l of 45 AlaczYA::P22-lacYAglgCAagpApgiApfkA-P22 lactose. This resulted in the formation of 2-fucosyllactose as baSPApfkBAarcAAiclR::slAwcalAIonAadhE-P14-frk+ shown in FIGS. 13 and 14. pCXP14-FT. H. pylori (a vector with sequence SEQ ID No 1). The promoter P22 and P14 originate from the promoter Example 7 library constructed by De Mey et al (11) and was cloned 50 similar to the methodology described by Aerts etal (2). “::sl” Fermentative Fucosyllactose Production with a marks a scarless gene deletion, thus without a FRT site that Fucosyltransferase Originating from Dictyostellium remains in the chromosome. discoideum This strain was cultured in a bioreactor as described above in materials and methods, in the mineral medium with 30 g/1 The mutant strain in which the genes lacZ, glgC, agp, 55 of sucrose and 50 g/l of lactose. After the batch phase the pfkA, pfkB, pgi, arcA, ic/R, wcal are knocked out and lacY bioreactor was fed with 500 g/l of sucrose, 50 g/l lactose and was expressed via constitutive expression to ensure expres 1 g/l of magnesium Sulphate heptahydrate. This led to the sion under all culturing conditions, was transformed further accumulation of 27.5 g/l of fucosyllactose in the Superna with a fucosyltransferase originating from Dictyostellium tant. discoideum and a Sucrose phosphorylase originating from 60 Bifidobacterium adolescentis, which were also expressed constitutively. The constitutive promoters originate from the SEQID No 1 : pcxP14-FT. H. pylori promoter library described by De Mey et al. 2007. This CGCGTTGGATGCAGGCATGCAAGCTTGGCTGTTTTGGCGGATGAGAGA strain was cultured in a medium as described in the materials AGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGA and methods, however with 30 g/l of sucrose and 50 g/l of 65 lactose. This resulted in the formation of 2-fucosyllactose as TAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACC shown in FIGS. 13 and 14.

