University of Nevada, Reno

Home range, spatial dynamics, and growth of Moapa dace (Moapa coriacea)

A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Biology

by

Mark E. Hereford

Dr. Mary M. Peacock/Thesis Advisor

May, 2014

© by Mark E. Hereford 2014 All Rights Reserved

THE GRADUATE SCHOOL

We recommend that the thesis prepared under our supervision by

MARK EARL HEREFORD

entitled

Home range, spatial dynamics, and growth of Moapa dace (Moapa coriacea)

be accepted in partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE

Mary M. Peacock, Ph.D., Advisor

Chris R. Feldman, Ph.D., Committee Member

Jill S. Heaton, Ph.D., Graduate School Representative

David W. Zeh, Ph.D., Dean, Graduate School

i

ABSTRACT

Moapa dace (Moapa coriacea) is an endangered thermophilic minnow (Family:

Cyprinidae) native to the upper Muddy River which originates at geothermal springs in southeastern Nevada, USA. Historically Moapa dace occupied tributaries and the main stem of the Muddy River totaling 18 kilometers of stream habitat near the geothermal sources where water temperatures are between 26.0°C and 32.0°C. Due to habitat fragmentation, water diversion, and invasive species introductions during the early and mid-1900’s Moapa dace populations drastically declined. In 1997, following the invasion of the non-native blue tilapia (Oreochromis aureus), a fish barrier was installed isolating three tributaries from the main stem of the Muddy River for the protection of native aquatic organisms above the barrier. During this study Moapa dace were restricted to stream habitat above this barrier totaling 2.8 kilometers. The goals of this study were to determine the home range size, spatial dynamics, and growth of Moapa dace in these three tributaries of the Muddy River. A mark-recapture method using baited minnow traps was implemented and genetic tagging of individuals based on their unique genotypes using ten polymorphic microsatellites was used to identify individuals over a three year period (October 2009 – September 2012). Using geographic information systems (GIS) I was able to demonstrate that home range density (number of individual home ranges per square meter) was most restricted in a fragmented tributary and home range density increased in a tributary immediately following stream habitat restoration.

Mean home range length of individuals increased in the last year of this study (141.3 meters), was greatest in the largest tributary (215.2 meters), and was the least in the

ii fragmented tributary (70.5 meters). Growth rates of Moapa dace drastically decline in individuals over 40 mm (fork length), are highest between May and July, and lowest between September and November. Using Fulton’s body condition factor (K=W/L3) two distinct periods of low (January – March) and high (May – November) body condition were discovered. Growth rates and body condition were both significantly higher in individuals with home ranges over 25 meters. The results of this study suggest that

Moapa dace will immediately occupy stream habitat that has been recently restored to increase stream velocities and re-emphasizes the importance of habitat connectivity as it relates to an individual’s ability to maximize energy intake.

iii

ACKNOWLEDGEMENTS

This thesis would not have possible without the assistance of many individuals. I would like to thank Gary Scoppettone for his guidance and mentorship throughout this and many projects I have worked on, his teachings of his extensive knowledge of native fishes in western North America is something I am very grateful for. I would also like to thank my major advisor Dr. Mary Peacock whose encouragement, determination, and good spirits allowed me to complete this endeavor.

The Southern Nevada Public Land Management Act, United States Fish and

Wildlife Service, and the United States Geological Survey provided funding and logistical support for this project. Special thanks to Lee Simons and Amy LaVoie of the

United States Fish and Wildlife Service and David Syzdek and staff of the Southern

Nevada Water Authority for field logistical support. Without the hard work of Mark

Fabes and Antonio Salgado of the United States Geological Survey this project could not have been completed. I would also like to thank Veronca Kirchoff for her knowledge and patience in teachings of molecular laboratory techniques which allowed me to analyze many samples. Thank you to my family and friends who have supported me throughout this process.

Last but not least I would like to thank my lovely, brainy, and buff wife, Danielle

Hereford, who not only worked with me throughout every aspect of field, laboratory, and analysis of this project but whose encouragement and enthusiasm allowed me to complete this project in a timely manner while still enjoying every process along the way.

iv

TABLE OF CONTENTS

Page

Introduction 1

Methods 8

Results 21

Discussion 26

Management/Conservation Implications 31

Literature Cited 36

v

LIST OF TABLES

Page

Table Legends 45

Table 1. Summary of in-stream habitat characteristics 46

Table 2. Moapa dace microsatellite primer information 47

Table 3. Summary of fishes captured 48

vi

LIST OF FIGURES

Page

Figure Legends 49

Figure 1. Origin of the Muddy River, Nevada 51

Figure 2. Warm Springs area of the Muddy River, Nevada 52

Figure 3. Sampling locations within the Warm Springs area 53

Figure 4. Average monthly water temperatures within study area 54

Figure 5. Home range density of Moapa dace 55

Figure 6. Mean home range length of Moapa dace among years 56

Figure 7. Mean home range length of Moapa dace among tributaries 57

Figure 8. Relationship of home range length and distance downstream 58

Figure 9. Growth rates of different Moapa dace size classes 59

Figure 10. Seasonal growth rates of Moapa dace 60

Figure 11. Monthly body condition of Moapa dace 61

1

INTRODUCTION

Surface water habitat only makes up 0.01% of Earth’s total water and only 0.8% of Earth’s surface but supports more than 100,000 aquatic species, or 6% of all described species (Dudgeon et al. 2006). Almost half of the described vertebrate species on Earth are fishes with 700 fish species found in the freshwater ecosystems of North America

(Allen and Flecker 1993; Helfman et al. 2009). Even with this extraordinary amount of diversity freshwater fishes and their ecosystems are one of the most threatened in the world (Ward 1998; Malmqvist and Rundle 2002; Dudgeon et al. 2006). There are many causes for the decline in biodiversity of freshwater fishes, including: habitat loss and degradation, habitat fragmentation, invasive species, overexploitation, secondary extinctions, chemical and organic pollution, and climate change (Allen and Flecker 1993;

Fahrig 2003). Invasive non-native fish compete within trophic level, hybridize with native fish, use spawning habitat of native fishes, and can directly consume native fishes

(Allen and Flecker 1993; Rahel 2000; Poff et al. 2007). Habitat fragmentation in lotic ecosystems can have an adverse effect on the amount of genetic diversity that is maintained within fishes. Not only does fragmentation disrupt migratory fish from reaching their spawning grounds and disrupt metapopulation dynamics among populations (Allen and Flecker 1993; Willson and Halupka 1995), but it can also lead to a loss of genetic diversity in populations due to isolation, smaller habitats, and lower recruitment (Neilsen et al. 1997; Alo and Turner 2005).

Freshwater fishes living in desert aquatic ecosystems are one of the most threatened groups of organisms. Of all the fish species on the United States Endangered

2

Species List, the majority live in desert aquatic environments (Ono et al. 1983). Desert fishes are typically restricted to small, isolated areas with limited amounts of surface water which originate from springs supplied by water from aquifers. Due to increasing human populations in the southwest deserts of North America water demand for agriculture, industrial, and consumptive purposes have greatly increased habitat loss and fragmentation, as well as the introduction of non-native species into these unique and isolated desert aquatic ecosystems (Ono et al. 1983; Williams et al. 1985).

The Moapa dace (Moapa coriacea), the only species of the Moapa genus, is a thermophilic cyprinid endemic to the headwaters of the Muddy River, Clark County, in southern Nevada. It was first collected and described in 1938 in the upper reaches of the

Muddy River, (Hubbs and Miller 1948). Historically, Moapa dace has had an incredibly restricted distribution of around 16 kilometers of stream habitat in the main stem of the upper Muddy River and its many tributaries, which originate as geothermal springs (Ono et al. 1983). When first discovered by Hubbs and Miller (1948) Moapa dace were abundant but only inhabited the upper reaches of the Muddy River and its geothermal tributaries (i.e. Warm Springs area), in water varying from 26 to 32 degrees Celsius along with another native thermophilic fish, the Moapa White River springfish (Crenichthys baileyi moapae).

The Muddy River originates from more than 20 springs within a two kilometer radius in the Warm Springs area of the Moapa Valley in the Mojave Desert (Scoppettone et al. 1998) and contains 28 at-risk or rare species including ten rare and one endangered endemic aquatic species (USFWS 1995). The Muddy River is one of the remnants of

3

Pluvial White River, which drained the majority of southeastern Nevada during the late

Pleistocene Epoch (Wisconsin Glacial Episode, 85,000 – 11,000 years ago) (Hubbs and

Miller 1948). Before the construction of the Hoover dam on the Colorado River and the creation of Lake Mead in 1936, the Muddy River was a tributary to the Virgin River which then joined the Colorado River (Hubbs and Miller 1948). Currently the Muddy

River flows into the Overton Arm of Lake Mead.

Because the Muddy River system is a rare oasis in the Mojave Desert, the river has been greatly altered by humans. Portions of the Muddy River are diverted for irrigation use and for human consumption, including the water source for a coal-fired power plant. In the past, spring sources of the Muddy River were pooled for recreation purposes or capped and diverted or pumped for irrigation and consumption. Spring-fed tributaries were excavated and replaced with concrete channels (Gary Scoppettone, personal communication). The riparian corridor of the Muddy River system has been invaded by non-native vegetation including fan palm (Washingtonia filifera) in the Warm

Springs area and tamarisk (Tamarisk sp.) on the lower sections of the Muddy River

(Scoppettone et al. 1998). The Western mosquitofish (Gambusia affinis) was the first recorded non-native fish in the Warm Springs area (Hubbs and Miller, 1948). Shortfin mollies (Poecilia Mexicana) were introduced in the 1960’s (Deacon and Bradley 1972).

Since their introductions, western mosquitofish and shortfin mollies have established themselves throughout the entire system but are in higher densities in the spring-pools and headwaters of the Warm Springs area, typically where the native species Moapa dace and springfish co-occur (Deacon and Bradley 1972). Since its discovery the Moapa dace

4 population has declined dramatically. In a survey conducted between 1964 and 1968

Moapa dace were found in very low numbers in only two of three transects sampled within the Warm Springs area (Deacon and Bradley 1972). Due to loss of habitat and drastic declines in population numbers the Moapa dace was listed as an endangered species under the United States Endangered Species Act on March 11, 1967 (U.S.

Department of the Interior 1967).

In 1979 and subsequent years the United States fish and Wildlife Service purchased land within the Warm Springs area where three geothermal springs (Apcar,

Pederson, and Plummer) originate, making the first wildlife refuge (Moapa Valley

National Wildlife Refuge, MVNWR), solely for protection of an endangered fish

(USFWS 1995). Farther downstream and where springs form the Muddy River, land was purchased by the Southern Nevada Water Authority (SNWA) in 2007 and is managed for the protection of native organisms as well as for protecting the headwaters of the Muddy

River where SNWA owns and leases water rights (Southern Nevada Water Authority

2011). In a range wide snorkel survey in 1987 the population of Moapa dace was estimated at 2,800 (Scoppettone et al. 1992). In 1994, 3,841 adult Moapa dace were counted but this number dropped drastically in 1997 to 1,565 adults following an invasion of a non-native fish (Scoppettone et al. 1998). In 1995 blue tilapia (Oreochromis aureus), a fish native to Asia, was first noticed in the Warm Springs area after a diversion dam was removed downstream, this was followed by a sharp decline in native fishes which were being consumed by blue tilapia (Scoppettone et al. 1998; Scoppettone et al.

