Molecular Phylogenetics and Evolution 65 (2012) 35–45

Contents lists available at SciVerse ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier.com/locate/ympev

Convergent evolution of morphological and ecological traits in the open-habitat chat complex (Aves, Muscicapidae: Saxicolinae) ⇑ Mansour Aliabadian a,b, , Mohammad Kaboli c, Marc I. Förschler d, Vincent Nijman e, Atefeh Chamani c, Annie Tillier f, Roger Prodon g, Eric Pasquet f,h, Per G.P. Ericson i, Dario Zuccon j,f a Department of Biology, Faculty of Sciences, Ferdowsi University of Mashhad, Mashhad, Iran b Netherlands Centre for Biodiversity Naturalis, Section Zoological Museum of Amsterdam (ZMA), University of Amsterdam, Mauritskade 57, 1092 AD Amsterdam, The Netherlands c Department of Fisheries and Environmental Sciences, College of Agricultural and Natural Resources, University of Tehran, P.O. Box 4111, Karaj, Iran d Institute of Avian Research, ‘‘Vogelwarte Helgoland’’, An der Vogelwarte 21, 26386 Wilhelmshaven, Germany e Oxford Brookes University, School of Social Sciences and Law, Department of Anthropology and Geography, OX3 0BP Oxford, United Kingdom f UMS 2700 – CNRS, Service de Systématique Moléculaire, Muséum National d’Histoire Naturelle, CP26, 57 rue Cuvier, F-75231 Paris Cedex 05, France g Laboratoire Ecologie et Biogéographie des Vertébrés (EPHE), Centre d’Ecologie Fonctionnelle et Evolutive, UMR 5175, 1919 route de Mende, 34293 Montpellier Cedex 5, France h UMR 7205 – CNRS, Muséum National d’Histoire Naturelle, CP51, 57 rue Cuvier, F-75231 Paris Cedex 05, France i Department of Vertebrate Zoology, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden j Molecular Systematics Laboratory, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden article info abstract

Article history: Open-habitat chats (genera Myrmecocichla, Cercomela, Oenanthe and relative) are a morphologically and Received 26 July 2011 ecologically cohesive group of genera with unclear phylogenetic relationships. They are distributed Revised 3 April 2012 mostly in open, arid and/or rocky habitats of Africa and Eurasia. Here, we present the most comprehen- Accepted 16 May 2012 sive molecular phylogenetic analysis of this group to date, with a complete taxon sampling at the species Available online 24 May 2012 level. The analysis, based on a multilocus dataset including three mitochondrial and three nuclear loci, allows us to elucidate the phylogenetic relationships and test the traditional generic limits. All genera Keywords: are non-monophyletic, suggesting extensive convergence on similar plumage patterns in unrelated spe- Molecular phylogeny cies. While the colour pattern appear to be a poor predictor of the phylogenetic relationships, some of the Systematics Passeriformes ecological and behavioural traits agree relatively well with the major clades. Following our results, we Wheatears also propose a revised generic classification for the whole group. Saxicolinae Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction subspecies and/or the occurrence of light and dark morphs in cer- tain populations. Recent molecular analyses have detected a con- The open-habitat chats occur mostly in open, arid and/or rocky siderable genetic distance within some species (Oenanthe lugens: habitats of Africa and Eurasia. The members of this group of birds Förschler et al., 2010; Myrmecocichla arnotti: Glen et al., 2011; share many elements of their ecology, behaviour and morphology Oenanthe hispanica: Randler et al., 2012), suggesting that some well (Tye, 1989a; Lynes, 1924–1926; Panov, 2005; Kaboli et al., 2007). differentiated populations should be treated as distinct species. Most species display a predominantly black-and-white, brown or The group as a whole is clearly monophyletic, but the internal grey plumage pattern. They are currently included in five genera, relationships recovered from three published datasets are conflict- Campicoloides, Cercomela, Myrmecocichla, Oenanthe and Thamnolaea ing with respect to the branching pattern of the major lineages (Dickinson, 2003), with 39 or so species-level taxa. Despite exten- (Zuccon and Ericson, 2010a; Sangster et al., 2010; Outlaw et al., sive work on open-habitat chats’ ecology, biogeography, ethology, 2010), possibly because of the incomplete taxon sampling. While and morphology (Vaurie, 1955; Cornwallis, 1975; Potapova and Pa- the phylogenic relationships in Oenanthe and Cercomela have been nov, 1977; Ivanitzky, 1980; Loskot, 1983; Grabovsky and Panov, elucidated in greater detail (Aliabadian et al., 2007; Outlaw et al., 1992; Panov, 2005; Kaboli et al., 2007) their alpha-taxonomy is 2010), the relationships of Myrmeococichla and Thamnolaea with not fully understood. In the wheatears of the genus Oenanthe, the the other chats remain to be investigated. species delimitation is complicated by the presence of distinct The genus Myrmecocichla consists of seven open-habitat chats endemic to the Sub-Saharan Africa (Sibley and Monroe, 1990; Bor-

⇑ Corresponding author. Address: Department of Biology, Faculty of Sciences, row and Demey, 2001; Dickinson, 2003; Clements, 2007). These Ferdowsi University of Mashhad, P.O. Box 1436, Iran. small to medium-sized ground-dwelling chats have a predominant E-mail address: [email protected] (M. Aliabadian). black plumage, a very upright stance, a short but often cocked tail,

1055-7903/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ympev.2012.05.011 36 M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 35–45 a curious low buzzing flight, and highly simplified songs (Collar, plemented with other sequences obtained from Genbank. The de- 2005). The limits of Myrmecocichla have sometimes been enlarged gree of divergence was inspected using a neighbour-joining (NJ) to include also Thamnolaea, two African, relatively large, rufous- tree with uncorrected p-distances calculated in PAUP v.4.0b10 bellied species that inhabit rocky hillsides and often nest in old (Swofford, 2003). In almost all comparisons, the genetic divergence swallows’ nest (Keith et al., 1992). However, while Thamnolaea between our two samples was minimal and we concatenated the semirufa was recently shown to be part of the Monticola radiation sequences in a single dataset (see also in Section 3). (Zuccon and Ericson, 2010b), T. cinnamomeiventris is effectively closely related to Myrmecocichla (Zuccon and Ericson, 2010a; 2.2. Laboratory protocols Sangster et al., 2010). Alternatively Myrmecocichla arnotti and M. albifrons were removed from Myrmecocichla and transferred to The total genomic DNA from fresh tissues samples (blood, mus- the genus Pentholaea for the lack of white wing panels, more elab- cle, feathers) was extracted using DNEasy Tissue Extraction Kits orated songs and the tendency to nest in tree holes (Collar, 2005). (Qiagen, Inc.) following the manufacturer protocol. We used the The resemblance of Myrmecocichla to certain species of Oenanthe Qiagen DNA Micro Kit for the museum skin samples with a modi- (most notably the close similarity of M. arnotti to O. monticola) fied protocol as described by Irestedt et al. (2006). The mitochon- has been considered an indication of a close relationship between drial and nuclear genes were amplified and sequenced using Oenanthe and Myrmecocichla (Collar, 2005). standard primers and amplification procedures as described in Hitherto the main difficulty with open-habitat chats classifica- Fjeldså et al. (2003) for GAPDH, Irestedt et al. (2002) for myoglobin, tion is the heavy reliance on highly variable plumage characters Allen and Omland (2003) for ODC, Zuccon et al. (2006) for ND2, that can be susceptible to selective pressure obscuring true phylo- Chesser (1999) for ND3, Hebert et al. (2004) for COI and Palumbi genetic relationships. Indeed a reassessment of the relationships of et al. (1991) for 16S. The museum study skins were amplified in Cercomela revealed extensive polyphyly, with four distinct lineages a series of 200–300 bp overlapping fragments, using a large num- variously interspersed in the open-habitat chat clade, with re- ber of internal primers, whose sequences are available from the peated convergence in plumage pattern in Cercomela and Oenanthe authors. The PCR products were purified using QIAquick PCR Puri- (Outlaw et al., 2010). fication Kit (Qiagen) following manufacturer instructions and se- Here, we present the most comprehensive molecular phyloge- quenced using dye-labelled dideoxy terminator cycle sequencing netic analysis of the open-habitat chats to date with a complete with BigDye v3.1 (Applied Biosystems, Inc.). taxon sampling at the species level. The analysis, based on a mul- tilocus dataset including both fast-evolving mitochondrial DNA 2.3. Phylogenetic analyses genes and more moderate-to-slow evolving nuclear DNA loci, al- lows us to elucidate the phylogenetic relationships, test the tradi- The seven loci were concatenated in a partitioned dataset ana- tional generic limits and propose a revised classification of the lysed under the Bayesian inference and the maximum likelihood whole group. criteria. The Bayesian inference was carried out using MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003), implemented on the freely 2. Materials and methods available Bioportal (www.bioportal.uio.no). A mixed model ap- proach was implemented to account for the potential differences 2.1. Taxon sampling and gene choice in evolutionary model parameters between the data partitions cor- responding to the five genes. The models best fitting the data were We sampled all species in the genera Campicoloides, Cercomela, obtained with MrModelTest (Nylander, 2004), using the AIC crite- Myrmecocichla and Oenanthe, plus Thamnolaea cinnamomeiventris. rion (Akaike, 1973), in conjunction with PAUP⁄ (Swofford, 2003). Thamnolaea semirufa, which belongs to the Monticola clade (Zuccon MrModelTest output suggested as the best fit the HKY + C model and Ericson, 2010b), was excluded from the analysis. Following the for GAPDH and myoglobin introns and the HKY + I + C model for redefinition of certain species limits, we treated Myrmecocichla (ar- the COI gene, while the GTR + C + I model was used for remaining notti) collaris, O. (lugens) persica, O. (lugens) lugubris, and O. (hispa- loci. We assumed uniform interval priors for the parameters, ex- nica) melanoleuca as valid species (Förschler et al., 2010; Glen et al., cept for base frequencies, which were assigned a Dirichlet prior 2011; Randler et al., 2012). (Huelsenbeck and Ronquist, 2001). We run two independent runs We used five species belonging to the genera Saxicola, Monticola of four incrementally heated Metropolis-coupled MCMC chains and Phoenicurus as outgroups, since these are the sister lineages to for 20 million generations, with sampling every 1000 generations, our ingroup (Zuccon and Ericson, 2010a; Sangster et al., 2010). yielding 20,000 trees. We used the online version of AWTY Samples were obtained from freshly collected specimens as (Nylander et al., 2008) to assess the convergence of the MCMC well as from museum skins. Table 1 provides a list of the taxa in- chains and to estimate the number of generations to discard as cluded in this study, together with museum accession numbers, ‘‘burn-in’’ (2000 trees). collection localities and Genbank accession numbers. Maximum likelihood searches of the partitioned dataset were The sequences used in this study were obtained in different lab- conducted with RAxML v. 7.0.3 (Stamatakis, 2006) using a oratories for independent projects and merged only at a later stage. GTR + C + I model and random starting tree, with a-shape param- The original projects chose different markers and used samples eters, GTR-rates, and empirical base frequencies estimated and deriving from different individuals, although the species se- optimised for each partition. Nodal support was estimated using quenced were almost the same. In the Stockholm lab, we se- 100 bootstrap replicates. quenced the NADH dehydrogenase subunits II and III (ND2 and Additionally, we compared the phylogenetic signal in the nucle- ND3) and three nuclear loci, intron 11 of the glyceraldehyde-3- ar and mitochondrial genomes analysing two combined datasets, phosphodehydrogenase (GAPDH), intron 2 of the myoglobin gene concatenating the three nuclear and the four mitochondrial loci, (MYO), and introns 6 and 7 of the ornithine decarboxylase (ODC), respectively, applying the same conditions indicated above for while in Paris and Amsterdam, we sequenced ND2, the cytochrome the Bayesian inference. oxidase subunit 1 (COX1) and 16S ribosomal RNA gene (16S). For We compared alternative phylogenetic hypotheses using the Shi- each species sequences in both labs, we used the ND2 sequences modaira–Hasegawa test (SH-test, Shimodaira and Hasegawa, 1999), to compare the genetic distance between the two individuals, sup- as implemented in RAxML v. 7.0.3 (Stamatakis, 2006). The tested M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 35–45 37