US 9,719,119 B2 29 30 bioreactor was fed with 500 g/l of sucrose, 20 g/l lactose and 15. Hammer, K. I. Mijakovic, and P. R. Jensen. 2006. 1 g/l of magnesium Sulphate heptahydrate. This led to the Synthetic promoter libraries—tuning of gene expression. accumulation of 26 g/l of fucosyllactose in the Supernatant TRENDS in Biotechnology 24:53-55. with nearly stoichiometric conversion of lactose. Increasing 16. Hanahan, D., J. Jessee, and F. R. Bloom. 1991. Plasmid the lactose feed concentrations leads further to increased 5 transformation of Escherichia coli and other bacteria. final fucosyllactose titers and stoichiometric lactose conver Methods in Enzymology 204:63-113. S1O. 17. Hommais, F., E. Krin, J.-Y. Coppée, C. Lacroix, E. Yeramian, A. Danchin, and P. Bertin. 2004. GadE (YhiE): REFERENCES a novel activator involved in the response to acid envi 10 ronment in Escherichia coli. Microbiology 150:61-72. 1. 2006. R: A Language and Environment for Statistical 18. Jigami, Y. 2008. Yeast Glycobiology and Its Application. Computing. R Foundation for Statistical Computing. Bioscience, Biotechnology, and Biochemistry 72:637 R-Development Core Team, Vienna, Austria. 648. 2. Aerts, D., T. Verhaeghe, M. De Mey, T. Desmet, and W. 15 19. Keasling, J. D. 1999. Gene-expression tools for the Soetaert. 2010. A constitutive expression system for high metabolic engineering of bacteria. Trends in Biotechnol throughput screening. Engineering in Life Sciences ogy 17:452-460. 10:DOI: 10.1002/elsc.201000065. 20. Lequeux, G. 2008. Metabolic modelling and analysis for 3. Alper, H., C. Fischer, E. Nevoigt, and G. Stephanopoulos. the optimization of Escherichia coli as a production host. 2005. Tuning genetic control through promoter engineer Ghent University, Ghent. ing. Proceedings of the national academy of Sciences of 21. Lequeux, G. L. Johansson, J. Maertens, P. Vanrol the United States of America 102:12678-12683. leghem, and G. Liden. 2005. Metabolic flux analysis of C 4. Beauprez, J. 2010. Metabolic modelling and engineering and P-limited shikimic acid producing E. coli. Journal of of Escherichia coli for succinate production. PhD. Ghent Biotechnology 118:S121-S121. University, Ghent. 25 22. Masuda, N., and G. M. Church. 2003. Regulatory 5. Bode, L. 2006. Recent Advances on Structure, Metabo network of acid resistance genes in Escherichia coli. lism, and Function of Human Milk Oligosaccharides. The Molecular Microbiology 48:699-712. Journal of Nutrition 136:2127-2130. 23. Pattyn, F. F. Speleman, A. De Paepe, and J. Vandes 6. Canton, B. A. Labno, and D. Endy. 2008. Refinement and ompele. 2003. RTPrimerDB: The Real-Time PCR primer standardization of synthetic biological parts and devices. 30 and probe database. Nucleic Acids Research 31:122-123. Nat Biotech 26:787-793. 24. Perrenoud, A., and U. Sauer. 2005. Impact of global 7. Cavallaro, G., L. Maniscalco, P. Caliceti, S. Salmaso, A. transcriptional regulation by ArcA, Arch3, Cra, Crp. Cya, Semenzato, and G. Giammona. 2004. Glycosilated Mac Fnr, and Mlc on glucose catabolism in Escherichia coli. romolecular Conjugates of Antiviral Drugs with a Polyas Journal of Bacteriology 187:3171-3179. partamide. Journal of Drug Targeting 12:593-605. 35 25. Ritz, C., and A.-N. Spiess. 2008. qpcR: an R package for 8. Coppa, G. V., L. Zampini, T. Galeazzi, and O. Gabrielli. sigmoidal model selection in quantitative real-time poly 2006. Prebiotics in human milk: a review. Digestive and merase chain reaction analysis. Bioinformatics 24:1549 Liver Disease 38:S291-S294. 1551. 9. Datsenko, K. A., and B. L. Wanner. 2000. One-step 40 26. Salis, H. M., E. A. Mirsky, and C. A. Voigt. 2009. inactivation of chromosomal genes in Escherichia coli Automated design of synthetic ribosome binding sites to K-12 using PCR products. Proceedings of the national control protein expression. Nat Biotech 27:946-950. academy of sciences of the United States of America 27. Seed, B., and J. Holgersson. 1999. Fucosyltransferase 97:6640-6645. genes and uses thereof U.S. Pat. No. 5,858,752. 10. De Mey, M., G. J. Lequeux, J. J. Beauprez, J. Maertens, 45 28. Shalel-Levanon, S. K. Y. San, and G. N. Bennett. 2005. E. Van Horen, W. K. Soetaert, P. A. Vanrolleghem, and E. Effect of ArcA and FNR on the expression of genes J. Vandamme. 2007. Comparison of different strategies to related to the oxygen regulation and glycolysis pathway in reduce acetate formation in Escherichia coli. Biotechnol Escherichia coli under growth conditions. Biotechnology ogy Progress. and Bioengineering 92: 147-159. 11. De Mey, M., J. Maertens, G. J. Lequeux, W. K. Soetaert, 50 29. Shalel-Levanon, S. K. Y. San, and G. N. Bennett. 2005. and E. J. Vandamme. 2007. Construction and model Effect of oxygen on the Escherichia coli ArcA and FNR based analysis of a promoter library for E. coli: an regulation systems and metabolic responses. Biotechnol indispensable tool for metabolic engineering. BMC Bio ogy and Bioengineering 89:556-564. technology 7:34-48. 30. Smith, S., A. D. Elbein, and Y.T. Pan. 1999. Inhibition 12. Deng, M.-D., D. K. Severson, A. D. Grund, S. L. 55 of Pathogenic Bacterial Binding by High Mannose Oli Wassink, R. P. Burlingame, A. Berry, J. A. Running, C. A. gosaccharides U.S. Pat. No. 5,939,279. Kunesh, L. Song, T. A. Jerrell, and R. A. Rosson. 2005. 31. Smyth, G. K. 2005. limma: Linear models for microarray Metabolic engineering of Escherichia coli for industrial data., p. 397–420. In R. Gentleman, V. Carey, W. Huber, production of glucosamine and N-acetylglucosamine. R. A. Irizarry, and S. Dudoit (ed.), Bioinformatics and Metabolic Engineering 7:201-214. 60 Computational Biology Solutions. Using R and Biocon 13. Ebel, W., and J. E. Trempy. 1999. Escherichia coli Rcs.A, ductor. Springer. a Positive Activator of Colanic Acid Capsular Polysac 32. Smyth, G. K. 2004. Linear Models and Empirical Bayes charide Synthesis, Functions To Activate Its Own Expres Methods for Assessing Differential Expression in sion. Journal of bacteriology 181:577-584. Microarray Experiments. Statistical Applications in 14. Foster, J. W. 2004. Escherichia coli acid resistance: Tales 65 Genetics and Molecular Biology 3:3. of an amateur acidophile. Nature Reviews Microbiology 33. Smyth, G. K., and T. Speed. 2003. Normalization of 2:898-907. cDNA microarray data. Methods 31:265-273. US 9,719,119 B2 31 32 34. Spiess, A.-N., C. Feig, and C. Ritz. 2008. Highly 38. Waegeman, H. J. J. Beauprez, H. Moens, J. Maertens, accurate sigmoidal fitting of real-time PCR data by intro M. De Mey, M. R. Foulquie-Moreno, J. J. Heijnen, D. ducing a parameter for asymmetry. BMC Bioinformatics Charlier, and W. Soetaert. 2010. Effect of iclR and arcA 9:221. knockouts on biomass formation and metabolic fluxes in 35. Stevenson, G. K. Andrianopoulos, M. Hobbs, and P. R. Escherichia coli K12 and its implications on understand Reeves. 1996. Organization of the Escherichia coli K-12 ing the metabolism of Escherichia coli BL21 (DE3). gene cluster responsible for production of the extracellu BMC microbiology 11:1-17. lar polysaccharide collanic acid. Journal of Bacteriology 39. Waegeman, H. J. J. Beauprez, H. Moens, J. Maertens, 178:4885-4893. M. De Mey, M. R. Foulquie-Moreno, J. J. Heijnen, D. 36. Stout, V., A. Torres-Cabassa, M. R. Maurizi, D. Gutnick, 10 Charlier, and W. Soetaert. 2011. Effect of iclR and arcA and S. Gottesman. 1991. Rcs.A, an unstable positive knockouts on biomass formation and metabolic fluxes in regulator of capsular polysaccharide synthesis. Journal of Escherichia coli K12 and its implications on understand bacteriology 173:1738-1747. ing the metabolism of Escherichia coli BL21 (DE3). 37. Sunnarborg, A., D. Klumpp, T. Chung, and D. C. BMC microbiology 11:1-17. Laporte. 1990. Regulation of the glyoxylate bypass 15 40. Warnecke, T., and R.T. Gill. 2005. Organic acid toxicity, operon: cloning and characterization of IclR. Journal of tolerance, and production in Escherichia coli biorefining Bacteriology 172:2642-2649. applications. Microbial Cell Factories 4.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 9 O