2005). This prompted immediate action to remove blue tilapia from a portion of the

5

Warm Springs area (Apcar, Pederson, and Plummer tributaries) and create a gabion barrier to prevent further invasion (Gary Scopppettone, personal communication). While these actions successfully removed blue tilapia from three tributaries and prevented further upstream movement by blue tilapia, Moapa dace are now restricted to a small portion (2.8 km) of their historical (16 km) stream habitat which is disconnected from the main stem of the Muddy River.

Recently the tributaries where Moapa dace currently occur (Apcar, Pederson, and

Plummer) have been restored to free flowing streams from backed up marshes due to barriers, concrete channels, and cemented pools. Stream rehabilitation on the upper

Pederson tributary began in the mid-1980s, and in 2008 the lower portion was re-routed from a marsh connected to the Plummer tributary to the historical route and now discharges into the Apcar tributary. In 2007, the Plummer tributary was restored on the

MVNWR property. In 2009, the Apcar tributary on the MVNWR was restored. During this study the middle portion of the Apcar tributary, located on the SNWA property was restored to increase flows and improve Moapa dace habitat following a fire and was completed in August 2011 (Dave Syzdek, SNWA, personal communication).

Moapa dace are threatened by both historic and current habitat alterations which have potentially eliminated access to spawning, nursery, and foraging habitats (USFWS

1995). Future water withdrawal and pumping of the aquifer also have the potential to decrease available habitat and increase habitat fragmentation (Hatten et al. 2013). Factors that drive species to extinction in fragmented landscapes include environmental and demographic stochasticity, increased habitat degradation, and loss of genetic variation in

6 small isolated populations (Davies et al. 2001). Understanding how fragmentation of once interconnected stream systems can negatively affect lotic fishes is becoming increasingly important especially at the landscape scale as fragmentation reduces home range size, therefore restricting fish movement which may reduce foraging options and access to spawning habitats (Allen and Flecker 1993; Fausch et al. 2002).

The amount of habitat needed and ability to move within that habitat is crucial in determining conservation goals of endangered species (Turchin 1998; Moyle and Sato

1991). The ability of an individual to move within its habitat plays an important role in fulfilling its life history, avoiding predators, and maintaining gene flow throughout a population (Schlosser 1995; Hanski 1998; Fausch et al. 2002). Because stream fish are likely to be affected by habitat fragmentation much research has focused on understanding movement dynamics and home range size of a wide variety of fish species

(Gerking 1959; Gowan et al. 1994; Schlosser and Angermeier 1995; Skalski and Gilliam

2000). Stream fish demonstrate considerable variation in these parameters (Hill and

Grossman 1987; Smithson and Johnston 1999; Alldredge et al. 2011), where fish size and shape of habitat (Lonzarich et al. 2000; Woolnough et al. 2009), season (Modde and

Irving 1998; Sweet and Hubert 2010), as well as habitat connectivity (Albanese et al.

2004; Walker et al. 2013) can influence how organisms use the habitat and whether the habitat is adequate to fulfill life history needs. Even though a recovery plan has been established for Moapa dace (USFWS 1983), a study to determine its home range and movement behaviors has not been conducted throughout its current range.

7

Understanding the relationship between food resources and growth in intact and altered ecosystems may shed light on life history requirements and therefore aide in conservation actions for declining populations (Wootton 1990). With a few exceptions, growth in fishes is indeterminate and variable, resulting in responses to environmental changes with changes in growth rates (Wootton 1990). Abiotic environmental factors that affect growth in fishes include: temperature, light, salinity, and oxygen; biotic factors that affect growth are food availability, size of individual, intraspecific and interspecific competition (Brett 1979). Growth in fishes is typically quantified by measuring body length or weight of individuals over time, and the relationship of these two measurements

(body condition) can be quantified to determine the well-being of an individual assuming that heavier fish of a given length are in better condition (Ricker 1979; Bolger &

Connolly 1989; Wootton 1990). Differences in body condition and growth rates among individuals in populations living under similar or different habitats may indicate changes in feeding behavior or food supply directly due to habitat differences (Bolger & Connolly

1989). Previous studies investigating the life history of Moapa dace have demonstrated that female fecundity increases with length and adult length varies depending on the water volume. Larger fish occupy larger water volumes such as the main stem of the

Muddy River and smaller individuals are found in the lower volume tributaries

(Scoppettone et al. 1992).

The goals of this study were to determine: 1) home range size of Moapa dace, 2) whether home range density and location of home ranges differed among years, 3) whether home range size varied among tributaries or among years, 4) if there is a

8 relationship between the location of an individual’s home range and home range size, 5) whether Moapa dace demonstrate directional bias in movements both seasonally and yearly, and among tributaries and if there was a difference in the length of these movements, 6) differences in growth rates among size classes and seasons, 7) seasonal differences in body condition, 8) and whether there were differences in growth rate and body condition among individuals with differing home range sizes.

This study was part of a larger research project investigating survival and population dynamics of Moapa dace using a bi-monthly, random-stratified, mark- recapture methodology. Individual Moapa dace were capture using minnow traps from

October 2009 to September 2012. Because Moapa dace rarely exceed 12 cm in total length (Scoppettone and Goodchild 2009) traditional methods of tagging were not used, instead genetic tagging methods using ten polymorphic microsatellite loci were used to identify individuals from caudal fin tissue samples. Genetic tagging has been successful at identifying unique genotypes of individuals in humpback whales (Megaptera novaeangliae) (Palsbøll et al. 1997), black bears (Ursus americanus) (Woods et al. 1999;

Peacock et al. 2011), brown bears (Ursus americanus) (Woods et al. 1999), and common dace (Leuciscus leusciscus) (Andreou et al. 2012).

METHODS

Study site

Historically the Muddy River (Clark County, Nevada) was 48 kilometers long before it discharged into the Virgin River (Hubbs and Miller 1948), currently it flows 40

9 kilometers before terminating in Lake Mead which was formed after construction of

Hoover Dam in 1936 (Fig 1). The average temperature of the thermal springs in the headwaters of the Muddy River that form the Warm Springs area is approximately 32 °C, with average daily temperature decreasing as water moves downstream, the opposite of typical stream hydrology (Fig 2, Table 1). Turbidity increases as water moves downstream from the headwater springs. Water discharge at the spring sources stay relatively constant but water volume increases downstream due to input from other springs. Downstream water discharge can fluctuate due to water withdrawal and precipitation events. During this study, daily average water discharge at the confluence of all spring sources in the Warm Springs area was 1.05 - (SD ± 0.11) (USGS, stream gage 09416000) and daily average water discharge of the Muddy River into Lake Mead was 0.74 - (SD ± 0.73) (USGS, stream gage 09419507).

Upland vegetation along the Muddy River and surrounding valley historically consisted of: shadscale (Atriplex confertifolia), greasewood (Sarcobatus vermiculatus), mesquite (Prosopis sp.), quail brush (Atriplex lentiformis), arrowweed (Pluchea sericea), and riparian vegetation included willow (Salix sp.), cottonwood (Populus sp.), grasses, and forbs (Carpenter 1915). During this study riparian vegetation consisted of bulrush

(Schoenoplectus acutus), cattails (Typha sp.), yerba mansa (Anemopsis californica), ash

(Fraxinus velutina), cottonwood (Populus fremontii), arrowweed (Pluchea sericea), mesquite (Prosopis sp.), and grasses. Non-native fan palm (Washingtonia filfera) densely lined stream channels in the study area prior to 2011 when they were mostly removed after a fire in the summer of 2010. Non-native tamarisk (Tamarisk sp.), which has

10 invaded the lower sections of the Muddy River, is sparse in the study area and is actively being removed. The invasive macrophyte eel grass (Vallsneria sp.) is common on the

Warm Springs Natural Area (WSNA) portion of study site.

The Muddy River is inhabited by ten rare and endemic aquatic species: Moapa dace (Moapa coriacea), Moapa White River springfish (Crenichthys baileyi moapae),

Virgin River chub (Gila seminuda), Moapa speckled dace (Rhinichthys osculus moapae),

Moapa pebblesnail (Pyrgulopsis avernalis), grated tryonia (Tryonia clathrata), Moapa riffle beetle (Microcylloepsis moapus), Moapa Warm Springs riffle beetle (Stenelmis moapa), Moapa naucorid (Limnocoris moapensis), and a water strider (Rhagovelia becki)

(USFWS 1995). During this study Moapa dace and Moapa White River springfish were the only native fish species caught. Invasive aquatic organisms include a freshwater snail

(Melanoides sp.), western mosquitofish (Gambusia affinis), which were present when

Moapa dace were discovered in 1938 (Hubbs and Miller 1948), shortfin molly (Poecilia mexicana) established in the 1960’s (Deacon and Bradley 1972), and blue tilapia

(Oreochromis aurea), which invaded the Warm Springs area in 1995, but were removed from study area (Apcar, Pederson, and Plummer tributaries) in 1998 (Scoppettone et al.

2005). Current efforts are underway to remove blue tilapia from the rest of the Warm

Springs area.

Moapa dace are currently limited to the Apcar, Pederson, and Plummer tributaries in the Warm Springs area and their confluence due to a gabion barrier that isolates these tributaries from the main stem of the Muddy River (Fig 3). The Apcar spring

(114°43’8.627”W 36°42’52.955”N), which flows 1,143 meters before discharging into

11 the Plummer tributary, had an average discharge of 0.0415 - (SD ± 0.007), an average temperature of 32.47°C (SD ± 0.16), pH of 7.47, and dissolved oxygen of 6.33 mg - during the study. The Pederson spring (114°42’56.595”W 36°42’33.573”N) flows 703 meters before discharging into Apcar (550 meters downstream from the Apcar spring), had an average discharge of 0.005 - (SD ± 0.0008) (USGS, stream gage

09415908), an average temperature of 31.93°C (SD ± 0.56), pH of 6.97, and dissolved oxygen of 2.92 mg - . Pederson contains two barriers to fish upstream movements located 340 and 565 meters downstream of the springhead. The stream reaches that are upstream of these barriers are the only reaches within the study site that do not contain non-native fish species. Plummer spring (114°42’46.608”W 36°42’36.665”N) flows 612 meters before joining the Apcar tributary. Discharge at the Plummer spring was 0.041

- , average temperature 32.10°C (SD ± 0.48), pH of 7.15, and dissolved oxygen of

2.39 mg - . Another spring with an average temperature of 32.03°C (SD ± 0.55) and volume of 0.055 - connects to the Plummer tributary 185 meters downstream from the Plummer spring source. At the confluence of Plummer and Apcar (114°42’29.347”W

36°42’44.608”N) the average flow increased to 0.376 - , average temperature was reduced to 30.30°C (SD ± 1.29), pH increased to 7.6, and dissolved oxygen increased substantially to 6.39 mg - . After the confluence the stream travels an additional 275 meters before it reaches the gabion barrier and the main stem of the Muddy River. Stream velocity is drastically reduced in this reach due to the backup of water behind the gabion barrier. Warm Springs Road intersects all three tributaries and culverts are used to pass water under the road (Fig 3). Prior to this study a potential culvert barrier to fish movement was removed at the bottom of the Plummer tributary at the confluence with

12 the Apcar tributary. Total length of available habitat for Moapa dace is 2,792 linear stream meters. A summary of in-stream habitat characteristics quantified during this study can be found in Table 1.