Table 1 Samples and sequences included in the phylogenetic analysis, with museum accession numbers and collection localities. The taxonomy follows Dickinson (2003). GenBank accession numbers of sequences published previously are followed by their references. Museum acronyms: BMNH, The Natural History Museum, Tring; IAR, Institute of Avian Research Wilhelmshaven, Vogelwarte Helgoland; MIUT, Museum of Ispahan University of Technology; MNHN, Muséum National d’Histoire Naturelle, Paris; NHMO, Natural History Museum, University of Oslo; NMBV, National Museum, Bloemfontein; NRM, Swedish Museum of Natural History; UMMZ, University of Michigan Museum of Zoology; USNM, United States National Museum, and ZMUC, Zoological Museum of the University of Copenhagen. References: [1] Zuccon and Ericson (2010a); [2] Zuccon and Ericson (2010b); [3] Outlaw et al. (2010); [4] Aliabadian et al. (2007); [5] Glen et al. (2011); [6] Förschler et al. (2010).

Taxon Sample GADPH Myoglobin ODC ND2 ND3 COI 16S ND2* Locality Campicoloides NMBV 06249 GU358973 GU358710 GU358838 GU358779 xxx South Africa, Free State bifasciatus [1] [1] [1] [1] MNHN xxx xxx xxx South Africa RSA073 Cercomela dubia BMNH xxx xxx xxx xxx xxx – – Ethiopia 1902.1.20.89 Cercomela familiaris NRM 680265 GU358974 GU358711 GU358839 GU237102 xxx Botswana, Francistown [1] [1] [1] [2] MNHN xxx xxx xxx South Africa, GA59064 Berfontein Cercomela fusca UMMZ xxx xxx xxx xxx xxx – – India 181352 Cercomela melanura NRM 89950 xxx xxx xxx xxx xxx Israel, Sinai, Wadi Hebran IAR JA12106 xxx xxx xxx Jordan Cercomela schlegelii NRM 89947 xxx xxx xxx xxx xxx – – Angola, Benguella Cercomela scotocerca NRM 89960 xxx xxx xxx xxx xxx – – Eritrea, Cheren Cercomela sinuata NRM RA.02 xxx xxx xxx xxx xxx – – South Africa, Basutoland Cercomela sordida NRM 558924 GU359040 GU358774 GU358905 GU358832 xxx – – Ethiopia, Addis-Abeba [1] [1] [1] [1] Cercomela tractrac BMNH xxx xxx xxx xxx xxx – – Namibia, Witputs 1950.50.434 Myrmecocichla NRM 89928 xxx xxx xxx xxx xxx – – Kenya, Eldoret aethiops Myrmecocichla NRM 558941 xxx xxx xxx xxx xxx – – Sudan, Zande District albifrons Myrmecocichla arnotti NRM 558901 GU359016 GU358751 GU358881 GU358815 xxx – – South Africa, Transvaal [1] [1] [1] [1] Myrmecocichla collaris FMNH – – – HM595025 – – – Tanzania 438821 [5] Myrmecocichla NMBV 06296 xxx xxx xxx xxx xxx South Africa formicivora MNHN xxx xxx xxx South Africa, B038907 Kimberley Myrmecocichla BMNH xxx xxx xxx xxx xxx – – Eritrea, Senafe melaena 1952.25.13 Myrmecocichla nigra NRM 570041 GU359017 GU358752 GU358882 GU237119 xxx – – Angola, Dembos [1] [1] [1] [2] Myrmecocichla BMNH xxx xxx xxx xxx xxx – – Angola, Vouga tholloni 1957.35.276 Oenanthe alboniger MIUT 2003- xxx xxx xxx xxx xxx DQ683480 DQ683446 Iran, Firouz Abad 95(18) [4] [4] Oenanthe bottae NRM 558916 xxx xxx xxx xxx Saudi Arabia, Taik IAR A1147 xxx xxx xxx Ethiopia Oenanthe chrysopygia NRM 896463 xxx xxx xxx xxx xxx Russia, Ordubad MIUT 2003- DQ683481 DQ683447 xxx Iran, Kashan 96(19) [4] [4] Oenanthe cypriaca NRM 553236 xxx xxx xxx xxx xxx – – Cyprus, Ayia Phyla Oenanthe deserti NRM GU359019 GU358754 GU358884 GU237121 xxx Iran, Mashhad 20046660 [1] [1] [1] [2] MIUT 2003- DQ683485 DQ683451 xxx Morocco, Eastern high 99(22) [4] [4] plateaus Oenanthe finschii NRM 896462 xxx xxx xxx xxx xxx Russia, Dzhulfa, BMNH A/ DQ683487 DQ683453 xxx Iran, Firouz Abad 2005.2.11 [4] [4] Oenanthe heuglini MNHN xxx xxx xxx xxx xxx – – Ethiopia 1966.549 Oenanthe hispanica NRM 551781 xxx xxx xxx xxx xxx Spain, Zafra hispanica MNHN 1995- xxx xxx xxx France 104 Oenanthe hispanica DZC xxx xxx xxx xxx xxx Greece, Rhodos melanoleuca 20010729.02 IAR xxx xxx xxx Mali 81418926 Oenanthe isabellina NRM 90181 xxx xxx xxx xxx xxx Eritrea, Gheleb BMNH A/ DQ683492 DQ683458 xxx Iran, Ispahan 2005.2.1 [4] [4]

(continued on next page) 38 M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 35–45

Table 1 (continued)

Taxon Sample GADPH Myoglobin ODC ND2 ND3 COI 16S ND2* Locality Oenanthe leucopyga NRM 90334 xxx xxx xxx xxx xxx Algeria, Ouad Itlou leucopyga IAR HA01112 DQ683508 DQ683474 xxx Morocco, Tazenakht [4] [4] Oenanthe leucopyga NHMO 22655 xxx xxx xxx xxx xxx – – Israel ernesti Oenanthe leucura NRM 90197 xxx xxx xxx xxx xxx Algeria, Tilatou IAR xxx xxx xxx Morocco 82004655 Oenanthe lugens IAR 503 xxx xxx xxx xxx xxx HM046858 HM046838 Morocco, Boumalne halophila [6] [6] Oenanthe lugens IAR 396 xxx xxx xxx xxx xxx HM046860 HM046840 Jordan, Wadi Raman lugens [6] [6] Oenanthe lugens NRM xxx xxx xxx xxx xxx Iran persica 20046701 BMNH A/ DQ683497 DQ683463 xxx Iran, Ispahan 2005.2.7 [4] [4] Oenanthe lugubris IAR 447 xxx xxx xxx xxx xxx HM046871 HM046871 Ethiopia, Jemmu [6] [6] Oenanthe moesta NRM 90315 xxx xxx xxx xxx xxx Algeria, Bordj Saada MIUT 2003- DQ683500 DQ683466 xxx Morocco, Eastern high 103(26) [4] [4] plateaus Oenanthe monacha NRM 90320 xxx xxx xxx xxx xxx Egypt, Suez IAR BG22386 xxx xxx xxx Israel Oenanthe monticola NRM 90042 xxx xxx xxx xxx xxx South Africa, Great Namaqualand MNHN xxx xxx xxx South Africa RSA037 Oenanthe oenanthe NRM 966643 GU359020 GU358755 GU358885 GU358816 xxx Sweden, Stockholm [1] [1] [1] [1] BMNH A/ DQ683502 DQ683468 xxx Iran, Ispahan 2005.2.4 [4] [4] Oenanthe phillipsi MNHN 1974- xxx xxx xxx xxx xxx xxx Ethiopia 1550 Oenanthe picata NRM xxx xxx xxx xxx xxx Iran 20046664 MIUT 2003- DQ683509 DQ683475 Iran, Touran 7.1(27) [4] [4] Oenanthe pileata NRM 90366 xxx xxx xxx xxx xxx Tanzania, Tanga MNHN 36- xxx xxx xxx South Africa, E05 Berfontein Oenanthe pleschanka NRM xxx xxx xxx xxx xxx Sweden (vagrant) 20046694 MIUT 2003- DQ683507 DQ683473 xxx Iran, Dar Gaz 26(30) [4] [4] Oenanthe NHMO 23723 xxx xxx xxx xxx xxx xxx xxx Israel xanthoprymna Thamnolaea NRM GU359034 GU358769 GU358899 GU358828 xxx xxx xxx Nigeria, Jos cinnamomeiventris 20086147 [1] [1] [1] [1] Outgroup Phoenicurus NRM GU359022 GU358757 GU358887 GU237122 xxx Sweden, Stockholm phoenicurus 20016219 [1] [1] [1] [2] MNHN 22-43 xxx xxx xxx France, Ahetze Saxicola rubetra NRM GU359028 GU358763 GU358893 GU237123 xxx Sweden, Stockholm 20016186 [1] [1] [1] [2] ZMUC xxx xxx xxx Denmark, 131941 Kongelunden Saxicola (torquata) NRM 947295 xxx xxx xxx xxx xxx xxx xxx Vietnam stejnegeri Monticola gularis NRM GU359006 GU358741 GU358871 GU237106 xxx Vietnam, Kon Tum 20036789 [1] [1] [1] [2] MNHN JF031 xxx xxx xxx Cambodia Monticola solitarius NRM GU359007 GU358742 GU358872 GU358808 xxx Captivity, unknown 20016756 [1] [1] [1] [1] MNHN 22-33 xxx xxx xxx France, Corsica

* These ND2 sequences were used only to evaluate the intraspecific divergence in the neighbour-joining tree, but they were not included in the phylogenetic analyses.

topologies were obtained enforcing the monophyly of selected taxa mapping them onto the Bayesian topology and calculating the (see Table 3) in the maximum likelihood searches in RAxML. homoplasy and retention indices in PAUPÃ. The characters scores We investigated the congruence of some plumage characters as were retrieved from the literature (Cramp, 1988; Urban et al., well as ecological and behavioural traits with the phylogeny by 1997; Ali and Ripley and Ali, 1998; Panov, 2005; Collar, 2005). M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 35–45 39

Table 2 Sequence characteristics of the seven loci analysed. The numbers of variable and parsimony informative bases are calculated for the ingroup only.