SEO ID NO 1 LENGTH: 3638 TYPE: DNA ORGANISM: Artificial sequence FEATURE; OTHER INFORMATION: Wector

<4 OOs SEQUENCE: 1 cgc.gttggat gcaggcatgc aagcttggct gttittggcgg atgagagaag attitt Cagcc 60

tgatacagat taaat Cagaa cqcagaa.gcg gtctgataaa acagaatttg cctggcggca 12O gtagcgcggt ggtc.ccacct gaccc catgc cgaact caga agtgaaacgc cgtagcgc.cg 18O

atgg tagtgt ggggit ct coc catgcgagag tagggaactg. cc aggcatca aataaaacga 24 O

aaggcticagt caaagactg ggcctitt.cgt tittatctgtt gtttgtcggit galacgct Ctc 3 OO

Ctgagtagga caaatcc.gcc gggagcggat ttgaacgttg cgaa.gcaacg gCCCggaggg 360

tggcgggcag gacgc.ccgcc at aaactgcc aggcatcaaa ttaa.gcagala ggc.catcct 42O

acggatggcc tittittgcgtt totacaaact cittitttgttt atttittctaa atacattcaa 48O

atatgtatcc gct catgaga caataac cct gataaatgct tcaataatat tdaaaaagga 54 O

agagtatgag tattoaa.cat titcc.gtgtcg cc cittatt co ctitttittgcg goattittgcc 6 OO titcCtgttitt totcaccca gaaacgctgg taaagtaaa agatgctgaa gatcagttgg 660 gtgcacgagt gggttacat c galactggat C to aacagcgg talagat cott gagagtttitc 72O gcc.ccgaaga acgttitt coa atgatgagca Cttittaaagt totgctatgt gg.cgcggitat 78O