Sampling methods

From October 27, 2009 to September 15, 2012 fishes in the Warm Springs area of the headwaters of the Muddy River were sampled using a stratified random sampling approach (Fig 3). Fishes were sampled in streams above the gabion barrier on the Apcar,

Pederson, and Plummer tributaries located on the Moapa Valley National Wildlife

Refuge (MVNWR) and the Warms Springs Natural Area (WSNA) properties (Fig 3).

Sampling stations were created using ArcMap 9.3 (ESRI 2009) and National Agriculture

Imagery Program (NAIP, USDA) photos. Actual station locations were corrected in the field by measuring stream distance between stations. Station coordinates (DD NAD83) were recorded using Garmin© etrex® handheld global positioning system (GPS) devices with an accuracy of ± 2 meters. Each sampling station location was marked on the bank next to the stream so that subsequent sampling could be within ± 1 meter. Sampling stations were located 25 meters apart, starting at the springheads, except for two of the tributaries (Apcar and Plummer), where stations were 5 meters apart in the upper most sections located on the MVNWR property between March 2010 and September 2012. Six stations, not included in the stratified random design, were created where it was thought that the probability of catching Moapa dace would be high, three of these stations were located on the MVNWR side of the Pederson tributary and three were located on the

WSNA side of the Plummer tributary. The total number of stations sampled was 120

13 between October 2009 and January 2010 and 164 between March 2010 and September

2012.

Stations were sampled (± 1 meter) bi-monthly (November, December, March,

May, July, September) with two capture occasions per sampling bout, resulting in 18 sampling periods and 36 sampling occasions. Fishes were caught using ¼ inch mesh Gee brand standard minnow traps baited with dry dog food (1.5 – 3.0 grams). Traps were set overnight (24 hours) except in Pederson and Plummer tributaries (5 hours) where warmer water temps limited the amount of time fish can safely be trapped. Fish caught in traps were then identified to species and enumerated. Ten random samples per trap of species other than Moapa dace were measured to total length (due to structure of caudal fin).

Non-native fishes captured were removed from the system. All Moapa dace captured were measured to fork length, weighed (wet weight) to the nearest one-hundredth of a gram using a OHAUS® Scout Pro SP402 scale (only between November 2010 and

September 2012) and a small sample of the caudal fin was collected (~2 ) with sterile scissors and stored in an Eppendorf tube with at least 1 ml 95% ethanol (between October

2009 and March 2011) or between wax paper in coin envelopes (between May 2011 and

September 2012) and stored at room temperature for further molecular analysis.

Individual Moapa dace were then released into the stream at capture locations. Traps were re-set within one to three days later and the preceding steps were repeated.

Genetic tagging

Moapa dace fin clips stored in 1.5 ml Eppendorf tubes with 95% ethanol were difficult to remove, therefore the tubes were opened overnight and the ethanol was

14 allowed to evaporate, leaving the clip in the Eppendorf tube. DNA extractions were done using QIAGEN® DNeasy® 96 tissue extraction kits by adding 180 μl of buffer ATL tissue lysis buffer and 20 μl of proteinase K to each sample and allowing the solutions to incubate at 56°C for 12 hours. Four hundred and ten μl of a 1:1.05 solution of buffer AL and 100% ethanol were then added to each sample prior to transfer to a DNeasy® 96 plate. Extractions were carried out according to the manufacturer’s protocol. Samples were eluted by adding 75 μl of warm (56°C) buffer AE and incubating at room temperature (20-25°C) for five minutes and centrifuged for two minutes at 6,000 rpm.

This process was repeated one more time for a total elution of 150 µl. Total genomic

DNA was quantified using a fluorescent nucleic acid stain (PicoGreen®) and a

Labsystems Fluoroskan Ascent fluorescence plate reader. Extracted DNA was diluted to equal 1-30 ng - . DNA extracted from fin clips stored in wax paper in envelopes was conducted similarly to those stored in ethanol except that the clips were removed from the wax paper and placed directly in the elution microtubes provided by the manufacturer prior to extraction.

Individual genotypes were obtained at 10 polymorphic microsatellite loci (Table

2). Six primers (Lce-C1, LleB-072, Lsou08, LleC-090, BL1-2b, Lsou05) used to amplify loci in Moapa dace were originally developed from European dace (Leuciscus leuciscus;

Debut et al. 2009), two primers (Gbi-G34 and Gbi-G39) were developed for Lahontan tui chub (Gila bicolor obesa; Meredith and May 2002), Gel_223 primer was developed for bonytail chub (Gila elegans; Keeler-Foster et al. 2004), and Gila-D17 primer was developed for roundtail chub (Gila robusta; Dowling et al. 2008). Allele numbers varied

15

from 6 - 23 per locus and expected heterozygosity ( ) varied from 0.25 – 0.91 (Table 2).

All microsatellite primers were ordered with M13 tails to allow for combinations of multiple loci during polymerase chain reaction (PCR) as suggested by Shuelke (2000).

Each primer mixture consisted of 25 μl of tailed forward primer, 75 μl of reverse primer,

25 μl of M13 fluorescently labeled primer, and 125 µl of molecular grade water.

Fluorescently labeled M13 primers were ordered with NED, VIC, or FAM (Applied

Biosystems). Samples were combined into five multiplex PCR reactions including 1 - 4 loci per each 12 µl reaction. PCR cycle parameters include a 15 minute hot start at 95°C, followed by 41 cycles of 95°C for 30 seconds, a touch-down annealing temperature for

90 seconds, and 72°C for 30 seconds. The touch-down annealing temperatures for each

PCR stage were 65°C for 7 cycles, 61°C for 7 cycles, 58°C for 7 cycles , and 20 cycles at

55°C in which the first 21 cycles are amplifying the specific primer and the final 20 cycles are adding the fluorescently labeled M13 primer to the PCR product. TECHNE®

Touchgene Gradient Thermal Cyclers with 96 well plate formats were used for all PCRs.

Fragment analysis was conducted on two panels, one panel contained LleB-072, Lce-C1,

Lsou08, LleC-09, Gbi-G34 and the other contained Gel_223, gila-D17, BL1-2b, Gbi-G39, and Lsou05. Ten µl of formamide, 5.0 µl of DI water, and 0.05 µl of GeneScan™ 500

LIZ™ Size standard were added to each PCR product. Fragment analysis was carried out on a Perkin Elmer Applied Biosystems 3730 Genetic Analyzer (Nevada Genomics

Center, http://www.ag.unr.edu/genomics/) and all alleles were scored using ABI

GeneMapper® software (version 3.7). Number of alleles, expected heterozygosity (He), observed heterozygosity (Ho), and allelic richness (RS) were calculated for each locus using program Fstat (version 2.9.3.2).

16

To identify individuals using multilocus microsatellite genotypes I used the program GENECAP version 1.4 (Wilberg and Dreher 2004). GENECAP is an executable macro within Microsoft Excel® which compares each multilocus genotype with all other genotypes in the dataset to identify matching samples (Wilberg and Dreher 2004). The program calculates probability of identity (PI), allele frequencies, and match probabilities while also accounting for missing data as a result of poor DNA quantity or quality. To account for the chance that two individuals sharing the same genotype leading to a false match, the conservative method of calculating the probability that two individuals are siblings ( ) was used and set at a threshold of 0.05 (Woods et al. 1999; Andreau et al.

2012).

Genotypes with loci that contained ambiguous amplification were excluded in the analysis. Samples that contained less than five amplified loci were removed from the analysis to reduce errors in matching individuals based on suggestions by Paetkau (2004) and confirmed in a study on teleosts by Andreau et al. (2012). Analysis was performed to account for errors in genotypes of samples taken from the same individual, which can lead to an excess of individuals (Taberlet et al. 1996; Taberlet et al. 1999; Woods et al.

1999; Miller et al. 2002; Paetkau 2003; McKelvey & Schwartz 2004; Paetkau 2004). To identify these potential problem samples I used GENECAP to identify individuals that differed by one allele, the traces for these samples were then scrutinized in

GeneMapper® (Applied Biosystems) for potential allelic drop out or genotyping errors by two observers and corrections were made if necessary or samples were removed from further analysis. This process was repeated until genotyping errors or allelic drop out

17 could no longer be detected. Samples with matching genotypes were given a unique identification which was used to analyze home range, spatial dynamics, and growth of individuals over the study period.

Stream characteristics

Stream width (cm) and thalweg depth (cm) were measured at capture locations in

2010 and averaged within 100 meter reaches. Stream discharge ( - ) data was collected at strategic locations (above and below water inputs) on March 18, 2012 using a

Marsh McBirney Model 201 portable water current meter and calculated using the USGS midsection method (Rantz et al. 1982). Stream temperature (°C) was collected at 20 locations, including the spring sources and above and below confluences of tributaries, and recorded every 15 minutes using Thermoworks® Precision RTD Data Loggers® from August 9, 2011 to August 8, 2012.

Home range analysis

Home range length for individual Moapa dace was quantified as the difference between the most upstream capture and the farthest downstream capture of an individual

(Young 1996). To determine any changes in the amount of stream habitat occupied by

Moapa dace over the course of the study given ongoing habitat restoration, home range density for each year was calculated using the line density tool in the Spatial Analyst extension in ArcGIS 10.0 (ESRI 2011). Home range density was calculated as the number of lines within a five meter search radius and represented as a value of lines per square-meter. Only individuals with a home range equal to or greater than 25 m were used in the analysis to account for unequal trapping densities within the study area.

18

Differences in home range size were analyzed among years (2010, 2011, and 2012) and among tributaries (Apcar, Pederson, and Plummer) as described above except with the section below the most downstream barrier on Pederson considered to be a part of the

Apcar tributary due to its lack of connectivity with the upper portions of the Pederson tributary. Individuals that had a home range equal to or greater than five meters were used in the analysis to investigate differences in home range length among years (2010,

2011, and 2012). To account for different trap densities in the study only individuals with a home range length equal to or greater than 25 meters were used in the analysis of home range length among tributaries. Home range length data did not meet the assumptions of parametric tests; therefore, a Kruskal-Wallis one-way ANOVA test (α = 0.05) was used to test for yearly differences in home range size as well as differences among tributaries

(Sokal and Rohlf 1995). All data analysis was completed using program R version 2.15.1

(R Core Team 2012).