Gene region GAPDH Myoglobin ODC ND2 ND3 COI 16S Alignment length 278 730 673 1041 351 648 544 Number of variable bases (%) 66 (23.7%) 100 (13.7%) 124 (18.4%) 516 (49.6%) 156 (44.4%) 213 (32.9%) 64 (11.8%) Number of parsimony 24 (8.6%) 26 (3.6%) 58 (8.6%) 419 (40.2%) 132 (37.6%) 168 (25.9%) 41 (7.5%) informative bases (%) % A nucleotides (range) 21.1 (19.6–22.6) 28.9 (28.2–32.3) 28.4 (27.6–29.4) 30.3 (28.8–32.0) 27.3 (25.1–29.6) 23.9 (23.0–25.0) 31.0 (29.9–31.7) % C (range) 20.5 (19.3–21.3) 22.8 (20.5–23.2) 16.3 (15.3–16.9) 35.4 (33.9–36.9) 34.8 (31.3–38.2) 35.0 (33.8–36.6) 26.3 (25.3–27.4) % G (range) 33.0 (31.3–34.2) 22.7 (22.1–24.4) 20.4 (18.8–21.2) 11.3 (9.8–12.9) 13.1 (11.4–15.4) 17.2 (16.6–17.9) 21.3 (20.6–22.1) % T (range) 25.3 (24.3–26.6) 25.6 (22.8–26.4) 35.0 (34.0–36.2) 23.0 (21.7–24.6) 24.8 (21.8–27.6) 23.9 (22.8–24.8) 21.4 (20.2–22.5) Selected substitution model HKY + C HKY + C GTR + C + I GTR + C + I GTR + C + I HKY + C + I GTR + C +I

Table 3 However, we noted that three ND2 sequences (Cercomela dubia Comparison of alternative phylogenetic hypotheses using the Shimodaira–Hasegawa GU055396–GU066397 and C. scotocerca GU055410) included in test performed with RAxML. D-ln L: difference in tree likelihood compared to the best Outlaw et al.’s analysis (2010) were deeply different from ours tree. Significant: significantly worse than the best topology, p < 0.05. for the same species and were misplaced in the NJ tree in compar- Topology tested Tree likelihood D-ln L SH- ison to the remaining open-habitat chats. Also one sequence of test Cercomela fusca (GU055403) and one of C. sordida (GU055414) Best tree À26133.237484 Best are quite different from the others from the same species (5.5% Monophyly of Cercomela À26370.053486 À236.816001 Yes and 6.9% p-distance, respectively). An in depth analysis of the se- Monophyly of Myrmecocichla À26224.734982 À91.497498 Yes quences used by Outlaw et al. (2010) revealed that some of them Monophyly of Oenanthe À26441.402422 À308.164938 Yes are likely chimaeras containing fragments belonging to other spe- Monophyly of Pentholaea sensu À26283.823520 À150.586036 Yes Collar (2005) cies of Muscicapidae (see Suppl. materials for details).

3.3. Phylogenetic analysis

The Bayesian tree (Fig. 1) results in a well resolved topology 3. Results with four major clades, where none of the polytypic genera (Cerco- mela, Myrmecocichla and Oenanthe) are monophyletic. Our results 3.1. Gene properties support a clade including Campicoloides bifasciatus and the three southern African sickle-winged chats (Cercomela schlegelii, C. trac- We obtained full sequences for most taxa (Table 1). The nuclear trac, and C. sinuata) (Clade 1 in Fig. 1). In this clade, C. tractrac introns, ND2 and ND3genes were sequenced for all taxa, while for and C. sinuata are sister taxa with 100% bootstrap support. Oenanthe cypriaca, O. heuglini, O. leucopyga ernesti and for most In the clade 2, Cercomela sordida is the basal lineage, followed by Cercomela and Myrmecocichla species we miss COI and 16S. We Thamnolaea cinnamomeiventris and the group of most Myr- checked the possible amplification of pseudogenes translating mecocichla plus Oenanthe monticola. Here Myrmecocichla formicivo- the protein coding genes into amino acids sequences, but we did ra, M. aethiops and M. tholloni form a well defined lineage as well not observe any unexpected stop codons or unusual amino acidic the group M. melaena, M. arnotti and M. collaris, whereas the posi- substitutions. tions of M. nigra and Oenanthe monticola are not supported. The sequence alignment was straightforward, thanks to the lim- The clade 3 comprises exclusively of Oenanthe species. Oenanthe ited number of indels in the three introns and in the 16S gene. The oenanthe, O. pileata, O. bottae, O. heuglini and O. isabellina form a seven genes were concatenated in a single dataset of 4265 bp. Of well defined lineage as well the group composed by O. deserti, O. these 1239 sites were variable (29.1%) and 868 parsimony infor- monacha, O. hispanica hispanica, O. hispanica melanoleuca, O cypri- mative (20.4%). Table 2 presents a summary of the molecular prop- aca and O. pleschanka. Oenanthe hispanica melanoleuca, O cypriaca erties of each partition. and O. pleschanka appear to be closely related, with minimal genet- ic divergence. 3.2. Intraspecific variability The last clade (clade 4) is the most heretogeneous taxonomi- cally, including about half Oenanthe species, Myrmecocichla albi- The NJ tree includes all our ND2 sequences plus the Oenanthe frons and five Cercomela. Myrmecocichla albifrons together with and Cercomela dataset of Outlaw et al. (2010) and a selection of Oenanthe phillipsi form the sister lineage to the remaining species. other Muscicapidae (Suppl. material Fig. S1). In all cases the genet- Four North-African Cercomela form a separate lineage, whereas the ic distance between our sequences for the same taxon was modest Indian C. fusca is sister to Oenanthe picata within a group of mostly (0–0.9%, uncorrected p-distance) and we are confident that concat- Palearctic species. enating the sequences obtained from the two individuals in a sin- The maximum likelihood analysis recovered a topology congru- gle dataset does not affect the results in a species-level analysis as ent with the Bayesian tree. The few observed differences involve the one presented here. the resolution of two polytomies. However, in the ML tree, the Comparing our sequences with other ND2 sequences retrieved nodes involved receive poor support values. from Genbank, we generally observed a very low intraspecific The analysis of the mitochondrial and nuclear datasets recovers divergence in most species. Only Oenanthe finschi, O. hispanica, O. less well-resolved trees, in both the Bayesian and maximum likeli- leucopyga, O. lugens, Cercomela melanura and C. sordida showed hood analyses (Suppl. material Figs. S2 and S3). This is especially higher intraspecific genetic distances (2.0–4.3% p-distance). These true in the nuclear topology, where most nodes have very low sup- results are not surprising since these species are polytypic, with port values. large and fragmented ranges, and thus it is not surprising that they The Shimodaira–Hasegawa test rejected as significantly less might be genetically structured. likely the traditionally defined genera Cercomela, Myrmecocichla 40 M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 35–45

Fig. 1. The majority rule consensus tree obtained from the mixed-model Bayesian analysis of the concatenated dataset. The support values indicated at the node are the posterior probability (threshold 0.70) and the bootstrap support (threshold 70%) obtained from the maximum likelihood analysis, respectively. Brackets and numbers on the right refer to the clades discussed in the text. The tree was edited in MrEnt v.2.2 (Zuccon and Zuccon, 2010). M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 35–45 41 and Oenanthe, as well the genus Pentholaea sensu Collar (2005) 4. Discussion (Table 3). The character mapping onto the Bayesian topology reveals that 4.1. Relationship among the open-habitat chats most analysed traits are highly homoplastic (high homoplasy indi- ces and low retention indices, Fig. 2). Only the choice of nest mete- Open-habitat chats are a morphologically and ecologically rial agrees rather well with the tree topology (homoplasy index cohesive group of genera with unclear phylogenetic relationships 0.60 and retention index 0.86). (Zuccon and Ericson, 2010a; Sangster et al., 2010). Some molecular

