Novel Actions of Sclerostin on Bone
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												
												Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. - 
												
												Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, And
Volume 86 • Number 12 Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, and Receptor Activator of Nuclear Factor-kB Ligand in Periodontitis Umut Balli,* Ahmet Aydogdu,† Figen Ongoz Dede,* Cigdem Coskun Turer,* and Berrak Guven‡ Background: To investigate changes in the levels and rel- ative ratios of sclerostin, osteoprotegerin (OPG), and recep- tor activator of nuclear factor-kB ligand (RANKL) in the gingival crevicular fluid (GCF) of patients with periodontitis after non-surgical periodontal treatment. Methods: Fifty-four individuals (27 healthy controls and 27 patients with chronic periodontitis [CP]) were enrolled in eriodontal disease is a complex the study. Periodontitis patients received non-surgical peri- biologic process related to the in- odontal therapy. GCF sampling and clinical periodontal pa- Pteraction between groups of mi- rameters were assessed before and 6 weeks after therapy. croorganisms and the host immune/ Sclerostin, OPG, and RANKL levels were measured by enzyme- inflammatory response.1 When the bal- linked immunosorbent assay, and their relative ratios were ance between microbial challenge and calculated. host response is disturbed, periodontal Results: Total amounts and concentrations of sclerostin breakdown (clinical attachment loss [AL] were significantly higher in patients with CP than in healthy and alveolar bone resorption) can oc- individuals (P <0.025) and decreased after treatment cur.1,2 Microorganisms and their prod- (P <0.05). The RANKL/OPG ratio was significantly lower in ucts are the primary etiologic factors that healthy individuals than in patients with periodontitis before directly initiate periodontal disease. and after treatment (P <0.025), but no significant difference However, the majority of periodontal was observed in patients with periodontitis after treatment breakdown is caused by endogenous (P >0.05). - 
												
												MEPE Is a Novel Regulator of Growth Plate Cartilage Mineralization
Edinburgh Research Explorer MEPE is a novel regulator of growth plate cartilage mineralization Citation for published version: Staines, K, Mackenzie, NCW, Clarkin, CE, Zelenchuk, L, Rowe, PS, MacRae, VE & Farquharson, C 2012, 'MEPE is a novel regulator of growth plate cartilage mineralization', Bone, vol. 51, no. 3, pp. 418-430. https://doi.org/10.1016/j.bone.2012.06.022 Digital Object Identifier (DOI): 10.1016/j.bone.2012.06.022 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Bone Publisher Rights Statement: Available under Open Access General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 01. Oct. 2021 Bone 51 (2012) 418–430 Contents lists available at SciVerse ScienceDirect Bone journal homepage: www.elsevier.com/locate/bone Original Full Length Article MEPE is a novel regulator of growth plate cartilage mineralization K.A. Staines a,⁎, N.C.W. Mackenzie a, C.E. Clarkin b, L. Zelenchuk c, P.S. Rowe c, V.E. - 
												
												Anti-Sclerostin Antibody Inhibits Internalization of Sclerostin and Sclerostin-Mediated Antagonism of Wnt/ LRP6 Signaling
Anti-Sclerostin Antibody Inhibits Internalization of Sclerostin and Sclerostin-Mediated Antagonism of Wnt/ LRP6 Signaling Maarten van Dinther1, Juan Zhang1, Stella E. Weidauer2, Verena Boschert2, Eva-Maria Muth2, Achim Knappik3, David J. J. de Gorter1, Puck B. van Kasteren1¤, Christian Frisch3, Thomas D. Mueller2, Peter ten Dijke1* 1 Department of Molecular Cell Biology and Centre for Biomedical Genetics, Leiden University Medical Center, Leiden, The Netherlands, 2 Department of Molecular Plant Physiology and Biophysics, Julius-von-Sachs Institut, Wuerzburg, Germany, 3 AbD Serotec, a Bio-Rad company, Puchheim, Germany Abstract Sclerosteosis is a rare high bone mass disease that is caused by inactivating mutations in the SOST gene. Its gene product, Sclerostin, is a key negative regulator of bone formation and might therefore serve as a target for the anabolic treatment of osteoporosis. The exact molecular mechanism by which Sclerostin exerts its antagonistic effects on Wnt signaling in bone forming osteoblasts remains unclear. Here we show that Wnt3a-induced transcriptional responses and induction of alkaline phosphatase activity, an early marker of osteoblast differentiation, require the Wnt co-receptors LRP5 and LRP6. Unlike Dickkopf1 (DKK1), Sclerostin does not inhibit Wnt-3a-induced phosphorylation of LRP5 at serine 1503 or LRP6 at serine 1490. Affinity labeling of cell surface proteins with [125I]Sclerostin identified LRP6 as the main specific Sclerostin receptor in multiple mesenchymal cell lines. When cells were challenged with Sclerostin fused to recombinant green fluorescent protein (GFP) this was internalized, likely via a Clathrin-dependent process, and subsequently degraded in a temperature and proteasome-dependent manner. Ectopic expression of LRP6 greatly enhanced binding and cellular uptake of Sclerostin- GFP, which was reduced by the addition of an excess of non-GFP-fused Sclerostin. - 
												