To test whether location (distance downstream) within a stream influences home range size the centroid of home ranges was calculated for each individual and the distance from the corresponding springhead was measured (m). Linear regression was used to analyze the relationship between an individual’s centroid distance from the springhead (m) and the entire length of their home range (m). Only fish that had home ranges equal to or larger than 25 m were analyzed to account for unequal trap densities in the upper reaches of Apcar and Plummer tributaries. Analysis was performed on individuals within each tributary (Apcar, Pederson, and Plummer) to examine the effect

19 of tributary on home range size. Both home range length and centroid distance were log transformed to normalize the data.

Spatial dynamics

To determine movement distributions of Moapa dace data for all individuals that were captured twice and within consecutive sampling periods (~60 days between captures) were used to test whether there were seasonal, yearly, or among tributary differences in movement distributions in terms of both number of moves upstream versus number of moves downstream and median distance moved. A test was used to compare the number of individuals that moved downstream to those that moved upstream and a Mann-Whitney U test was used to compare the median distance travelled by individuals that moved downstream to the median distance by those that moved upstream.

Growth

To determine differences in growth rates among size classes (FL, mm; 21-30, 31-

40, 41-50, 51-60, 61-70, 71-84) and among seasons data on all individuals that were captured twice and within consecutive sampling periods (~60 days between captures) were used. Growth rates were also compared among individuals that occupy the three different tributaries (Apcar, Pederson, and Plummer). Only adult (FL > 40 mm) individuals were used in the analysis of growth rates among seasons and tributaries to account for greater growth rates observed by juveniles. In the rare case that an individual was caught in more than one tributary (7 individuals) the individual was assigned to the

20 tributary where it was captured the majority of the time, or if equally caught in more than tributary it was assigned to the tributary it was last caught in. Growth rates were calculated as:

( )( ) ,

where is length (FL, mm) at sample occasion . Growth rates between seasons and tributaries were compared using a Kruskal-Wallis one-way ANOVA (α = 0.05) because data did not meet the assumptions of parametric tests.

Body condition was calculated using Fulton’s condition factor (K) which is calculated as

, where is weight (g) and is fork length (mm) of an individual when it was captured

(Bolger and Connolly 1989). Only fish caught between November 2010 and September

2012 were weighed therefore body condition was only calculated for these individuals.

Mean body condition was calculated for every month so differences in seasonal body condition could be observed. Mean body condition was also compared between individuals that occupy the three different tributaries (Apcar, Pederson, and Plummer). A one-way ANOVA (α =0.05) was used to test for monthly and tributary differences in body condition.

To determine if there was difference in growth rates ( ) between fish that move and fish that do not move the difference in fork lengths of the last and first

21 captures of an individual was divided by the number of days between the first and last capture and compared between the two behaviors. To determine if there was a difference in body condition between fish that move and fish that do not move the calculated body condition of each individual was averaged from each capture and compared between the two behaviors. “Movers” were considered to be individuals that have a home range equal to or larger than 25 m while “stayers” were considered to be fish that had home ranges less than 25 m for the duration of the study. A t test was used to determine if there was a significant difference in body condition between “movers” and “stayers.” Because growth data did not meet the assumptions of parametric tests a Mann-Whitney U test was conducted to determine significant difference between “movers” and “stayers.”

RESULTS

The number of Moapa dace alleles amplified per locus ranged from 6 to 22 with an average of 13.9 (SD ± 6.3) alleles per locus. Expected heterozygosity (He) per locus ranged from 0.25 to 0.91 with an average of 0.72 (SD ± 0.21) per locus. Observed heterozygosity (Ho) per locus ranged from 0.25 to 0.91 with an average of 0.64 (SD ±

0.23) per locus. Allelic richness (Rs) per locus ranged from 3.57 to 18.93 with an average of 10.50 (SD ± 5.37) per locus. There were no departures from Hardy-Weinberg equilibrium (Table 2).

A total of 3,940 Moapa dace were captured with a mean fork length of 50.8 mm

(SD ± 11.32) during this study. There was a yearly increasing trend in total Moapa dace captures with 807 in 2010, 1404 in 2011, and 1729 in 2012. The number of Moapa dace captured in the Apcar tributary more than doubled from 2011 to 2012 (Table 3). Moapa dace were captured in the greatest quantity in the Plummer tributary, followed by Apcar.

22

During this study 3,204 Moapa dace fin clip samples were successfully genotyped resulting in 1,590 unique individuals with an overall average capture rate of 2.02 (SD ±

1.77) per individual and an average capture rate of 3.47 (SD ± 1.99) for those individuals caught more than once. Springfish were the most abundantly captured fish and captures increased yearly, with a total capture during the study of 121,678 and a mean total length of 40.8 (SD ± 9.7). Shortfin molly captures increased from 2010 to 2011 but decreased in

2012, with a total capture during the study of 76,235 and a mean total length of 39.5 mm

(SD ± 10.1), while mosquitofish captures increased yearly, with a total capture during the study of 28,441 and a mean total length of 36.3 mm (SD ± 7.8) (Table 3).

All three tributaries demonstrate a downstream increasing trend in width (cm) and thalweg depth (cm) from their spring source. The Plummer tributary had the greatest increase in width and depth followed by Apcar. Pederson tributary had the smallest width and depth with 200 cm (SD ± 50.00) and 42 cm (SD ± 21.53) respectively at its confluence with Apcar. All three tributaries also demonstrate a downstream increasing trend in stream discharge ( - ) from the spring source, however, the Apcar spring source has the greatest water discharge at 0.081 - followed by the Plummer spring source. Average water temperature decreases as water moves from the spring source in all three tributaries, however, temperature variation and the maximum temperature recorded increases while the minimum temperature recorded decreases as water moves downstream from the spring sources due to the greater influence of air temperature during the coldest and warmest days of the year (Table 1). Average monthly water temperature of the entire study area changed seasonally with the highest being in the month of August and the lowest in December (Fig 4).

23

Home range

Home range density and amount of habitat occupied by Moapa dace increased over the course of the study. In 2010 home range density was the lowest and Moapa dace distribution the most restricted. Home range density increased in both the Plummer and

Apcar tributaries from 2010 to 2011. The amount of stream habitat used in the Pederson tributary also increased from 2010 to 2011but remained restricted due to barriers. Stream habitat used and home range density in the Apcar tributary increased from 2011 to 2012 including the area where stream restoration was completed in August of 2011. Stream habitat in the lower reach of Apcar and at the confluence with the Plummer tributary that was not occupied in 2010 or 2011 was occupied in 2012 indicating movement between the two tributaries (Fig 5).

The mean home range size (m) for Moapa dace over the entire study period was

109.8 (SE ± 6.15). Mean home range size was lowest in 2010 (n = 65, = 86.8, SE ±

14.1), increased in 2011 (n = 237, = 88.1, SE ± 6.4), and was highest in 2012 (n = 210,

= 141.3, SE ± 12.1). The mean ranks of home range length were significantly different among the three years (Kruskal-Wallis: H = 8.806, df = 2, P = 0.012) (Fig 6). Moapa dace had the smallest home range length in the Pederson tributary (n = 36, = 70.5, SE ±

8.3), followed by Plummer (n = 219, = 121.5, SE ± 8.4), and was highest in the Apcar tributary (n = 118, = 215.2, SE ± 16.5) and the mean ranks of home range length were significantly different between the three tributaries (Kruskal-Wallis: H = 40.221, df = 2,

P < 0.001) (Fig 7).

Apcar and Plummer tributaries both showed positive relationships between the distance an individual’s home range was from the springhead and total home range length

24

( = 0.483, F = 94.38, P < 0.001 and = 0.331, F = 101.0, P < 0.001) respectively.

The fragmented Pederson tributary showed no relationship with home range distance from springhead and home range length ( = -0.016, F = 0.448, P =0.507) (Fig 8).

Spatial dynamics

Directional bias in movement was evident in only one seasonal interval when years were combined. Between September to November individuals showed a downstream movement bias ( = 9.31, df = 1, P = 0.002). Overall analysis of directional bias within years and within systems, however, did not reveal a bias in direction of movement ( test: P > 0.05). Median distance traveled upstream and downstream did not differ amon seasonal intervals or among years for the entire system (Mann-Whitney

U test: P > 0.05). However, individuals captured in the Apcar tributary tended to move upstream (79.5 meters) for a greater distance than those that moved downstream (40.8 meters) between consecutive captures (Mann-Whitney U test: U = 1,727, P = 0.001).

Individuals captured in the Pederson and the Plummer tributaries showed no difference in median distance travelled upstream versus downstream (Mann-Whitney U test: P > 0.05).

Growth

Moapa dace growth rates varied substantially across size classes. The smallest size class (21-30 mm) had the highest growth rate with a mean value of 0.170 mm

(SE ± 0.029). Individuals in the 31-40 mm size class had a mean growth rate of 0.075 mm

(SE ± 0.009). Adult individuals in the size classes 41-50, 51-60, 61-70, 71-84 mm each had similar growth rates but declined as fish became larger, with mean values of

0.035 (SE ±0.003), 0.021 (SE ± 0.002), 0.016 (SE ± 0.028), and 0.017 mm (SE ±

25

0.006) respectively (Fig 9). Adult Moapa dace growth rates also varied across seasons

(Kruskal-Wallis: H = 26.82, df = 5, P < 0.001) with the highest growth rate during May to July (n = 69, ̅ = 0.033, SE ± 0.004) and the lowest growth rate from September to

November (n = 60, ̅ = 0.015, SE ± 0.004) (Fig 10).

Body condition was greatest in July (n =212, ̅ = 1.129, SE ± 0.01) and lowest in

March (n =353, ̅ = 1.052, SE ± 0.01). There was a significant difference between the mean monthly condition factors (ANOVA: F = 16.57, df = 964.1, P < 0.001), however, there was no significant difference between May, July, September, and November and no significant difference between January and March (P > 0.05) (Fig 11).

Growth rate did not differ among the three tributaries (Kruskal-Wallis: H = 1.756, df = 2, P = 0.415). There was, however, a significant difference in body condition among tributaries with Apcar having the highest mean body condition of 1.120 (n = 177, SE ±

0.01), followed by Plummer with a mean body condition of 1.091 (n = 310, SE ± 0.01), and Pederson with a mean body condition of 1.076 (n = 70, SE ± 0.02) (ANOVA: F =

4.104, df = 2, P = 0.018).

There were significant differences in both growth rate and body condition between individuals classified as “movers” and “stayers.” The mean growth

( ) for “movers” was 0.037 (n = 429, SE ± 0.04) and 0.029

(n = 158, SE ± 0.04) for “stayers” (Mann-Whitney U-test: U = 27,667.5, P <

0.001). The mean body condtion was also signficantly different for “movers” (1.106, SE

± 0.01) versus “stayers” (1.077, SE ± 0.01) (t – test: t = 2.22, df = 247.2, P = 0.027).