Fig. 2. The character states of selected morphological, ecological and behavioural characters have been mapped onto the Bayesian topology (see Fig. 1, outgroup not shown). Brackets and numbers on the right refer to the clades discussed in the text. The homoplasy and retention indices of each character have been estimated using PAUPÃ.? Denotes unknown character states. Sexual dimorphism: sex alike (black) or dichromatic (white). Juvenile plumage: like adult (black) or markedly different from adult (white). Polymorphism: non-polymorphic (white) or polymorphic (black). Nest material: classical (white), nest with twigs (grey) or nest with small pebbles (black). Nest location: on ground, under stone or bush, in hole, but not in burrow (white), nest more or less regularly in (rodent) burrows (grey), or in burrows dug by the birds themselves (black). Migratory behaviour: sedentary (white), partial migrant (grey) or long-distance migrant (black). 42 M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 35–45 studies investigated the relationship among selected taxa (Oenan- M. arnotti. A close relationship of O. monticola with Myrmecocichla the: Aliabadian et al., 2007, Cercomela and Oenanthe: Outlaw et al., is not totally unexpected, as it was already advanced by Tye 2010), but a detailed phylogeny for the entire group was still miss- (1989a), based on similar pattern of white wing-covers, and Wol- ing. With a complete dataset, we are able to provide the first well ters, 1980 proposed to place it in the monotypic genus Dromolaea. resolved phylogenetic hypothesis for all species in the clade. The We confirm the extensive polyphyly in the genera Cercomela congruence between the mitochondrial and nuclear topologies and Oenanthe already observed by Outlaw et al. (2010). Although with the full dataset analysis further supports our results. We are ours and Outlaw et al.’s topologies generally agree, they differ in able to generally confirm the outcomes of previous analyses, but a number of points. With a larger dataset in term of species and the more comprehensive taxon sampling suggests also novel number of characters, we obtained a better resolved topology with relationships. higher nodal support. The composition of the genera Myrmecocichla, Cercomela and Collar (2005) advocated the separation of Cercomela sordida in Oenanthe remained relatively stable overall since Ripley’s revision the monotypic genus Pinarochroa for its longer tarsi and shorter of the Turdidae (1964). Myrmecocichla included only African spe- tail. Outlaw et al. (2010) findings and our results are congruent cies, with black, black-and-white, or dark plumage, Cercomela in placing the species in a distinct lineage, removed from the other was used for mostly greyish or pale brown African and Indian Cercomela. But Outlaw et al. (2010) were unable to resolve its posi- birds, while Oenanthe included more strongly patterned species tion with respect to the other taxa in the clades 1 and 2. Our anal- occurring in both Africa and Eurasia. But none of these currently yses suggest that Cercomela sordida is placed with strong support admitted genera is monophyletic, as already shown by Sangster as the sister taxon to the Thamnolaea cinamomeiventris-Myr- et al. (2010) and Outlaw et al. (2010), suggesting extensive conver- mecocichla group. gence on similar plumage patterns in less closely related species. Tye (1989b) suggested that Oenanthe as currently defined may All the analyses identify four major clades as defined in Fig. 1, not be monophyletic, and he noted similarities with some species with the same branching order. The same lineages and topology of Cercomela. We confirm Tye’s hypothesis: all Oenanthe species, were recovered by Zuccon and Ericson (2010a). Outlaw et al.’s with the exclusion of O. monticola, form a large clade that includes analysis (2010) recovers our clades 3 and 4 as sister lineages, but also Myrmecocichla albifrons and five Cercomela species. the clades 1 and 2 are intermixed. The topological differences with Our topology in clade 3 is virtually identical to Outlaw et al.’s, dif- our results might be due to a low resolution power of the mito- fering only in the relative placement of Oenanthe deserti, either sister chondrial markers in Outlaw et al.’s analysis, suggested also by to O. monacha or to the O. hispanica-pleschanka-cypriaca complex. the lack of support in all basal nodes. However, neither arrangement received a significant support values. The placement of Campicoloides bifasciatus has long been dis- Several Oenanthe species are polytypic and/or polymorphic (Col- puted. This species has been included either in Myrmecocichla lar, 2005). The O. hispanica complex represents a challenging group (Seebohm, 1881), Oenanthe (e.g. Ripley, 1964)orSaxicola (e.g. of forms whose relationships have been recently investigated by Tye, 1989b; Keith et al., 1992), or segregated in its own monotypic Randler et al. (2012). In our tree, the genetic distance among O. genus Campicoloides (e.g. Wolters, 1980; Dickinson, 2003). Illera hispanica melanoleuca, O. pleschanka and O. cypriaca is minimal. et al. (2008), Zuccon and Ericson (2010a) and Sangster et al. Nonetheless playback experiments and the presentation of differ- (2010) confirmed that Campicoloides bifasciatus is not part of Saxi- ent dummy models showed that O. cypriaca responds stronger to cola, but they could not resolve its taxonomic position due to the conspecific stimuli, suggesting that it is already behaviourally dis- limited taxonomic sampling. With a more inclusive dataset, Out- tinct (Randler et al., 2012) and it should be treated as a valid species. law et al. (2010) showed that it is the sister lineage of the three O. hispanica melanoleuca and O. pleschanka are morphologically well sickle-winged chats (Cercomela schlegelii, C. sinuata and C. tractrac) distinct, with limited overlap in both breeding and wintering (Clade 1). Our results support the findings of Outlaw et al. (2010). ranges (Cramp, 1988). However, they are known to hybridize in The genus Myrmecocichla comprises only African species (e.g. the overlap zones (Panov and Ivanitzky, 1975) and further studies Ripley, 1964; Dickinson, 2003), but opinions on its limits have var- are needed to clarify the relationships and the taxonomic status ied. On one side, Myrmecocichla was enlarged to encompass also of the two forms. Instead the west Mediterranean subspecies O. Thamnolaea cinnamomeiventris and T. semirufa (Keith et al., 1992; hispanica hispanica is deeply divergent from the rest of the complex Sibley and Monroe, 1990), on the other Wolters, 1980 resurrected and probably it deserves to be raised to full species. the genus Pentholaea for three species, Myrmecocichla melaena, M. The composition of clade 4, allowing for the differences in taxon albifrons and M. arnotti, restricting Myrmecocichla to the remaining sampling, is congruent with Outlaw et al.’s results. Both studies species. Collar (2005) also used Pentholaea, but applied it to Myr- indicate that Oenanthe phillipsi belong to the basal lineages in this mecocichla albifrons and M. arnotti only. When compared with clade. At the base of the clade falls also two species that have not the other Myrmecocichla species, Collar noted that Pentholaea taxa been sampled before, O. moesta and Myrmecocichla albifrons. are more arboreal, often nest in tree holes, have more elaborate The incongruences between the two studies lie in two main songs and lack a white wing patch. areas, the Cercomela lineages on the one hand, and the position Neither of these taxonomic treatments reflects the real phyloge- of Oenanthe leucura, O. leucopyga and O. alboniger on the other. netic relationships. Our results confirm a close relationship be- According to our results four Cercomela species form a well sup- tween Thamnolaea cinnamomeiventris and Myrmecocichla (clade ported lineage, with the same topology supported also by the nu- 2). However, only seven species of Myrmecocichla are part of this clear and mitochondrial data alone. In Outlaw et al.’s tree clade, together with one species of Oenanthe, O. monticola (clade Cercomela scotocerca and C. dubia branch off first, followed by the 2). Two lineages are well supported: a group with strongly pat- C. familiaris–C. melanura lineage and the remaining taxa. We sus- terned species (Myrmecocichla arnotti, M. collaris and M. melaena) pect that the differences are probably due to the inclusion in Out- and a group characterised by a more mottled plumage (M. formici- law et al.’s dataset of some chimaeric sequences containing regions vora, M. aethiops and M. tholloni). The Oenanthe monticola subspe- belonging to other Muscicapidae species (see Suppl. material S1). cies vary in the relative amount of black, grey and white in the Also the large genetic intraspecific divergences observed by Out- plumage, and the nominotypical subspecies shows a black and law et al. in C. dubia and C. fusca should be treated with caution white plumage quite similar to Myrmecocichla arnotti. Indeed in since these too were estimated on the suspected chimaeric our topology, O. monticola is sister to the lineages containing also sequences. M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 35–45 43

The different relationships among some Oenanthe species more (Fig. 2). But further syntheses of behavioural traits within the likely reflect conflicting signals in the loci analysed, as shown by whole group are needed. the contrasting topologies supported by the nuclear and mitochon- drial trees. 4.3. Notes on plumages Preliminary analyses of the Oenanthe lugens complex disclosed high genetic distances among the various subspecies (Förschler In the open-habitat chats, the sexes are mostly alike in clades 1 et al., 2010), but failed to include other congeneric taxa for a and 4; the situation is mixed in clades 2 and 3 (Fig. 2). The females throughout comparison. Here we show that the different lineages tend to be dull-coloured in species breeding on the ground (e.g. in identified by Förschler et al. (2010) are not the each other closest clade 3), while male-like females (often black or dark brown) are taxon. The Iranian form O. lugens persica is sister to the species pair more frequent in species breeding in holes or in burrows (Panov, O. chrysopygia–O. xanthoprymna, while the nominate O. lugens lu- 2005), but there are exceptions. When the sexes are similar, juve- gens and O. lugens halophila, distributed from Egypt to Iraq, are niles tend to fledge with a plumage that is more or less similar to more basal. Although often considered part of the O. lugens com- the adult plumage. This mainly concerns sedentary species where plex, the Ethiopian O. lugubris appers to be sister to O. leucopyga. families keep close together for some time (clade 4), in particular In the latter taxon the two subspecies, the North African leucopyga when there are cases of helpers and cooperative breeding (clade and the Middle Eastern ernesti, are surprising highly divergent 2). This seems to give some credit to Moreno and Soler, 2011 (4.8% p-distance in ND2), possibly an indication that they should hypothesis that juveniles are more likely to have adult-like plum- be raised to full species. age when they participate to more extended interactions with adults and other youngs. A well known, but still largely unexplained, characteristic of the 4.2. Ecological preferences in the open-habitat chats group is the di- or poly-chromatism of the males (Mayr and Strese- mann, 1950): the males of eighth species, seven of them belonging to The habitats of the different species of the whole group are not the clades 3 and 4, are dimorphic or polymorphic. But this character- very diversified, consisting in most cases in arid landscapes with or istic is also met in an isolated species of clade 2 (Oenanthe monticola). without a low vegetation cover. Few species tolerate a substantial The Homoplasy Indices of the three plumage traits considered here tree cover (Cercomela faminiaris, Thamnolea cinnamomeiventris, are very high, clearly indicating that plumage and colour patterns Myrmecocichla arnotti; although some of them occasionally breed seem to be highly labile between the species of the group, and con- in tree holes: Oenanthe cypriaca, Myrmecocichla albifrons), and this vergences and reversals are frequent, so that it is impossible to rely character is scattered all over the phylogeny. Several species on plumage characters for constructing phylogenies. belonging to different clades can be found at high altitudes (Myr- An example of convergence, among others, is the black-and- mecocichla melanea, Oenanthe oenanthe, O. deserti, O. chrysopygia, white pattern (throat, upper back, and wings black; crown, rump, Cercomela sordida), and about half of the species of clades 3 and and belly white) that can be met with in non-closely related species 4 are long distance or partial migrants. Subtle differences in mor- belonging to clades 3 and 4 (Oenanthe picata, O. lugens, O. pleschan- phometry between species correspond more to behavioural differ- ka, O. monacha). In the open-habitat chats, morphological features ences than to ecological factors (Kaboli et al., 2007), and niche appear more correlated to phylogeny that plumage patterns do conservatism seems to be a common trait of the group (Aliabadian (Kaboli et al., 2007). For example, the split of the former Cercomela et al., 2007). Each of the main clades of our phylogeny can be re- genus in two independent lineages, hardly justified by any striking lated to a dominant habitat-type (Fig. 2): difference in colour pattern, correspond to marked difference in wing morphology. The close relatedness of Oenanthe lugens and O. - the species of clade 1, resident, are typical of South-African chrysopygia, which has never been suspected from the comparison semi-deserts with scant scrubland or heath land (karoo, fyn- of their plumage pattern in former systematic syntheses, is sup- bos), on flat or broken grounds; ported by their close morphological similarity (Kaboli et al., - the species of clade 2, resident and ground dwelling, are mainly 2007). Inversely, the resemblance between the plumages of Oenan- found in flat and short-grass terrains of Africa with or without the oenanthe and O. phillipsi, that has led certain authors to lump scattered bushes or trees and/or termite mounds, on sandy or them in a same superspecies (e.g., Hall and Moreau, 1970; Keith marshy, sometimes rocky (Oenanthe monticola, Myrmecocichla et al., 1992), is a homoplasy that had been suspected from well melanea) substrates. Typically, the Myrmecocichla breed on bur- marked differences in morphometry (Kaboli et al., 2007). But a thor- row which they can dig themselves, or in old nests; ough study of the relationships between plumage evolution, adap- - the species of clade 3 are good fliers and most of them are tation and speciation in the open-habitat chats remain to be made. migratory. They are distributed in three contrasted habitats of Africa and Eurasia: deserts (Oenanthe deserti, O. monacha), 4.4. Taxonomic recommendations steppes (O. bottae, O. isabellina, O. pileata, to some extent O. oenanthe; these species often use rodent burrows as nest sites), On the basis of the results presented here, we recommend to or habitats with a certain degree of woody cover (O. hispanica, redefine the generic limits in the open-habitat chats as the O. pleschanka, O. cypriaca; these species often perch on bushes following: or even on trees; they use to bring twigs at the nest); - the species of clade 4 inhabit as well Arica and Eurasia; except 1. the three sickel-winged chats (Cercomela schlegelii, C. sinuata the three most basal ones, they are typical of broken substrates, and C. tractrac) form a well supported clade for which can be and usually perch on rocks and breed in rock crevices. They resurrected the genus name Emarginata Shelley, 1896 (type spe- share the common habit to carry stones at the nest, a trait that cies Luscinia sinuata Sundevall, 1858), as suggested by Outlaw is only and occasionally found in Oenanthe monticola among the et al. (2010); other chats. 2. Cercomela sordida should be transferred to the monotypic genus Pinarochroa Sundevall, 1872, as suggested by Outlaw et al. Despite their rather high Homoplasy Indices, particular traits (2010); seem to prevail in certain clades (stone-carrying in clade 4, long- 3. the genus Thamnolaea Cabanis, 1850 should be retained for the distance migration in clades 3 and 4, burrow-digging in clade 2) species cinnamomeiventris only while T. semirufa should be 44 M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 35–45