tat cocgtgt tacgc.cggg calaga.gcaac toggtc.gc.cg catacactat tdtcagaatg 84 O

acttggttga gtact cacca gt cacagaaa agcatcttac ggatgg catg acagtaagag 9 OO aattatgcag togctgccata accatgagtgataa cactgc ggccaactta cittctgacaa 96.O

cgatcggagg accgaaggag ct aaccgctt ttittgcacaa catgggggat catgitaactic 102O gccttgatcg ttgggalaccg gagctgaatgaa.gc.cat acc aaacgacgag catgacacca 108O

cgatgcc tac agcaatggca acaacgttgc gcaaactatt aactggcgaa citact tactic 114 O tagct tcc.cg gCaacaatta at agactgga tiggaggcgga taaagttgca ggaccact tc 12 OO

tgcgctcggc cctt.ccggct ggctggittta ttgctgataa atctggagcc ggtgagcgtg 1260

ggit ct cqcgg tat cattgca gCactggggc Cagatggitaa gcc.ctic ccgt atcgtagtta 132O

totacacgac ggggagt cag gCaactatgg atgaacgaaa tagacagat C gotgagatag 138O

US 9,719,119 B2 39 40 - Continued

22 Os. FEATURE: 223 OTHER INFORMATION: Promotor

<4 OOs, SEQUENCE: 3 tgtttattta t cactittggc agagtaatta tcc tigtgcac tattaatagc aatgtc.gc.ca 6 O tgcacattta ccttgcagtt aattgaataa aaatttaact ggcatcagtic Ctaaaaaaat 12 O tgattt catc cqcaggctat tgacagaata att Cagactg gtctttcagg catccagaca 18O cgct accqcc cct ggcttitt tagctaccaa tacactgatt tag tittaatt titt CacaccC 24 O tcticagoatg cagtcgttga tgagaaaggg ttattacgga aattaacttic cgaatataag 3OO gtgacatt at ggtaattgaa tattggctitt c caataatgc 34 O

SEQ ID NO 4 LENGTH: 101 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Promotor

<4 OOs, SEQUENCE: 4 cgaggt cac ggat.cccaag Cttct tctag agcggcc.gcc atggaaattt C cct attata 6 O c catatgc.cg gccalagatgt Caagaaactt atagaatgaa g

SEO ID NO 5 LENGTH: 44 TYPE: DNA ORGANISM: Artificial sequence FEATURE; OTHER INFORMATION: Promotor

<4 OOs, SEQUENCE: 5 taagtgtcat t caatatggit ttittaggagt ttctittaggit togac 44

SEQ ID NO 6 LENGTH: 485 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Promotor

<4 OOs, SEQUENCE: 6 tgtttattta t cactittggc agagtaatta tcc tigtgcac tattaatagc aatgtc.gc.ca 6 O tgcacattta ccttgcagtt aattgaataa aaatttaact ggcatcagtic Ctaaaaaaat 12 O tgattt catc cqcaggctat tgacagaata att Cagactg gtctttcagg catccagaca 18O cgct accqcc cct ggcttitt tagctaccaa tacactgatt tag tittaatt titt CacaccC 24 O tcticagoatg cagtcgttga tgagaaaggg ttattacgga aattaacttic cgaatataag 3OO gtgacatt at ggtaattgaa tattggctitt c caataatgc Caggtogac ggat.cccaag 360

Cttcttctag agcggcc.gc.c atggaaattit c cct attata ccatatgcc.g gcc aagatgt caagaaactt atagaatgaa gtaagtgtca ttcaatatgg tttittaggag titt ctittagg 48O ttgac 485

SEO ID NO 7 LENGTH: 74 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer US 9,719,119 B2 41 - Continued

<4 OO > SEQUENCE: 7 Cataatggat titcCttacgc gaaatacggg Cagacatggc Ctgc.ccggitt attagtgtag 6 O gctggagctg. Cttic 74

<210s, SEQ ID NO 8 &211s LENGTH: 71 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 8 gtatgttgttg tdgaattgttg agcggataac aattt cacac aggaalacagc ticatatgaat 6 O atcc to citta g 71.