26

DISCUSSION

This study focused on the remaining populations of the endangered Moapa dace which occupy a fraction of its historic range in three small tributaries. These three tributaries originate from geothermal sources and increase in size (depth, width, volume) as water moves downstream. Average water temperature decreases and becomes more variable as water moves downstream where it becomes increasingly influenced by air temperature. In fact, the highest and lowest recorded water temperatures during this study were observed at the most downstream location of this study due to the increased influence of air temperature and deceased influence of the geothermal sources. Non- native, invasive fishes (shortfin molly and mosquitofish) were prevalent throughout the study area but were in highest densities at the most downstream sampling locations that were located in habitat suitable for these invasive species due to water ponding behind a gabion barrier. Moapa White River springfish were the most abundant native fish and occurred at highest densities near the springheads. Annual Moapa dace captures increased throughout the duration of the study following similar trends of the bi-annual snorkel counts conducted by United States Fish and Wildlife Service, SNWA, and Nevada

Department of Wildlife (Lee Simons, USFWS, personal communication).

Restoration from a disturbed stream to a more natural hydrograph can have large effects on fish assemblages, decreasing non-native fish presence while increasing native fish abundance (Marchetti and Moyle 2001; Propst and Gido 2004; Scoppettone et al.

2005) and the response to this change can happen relatively quickly (Hill and Platts

1998). The home range density analysis demonstrated that Moapa dace were the most

27 restricted and had the lowest densities with the fewest captures in 2010. In 2011 home range density increased in the upper Plummer and Apcar reaches. Moapa dace immediately began occupying the middle reach of the Apcar tributary after restoration was completed in August 2011 at higher densities and in habitat previously not occupied where captures more than doubled. In 2012 Plummer tributary home range densities and captures decreased along with the first evidence of fish moving between Apcar and

Plummer suggesting that Moapa dace had moved from Plummer to the newly restored section of Apcar. The increase in habitat use and home range density in Apcar and the lower reaches of Pederson can be attributed directly to restoration efforts in which stream width was decreased and depth increased resulting in higher velocities.

Individual home range size can depend upon many biotic and abiotic factors

(Albanese et al. 2004). Overall stream length and degree of habitat fragmentation affects the ability of fish to move and therefore can affect home range size (Woolnough et al.

2009; Alexiades et al. 2012). Home ranges of organisms can increase if the distance between suitable habitats is large, requiring greater distance of movements between habitats. However, if the distance between habitats becomes too large and suitable habitat patches are small home ranges will be restricted due to the inability of an individual to travel the distance between suitable habitats (Weins 2001). It has also been suggested that the home range of individuals can increase when individuals move great distances in order to find suitable foraging sites, reduce competition, and to avoid predation (Ims and

Hjermann 2001; Gowan and Fausch 2002). Habitat fragmentation plays a large role in determining home range size in Moapa dace. In this study home range size of individuals

28 was largest in the Apcar tributary, the largest tributary, and smallest in the Pederson tributary, the most fragmented tributary. I observed a dramatic increase in home range size in 2012 as fish were able to expand into the newly restored habitat thereby decreasing densities in other parts of the stream system. The effect of fragmentation on home range size can also be seen in the relationship between home range size and distance from spring source. Apcar and Plummer tributaries both showed a positive relationship between home range size and distance from spring source, whereas no relationship was observed in the Pederson tributary. This is likely due to the two barriers in the Pederson tributary which function not only as barriers to upstream movement but are also effective in preventing downstream movement.

The only directional bias in movement was observed for individual fish caught from September to November in which there was a downstream bias. This behavior occurred when growth rates are at their lowest followed by an increase in growth rates from November to January. Downstream movement could be a response to sub-optimal forage in their upstream location due to seasonal variation in available forage as seen in other studies which have shown that steam-dwelling fish tend to move when forage in their present location become less optimal relative to other locations within their home range (Heggenes et al. 1999; Gowan and Fausch 2002).

It is common for fishes to show a decline in growth rates when they become reproductive adults, allocating more energy into gamete production (Ricker 1979;

Wootton 1990). Previous studies investigating the life history characteristics of Moapa dace have shown that females become reproductive when they reach the size of 40 mm

29

(fork length) (Scoppettone et al. 1992). When growth rates were compared among size classes in this study there was a dramatic decline in growth when fish reach 41 mm (fork length), supporting results from previous studies (Scoppettone et al. 1992; Scoppettone and Burge 1994). Growth rates of fishes will decrease or increase over short periods of time depending upon food availability, competition, season, and availability of nutrients for primary production (Ricker 1979; Wooton 1990; Beardsley and Britton 2012). Adult

Moapa dace demonstrate a similar seasonal pattern in growth rates, highest in the spring, as other fish species living in desert geothermal springs (Naiman 1976). The most striking pattern in adult Moapa dace seasonal growth rates is the rapid decrease in the summer months followed by an increase in the fall and winter months. It has been observed that water temperature and available light play a large role in determining growth rates in fishes (Huh et al. 1976; Lobón-Cerviá and Rincón 1998; Selong et al.

2001; Xu et al. 2010) and some fish species have an optimum temperature at which growth rates are maximized (McCormick et al. 1972, Dwyer and Piper 1987). Moapa dace growth rates increased between November and January indicating that photo-period is not the primary driver in determining growth rates for this species; instead this study suggests that water temperature plays a larger role. Because Moapa dace are poikilothermic stream temperatures strongly influence metabolic rates thus influencing growth rates (Brett 1971). Average water temperature in the study area was highest in

August and this was followed by a decrease in growth rates until the period of November to January when water temperatures became cooler indicating an optimum temperature for growth.

30

Moapa dace have two distinct periods of high and low body condition, the high being in the spring to fall months and low in the winter months. Differences in body condition have been shown to be associated with gonadal maturation and changes in feeding intensities (Wooton 1990). Moapa dace are known to be reproductive throughout the year but most reproduction occurs in the spring with the highest larval counts in the month of April (Scoppettone et al. 1992). Therefore, differences in body condition in

Moapa dace in this headwater system can be attributed to changes in feeding intensity most likely driven by the photoperiod. It is known that autotrophs play a major role in trophic dynamics in the headwaters of streams in arid and semi-arid climates (Naiman

1976; Minshall 1978) and that available light is the limiting factor in determining abundance of autotrophs (Vannote et al. 1980; Hill and Knight 1988). Studies manipulating light intensities in streams have demonstrated that the abundance of primary consumers increases in response to an increase in autotrophs due to more available light (Fuller et al. 1986; Wallace and Gurtz 1986). Moapa dace are known to be obligate drift feeders that primarily consume invertebrates (Scoppettone et al. 1992), thus the results of this study suggests that Moapa dace body condition is influenced by seasonal changes in primary production which invertebrates feed on which tends to be more variable at the extreme headwaters of arid streams.

Studies of wild fish in natural streams have shown that growth rates are positively correlated with the degree of movement (Martin-Smith and Armstrong 2002) and fish that are more mobile have a higher body condition (Shrank and Rahel 2006). Similarly the results of this study indicate that Moapa dace that are mobile have higher growth rates

31 and higher body condition than individuals that are sedentary. This could be a result of greater access to food resources for individuals that move more. However, mobility also allows an individual to occupy locations within the stream where water temperature is optimal for growth (Brett 1971; McCormick et al. 1972). Low body condition was observed in Pederson tributary where home range size was the smallest due to restricted movements of individuals caused by barriers which fragmented the stream habitat.

Individuals in the Apcar tributary showed the greatest mobility and had the largest home ranges and highest body conditions in the study area. The results of this study re- emphasize the importance habitat connectivity within the Warm Springs area as it relates to an individual’s ability to maximize its energy intake.

Management/conservation implications

This study demonstrates the importance of stream habitat connectivity within the

Warm Springs area of the upper Muddy River, Nevada. Moapa dace will re-establish themselves in stream sections that are restored to free flowing, high velocity habitats from marshes and backed up stream habitats due to barriers. Moapa dace are a highly mobile fish species that require long lengths of stream habitat to optimize their energy intake and to locate microhabitats where water temperatures are suitable for growth and reproduction. Climate change and water withdrawal from nearby aquifers are ongoing threats to this endangered species, especially in the headwater tributaries that Moapa dace are currently limited to. Previous research has shown that if water discharge from the spring-sources is decreased the amount of available habitat for Moapa dace will be greatly reduced in the headwaters of this ecosystem (Hatten et al. 2013). A reduction in

32 available suitable habitat for this species will most likely result in increased fragmentation between areas of suitable habitat causing an increase in the restrictions of home ranges of individuals thus reducing growth rates and body condition of Moapa dace.

The recovery plan for Moapa dace states that delisting of this species will be considered if 6,000 individuals are present in the five major spring systems in the upper

Muddy River for five consecutive years and spawning, nursery, and foraging habitat be available in 75 percent of its historical habitat (USFWS1995). These goals can be achieved if non-native tilapia are removed from other streams within the Warm Springs area permitting the removal of the gabion barrier separating the Apcar, Pederson, and

Plummer tributaries from the Muddy River. This study demonstrates that Moapa dace will quickly occupy stream reaches immediately following restoration activities so long as connectivity is maintained with current populations. Evidence from a wide range of drift-feeding fishes shows that increased stream flows are positively correlated to growth rates, mostly likely due to an increase in available forage (Sommer et al. 2001; Quist and

Spiegel 2012). Previous studies have shown that mean fork lengths of Moapa dace captured in the main stem of the Muddy River were significantly larger than those captured in the smaller Apcar tributary (78 mm and 51 mm respectively), similarly this study shows that Moapa dace inhabiting the smaller tributaries of the Muddy River continue to have small mean fork lengths (50.8 mm) (Scoppettone et al. 1986). Allowing

Moapa dace access to historical habitat in the Muddy River where temperatures are optimal for growth and where flows are higher will likely result in increased growth rates

33 and improved body condition. Due to the geothermal source of water in this system dissolved oxygen increases as water moves downstream, therefore allowing Moapa dace access to stream reaches further downstream could also improve growth rates due to the direct and indirect effects of dissolved oxygen on growth rates in fishes (Kramer 1987;

Wootton 1990).

While this study is informative on growth and movement dynamics of the current population of Moapa dace there are many aspects of this species’ life history and behavior that could not be addressed. Males and females could not be identified in the field due to a lack of obvious sexual dimorphism in this species. It is known that fishes can exhibit a sexual size dimorphism within species and that growth rates can be different between sexes due to differing life history strategies influenced by reproductive strategies. Differences in growth rates between sexes varies from species to species with some male salmonids having faster growth rates than females (Martin-Smith and

Armstrong 2002; Yamamoto 2004) while some female cyprinids demonstrate faster growth rates (Jeppson and Platts 1959; Osmundson 2006). Because this study could not differentiate sex, sex differences in growth rate for males and females could not be assessed. The few studies investigating sex-biased movement behavior in fishes have shown that movement behaviors vary depending on the life history of the species being studied. Kobler et al. (2012) found that female bullhead (Cottus perifretum), which have male parental care of offspring, moved further than males at the beginning of the reproductive period while males moved further than females at the end of the reproductive period. In other species of fish where mating systems do not involve male

34 parental care studies have shown that males are significantly more mobile than females depicting mating strategies in which males reduce mate competition, increase the number of mating opportunities, and decrease the probability that they will reproduce with related females by having larger home ranges than females (Hutchings and Gerber 2002; Croft et al. 2003; Marentette et al. 2011). Very little is known about the mating system of Moapa dace, but it is assumed that they are group spawners similar to other Cyprinidae fishes

(Pyron et al. 2013) and parental care is not provided. If this is the case it is then highly likely that this study under-estimates mobility and home range size of male Moapa dace and differences in specific seasonal movements of males and females could exist but were undetected in this study.