included in the genus Monticola following Zuccon and Ericson References (2010b); 4. Myrmecocichla arnotti, M. collaris, M. melaena, M. nigra, M. form- Akaike, H., 1973. Information theory as an extension of the maximum likelihood principle. In: Petrov, B.N., Csaki, F. (Eds.), Second International Symposium on icivora, M. aethiops, M. tholloni and Oenanthe monticola should Information Theory. Akademiai Kiado, Budapest. be included in the same genus. Two generic names available Ripley, S.D., Ali, S., 1998. Handbook of the Birds of India and Pakistan. vol. 9. Oxford for this taxon were established simultaneously: Myrmecocichla University Press, Oxford, UK. Cabanis, 1850 (type species Oenanthe formicivora Vieillot, Allen, E.S., Omland, K.E., 2003. Novel intron phylogeny (ODC) supports plumage convergence in orioles (Icterus). Auk 120, 961–969. 1818) and Dromolaea Cabanis, 1850 (type species Oenanthe mon- Aliabadian, M., Kaboli, M., Prodon, R., Nijman, V., Vences, M., 2007. Phylogeny of ticola Vieillot, 1818). To our knowledge no precedence have ever Palearctic wheatears (genus Oenanthe) – congruence between morphometric been established between Myrmecocichla and Dromolaea, nor and molecular data. Mol. Phylogenet. Evol. 42, 665–675. Borrow, N., Demey, R., 2001. Birds of Western Africa. Christopher Helm Publishers, Myrmecocichla formicivora and Oenanthe monticola have ever London. been treated as congeneric under either generic names. In agree- Chesser, R.T., 1999. Molecular systematics of the rhinocryptid genus Pteroptochos. ment with the provisions of the International Code of Zoological Condor 101, 439–446. Collar, N., 2005. Family Turdidae (thrushes). In: del Hoyo, J., Elliot, A., Christie, D.A. Nomenclature for simultaneously published names (Art. 24, (Eds.), Handbook of the Birds of the World Cuckoo-Shrikes to Thrushes. Lynx ICZN 1999) and acting as First Reviser, we select the genus name Edicions, Barcelona. Myrmecocichla Cabanis, 1850 to take precedence over Dromolaea Cornwallis L. 1975. The Comparative Ecology of Eleven Species of Wheatear (genus Oenanthe) in S.W. Iran. DPhil thesis, Oxford University. Cabanis, 1850. This choice assures nomenclatural stability since Clements, JF., 2007. The Clements Checklist of Birds of the World, sixth ed. Springer, Myrmecocichla has been consistently applied to the majority of Berlin. species in this clade while Dromolaea has only rarely been con- Cramp, S. 1988. Handbook of the Birds of Europe, the Middle East and North Africa. In: The Birds of Western Palearctic, vol. 5. Oxford University Press, New York. sidered valid and it has been applied only to some Oenanthe taxa; Dickinson, E.C., 2003. The Howard and Moore Complete Checklist of the Birds of the 5. we recommend, for the sake of nomenclatural stability, to apply World, third ed. Christopher Helm. the genus name Oenanthe Vieillot, 1816 to all the species of the Fjeldså, J., Zuccon, D., Irestedt, M., Johansson, U.S., Ericson, P.G.P., 2003. Sapayoa clades 3 and 4, including the former Myrmecocichla albifrons, aenigma: a new world representative of old world suboscines. Proc. R. Soc. London B 270, S238–S241. Cercomela melanura, C. familiari, C. scotocerca, C. dubia and C. Förschler, M., Khoury, F., Bairlein, F., Aliabadian, M., 2010. Phylogeny of the mourning fusca. Alternatively should the clades 3 and 4 in Fig. 1 be found wheatear Oenanthe lugens complex. Mol. Phylogenet. Evol. 56, 758–767. to deserve separate generic or subgeneric status, the valid Glen, R., Bowie, R.C.K., Stolberger, S., Voelker, G., 2011. Geographically structured plumage variation among populations of White-headed Black Chat names would be Campicola Swainson, 1827 (type species Mota- (Myrmecocichla arnotti) in Tanzania confirms the race collaris to be a valid cilla pileata Gmelin, 1789) and Oenanthe Vieillot, 1816 (type taxon. J. Ornithol. 152, 63–70. species Turdus leucurus Gmelin, 1789), respectively. Grabovsky, V.I., Panov, E.N., 1992. Song convergence in pied wheatear (Oenanthe pleschanka) and black-eared wheatear (Ohispanica) in secondary contact zones. Zool. Zhur. 71, 75–84. Hall, B.P., Moreau, R.E., 1970. An atlas of Speciation in African Passerine Birds British Museum (Natural History). British Museum (Natural History), London. Acknowledgments Hebert, P.D.N., Stoeckle, M.A., Zemlak, T.S., Francis, C.M., 2004. Identification of birds through DNA barcodes. PLoS Biol. 2, 1657–1663. The authors are grateful to the museum staffs who provided us Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. samples included in this study: Dawie de Swardt (National Mu- Illera, J.C., Richardson, D.S., Helm, B., Atienza, J.C., Emerson, B.C., 2008. Phylogenetic seum, Bloemfontein, South Africa), Robert Pryˆs-Jones and Mark relationships, biogeography and speciation in the avian genus. Saxicola. Mol. Adams (The Natural History Museum, Tring, United Kingdom), Phylogenet. Evol. 48, 1145–1154. Irestedt, M., Ohlson, J.I., Zuccon, D., Källersjö, M., Ericson, P.G.P., 2006. Nuclear DNA Jan T. Lifjeld and Arild Johnsen (Natural History Museum, Univer- from old collections of avian study skins reveals the evolutionary history of the sity of Oslo), Göran Frisk (Swedish Museum of Natural History, Old World suboscines (Aves, Passeriformes). Zool. Scripta 35, 567–580. Stockholm, Sweden), Janet Hinshaw (University of Michigan, Mu- Irestedt, M., Fjeldså, J., Johansson, U.S., Ericson, P.G.P., 2002. Systematic relationships and biogeography of the tracheophone suboscines (Aves: seum of Zoology, Ann Arbor, USA), Jon Fjeldså (Zoological Museum, Passeriformes). Mol. Phylogenet. Evol. 23, 499–512. University of Copenhagen, Denmark), Kees Roselaar and Tineke Ivanitzky, V.V., 1980. Interspecific relations of sympatric species of wheatears Prins (Zoological Museum, Amsterdam, the Netherlands). Some (Oenanthe, Turdidae, Passeriformes) 2 Behavioural aspects of coexistence in closely related species. Zool. Zhur LIX., 739–749. few additional samples came from the collection of the late An- Kaboli, M., Aliabadian, M., Guillaumet, A., Roselaar, C.S., Prodon, R., 2007. dreas J. Helbig kindly provided by Martin Haase (Zoological Insti- Ecomorphology of the wheatears (genus Oenanthe). Ibis 149, 792–805. tute and Museum, Greifswald, Germany). Our work was further Keith, S.E., Urban, E.K., Fry, C.H., 1992. The Birds of Africa vol. 4 Broadbills to Chats. supported by Franz Bairlein (Institute of Avian Research, Wilhelm- Academic Press, London. Loskot, V.M., 1983. Biology of oriental black-eared wheatear Oenanthe hispanica shaven, Germany) and Fares Khoury (Department of Biological Sci- melanoleuca. Zool. Zhur. 116, 79–107. ences, Hashemite University, Zarqa, Jordan). The staff at the Lynes, H., 1924–1926. On the birds of North and Central Darfur, with notes on the laboratories in Amsterdam (Hans Breeuwer, Lin Dong, Peter Kupe- West-Central kordofan and North nuba Proviances of the Brithish sudan. Ibis 6, 399–446, 648–719; 7, 71–131, 344–416, 758–797; 8, 346–405. rus, Steph Menken, Betsy Voetdijk, Ronald Vonk), Paris (Céline Mayr, E., Stresemann, E., 1950. Polymorphism in the chat genus Oenanthe. Bonillo, Josie Lambourdière) and Stockholm (Bodil Cronholm, Pia Evolution 4, 291–300. Eldenäs, Martin Irestedt, Keyvan Myrbakhsh) provided help and Moreno, J., Soler, J., 2011. Sources of distinctness of juvenile plumage in Western Palearctic passerines. Biol. J. Linn. Soc. 102, 440–454. advice for the experimental work. Financial support to this work Nylander, J.A.A., Wilgenbush, J.C., Warren, D.L., Swofford, D.L., 2008. AWTY (are we was provided by the Ferdowsi University of Mashhad (Grant No. there yet?): a system for graphical exploration of MCMC convergence in 2/18074 to MA), PA Hens Memorial Fund (to MA) and by the Swed- Bayesian phylogenetics. Bioinformatics 24, 581–583. Nylander, JAA. MrModeltest v22 (Program distributed by the author) Uppsala ish Research Council (Grant No. 621-2007-5280 to PE). This work University, Uppsala: Department of Systematic Zoology, 2004 has been in part supported by Genoscope (Evry) as part of the pro- Outlaw, R.K., Voelker, G., Bowie, R.C.K., 2010. Shall we chat? Evolutionary ject ‘Macrophylogeny of life’ (Agreement No. 2005/67). relationships in the genus Cercomela (Muscicapidae) and its relation to Oenanthe reveals extensive polyphyly among chats distributed in Africa India and the Palearctic. Mol. Phylogenet. Evol. 55, 284–292. Palumbi, SR., Martin, A., Romano, S., McMillan, WO., Stice, L., Grabowski, G., 1991. Appendix A. Supplementary material The Simple Fool’s Guide to PCR Version 20 Honolulu Privately published document compiled by S. Palumbi. Department of Zoology, University Hawaii, Supplementary data associated with this article can be found, in 1991. Panov, E.N., 2005. Wheatears of Palearctic Ecology Behaviour and Evolution of the the online version, at http://dx.doi.org/10.1016/j.ympev.2012. Genus Oenanthe. Pensoft Publishers, Sofia. 05.011. M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 35–45 45