												Genome-Wide Screen of Otosclerosis in Population Biobanks
medRxiv preprint doi: https://doi.org/10.1101/2020.11.15.20227868; this version posted November 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . 1 Genome-wide Screen of Otosclerosis in 2 Population Biobanks: 18 Loci and Shared 3 Heritability with Skeletal Structure 4 Joel T. Rämö1, Tuomo Kiiskinen1, Juha Karjalainen1,2,3,4, Kristi Krebs5, Mitja Kurki1,2,3,4, Aki S. 5 Havulinna6, Eija Hämäläinen1, Paavo Häppölä1, Heidi Hautakangas1, FinnGen, Konrad J. 6 Karczewski1,2,3,4, Masahiro Kanai1,2,3,4, Reedik Mägi5, Priit Palta1,5, Tõnu Esko5, Andres Metspalu5, 7 Matti Pirinen1,7,8, Samuli Ripatti1,2,7, Lili Milani5, Antti Mäkitie9, Mark J. Daly1,2,3,4,10, and Aarno 8 Palotie1,2,3,4 9 1. Institute for Molecular Medicine Finland (FIMM), Helsinki Institute of Life Science (HiLIFE), University of 10 Helsinki, Helsinki, Finland 11 2. Program in Medical and Population Genetics, Broad Institute of Harvard and MIT, Cambridge, 12 Massachusetts, USA 13 3. Stanley Center for Psychiatric Research, Broad Institute of Harvard and MIT, Cambridge, Massachusetts, 14 USA 15 4. Analytic and Translational Genetics Unit, Massachusetts General Hospital, Boston, Massachusetts, USA 16 5. Estonian Genome Center, University of Tartu, Tartu, Estonia, Institute of Molecular and Cell Biology, 17 University of Tartu, Tartu, Estonia 18 6. Finnish Institute for Health and Welfare, Helsinki, Finland 19 7. Department of Public Health, Clinicum, Faculty of Medicine, University of Helsinki, Helsinki, Finland 20 8. - 
												
												Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest. - 
												
												Gene Expression Profiling of Corpus Luteum Reveals the Importance Of
bioRxiv preprint doi: https://doi.org/10.1101/673558; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Gene expression profiling of corpus luteum reveals the 2 importance of immune system during early pregnancy in 3 domestic sheep. 4 Kisun Pokharel1, Jaana Peippo2 Melak Weldenegodguad1, Mervi Honkatukia2, Meng-Hua Li3*, Juha 5 Kantanen1* 6 1 Natural Resources Institute Finland (Luke), Jokioinen, Finland 7 2 Nordgen – The Nordic Genetic Resources Center, Ås, Norway 8 3 College of Animal Science and Technology, China Agriculture University, Beijing, China 9 * Correspondence: MHL, [email protected]; JK, [email protected] 10 Abstract: The majority of pregnancy loss in ruminants occurs during the preimplantation stage, which is thus 11 the most critical period determining reproductive success. While ovulation rate is the major determinant of 12 litter size in sheep, interactions among the conceptus, corpus luteum and endometrium are essential for 13 pregnancy success. Here, we performed a comparative transcriptome study by sequencing total mRNA from 14 corpus luteum (CL) collected during the preimplantation stage of pregnancy in Finnsheep, Texel and F1 15 crosses, and mapping the RNA-Seq reads to the latest Rambouillet reference genome. A total of 21,287 genes 16 were expressed in our dataset. Highly expressed autosomal genes in the CL were associated with biological 17 processes such as progesterone formation (STAR, CYP11A1, and HSD3B1) and embryo implantation (eg. - 
												
												Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes. - 
												
												Evaluation of Gene Variants in TGFB1, SERPINF1 and MEPE in a Spanish Family Affected by Otosclerosis and Tinnitus
Francisco J. Álvarez, Santiago Álvarez, Jesús Alonso, Pedro García Volumen 5 / Número 1 • http://www.revistabionatura.com RESEARCH / INVESTIGACIÓN Evaluation of Gene Variants in TGFB1, SERPINF1 and MEPE in a Spanish Family Affected by Otosclerosis and Tinnitus Francisco J. Álvarez1, Santiago Álvarez4, Jesús Alonso3, Pedro García2 DOI. 10.21931/RB/2020.05.01.7 Abstract: Otosclerosis (OTSC) is a common type of deafness affecting up to 0.4 % of Caucasians. Its familial form is inherited in an autosomal dominant fashion, although to this date, no definitive cause for OTSC has been found. In the development of OTSC, three recent genetic association studies have suggested the participation of particular point mutations and small indels in the TGFB1, SERPINF1, and MEPE genes. Consequently, replicative studies are needed to confirm the role of the proposed mutations in OTSC patients. The goal of this study was to test the presence of the candidate variants described in the genes TGFB1, 1050 SERPINF1, and MEPE in a new case of familial OTSC with seven affected individuals. DNA was extracted from saliva samples of a Spanish family with several members affected by OTSC. PCR amplified target regions of some candidate genes, and the products were purified, Sanger-sequenced, and analyzed in silico. The family subject of the study did not carry the candidate variants for OTSC described in the genes TGFB1, SERPINF1, and MEPE, although it cannot be ruled out the involvement of other mutations in genes related to their same signaling pathways. This result highlights the importance of performing replicative studies for complex diseases, such as OTCS, in families of diverse origins. - 
												
												Comparative and Evolutionary Analysis of the Interleukin 17 Gene Family in Invertebrates
RESEARCH ARTICLE Comparative and Evolutionary Analysis of the Interleukin 17 Gene Family in Invertebrates Xian-De Huang1,2, Hua Zhang1,2, Mao-Xian He1,2* 1 Key Laboratory of Tropical Marine Bio-Resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou, China, 2 Guangdong Provincial Key Laboratory of Applied Marine Biology (LAMB), South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou, China * [email protected] Abstract a11111 Interleukin 17 (IL-17) is an important pro-inflammatory cytokine and plays critical roles in the immune response to pathogens and in the pathogenesis of inflammatory and autoimmune diseases. Despite its important functions, the origin and evolution of IL-17 in animal phyla have not been characterized. As determined in this study, the distribution of the IL-17 family among 10 invertebrate species and 7 vertebrate species suggests that the IL-17 gene may OPEN ACCESS have originated from Nematoda but is absent from Saccoglossus kowalevskii (Hemichor- Citation: Huang X-D, Zhang H, He M-X (2015) data) and Insecta. Moreover, the gene number, protein length and domain number of IL-17 Comparative and Evolutionary Analysis of the differ widely. A comparison of IL-17-containing domains and conserved motifs indicated Interleukin 17 Gene Family in Invertebrates. PLoS somewhat low amino acid sequence similarity but high conservation at the motif level, ONE 10(7): e0132802. doi:10.1371/journal. pone.0132802 although some motifs were lost in certain species. The third disulfide bond for the cystine knot fold is formed by two cysteine residues in invertebrates, but these have been replaced Editor: Michael Schubert, Laboratoire de Biologie du Développement de Villefranche-sur-Mer, FRANCE by two serine residues in Chordata and vertebrates. - 
												
												Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in - 
												
												The Role of BMP Signaling in Osteoclast Regulation
Journal of Developmental Biology Review The Role of BMP Signaling in Osteoclast Regulation Brian Heubel * and Anja Nohe * Department of Biological Sciences, University of Delaware, Newark, DE 19716, USA * Correspondence: [email protected] (B.H.); [email protected] (A.N.) Abstract: The osteogenic effects of Bone Morphogenetic Proteins (BMPs) were delineated in 1965 when Urist et al. showed that BMPs could induce ectopic bone formation. In subsequent decades, the effects of BMPs on bone formation and maintenance were established. BMPs induce proliferation in osteoprogenitor cells and increase mineralization activity in osteoblasts. The role of BMPs in bone homeostasis and repair led to the approval of BMP 2 by the Federal Drug Administration (FDA) for anterior lumbar interbody fusion (ALIF) to increase the bone formation in the treated area. However, the use of BMP 2 for treatment of degenerative bone diseases such as osteoporosis is still uncertain as patients treated with BMP 2 results in the stimulation of not only osteoblast mineralization, but also osteoclast absorption, leading to early bone graft subsidence. The increase in absorption activity is the result of direct stimulation of osteoclasts by BMP 2 working synergistically with the RANK signaling pathway. The dual effect of BMPs on bone resorption and mineralization highlights the essential role of BMP-signaling in bone homeostasis, making it a putative therapeutic target for diseases like osteoporosis. Before the BMP pathway can be utilized in the treatment of osteoporosis a better understanding of how BMP-signaling regulates osteoclasts must be established. Keywords: osteoclast; BMP; osteoporosis Citation: Heubel, B.; Nohe, A. The Role of BMP Signaling in Osteoclast Regulation.