Future research and conservation efforts should focus on the spawning habitat requirements for adult and nursery habitat requirements for larval life stage Moapa dace.

Understanding the requirements of these critical habitats would allow for a prioritization of restoration activities throughout the Warm springs area. While this study investigated the relative distribution and abundance of non-native fishes it did not look into the effect of non-native fishes on Moapa dace and other native species. Future research should investigate how the abundance of shortfin molly and mosquitofish affect the distribution and survival of native organisms and how restoration of streams influences their abundance. Monitoring of Moapa dace should continue and when the gabion barrier is removed and the tributaries in this study are connected to the main stem of the Muddy

River extensive research should be focused on the distribution, spatial dynamics, and population dynamics of this species to investigate how Moapa dace utilize this

35 reconnected habitat. Ensuring that blue tilapia do not invade this system again is critical for the recovery of this species. Restoration and maintenance of newly restored areas should continue to promote the abundance of Moapa dace and should be focused on spawning, nursery, and foraging habitat to achieve the recovery goals for the delisting of this unique species.

36

LITERATURE CITED

Albanese, B., P.L. Angermeier, and S. Dorai-Raj. 2004. Ecological correlates of fish movement in a network of Virginia streams. Canadian Journal of Fisheries and Aquatic Sciences 61:857-869.

Alexiades, A.V., M.M. Peacock, and R. Al-Chokhachy. 2012. Movement patterns, habitat use, and survival of Lahontan cutthroat trout in the Truckee River. North American Journal of Fisheries Management 32:974-983.

Allan, J.D., and A.S. Flecker. 1993. Biodiversity conservation in running waters. BioScience 43:23-43.

Alldredge, P., M. Gutierrez, D. Duvernell, J. Schaefer, P. Brunkow, and W. Matamoros. 2011. Variability in movement dynamics of topminnow (Fundulus notatus and F. olivaceus) populations. Ecology of Freshwater Fish 20:513-521.

Alo, D., and T.F. Turner. 2005. Effects of habitat fragmentation on effective population size in the endangered Rio Grande silvery minnow. Conservation Biology 19:1138-1148.

Andreou, D., J. Vacquie-Garcia, J. Cucherousset, S. Blanchet, R.E. Gozlan, and G. Loot. 2012. Individual genetic tagging for teleosts: an empirical validation and a guideline for ecologists. Journal of Fish Biology 80:181-194.

Beardsley, H., and J.R. Britton. 2012. Contribution of temperature and nutrient loading to growth rate variation of three cyprinid fishes in a lowland river. Aquatic Ecology 46:143-152.

Bolger, T. and P.L. Connolly. 1989. The selection of suitable indices for the measurement and analysis of fish condition. Journal of Fish Biology 34:171-182.

Brett. J.R. 1971. Energetic responses of salmon to temperature: a study of some thermal relations in the physiology and freshwater ecology of sockeye salmon (Oncorhynchus nerka). American Zoologist 11:99-113.

Brett, J.R. 1979. Environmental factors and growth. In: Hoar, W.S., D.J. Randall, and J.R. Brett, editors. Fish Physiology: Volume VIII, Bioenergetics and Growth. New York, New York, USA: Academic Press. p 599-675.

Carpenter, E. 1915. Groundwater in southeastern Nevada. US Geological Survey Water- Supply Paper 365. 86 p.

37

Croft, D.P., B. Albanese, B.J. Arrowsmith, M. Botham, M. Webster, and J. Krause. 2003. Sex-biased movement in the guppy (Poecilia reticulata). Oecologia 137:62-68.

Davies, K.F., C. Gascon, and C.R. Margules. 2001. Habitat fragmentation: consequences, management, and future research priorities. In: Soule, M.E. and G.H. Orians, editors. Conservation Biology: Research Priorities for the Next Decade. Washington DC, USA: Island Press. p 81-97.

Deacon, J.E., and W.G. Bradley. 1972. Ecological distribution of fishes of Moapa (Muddy) River in Clark County, Nevada. Transactions of the American Fisheries Society 101:408-419.

Dowling, T.E., P.C. Marsh, C.D. Anderson, M.S. Rosenberg, and A.T. Kelson. 2008. Population structure in the roundtail chub (Gila robusta complex) of the Gila River basin as determined by microsatellites. Final report to Arizona Game and Fish Department, Contract # AGR 4/21/04.

Dubut, V., J. Francois-Martin, A. Gilles, J. Van Houdt, R. Chappaz, and C. Costedoat. 2009. Isoloation and characterization for the dace complex: Leuciscus leuciscus (Teleostei: Cyprinidae). Molecular Ecology Resources 9:1179-1183.

Dudgeon, D., A.H. Arthington, M.O. Gessner, Z.I. Kawabata, D.J. Knowler, C. Leveque, R.J. Naiman, A.H. Prieur-Richard, D. Soto, M.L.J., Stiassny, and C.A. Sullivan. 2006. Freshwater biodiversity: importance, threats, status and conservation challenges. Biological Reviews 81:163-182.

Dwyer, W.P., and R.G. Piper. 1987. Atlantic salmon growth efficiency as affected by temperature. The Progressive Fish-Culturist 49:57-59.

ESRI (Environmental Systems Resource Institute). 2009. ArcMap 9.3. ESRI, Redlands, California, USA.

ESRI (Environmental Systems Resource Institute). 2011. ArcMap 10.1. ESRI, Redlands, California, USA.

Fahrig, L. 2003. Effects of habitat fragmentation on biodiversity. Annual Review of Ecology, Evolution, and Systematics 34:487-515.

Fausch, K.D., C.E. Torgersen, C.V. Baxter, and H.W. Li. 2002. Landscapes to riverscapes: bridging the gap between research and conservation of stream fishes. BioScience 52:483-498.

Fuller, R.L., J.L. Roelofs, and T.J. Fry. 1986. The importance of algae to stream invertebrates. Journal of the North American Benthological Society 5:290-296.

38

Gerking, S.D. 1959. The restricted movement of fish populations. Biological Reviews 34:221-242.

Gowan, C., M.K. Young, K.D. Fausch, and S.C. Riley. 1994. Restricted movement in resident stream salmonids: a paradigm lost? Canadian Journal of Fisheries and Aquatic Sciences 51:2626-2637.

Gowan, C., and K.D. Fausch. 2002. Why do foraging stream salmonids move during summer? Environmental Biology of Fishes 64:139-153.

Hanski, I. 1998. Metapopluation dynamics. Nature 396:41-49.

Hatten, J.R., T.R. Batt, G.G. Scoppettone, and C.J. Dixon. 2013. An ecohydraulic model to identify and monitor Moapa dace habitat. PLoS ONE 8:1-12.

Heggenes, J., J.L. Baglinière, and R.A. Cunjak. 1999. Spatial niche variability for young Atlantic salmon (Salmo salar) and brown trout (Salmo trutta) in heterogeneous streams. Ecology of Freshwater Fish 1999:1-21.

Helfman, G.S., B.B. Collette, D.E. Facey, and B.W. Bowen. 2009. The diversity of fishes. 2nd ed. Hoboken, New Jersey, USA: John Wiley and Sons Ltd. 720 p.

Hill, J., and G.D. Grossman. 1987. Home range estimates for three North American stream fishes. Copeia 2:376-380.

Hill, M.T., and W.S. Platts. 1998. Ecosystem restoration: A case study in the Owens River Gorge, California. Fisheries 23:18-27.

Hill, W.R., and A.W. Knight. 1988. Nutrient and light limitation of algae in two northern California streams. Journal of Phycology 24:125-132.

Hubbs, C.L., and R.R. Miller. 1948. Two new relict genera of cyprinid fishes from Nevada. University of Michigan Museum of Zoology Occasional Papers 507:1- 30.

Huh, H.T., H.E. Calbert, and D.A. Stuiber. 1976. Effects of temperature and light on growth of yellow perch and Walleye using formulated feed. Transactions of the American Fisheries Society 105:254-258.

Hutchings, J.A., and L. Gerber. 2002. Sex-biased dispersal in a salmonid fish. Proceedings of the Royal Society 269:2487-2493.

Ims, R.A., and D.Ø. Hjermann. 2001. Condition-dependent dispersal. In: Clobert, J., E. Danchin, A.A. Dhondt, and J.D. Nichols, editors. Dispersal. New York, New York, USA: Oxford University Press. p 96-109.

39

Jeppson, P.W., and W.S. Platts. 1959. Ecology and control of the Columbia squawfish in northern Idaho lakes. Transactions of the American Fisheries Society 88:197-202.

Keeler-Foster, C.L., I.B. Spies, V. Bondu-Hawkins, and P. Bentzen. 2004. Development of microsatellite markers in bonytail (Gila elegans) with cross-species amplification in humpback chub (Gila cypha). Molecular Ecology Notes 4:23-25.

Kobler, A., Y. Humblet, K. Geudens, and M. Eens. 2012. Period-dependent sex-biased movement in a polygamous stream fish (Cottus perifretum Freyhof, Kottelat, and Notle, 2005-Actinopterygii, Cottidae) with male parental care. Hydrobiologia 693:195-204.

Kramer, D.L. 1987. Dissolved oxygen and fish behavior. Environmental Biology of Fishes 18:81-92.

Lobón-Cerviá, J., and P.A. Rincón. 1998. Field assessment of the influence of temperature on growth rate in a brown trout population. Transactions of the American Fisheries Society 127:718-728.

Lonzarich, D.G., M.R. Lonzarich, and M.L. Warren Jr. 2000. Effects of riffle length on the short-term movement of fishes among stream pools. Canadian Journal of Fish and Aquatic Sciences 57:1508-1514.

Malmqvist, B., and S. Rundle. 2002. Threats to the running water ecosystems of the world. Environmental Conservation 29:134-153.

Marchetti, M.P., and P.B. Moyle. 2001. Effects of flow regime on fish assemblages in a regulated California stream. Ecological Applications 11:530-539.

Marentette, J.R., G. Wang, S. Tong, N.M. Sopinka, M.D. Taves, M.A. Koops, and S. Balshine. 2011. Laboratory and field evidence of sex-biased movement in the invasive round goby. Behavioral Ecology and Sociobiology 65:2239-2249.

Martin-Smith, K.M., and J.D. Armstrong. 2002. Growth of wild stream-dwelling Atlantic salmon correlate with activity and sex but not dominance. Journal of Animal Ecology 71:413:423.

McCormick, J.H., K.E.F. Hokanson, and B.R. Jones. 1972. Effects of temperature on growth and survival of young brook trout, Salvelinus fontinalis. Journal of the Fisheries Research Board of Canada 29:1107-1112.

Mckelvey, K.S., and M.K. Schwartz. 2004. Genetic errors associated with population estimation using non-invasive molecular tagging: problems and new solutions. The Journal of Wildlife Management 68:439-448.