Panov, E.N., Ivanitzky, V.V., 1975. Evolutionary and taxonomic relations between Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood based phylogenetic black-eared wheatear Oenanthe hispanica and pied wheatear Oenanthe analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688– pleschanka. Zool. Zhurn. 54, 1860–1873. 2690. Potapova, E.G., Panov, E.N., 1977. Structural patterns of jaw apparatus in wheatears Swofford, D.L., 2003. PAUPÃ Phylogentic Analyses Using Parsimony (Ãand other of the genus Oenanthe, with special reference to the ways of decrease of food methods), Version 4b10. Sinauer associates. competition between closely related species. Zool. Zhurnal. 56, 743–752. Tye, A., 1989a. Superspecies in the genus Oenanthe (Aves, Turdidae). Bonn. Zool. Randler, C., Förschler, M.I., Gonzalez, J., Aliabadian, M., Baierlein, F., Wink, M., 2012. Beitr. 40, 165–182. Phylogeography, pre-zygotic isolation and taxonomic status in the endemic Tye, A., 1989b. The systematic position of the Buff-streaked Chat (Oenanthe/ Cyprus Wheatear Oenanthe cypriaca. J. Orn. 153, 303–312. Saxicola bifasciata). Bull. Brit. Orn. Club. 109, 53–58. Ripley, SD. 1964. Family Muscicapidae Subfamily Turdinae. In: E. Mayr, R.A. Paynter, Urban, E.K., Fry, C.H., Keith, S. (Eds.), 1997. The Birds of Africa, vol. 5. Academic Jr., (Eds.). Check-List of Birds of the World, vol. 10. Mus. Comp. Zool.: Cambridge Press, London. Mass, p. 502. Vaurie, C., 1955. Systematic notes on Palearctic birds No 14 Turdinae: the genera Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3 Bayesian phylogenetic inference Erithacus, Luscinia, Tarsiger, Phoenicurus, Monticola, Erythropygia, and under mixed models. Bioinformatics 19, 1572–1574. Oenanthe. Am. Mus. Novit. 1731, 1–30. Sangster, G., Alström, Forsmark, E., Olsson, U., 2010. Multi-locus phylogenetic Wolters, HE. Die Vogelarten der Erde Lief 6. Hamburg: Paul Parey; 1980, pp. 401– analysis of Old World chats and flycatchers reveals extensive paraphyly at 452. family, subfamily and genus level (Aves: Muscicapidae). Mol. Phylogenet. Evol. Zuccon, A., Zuccon, D., 2010. MrEnt v.2.2. Program distributed by the authors. 57, 380–392. . Seebohm, H. 1881. Catalogue of the Birds in the British Museum, vol. 5 British Zuccon, D., Ericson, P.G.P., 2010a. A multi-gene phylogeny disentangles the chat- Museum (National History). London, flycatcher complex (Aves: Muscicapidae). Zool. Scr. 39, 213–224. Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with Zuccon, D., Ericson, P.G.P., 2010b. The Monticola rock-thrushes: phylogeny and applications to phylogenetic inference. Mol. Phylogenet. Evol. 16, biogeography revisited. Mol. Phylogen. Evol. 55, 901–910. 1114–1116. Zuccon, D., Cibois, A., Pasquet, E., Ericson, P.G.P., 2006. Nuclear and mitochondrial Sibley, C.G., Monroe, B.L., 1990. Distribution and Taxonomy of Birds of the World. sequence data reveal the major lineages of starlings, mynas and related taxa. Yale University Press, New Haven. Mol. Phylogenet. Evol. 41, 333–344.

Supplementary material

Convergent evolution in the open-habitat chat complex (Aves, Muscicapidae: Saxicolinae)

Aliabadian M., M. Kaboli, M.I. Förschler, V. Nijman, A. Chamani, A. Tillier, R. Prodon, E. Pasquet, P.G.P. Ericson, D. Zuccon

1. Re-analysis of Outlaw et al.’s sequences

Comparing our sequences to those analyzed by Outlaw et al. we noticed that while in most intraspecific comparisons the sequences were highly similar, in few cases some regions were anomalously divergent. Using the BLAST search function in Genbank we discovered that these regions were much more similar or identical to other Muscicapidae taxa than to the putative species. Here we present the alignments of the problematic sequences with other conspecific sequences and the putative contaminants. The regions identical to the putative contaminants are highlighted. There are high chances that the following Cercomela sequences were contaminated by other samples during the lab procedures and they should be discarded.

Taxon Accession N Gene Notes Cercomela dubia GU055396 ND2 two regions of 101bp and 125bp identical to two Sheppardia aequatorialis sequences (FN546903 and FN546904) Cercomela fusca GU055403 ND2 a region of 323bp identical to Saxicola torquata (FJ705785) Cercomela melanura GU055454 Cyt b a region of 197bp identical to and a region of 347bp differing by 1.1% from two Cercotrichas leucophrys (AY206915 and HM633270) Cercomela scotocerca GU055410 ND2 a region of 299bp identical to Saxicola torquata (FJ705785) Cercomela scotocerca GU055458 Cyt b two regions of 278bp and 224bp identical to Muscicapa adusta (HM633400) Cercomela sordida GU055414 ND2 it differs by 16.9-18.0% in a region of 261bp from three other sequences of the same species, while the rest of the sequence differs from the others by 3.0- 3.3% only

Cercomela dubia ND2

10 20 30 40 50 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055396_Cercomela_dubia ATGAACCCCCAAGCAAAACTAGTATTCATCATCAGTCTATTTCTAGGGACTACCATCACAATCTCAAGTAACCACTGAATCATAGCCTGAACCGGACTTG GU055397_Cercomela_dubia ...... C..C...... A...... C...... BMNH_Cercomela_dubia ...... G...... A.C....C.TC...CT..C.CA....A..C.....T...... C.....T...G.T.....T...G...... FN546903_Sheppardia_aequatorialis G...... G...... C..CC.C.....A...... T...... C..T...... G....G...... G..C. FN546904_Sheppardia_aequatorialis ...... G...... C..CC.C.....A...... T...... C..T...... G....G...... G..C.

110 120 130 140 150 160 170 180 190 200 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055396_Cercomela_dubia AGATCAACACCCTAGCCATCCTCCCTCTAATCTCAAAATCCCATCATCCACGAGCCATTGAGGCTGCAACCAAATATTTTCTAGTTCAAGCAGCCGCCTC GU055397_Cercomela_dubia ...... T...... A...... C...... BMNH_Cercomela_dubia .A...... T...... C...... G..T..C..C...... T..C..A..C...... C..C...ACC...... T..... FN546903_Sheppardia_aequatorialis .A...... T..G...... C...... C.T.....C...... A...... C.....C...... T..... FN546904_Sheppardia_aequatorialis .A...... T..G...... C..G...... C.T.....C...... A...... C.....C...... T.....

210 220 230 240 250 260 270 280 290 300 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055396_Cercomela_dubia CGCTTTAATCCTATTCTCCAGCATAACTAACGCATGACAAACCGGACAATGAGACATTACCCAACTAACCTCCCCCACATCGTGTCTAGTCTTAACTGCA GU055397_Cercomela_dubia ...... T...... C...... G...... A...... BMNH_Cercomela_dubia .A.CC...... T...... G...... C..A...... T.A...... A..CT..A.T.....C... FN546903_Sheppardia_aequatorialis T..C...C.T...... T...... C...... G.....C...... G...... C...T..A..C...... FN546904_Sheppardia_aequatorialis T..C...C.T...... T...... C...... G.....C...... G...... C...T..A..C......

310 320 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055396_Cercomela_dubia GCCGTTGCAATGAAATTAGGACTAGCCCCATTCCACTTCTGATTCCCAGAAGTGCTTCAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GU055397_Cercomela_dubia ...A...... C.....A..C...... BMNH_Cercomela_dubia ...A.C.....A.xxxxxxxxxxxxxxxxxxxxxxx...... C...A.A..C...... FN546903_Sheppardia_aequatorialis ..TA.C...... G...... T...C.....T...... C.....A..A...... FN546904_Sheppardia_aequatorialis ..TA.C...... G...... T...C.....T...... C.....A..A......

410 420 430 440 450 460 470 480 490 500 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055396_Cercomela_dubia NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAACCCAACCCTCCTGGTCACTATGGCCATCCTCTCTGCAGCACTAGGTGGATG GU055397_Cercomela_dubia ...... BMNH_Cercomela_dubia ...... A.....C..A...... A...... T..A..... FN546903_Sheppardia_aequatorialis ...... T.A..AACA..G..A..T..T..T..A.....C.....A..... FN546904_Sheppardia_aequatorialis ...... T.A..AACA..G..A..T..T..T..A.....C.....A.....

510 520 530 540 550 560 570 580 590 600 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055396_Cercomela_dubia AATGGGGCTAAACCAAACACAAACCCGAAAAATCCTGGCCTTCTCATCCATCTCCCACTTAGGCTGAATGGCCATTATTATTGTCTACAGCCCTAAACTA GU055397_Cercomela_dubia ...... BMNH_Cercomela_dubia ...A...... G...... T...... A...... CA...... FN546903_Sheppardia_aequatorialis ..CT..A...... A...... C...... A...... C.....G....A...C...... FN546904_Sheppardia_aequatorialis ..CT..A...... A...... C...... A.....C..C.....G....A...C......

610 620 630 640 650 660 670 680 690 700 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055396_Cercomela_dubia GCCCTACTAAACTTCTACCTCTACGCCCTGATAACCACAGCCGTATTCTTAACCCTAAACTCAATTAACACCCTAAAACTCTCTACACTAATAACCACAT GU055397_Cercomela_dubia .....G...... BMNH_Cercomela_dubia ...... T...... A...... T...... C. FN546903_Sheppardia_aequatorialis ...... A...... A.....TG....T...... C.TG..T...... A...... A..A..C..T..G...... FN546904_Sheppardia_aequatorialis ...... A...... A.....TG....T...... C.TG..T...... A...... A..A..C..T..G......