<210s, SEQ ID NO 9 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 9 gcggttggaa taatagcg 18

<210s, SEQ ID NO 10 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 10 Caggittt CCC gactggaaag 2O

<210s, SEQ ID NO 11 &211s LENGTH: 75 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 11 agaccgc.cgg ttittaa.gcag C9ggalacatc. tctgaacata catgtaaaac Ctgcagtgta 6 O ggctggagct gct tc 7s

<210s, SEQ ID NO 12 &211s LENGTH: 82 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 12 gtctggcagg gacctgcaca C9gattgttgt gtgttccaga gatgataaaa aaggagttag 6 O tccatatgaa tat cotcc tt ag 82

<210s, SEQ ID NO 13 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer US 9,719,119 B2 43 44 - Continued

<4 OOs, SEQUENCE: 13 gcgaat atcg ggaaatgcag g 21

<210s, SEQ ID NO 14 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 14 cagagattgt tttacctgct gg 22

<210s, SEQ ID NO 15 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 15 catatttctg. tca cactictt tagtgattga taacaaaaga ggtgcCagga gtgtaggctg 6 O gagdtgct tc 70

<210s, SEQ ID NO 16 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 16 taaaaacgtt taaccagoga citcc.ccc.gct tct cqcgggg gagttittctg catatgaata 6 O t cct cottag 70

<210s, SEQ ID NO 17 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 17 gccacaggtg caattatc 18

<210s, SEQ ID NO 18 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 18

Cattitt cqaa gtc.gc.cgggt acg 23

<210s, SEQ ID NO 19 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer US 9,719,119 B2 45 46 - Continued

< 4 OOs SEQUENCE: 19 ggcgct acaa tict tccaaag ticaca attct Caaaatcaga agagtattgc gtgtaggctg 6 O gagdtgct tc 70

SEQ ID NO 2 O LENGTH: 70 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 2O ggttgc.cgga tigcggcgtga acgc.cttatc. c9cc tacat atcgacgatg catatgaata 6 O t cct cottag 70

SEQ ID NO 21 LENGTH: 2O TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 21 ggct cotcca acaccgttac

SEQ ID NO 22 LENGTH: 2O TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 22 tacatat cqg catcgacctg

SEQ ID NO 23 LENGTH 19 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 23 taccgc.catt toggcctgac 19

SEQ ID NO 24 LENGTH: 2O TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 24 aaagtgcgct ttgtcCatgc

SEO ID NO 25 LENGTH: 69 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer US 9,719,119 B2 47 48 - Continued

<4 OOs, SEQUENCE: 25 gact tccggc alacagatttic attittgcatt C caaagttca gagg tagt cq t taggctgg 6 O agctgcttic 69

<210s, SEQ ID NO 26 &211s LENGTH: 69 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 26 gcttctgtca toggttt cag gigtaaaggaa totgc ctittt to cqaaatcc atatgaatat 6 O cctic cittag 69

<210s, SEQ ID NO 27 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 27 tagcgt.ccct ggaaaggtaa C 21

<210s, SEQ ID NO 28 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 28 t ccct catca to cqt catag 2O

<210s, SEQ ID NO 29 &211s LENGTH: 71 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 29 cactitt Cogc tigatt.cggtg C cagactgaa at Cagcctat aggaggaaat ggtgtaggct 6 O ggagctgctt C 71.

<210s, SEQ ID NO 3 O &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 30 gttgc.cgaca ggttggtgat gattic ccc.ca atgctggggg aatgtttittg catatgaata 6 O t cct cottag 70

<210s, SEQ ID NO 31 &211s LENGTH: 79 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer US 9,719,119 B2 49 - Continued

<4 OOs, SEQUENCE: 31 ggttgaaaaa taaaaacggc gctaaaaagc gcc.gtttittt ttgacggtgg taaag.ccgag 6 O tgtaggctgg agctgctt C 79

<210s, SEQ ID NO 32 &211s LENGTH: 76 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 32 ggtcagggac titttgtactt cct gtttcqa tittagttggc aatttaggta gcaaaccata 6 O tgaatat cct c cittag 76

<210s, SEQ ID NO 33 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 33 Ctgc.cgaaaa taaagccag ta 22

<210s, SEQ ID NO 34 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 34 ggaaagtgca t caagaacgc aa 22

<210s, SEQ ID NO 35 &211s LENGTH: 71 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 35 ttgccactica gg tatgatgg gcagaatatt gcct Ctgc.cc gcc agaaaaa ggtgtaggct 6 O ggagctgctt C 71.