40

Meredith, E.P., and B. May. 2002. Microsatellite loci in the Lahontan tui chub, Gila bicolor obesa, and their utilization in other chub species. Molecular Ecology Notes 2:156-158.

Miller, C.R., P. Joyce, and L.P. Waits. 2002. Assessing allelic dropout in genotype reliability using maximum likelihood. Genetics 160:357-366.

Minshall, G.W. 1978. Autotrophy in stream ecosystems. BioScience 28:767-771.

Modde, T., and D.B. Irving. 1998. Use of multiple spawning sites and seasonal movement by razorback suckers in the Middle Green River, Utah. North American Journal of Fisheries Management 18:318-326.

Moyle, P.B., and G.M. Sato. 1991. On the design of preserves to protect native fishes. In: Minckley W.L. and J.E. Deacon, editors. Battle Against Extinction: Native Fish Management in the American West. Tucson, Arizona, USA: University of Arizona Press. p 155-170.

Naiman, R.J. 1976. Productivity of a hervivorous pupfish population (Cyprinidon nevadensis) in a warm desert stream. Fish Biology 9:125-137.

Nielsen, J.L., C. Carpanzano, M.C. Fountain, and C.A. Gan. 1997. Mitochondrial DNA and nuclear microsatellite diversity in hatcher and wild Onchorhynchus mykiss from freshwater habitats in southern California. Transactions of the American Fisheries Society 126:397-417.

Ono, R.D., J.D. Williams, and A. Wagner. 1983. Vanishing fishes of North America. Washington, DC, USA: Stone Wall Press. 257 p.

Osmundson, D.B. 2006. Proximate causes of sexual size dimorphism in Colorado pikeminnow, a long-lived cyprinid. Journal of Fish Biology 68:1563-1588.

Paetkau, D. 2003. An empirical exploration of data quality in DNA-based population inventories. Molecular Ecology 12:1375-1387.

Paetkau, D. 2004. The optimal number of markers in genetic capture-mark-recapture studies. The Journal of Wildlife Management 68:449-452.

Palsbøll, P.J., J. Allen, M. Bérubé, P.J. Clapham, T.P. Feddersen, P.S. Hammond, R.R. Hudson, H. Jørgensen, S. Katona, A.H. Larson, F. Larson, J. Lien, D.K. Mattila, J. Sigurjónsson, R. Sears, T. Smith, R. Sponer, P. Stevick, and N. Øien. 1997. Genetic tagging of humpback whales. Nature 338:767-769.

41

Peacock, E., K. Titus, D.L. Garshelis, M.M. Peacock, and M. Kuc. 2011. Mark-recapture using tetracycline and genetics reveal record-high bear density. Journal of Wildlife Management 75:1513-1520.

Poff, N.L., J.D. Olden, D.M. Merritt, and D.M. Pepin. 2007. Homogenization of regional river dynamics by dams and global biodiversity implications. Proceedings of the National Academy of Sciences of the United States of America 104:5732-5737.

Propst, D.L., and K.B. Gido. 2004. Responses of native and nonnative fishes to natural flow regime mimicry in the San Juan River. Transactions of the American Fisheries Society 133:922-931.

Pyron, M., T.E. Pitcher, S.J. Jacquemin. 2013. Evolution of mating systems and sexual size dimorphism in North American Cyprinids. Behavioral Ecology and Sociobiology 67:747-756.

Quist, M.C., and J.R. Spiegel. 2012. Population demographics of Catostomids in large river ecosystems: effects of discharge and temperature on recruitment dynamics and growth. River Research and Applications 28:1567-1586.

R Core Team. 2012. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0. URL http://www.R-project.org/.

Rahel, F.J. 2000. Homogenization of fish faunas across the United States. Science 288:854-856.

Rantz, S.E., and others. 1982. Measurement and computation of streamflow: volume 2. Computation of discharge, U.S. Geological Survey Water-Supply Paper 2175. 313 p.

Ricker, W.E. 1979. Growth rates and models. In: Hoar, W.S., D.J. Randall, and J.R. Brett, editors. Fish Physiology: Volume VIII, Bioenergetics and Growth. New York, New York, USA: Academic Press. p 677-743.

Schlosser, I.J. 1995. Critical landscape attributes that influence fish population dynamics in headwater streams. Hydrobiologia 303:71-81.

Schlosser, I.J., and P.L. Angermeier. 1995. Spatial variation in demographic processes of lotic fishes: conceptual models, empirical evidence, and implications for conservation. American Fisheries Society Symposium 17:392-401.

Schrank, A.J., and F.J. Rahel. 2006. Factors influencing summer movement patterns of Bonneville cutthroat trout (Oncorhynchus clarkia utah). Canadian Journal of Fisheries and Aquatic Sciences 63:660-669.

42

Schuelke, M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18:223-224.

Scoppettone, G.G., H.L. Burge, P.L. Tuttle, M. Parker, and N. Kanim Parker. 1986. Life history and status of the Moapa dace (Moapa coriacea). Unpublished report: U.S. Fish and Wildlife Service, National Fisheries Research Center, Washington, D.C.

Scoppettone, G.G., H.L. Burge, and P.L. Tuttle. 1992. Life History, abundance, and distribution of Moapa dace (Moapa coriacea). Great Basin Naturalist 52:216-225.

Scoppettone, G.G., and H.L. Burge. 1994. Growth and survivorship of Moapa dace (Osteichthyes: Cyprinidae: Moapa coriacea) in an isolated stream reach on Moapa National Wildlife Refuge. The Southwest Naturalist 39:192-195.

Scoppettone, G.G., P.H. Rissler, M.B. Nielson, and J.E. Harvey. 1998. The status of Moapa coriacea and Gila seminuda and status information on other fishes of the Muddy River, Clark County, Nevada. The Southwestern Naturalist 43:115-122.

Scoppettone, G.G., P.H. Rissler, C. Gourley, and C. Martinez. 2005. Habitat restoration as a means of controlling non-native fish in a Mojave Desert oasis. Restoration Ecology 13:247-256.

Scoppettone G.G., J.A. Salgado, and M.B Nielson. 2005. Blue tilapia (Oreochromis aureus) predation on fishes in the Muddy River system, Clark County, Nevada. Western North American Naturalist 65:410-414.

Scoppettone, G.G., and S. Goodchild. 2009. Threatened fishes of the world: Moapa coriacea Hubbs and Miller, 1948 (Cyprinidae). Environmental Biology of Fishes 86:339-340.

Selong, J.H., T.E. McMahon, A.V. Zale, and F.T. Barrows. 2001. Effect of temperature on growth and survival of bull trout, with application of an improved method for determining thermal tolerance in fishes. Transactions of the American Fisheries Society 130:1026-1037.

Skalski, G.T., and J.F. Gilliam. 2000. Modeling diffusive spread in a heterogeneous population: a movement study with stream fish. Ecology 81:1685-1700.

Smithson, E.B., and C.E. Johnston. 1999. Movement patterns of stream fishes in an Ouachita Highlands stream: an examination of the restricted movement paradigm. Transactions of the American Fisheries Society 128:847-853.

Sokal, R.R., and F.J. Rohlf. 1995. Biometry. 3rd ed. New York, New York, USA: W.H. Freeman and Company. 887 p.

43

Sommer, T.R., M.L. Nobriga, W.C. Harrell, W. Batham, and W.J. Kimmerer. 2001. Floodplain rearing of juvenile chinook salmon: evidence of enhanced growth and survival. Canadian Journal of Fisheries and Aquatic Sciences 58:325-333.

Southern Nevada Water Authority. 2011. Warm Springs Natural Area: stewardship plan. 81 p.

Sweet, D.E., and W.A. Hubbert. 2010. Seasonal movements of native and introduced catostomids in the Big Sandy River, Wyoming. The Southwest Naturalist 55:382- 389.

Taberlet, P., S. Griffin, B. Goossens, S. Questiau, V. Manceau, N. Escaravage, L.P. Waits, and J. Bouvet. 1996. Reliable genotyping of samples with very low DNA quantities using PCR. Nucleic Acids Research 24:3189-3194.

Taberlet, P., L.P. Waits, and G. Luikart. 1999. Noninvasive genetic sampling: look before you leap. TREE 14:323-327.

Turchin, P. 1998. Quantitative analysis of movement: measuring and modeling population redistribution in animals and plants. Sunderland, Maryland, USA: Sinauer Associates, Inc. 396 p.

United States Department of the Interior. 1967. Native fish and wildlife, endangered species. Federal Register 32:4001.

United States Fish and Wildlife Service. 1983. Moapa dace recovery plan. Portland, Oregon, USA. 32 p.

United States Fish and Wildlife Service. 1995. Recovery plan for the rare aquatic species of the Muddy River ecosystem. Portland, Oregon, USA. 60 p.

Vannote, R.L., G.W. Minshall, K.W. Cummins, J.R. Sedell, and C.E. Cushing. 1980. The river continuum concept. Canadian Journal of Fisheries and Aquatic Sciences 37:130-137.

Walker, R.H., G.L. Adams, and S.R. Adams. 2013. Movement patterns of southern redbelly dace, Chrosomus erythrogaster, in a headwater reach of an Ozark stream. Ecology of Freshwater Fish 22:216-227.

Wallace, J.B., and M.E. Gurtz. 1986. Response of baetis mayflies (Ephemeroptera) to catchment logging. The American Midland Naturalist 115:25-41.

Ward, J.V. 1998. Riverine landscapes: biodiversity patterns, disturbance regimes, and aquatic conservation. Biological Conservation 83:269-278.

44

Wiens, J.A. 2001. The Landscape context of dispersal. In: Clobert, J., E. Danchin, A.A. Dhondt, and J.D. Nichols, editors. Dispersal. New York, New York, USA: Oxford University Press. p 96-109.

Wilberg, M.J., and B.P. Dreher. 2004. Genecap: a program for analysis of multilocus genotype data for non-invasive sampling and capture-recapture population estimation. Molecular Ecology Notes 4:783-785.

Williams, J. E., D.B. Bowman, J.E. Brooks, A.A. Echelle, R. J. Edwards, D. A. Hendrickson, and J. J. Landye. 1985. Endangered aquatic ecosystems in North American deserts, with a list of vanishing fishes of the region. Journal of the Arizona-Nevada Academy of Sciences 20:1-62.

Willson, M.F. and K.C. Halupka. 1995. Anadromous fish as keystone species in vertebrate communities. Conservation Biology 9:489-497.

Woods, J.G., D. Paetkau, D. Lewis, B.N. McLellan, M. Proctor, and C. Strobeck. 1999. Genetic tagging of free-ranging black and brown bears. Wildlife Society Bulletin 27:616-627.

Woolnough, D.A., J.A. Downing, and T.J. Newton. 2009. Fish movement and habitat use depends on water body shape and size. Ecology of Freshwater Fishes 18:83-91.

Wootton, R.J. 1990. Ecology of teleost fishes. New York, New York, USA: Chapman and Hall. 404 p.

Xu, C., B.H. Letcher, and K.H. Nislow. 2010. Context-specific influence of water temperature on brook trout growth rates in the field. Freshwater Biology 55:2253- 2264.