710 720 730 740 750 760 770 780 790 800 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055396_Cercomela_dubia GAACAAAAACCCCAGCACTAAGTGCAANNNNNNNNNNNNNCCCTCTCTCCCTCGCAGGCCTACCCCCCTTAACGGGCTTCCTCCCTAAATGACTAATCAT GU055397_Cercomela_dubia ...... T...... G...... TC...... T.....T...C....A..G.....A..C...... BMNH_Cercomela_dubia ...... TC...... G...... A..G.....G..C...... FN546903_Sheppardia_aequatorialis ...... T...... C...... TA...... FN546904_Sheppardia_aequatorialis ...... T...... C...... TA......

810 820 830 840 850 860 870 880 890 900 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055396_Cercomela_dubia TCAAGAACTAACCAAACAAGAAATAGCCCCAGCAGCAACAATCATCGCCCTCCTTTCCCTATTAAGCCTGTTCTTCTACCTACGCCTAGCATATTGCGCA GU055397_Cercomela_dubia CG...... G...... T..T...... C....T...... C...... A...... T...... T.....C...... BMNH_Cercomela_dubia CG.....T...... G...... C..C.....C...C....T...... T..C...... A...... T....T..T.....C...... FN546903_Sheppardia_aequatorialis ...... T...... C..T...... FN546904_Sheppardia_aequatorialis ...... T...... C..T......

910 920 930 940 950 960 970 980 990 1000 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055396_Cercomela_dubia ACAATTACCCTCCCCCCTCACACTACGAACCACATGAAACAGTGGCACACCAATAAACCAACTAACATCCTAGTCGCCATCTTGACTACCATGTCCATCA GU055397_Cercomela_dubia .....C..G...... A..T..GG.A.....T..A...... T.....C..G.....A...... C...... A..T.... BMNH_Cercomela_dubia .....C..A..T.....A.....GG.A...... A...... T.....C..G.....A.....T...... C..G.C.....A..T.... FN546903_Sheppardia_aequatorialis ...... AG...... FN546904_Sheppardia_aequatorialis ...... AG......

1010 1020 1030 ....|....|....|....|....|....|....|... GU055396_Cercomela_dubia CCCTCCTACCCGTTTCACCCATAATCCTCACTATTGTC GU055397_Cercomela_dubia ...... T...... C...... BMNH_Cercomela_dubia ...... A.C..G..T...... FN546903_Sheppardia_aequatorialis ...... A..C...... G...... FN546904_Sheppardia_aequatorialis ...... A..C......

Cercomela fusca ND2

10 20 30 40 50 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055403_Cercomela_fusca TTGAACCCCCAAGCAAAACTAATCTTCACCTCCAGCCTACTCCTAGGAACAACTATCACTATCTCAAGCAACCACTGAATTATAGCCTGAACTGGGCTTG GU055402_Cercomela_fusca A...... C..C..T..A...... G...... T.....C..A.... GU055404_Cercomela_fusca A...... C..C..T..A...... G...... T.....C..A.... UMMZ_Cercomela_fusca A...... G...... G...... C..C..T..A...... G...... T.....C..A.... FJ705785_Saxicola_torquata A...... G...... T......

110 120 130 140 150 160 170 180 190 200 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055403_Cercomela_fusca AAATCAACACCCTAGCTATCCTCCCTTTAATCTCAAAATCCCACCACCCTCGAGCCATCGAAGCCGCAACTAAGTACTTCCTAGTCCAAGCAGCCGCCTC GU055402_Cercomela_fusca ...... TT....C...... C...... G...... G..T.....C...... AC...... GU055404_Cercomela_fusca ...... TT....C...... C...... G...... G..T.....C...... AC...... UMMZ_Cercomela_fusca ...... TT....C...... C...... G...... G..T.....C...... AC...... FJ705785_Saxicola_torquata ......

210 220 230 240 250 260 270 280 290 300 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055403_Cercomela_fusca CACTCTAGTCTTATTCTCCAGCATGACTAACGCATGACAGACCGGGCAATGAGACATCACACAACTGACTTCCCCAACATCATGCTTAATCTTAACTGCA GU055402_Cercomela_fusca ...C...A..C...... A.....T...... A...... T...G....G...... GT..T...... C.G...... C... GU055404_Cercomela_fusca ...C...A..C...... A.....T...... A...... T...G....G...... GT..T...... C.G...... C... UMMZ_Cercomela_fusca ...C...A..C...... A.....T...... A...... T...... G...... GT..T...... C.G...... C... FJ705785_Saxicola_torquata ......

310 320 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055403_Cercomela_fusca GCCCTCGCAATGAAGCTAGGACTAGCCCCCTTCCACTTCTGATTCCCAGAAGTGCTTCAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GU055402_Cercomela_fusca ...G...... A..AT....C....TT...... C.....A..C...NN...... GU055404_Cercomela_fusca ...G...... A..AT....C....TT...... C.....A..C...... UMMZ_Cercomela_fusca ...G...... A..AT....C....TT...... T..G..A..C...... FJ705785_Saxicola_torquata ...... C.....C......

410 420 430 440 450 460 470 480 490 500 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055403_Cercomela_fusca NNNNNNNNNNNNNNNNNNNNCTACTCTTTATAGTCTCCCAATCACTAAATCCAACCCTCCTAGTTACTATGGCAATTCTCTCTGCAGCACTAGGAGGATG GU055402_Cercomela_fusca ...... NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GU055404_Cercomela_fusca ...... UMMZ_Cercomela_fusca ...... FJ705785_Saxicola_torquata ...... C...... T...... C.....T.....GAC.G.C..A..G.....T..C...... T....G..G..

510 520 530 540 550 560 570 580 590 600 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055403_Cercomela_fusca AATAGGGCTAAACCAAACACAAACCCGAAAAATCATGGCCTTCTCGTCTATCTCCCACTTAGGCTGAATAGCCATTGTCATCATCTACAGCCCTAAACTA GU055402_Cercomela_fusca NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GU055404_Cercomela_fusca ...... UMMZ_Cercomela_fusca ...... C...... C...... G...... FJ705785_Saxicola_torquata ...... A...... T....T.....A..C..T...... G..T..CA.T...G.T...... C......

610 620 630 640 650 660 670 680 690 700 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055403_Cercomela_fusca GCCCTACTAAACTTCTACCTCTACGCCTTAATGACCACAGCCGTATTCTTAACCCTAAATGCAATTAACACCCTAAAACTCTCCACACTAATAACCACAT GU055402_Cercomela_fusca NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...... C. GU055404_Cercomela_fusca ...... T...... UMMZ_Cercomela_fusca ...... T...... G...... Y....Y...... C. FJ705785_Saxicola_torquata ...... T...A.T.....A...G...... G...... CT....C...... T..T.....C.....T....

710 720 730 740 750 760 770 780 790 800 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055403_Cercomela_fusca GAACAAAAACCCCAGCACTAAGCGCAACTCTAATACTAACCCTTCTCTCCCTCGCGGGCCTGCCCCCCCTAACAGGGTTCCTACCCAAATGACTGATCAT GU055402_Cercomela_fusca ...... T...... GU055404_Cercomela_fusca ...... UMMZ_Cercomela_fusca ...... Y...... FJ705785_Saxicola_torquata ...... G.CT...... G.T...... A.....T.....TT...... C.....G..T...... A..T..

810 820 830 840 850 860 870 880 890 900 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055403_Cercomela_fusca CGAAGAGCTAACCAAACAAGGGATGGCCCCCGCCGCAACAATCATCGCCCTCCTCTCTCTACTAAGCCTGTTCTTTTACCTGCGCCTCGCATACTGCGCA GU055402_Cercomela_fusca ...... T...... GU055404_Cercomela_fusca ...... UMMZ_Cercomela_fusca ...... FJ705785_Saxicola_torquata ...... A...... AA..A.....A..A...... T...... T.A.....C.....A...... T...

910 920 930 940 950 960 970 980 990 1000 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055403_Cercomela_fusca ACAATCACACTTCCCCCACACACGACAAACCACATAAAACAATGGCATACTAACAAGCCAACAAACATTTTAGTTGCTGTCCTGGCCACTATATCTATCA GU055402_Cercomela_fusca ...... GU055404_Cercomela_fusca ...... UMMZ_Cercomela_fusca ...... FJ705785_Saxicola_torquata ...... C...... T...... A..C...... A.....C.C...CC...... CA.TT...T...... C....

1010 1020 1030 ....|....|....|....|....|....|....|... GU055403_Cercomela_fusca CCCTCCTGCCCATTTCACCTATAATCCTCACTGTTGTC GU055402_Cercomela_fusca ...... GU055404_Cercomela_fusca ...... UMMZ_Cercomela_fusca ...... FJ705785_Saxicola_torquata ...... A..AGCC...... T...... A.....

Cercomela melanura cytochrome b

10 20 30 40 50 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055454_Cercomela_melanura TCCCTAGCCTTCAACTCAGTCGCCCACATATGTCGAAACGTACAATTCGGCTGATTAATCCGCAATCTCCATGCAAACGGAGCTTCATTCTTCTTCATCT GU055453_Cercomela_melanura ...... G...T...... C...... G..T..A...... T..A..C.....C...... C.....T...... HM633267_Cercomela_melanura ...... G...T...... C...... G..G..T..A...C....T..A..C.....C...... C.....T...... AY206915_Cercotrichas_leucophrys ...... A.....T..G..C...... HM633270_Cercotrichas_leucophrys ...... A.....T..G..C......

110 120 130 140 150 160 170 180 190 200 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055454_Cercomela_melanura GCATCTACCTACACATTGGCCGAGGATTCTACTACGGCTCCTACCTAAACAAAGAAACCTGAAACATCGGAGTCATCCTCCTCCTAACACTAATAGCAAC GU055453_Cercomela_melanura ...... C...... G.A...... T..GGTC..C..G..... HM633267_Cercomela_melanura ...... G.....C...... T...... T...... TG.A...... A.....GGTC..C..G..... AY206915_Cercotrichas_leucophrys ...... HM633270_Cercotrichas_leucophrys ......

210 220 230 240 250 260 270 280 290 300 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055454_Cercomela_melanura CGCCTTCGTAGGATACGTACTCCCCTGAGGCCAAATATCATTCTGAGGGGCTACAGTAATCACCAACCTATTCTCAGCAATCCCGTACATCGGCCAAACA GU055453_Cercomela_melanura ...... C.....C...... T...... HM633267_Cercomela_melanura T...... C.....C...... G..C...... T...... G AY206915_Cercotrichas_leucophrys ...... A...... C...... T...... T...... HM633270_Cercotrichas_leucophrys ...... A...... C...... T...... T......