<210s, SEQ ID NO 36 211 LENGTH: 77 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 36 gttcaa.catt aact catcgg at cagttcag taact attgc attagctaac aataaaacat 6 O atgaatat co to cittag 77

<210s, SEQ ID NO 37 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer US 9,719,119 B2 51 52 - Continued

<4 OO > SEQUENCE: 37 cggtggaatg agatcttgcg a 21

<210s, SEQ ID NO 38 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 38 acttgctic cc gacacgctica

<210s, SEQ ID NO 39 &211s LENGTH: 71 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 39 ttgccactica gg tatgatgg gcagaatatt gcct Ctgc.cc gcc agaaaaa gcc.gcttaca 6 O gacaagctgt g 71.

<210s, SEQ ID NO 4 O 211 LENGTH: 77 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223 OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 4 O gttcaa.catt aact catcgg at cagttcag taact attgc attagctaac aataaaaagc 6 O

Catgaccc.gg gaattac 77

<210s, SEQ ID NO 41 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 41

Ctattgcatt agctaacaat aaaactttitt Ctggcgggca gagg 44

<210s, SEQ ID NO 42 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 42 ccitctgc.ccg ccagaaaaag titt tattgtt agctaatgca at agittac 48

<210s, SEQ ID NO 43 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 43 gccagogcga taatcaccag US 9,719,119 B2 53 - Continued

<210s, SEQ ID NO 44 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 44 tgcgc.ctgaa ttggaatc 19

<210s, SEQ ID NO 45 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 45 ttittgat atc galaccagacg Ct c cattcgc ggatgtactic alaggt caac gtgtaggctg 6 O gagdtgct tc 70

<210s, SEQ ID NO 46 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 46 tctatoggtgc aacgcttitt.c agatat cacc at catgtttg ccggactatg catatgaata 6 O t cct cottag 70

<210s, SEQ ID NO 47 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 47 t caatatgcc gctttgttaa cqaaacctitt gaacaccgtc aggaaaacga ttittgatatic 6 O galaccagacg 70

<210s, SEQ ID NO 48 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 48 tgacaaatct aaaaaag.cgc gagcgagcga aaaccalatgc atcgittaatc tictatggtgc 6 O aacgcttitt c 70

<210s, SEQ ID NO 49 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer US 9,719,119 B2 55 56 - Continued

< 4 OOs SEQUENCE: 49 cgctttgtta acgaaacctt togalacaccidt caggaaaacg attittgatat cqaaccagac 6 O gctic catt cq 70

SEO ID NO 5 O LENGTH: 70 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 5 O

Cagt cqtgtc atctgattac Ctggcggaaa ttaaact aag agaga.gctct gtgtaggctg 6 O gagdtgct tc 70

SEO ID NO 51 LENGTH: 70 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 51 cgaattagcc togc.cago'cct gtttitt atta gtgcattttg cqc gagg to a catatgaata 6 O t cct cottag 70

SEO ID NO 52 LENGTH: 2O TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 52 agcgcaa.cag gCatctggtg

SEO ID NO 53 LENGTH: 2O TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 53 tatat caggc cagc.catc.cc

SEO ID NO 54 LENGTH: 69 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 54 gctgaacttg taggcctgat aagcqcagcg tat caggcaa tttittataat citt catttaa 6 O

69

SEO ID NO 55 LENGTH: 69 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Primer US 9,719,119 B2 57 58 - Continued

<4 OO > SEQUENCE: 55 gcqcaacgca attaatgtga gttagct cac to attagg.ca ccc.caggctt cqc ctacctg 6 O tgacggaag 69

<210s, SEQ ID NO 56 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 56 gcgcaacgca attaatgtga gttagct cac to attaggca CCC caggctt gtgtaggctg 6 O gagdtgct tc 70

<210s, SEQ ID NO 57 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 57 gctgaacttg taggcctgat aag.cgcagcg tat caggcaa tttittataat Cttaa.gcgac 6 O tt catt cacc 70

<210s, SEQ ID NO 58 &211s LENGTH: 68 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 58 cgacgcttgt to Ctgcgctt tott catgcc ggatgcggct aatgtagat C gctgaacttg 6 O taggcctg 68

<210s, SEQ ID NO 59 &211s LENGTH: 69 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 59

Cattaatgca gctggcacga Caggittt CCC gactggaaag C9ggcagtga gcgcaacgca 6 O attaatgtg 69