Yamamoto, T. 2004. Sex-specific growth pattern during early life history in masu salmon, Onchorynchus masou. Ecology of Freshwater Fish 13:203-207.

Young, M.K. 1996. Summer movements and habitat use by Colorado River cutthroat trout (Onchorhynchus clarki pleuriticus) in small, montane streams. Canadian Journal of Fisheries and Aquatic Sciences 53:1403-1408.

45

TABLE LEGENDS

Table 1. Summary of in-stream habitat characteristics measured for Apcar, Pederson, and Plummer tributaries in the Warm Springs area of the upper Muddy River, NV. Width (cm) and thalweg depth (cm) were averaged from transects spaced 5 and 25 meter apart. Water volume ( - ) was collected on 03/18/2012. Average, minimum, and maximum temperature recorded at 15 minute intervals from 08/09/2011 - 08/09/2012 except for those with asterix which include data from 08/09/2011 - 03/30/2011.

Table 2. Summary of polymorphic microsatellites, including expected heterozygosity (He), observed heterozygosity (Ho), and allelic richness (Rs), used in the genetic tagging of Moapa dace in the Warm Springs area of the upper Muddy River, NV between October 2009 and September 2012.

Table 3. Fishes captured in the Apcar, Pederson, and Plummer tributaries of the Warm Springs area of the upper Muddy River, Clark County, NV between October 2009 and September 2012.

46

Table 1.

Distance from Water Average Minimum Maximum springhead Width Thalweg depth volume temperature temperature temperature System (m) (cm) (±SD) (cm) (±SD) ( - ) (°C) (± SD) (°C) (°C) 0 - 100 169 (±36.14) 38 (± 13.31) 0.081 32.47 (± 0.16) 28.24 32.94 100 - 250 184 (± 51.49) 38 (± 10.54) 0.081 31.89 (± 0.36)* 31.13* 32.94* 250 - 500 0.108 27.63* 32.98* Apcar 205 (± 72.45) 52 (± 22.28) 31.54 (± 0.55)* 500 - 750 225 (± 102.06) 62 (± 24.80) 0.194 30.51 (± 1.21) 27.18 33.72 750 - 1000 335 (± 52.97) 51 (± 12.72) 0.243 30.07 (± 1.46) 27.14 33.87 1000 - 1143 300 (± 0.00) 54 (± 14.54) 0.243 30.07 (± 1.46) 27.14 33.87

0 - 100 115 (± 33.54) 25 (± 19.35) 0.042 31.93 (± 0.56)* 29.17* 33.31* 100 - 250 0.095 na na na Pederson 154 (± 33.23) 35 (± 10.08) 250 - 500 215 (± 62.58) 34 (± 12.43) 0.089 31.74 (± 0.71) 28.95 33.60 500 - 703 200 (± 50.00) 42 (± 21.53) 0.089 30.24 (± 1.15) 27.63 33.52

0 - 100 187 (± 70.89) 32 (± 10.39) 0.065 32.10 (± 0.48) 30.10 33.18 100 - 250 234 (± 110.83) 48 (± 18.24) 0.129 32.68 (± 0.23) 29.50 33.26 Plummer 250 - 500 223 (± 60.61) 34.5 (± 23.10) 0.133 31.50 (± 0.74) 27.57 33.42 500 - 750 397 (± 215.21) 97 (± 77.42) 0.376 30.30 (± 1.29) 27.24 33.85 750 - 887 1167 (± 351.18) 200 (± 0.00) 0.376 30.30 (± 1.29) 27.24 33.85

47

Table 2. Range Core motif Genus species Number of

Locus Florescent tag* PRIMER SEQUENCE (5'-3') Source Common name alleles H e H o R s Lce-C1 (CA)16 F: AGGTGTTGGTTCCTCCCG Debut et al. 2009 Leuciscus leuciscus 142-182 0.86 0.86 12.57 VIC R: TGTTATCTCGGTTTCACGAGC Eurasian Dace 13 LleB-072 (TG)13 F: TCATTAGGGAGGCTGCTTATTC Debut et al. 2009 Leuciscus leuciscus 187-209 0.66 0.65 4.08 NED R: CCTTTTCAACAATTTGTCACGG Eurasian Dace 6 Lsou08 (GT)17 F: GCGGTGAACAGGCTTAACTC Debut et al. 2009 Leuciscus leuciscus 207-241 0.25 0.25 3.57 FAM R: TAGGAACGAAGAGCCTGTGG Eurasian Dace 7 LleC-090 (TC)15GG(TC)3 F: TCAGACACAACTAACCGACC Debut et al. 2009 Leuciscus leuciscus 255-297 0.90 0.89 16.07 VIC R: GGCGCTGTCCAGAACTGA Eurasian Dace 20 Gbi-G34 (GATA)14 F: GTCTCCGGGTCTCCAACTCC Meredith and May 2002 Gila bicolor obesa 250-334 0.91 0.91 18.93 FAM R: GCTCGCCCCTGTCACCA Lahontan Tui Chub 22 Gbi-G39 (GATA)11 F: GAGCGGGTGGATTTTTACTATTAT Meredith and May 2002 Gila bicolor obesa 262-312 0.81 0.44 15.85 VIC R: ATTCATTATCCGGGGTCTCAT Lahontan Tui Chub 22 Gel_223 (TATC)18 F: CATAACTGATTTTTTTAATTAAGCTTG Keeler-Foster et al. 2004 Gila elegans 233-265 0.83 0.40 8.68 NED R: GTTACTGTAGTGGTTGAGGGAAC Bonytail Chub 9 GilaD17 (GT)13 F: TGGGCAGGAAAAGAGAAACT Dowling et al. 2005 Gila robusta 256-282 0.61 0.62 9.80 FAM R: ATAAAGAGACGGTAAAGAACT Roundtail Chub 12 BL1-2b (TG)12 F: TTTGCACTAGTAACGAGCATCA Debut et al. 2009 Leuciscus leuciscus 172-202 0.54 0.56 4.84 FAM R: CAGCACAGTTTCTCCATCCA Eurasian Dace 9 Lsou05 (CA)17 F: CTGAAGAAGACCCTGGTTCG Debut et al. 2009 Leuciscus leuciscus 209-249 0.83 0.83 10.58 FAM R: CCCACATCTGCTGACTCTGAC Eurasian Dace 19 *Florescent tag sequences on forward primers are VIC = gcggataacaatttcacacagg, NED = taaaacgacggccagtgc, FAM = tttcccagtcacgacgttg; Reverse tag = gtttctt

48

Table 3. Year Tributary Species Moapa dace springfish shortfin molly mosquitofish Apcar 115 12,823 9,119 3,024 Pederson 111 9,963 366 86 2010 Plummer 581 10,138 9,656 4,729 TOTAL 807 32,924 19,141 7,839 Apcar 244 16,677 14,852 4,589 Pederson 201 12,263 399 118 2011 Plummer 959 13,430 17,601 5,250 TOTAL 1,404 42,370 32,852 9,957 Apcar 578 16,839 11,247 4,939 Pederson 357 13,169 654 274 2012 Plummer 794 16,376 12,341 5,432 TOTAL 1,729 46,384 24,242 10,645

TOTAL 3,940 121,678 76,235 28,441

49

FIGURE LEGENDS

Figure 1. Map depicting the origin of the Muddy River, Clark County, Nevada and surrounding hydrographic features. Before the creation of the Hoover Dam (1936) on the Colorado River the Muddy River discharged into the Virgin River. Currently the Muddy River discharges into the Overton Arm of Lake Mead.

Figure 2. The Muddy River, NV originates at the Warm Springs area which consists of over 20 geothermal springs with an average temperature of approximately 32°C. Average daily temperature of the upper Muddy River decreases as water moves downstream of it sources.

Figure 3. Location of study site within the Warm Springs area of the upper Muddy River, NV. Apcar, Pederson, and Plummer tributaries are isolated from the main stem of the Muddy River by a gabion barrier to prevent invasion of blue tilapia. Known barriers to upstream movement of fishes are represented by red lines. White circles represent sampling locations.

Figure 4. Average monthly water temperature (± SD) recorded every 15 minutes at 20 locations from August 9, 2011 to August 8, 2012 within the Apcar, Pederson, and Plummer tributaries of the Warm Springs area of the upper Muddy River, NV.

Figure 5. Home range density of Moapa dace in 2010, 2011, and 2012 in Apcar, Pederson, and Plummer tributaries of the Warm Springs area in the upper Muddy River, NV. Home range of an individual was considered as the linear distance between the most upstream capture and most downstream capture within the year in question. Home range density was calculated as number of home ranges per square-meter. Black lines represent barriers to upstream movements for fish.

Figure 6. Mean home range length (± SE) of Moapa dace in the Warm Springs area of the upper Muddy River, NV in 2010, 2011, and 2012.

Figure 7. Mean home range length (± SE) of Moapa dace in the Apcar, Pederson, and Plummer tributaries in the Warm Springs area of the upper Muddy River, NV between October 2009 and September 2012.

50

Figure 8. Linear regressions of Moapa dace home range length (m) and distance of centroid of home range from associated springhead (m) in the Warm Springs area of the upper Muddy River, NV. Only individuals with home ranges equal to or larger than 25 meters were used in analysis to account for unequal trapping densities. Both Apcar and Plummer tributaries show a positive relationship ( = 0.448, F = 79.95, P < 0.001 and = 0.374, F = 123.8, P < 0.001) respectively, while Pederson showed no relationship ( = -0.016, F = 0.4482, P = 0.507).

Figure 9. Box-plot of growth rates (mm ) between different size classes (FL, mm) of Moapa dace in Apcar, Pederson, and Plummer tributaries of the Muddy River, NV during 2010-2012. The bottom and top of the box is the 25th and 75th percentile (1QR) of the growth rates, the horizontal line in the box indicates the 50th percentile, the black diamond is the mean growth rate, the end of the top whisker represents the 1.5XQR, and the end of the bottom whisker represents the minimum value of the growth rates.

Figure 10. Bar graph of mean (±SE) seasonal growth rates (mm ) of adult (FL > 40 mm) Moapa dace captured in Apcar, Pederson, and Plummer tributaries of the Muddy River, NV during 2010-2012. Growth rates were calculated as the difference in fork length measurements (mm) divided by the number of days between consecutive captures.

Figure 11. Monthly mean (± SE) body condition (Fulton’s condition factor, ) of Moapa dace in Apcar, Pederson, and Plummer tributaries in the Warm Springs area of the upper Muddy River, NV from November 2010 to September 2012. Total sample size was 2,379 fish. Body condition was greatest during July (n =212, ̅ = 1.129, SE ± 0.01) and lowest in March (n =353, ̅ = 1.052, SE ± 0.01) and there was a significant difference (One-way ANOVA, F = 16.57, df = 964.1, P < 0.001). Points with different letters above them are significantly different (α < 0.05).

51

Figure 1.

52

Figure 2.

53

Figure 3.

54

Figure 4.

55

Figure 5.

56

Figure 6.

57

Figure 7.

58

Figure 8.

59

Figure 9.

60

Figure 10.

61

Figure 11.