<210s, SEQ ID NO 60 &211s LENGTH: 69 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 60 gact tccggc alacagatttic attittgcatt C caaagttca gagg tagt cq t taggctgg 6 O agctgcttic 69 US 9,719,119 B2 59 60 - Continued

<210s, SEQ ID NO 61 &211s LENGTH: 69 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 61 gcttctgtca toggttt cag gigtaaaggaa totgc ctittt to cqaaatca agcttgcatg 6 O cctgcatcc 69

<210s, SEQ ID NO 62 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 62 agaggctatt C9gctatgac

<210s, SEQ ID NO 63 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 63 cgc.catgttg gaatgggagg 20

<210s, SEQ ID NO 64 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 64 tgattgttat act atttgca catt cqttgg at cactitcqa totgcaagaa gact tcc.ggc 6 O aacagatttic 70

<210s, SEQ ID NO 65 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 65 aattgcagaa tt catgtagg cctgataagc gaa.gc.gcatc aggcatttitt gct tctgtca 6 O tcggitttcag 70

<210s, SEQ ID NO 66 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 66 taccgc.catt toggcctgac 19 US 9,719,119 B2 61 62 - Continued

<210s, SEQ ID NO 67 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 67 aaagtgcgct ttgtcCatgc

<210s, SEQ ID NO 68 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 68 atcggcattg CCC agaaggg gcc.gtttatgttgccagaca gcgct actgagtgtaggctg 6 O gagdtgct tc 70

<210s, SEQ ID NO 69 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 69 attcagoag atgatt tact aaaaaagttt aac attatca ggaga.gcatt aagcttgcat 6 O gcctgcatcc 70

<210s, SEQ ID NO 70 &211s LENGTH: 68 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 7 O aag.ccgittat agtgcct cag tittaaggat.c ggit caactaa to cittaact g atcggcattg 6 O

CCC agaag 68

<210s, SEQ ID NO 71 211 LENGTH: 77 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 71 ttgattitt ca taggittaa.gc aaatcatcac cqcactgact atact ct cqt atticgagcag 6 O atgatt tact aaaaaag 77

<210s, SEQ ID NO 72 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 72 gcgt caggca gtgttgtatic US 9,719,119 B2 63 64 - Continued

<210s, SEQ ID NO 73 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 73 Ctggaagtga cqcattagag

<210s, SEQ ID NO 74 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 74 tgtc. attact tacacatc.cc gc 22

<210s, SEQ ID NO 75 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 75 gcattcaata C9gg tattgt gg 22

<210s, SEQ ID NO 76 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 76 cattggggat tatctgaatc agct CCCCtg gaatgcaggg gagcggcaag gtgtaggctg 6 O gagdtgct tc 70

<210s, SEQ ID NO 77 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 77 tatttittagt agcttaaatg tdattcaa.ca toactggaga aagtic titatg aagcttgcat 6 O gcctgcatcc 70

<210s, SEQ ID NO 78 &211s LENGTH: 72 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 78

Caattacagt ttctgactica ggact attitt aagaatagag gatgaaaggt cattggggat 6 O tatctgaatc ag 72 US 9,719,119 B2 65 66 - Continued

<210s, SEQ ID NO 79 &211s LENGTH: 8O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 79 gaatttitt ca at atcgc.cat agctittcaat taaatttgaa attttgtaaa at atttittag 6 O tagcttaaat gtgattcaac

<210s, SEQ ID NO 8O &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 80 ttcaccgcta aagcggittac

<210s, SEQ ID NO 81 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 81 cgcgtaatgc gtgggctttc

<210s, SEQ ID NO 82 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 82 ccggcatatg gtataatagg g 21

<210s, SEQ ID NO 83 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 83 acggcttgct ggc catca 18

<210s, SEQ ID NO 84 &211s LENGTH: 68 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 84 cgaatataag gtgacattat gigtaattgaa tattggctitt ccaataatgc tacggc.ccca 6 O aggit coaa 68 US 9,719,119 B2 67 - Continued

<210s, SEQ ID NO 85 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 85 aatattgtca acctaaagaa act cotaaaa accatattga atgacactta ttggctt cag 6 O ggatgagg.cg 70

<210s, SEQ ID NO 86 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 86 tcc.cgactac gtggaccttg 2O

<210s, SEQ ID NO 87 &211s LENGTH: 90 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OO > SEQUENCE: 87 catatggt at aatagggaaa titt coatggc ggcc.gcticta gaagaagctt gggat.ccgt.c 6 O gacct cqgca ttattggaaa gcc-aatatt c 9 O

<210s, SEQ ID NO 88 &211s LENGTH: 86 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 88 gcc.gc.catgg aaattt coct attataccat atgcc.ggcca agatgtcaag aaacttatag 6 O aatgaagtaa gtgtcattca atatgg 86

<210s, SEQ ID NO 89 &211s LENGTH: 73 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 89 aatattgtca acctaaagaa act cotaaaa accatattga atgacactta citt cattcta 6 O taagtttctt gac 73

<210s, SEQ ID NO 90 &211s LENGTH: 74 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer US 9,719,119 B2 69 70 - Continued

<4 OOs, SEQUENCE: 90 cgaatataag gtgacatt at ggtaattgaa tattggctitt C caataatgc cdaggtogac 6 O ggat.cccaag ctitc 74

The invention claimed is: 9. The method according to claim 1, wherein said at least 1. A method for synthesizing GDP-fucose and/or fucosy 10 one mutation that enhances the production of fucosylated lated oligosaccharides, the method comprising: genetically compounds consists of knocking out gene Ion. modifying transcriptional regulators: aerobic respiration 10. The method according to claim 1, wherein said at least control protein ArcA, and isocitrate lyase regulator IcIR, in one mutation that enhances the production of fucosylated an Escherichia coli strain, thereby upregulating at least one compounds consists of introducing a fucosyltransferase and/ of the genes of the collanic acid operon, wherein said method 15 further comprises introducing at least one mutation in said E. or a lactose permease. coli strain that enhances the production of fucosylated 11. The method according to claim3, wherein said at least compounds. one mutation that enhances the production of mannosylated 2. The method according to claim 1, wherein said at least compounds consists of deletion of the gene gmd of the one mutation that enhances the production of fucosylated collanic acid operon. compounds consists of deletion of wealJ gene. 12. The method according to claim3, wherein said at least 3. A method for synthesizing GDP-mannose and/or man one mutation that enhances the production of mannosylated nosylated oligosaccharides, the method comprising: geneti cally modifying transcriptional regulators: aerobic respira compounds consists of deletion of the gene gmm. tion control protein ArcA, and isocitrate lyase regulator 13. The method according to claim3, wherein said at least IcIR, in an Escherichia coli Strain, thereby upregulating at 25 one mutation that enhances the production of mannosylated least one of the genes of the collanic acid operon, said compounds consists of knocking out the collanic acid operon method further comprising introducing at least one mutation genes fel, gmd, gmm, wcaA, wcaB, wcaC, wcal), wcaE. in said E. coli strain that enhances the production of man wcaF, wcal, wca.J., wcaK, wca, WZX, WZa, WZb, WZc, and/or, nosylated compounds. wcaM. 4. The method according to claim 3 wherein the genes 30 14. The method according to claim3, wherein said at least cpSG and cpsB of the collanic acid operon are upregulated. one mutation that enhances the production of mannosylated 5. The method according to claim 1, wherein said at least compounds consists of introducing a gene encoding for a one mutation that enhances the production of fucosylated compounds consists of knocking-out collanic acid operon Sucrose phosphorylase or an invertase is introduced. genes gmm, wcaA, wcaB, wcaC, wcal), wcaE, wcaF, mai, 35 15. The method according to claim3, wherein said at least wca.J., wcaK, wcal, WZX, WZa, WZb, WZc and/or weaM. one mutation that enhances the production of mannosylated 6. The method according to claim 1, wherein said at least compounds consists of deletion of the genes pgi, pfkA and one mutation that enhances the production of fucosylated pfkB. compounds consists of knocking-out lac7. 16. The method according to claim3, wherein said at least 7. The method according to claim 1, wherein said at least 40 one mutation that enhances the production of mannosylated one mutation that enhances the production of fucosylated compounds consists of knocking out the gene Ion. compounds consists of introducing a Sucrose phosporylase or invertase. 17. The method according to claim3, wherein said at least 8. The method according to claim 1, wherein said at least one mutation that enhances the production of mannosylated one mutation that enhances the production of fucosylated compounds consists of introducing a gene encoding for a compounds consists of knocking out genes pgi, pfkA and 45 mannosyltransferase. pfkB.