310 320 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055454_Cercomela_melanura CTAGTAGAATGAGTTTGAGGCGGATTCTCAGTAGACAACCCCACATTAACCCGATTCTTTGCCCTCCACTTCCTACTTCCATTCCTCATCGTCGGTCTCA GU055453_Cercomela_melanura ...... C...... HM633267_Cercomela_melanura ...... C...... C...... C..C...... AY206915_Cercotrichas_leucophrys ...... CC.....A.....T..G.....T.....T...C....T...... C...T.A...... C...... G.T..T.CA..C.... HM633270_Cercotrichas_leucophrys ...... CC.....A.....T..G.....T.....T...C....T...... C...T.A...... C...... G.T..T.CA..C....

410 420 430 440 450 460 470 480 490 500 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055454_Cercomela_melanura CACTAGTCCACCTCACATTCCTACACGAAACAGGCTCAAACAACCCACTAGGCATCCCTGCAGACTGCGACAAAATCCCATTCCACCCATACTACTCCAC GU055453_Cercomela_melanura ...... C...... T...... G...... GT HM633267_Cercomela_melanura ...... C.....G...... GT AY206915_Cercotrichas_leucophrys ...... T...... G...... T.....T...... T.. HM633270_Cercotrichas_leucophrys ...... T...... G...... T.....T...... T..

510 520 530 540 550 560 570 580 590 600 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055454_Cercomela_melanura AAAAGACATCCTGGGATTTGCACTAATACTCATCCCCCTCGTCGCCCTAGCCCTATTCTACCCCAACCTCCTAGGAGACCCAGAAAACTTTACACCAGCC GU055453_Cercomela_melanura ...... A...... C...... C...... G...... C...T.....A.....C...... C...... T HM633267_Cercomela_melanura ...... A...... C...... G...... C...... A.....C...... C..G.....T AY206915_Cercotrichas_leucophrys ...... A...A..T...... T...... HM633270_Cercotrichas_leucophrys ...... A...A..T...... T......

610 620 630 640 650 660 670 680 690 700 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055454_Cercomela_melanura AACCCACTAGCCACACCACCCCACATCAAACCAGAATGATACTTCCTATTCGCATACGCTATCCTACGCTCCATCCCAAACAAACTAGGAGGAGTACTAG GU055453_Cercomela_melanura ...... C..A...... C...... C...... HM633267_Cercomela_melanura ...... G..C..A...... C...... T...... C...... G..C.... AY206915_Cercotrichas_leucophrys ...... T...... T...... HM633270_Cercotrichas_leucophrys ...... T...... T......

710 720 730 740 750 760 770 780 790 800 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055454_Cercomela_melanura CACTAGCCGCCTCCGTCCTAGTCCTATTCCTAGCCCCCTTACTCCACACATCTAAACTACGCTCACTGACCTTCCGACCAATCTCCCAAATTCTGTTCTG GU055453_Cercomela_melanura .C.....T...... TA....AC.C..A...... C....A...... A.A...... C.....A...G.C..A..... HM633267_Cercomela_melanura .C.....T..A.....A..G...... TA.T..AC....A...... C...... A...... T.....A...G.C..C..... AY206915_Cercotrichas_leucophrys ...... T...... C...... HM633270_Cercotrichas_leucophrys ...... T...... C......

810 820 830 840 850 860 870 880 890 900 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055454_Cercomela_melanura AGCCCTAGTCGCCAATCTACTAATCTTAACCTGAGTAGGAAGCCAGCCAGTCGAACACCCATTCATCATTATCGGCCAACTAGCCTCCTTATCCTACTTC GU055453_Cercomela_melanura .A...... T.....C..C..C...C...... A.....T...... C...... C.ATA------HM633267_Cercomela_melanura ...... C..CT.C...C...... A.....A...... C..T...... T...C....T...... AY206915_Cercotrichas_leucophrys ...... HM633270_Cercotrichas_leucophrys ......

910 920 930 940 950 ....|....|....|....|....|....|....|....|....|....|....|... GU055454_Cercomela_melanura ACTATCATCCTAATCCTATTCCCACTTGCAGCTGTACTAGAGAACAAAATACTAAAAC GU055453_Cercomela_melanura ------HM633267_Cercomela_melanura ..A.....T...... C...... AY206915_Cercotrichas_leucophrys ...... TG...... HM633270_Cercotrichas_leucophrys ...... TG......

Cercomela scotocerca ND2

10 20 30 40 50 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055410_Cercomela_scotocerca ATGAACCCCCAAGCAAAACTAATCTTCACCTCCAGCCTACTCCTAGGAACAACCATCACTATCTCAAGCAACCACTGAATTATAGCCTGAACTGGGCTTG NRM_Cercomela_scotocerca ...... G...... T.....A...... C.....T..A...... G...... T...G.C..A.... FJ705785_Saxicola_torquata ...... G...... T...... T......

110 120 130 140 150 160 170 180 190 200 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055410_Cercomela_scotocerca AAATCAACACCCTAGCTATCCTCCCTTTAATCTCAAAATCCCACCACCCTCGAGCCATCGAAGCCGCAACTAAGTACTTCCTAGTCCAAGCAGCCGCCTC NRM_Cercomela_scotocerca ...... T.....C...... CC...... T...... A.....T...... C...... AC...... T..... FJ705785_Saxicola_torquata ......

210 220 230 240 250 260 270 280 290 300 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055410_Cercomela_scotocerca CACTCTAGTCTTATTCTCCAGCATGACTAACGCATGACAGACCGGGCAATGAGACATCACACAACTGACTTCCCCAACATCATGCTTAATCTTAACTGCA NRM_Cercomela_scotocerca ...C...A..C...... A.....T...... A...... A....G...C...... C....T.....C... FJ705785_Saxicola_torquata ......

310 320 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055410_Cercomela_scotocerca GCCCTCGCAATGAAGCTAGGACTAGCCCCCTTCCACTTCTGATTCCCCGAAGTACTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NRM_Cercomela_scotocerca ...A...... A..AT...... G.TT...... FJ705785_Saxicola_torquata ...... C..T......

410 420 430 440 450 460 470 480 490 500 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055410_Cercomela_scotocerca NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NRM_Cercomela_scotocerca ...... FJ705785_Saxicola_torquata ......

510 520 530 540 550 560 570 580 590 600 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055410_Cercomela_scotocerca NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NRM_Cercomela_scotocerca ...... FJ705785_Saxicola_torquata ......

610 620 630 640 650 660 670 680 690 700 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055410_Cercomela_scotocerca NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAAAACTCTCCACACTAATAACCACCT NRM_Cercomela_scotocerca ...... T...... T..... FJ705785_Saxicola_torquata ...... T..T.....C.....T..A.

710 720 730 740 750 760 770 780 790 800 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055410_Cercomela_scotocerca GAACAAAAACCCCAGCACTAAGCGCAGCCCTAATACTAACCCTCCTCTCCCTCGCAGGTCTACCTCCCCTAACAGGGTTCCTACCCAAATGACTAATCAT NRM_Cercomela_scotocerca ...... T...A...... C.....C...... A.....G...... FJ705785_Saxicola_torquata ...... T...... G.T..T...... C..T..C..TT...... C.....G..T...... T..

810 820 830 840 850 860 870 880 890 900 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055410_Cercomela_scotocerca CGAAGAGCTAACCAAACAAGGAATAGCCCCTGCTGCAACAATCCTCGCCCTCCTTTCCCTACTAAGCCTGTTCTTCTACTTACGCCTTGCATACTGCGCA NRM_Cercomela_scotocerca ...... AT...... G...... C..C.....C..T...... T...... T...... FJ705785_Saxicola_torquata ...... A...... A...... A..A...... A...... T...... T.A...... C...... C...... T...

910 920 930 940 950 960 970 980 990 1000 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055410_Cercomela_scotocerca ACAATCACACTCCCCCCGCATACGGCAAACCATATAAAACAGTGGCATACCAACAAGCCAACAAACATCCTAGTCGCCATCCTGACTACCATATCTATCA NRM_Cercomela_scotocerca ...... T.....A..C...... C...... T..T...... G.C.....G...... FJ705785_Saxicola_torquata ...... A..C..TA...... C...... A..A..C..T.....A.....C.C...... T.....TT..GTC..T.....C....

1010 1020 1030 ....|....|....|....|....|....|....|... GU055410_Cercomela_scotocerca CCCTCCTACCCGTCTCACCTATAATCCTCACCATTGTC NRM_Cercomela_scotocerca ...... A...... T...... FJ705785_Saxicola_torquata ...... A.C...... T.....T......

Cercomela scotocerca cytochrome b

10 20 30 40 50 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055458_Cercomela_scotocerca TTAGCCACACACTACACAGCAGACACCTCCCTAGCCTTCAACTCAGTCGCCCACATATGCCGAAACGTACAATTCGGCTGACTAATCCGAAATCTACACG HM633400_Muscicapa_adusta C......

110 120 130 140 150 160 170 180 190 200 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055458_Cercomela_scotocerca CAAATGGAGCTTCATTCTTCTTCATCTGTATCTACTTCCACATCGGCCGAGGATTCTACTATGGCTCCTACTTAAACAAAGAAACCTGAAACATCGGAGT HM633400_Muscicapa_adusta ......

210 220 230 240 250 260 270 280 290 300 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055458_Cercomela_scotocerca CATCCTCCTCCTCACCCTAATAGCAACCGCCTTCGTAGGGTACGTCCTCCCTTGAGGACAGATATCCTTCTGAGGGGCTTCAGTAATCACCAACCTATTC HM633400_Muscicapa_adusta ...... A...... T......

310 320 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055458_Cercomela_scotocerca TCAGCAATCCCCTACATTGGCCAAACACTAGTAGAATGACTCTGAGGGGGATTCTCAGTAGATAACCCCACATTAACTCGATTCTTTGCCCTCCACTTCC HM633400_Muscicapa_adusta ...... G.A.....G.....T...... GCT...... C...... C..C...... CC.C..C...... C.....A......

410 420 430 440 450 460 470 480 490 500 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055458_Cercomela_scotocerca TACTTCCATTCCTCATCGTAGGCCTCACACTAGTTCACCTCACATTCCTCCACGAAACAGGCTCAAACAACCCACTAGGCATTCCCGCGGACTGCGACAA HM633400_Muscicapa_adusta ...... G...... C..T..A...... C.....A......

510 520 530 540 550 560 570 580 590 600 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055458_Cercomela_scotocerca AATCCCATTCCACCCATACTACTCCGTAAAAGACATCCTAGGATTTGCACTCATGCTCATCCCCTTCGTAGCCCTAGCCCTGTTCTCCCCCAACCTACTA HM633400_Muscicapa_adusta ...... AC...... T.....AA...... TAC....CT...... A...... T..

610 620 630 640 650 660 670 680 690 700 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055458_Cercomela_scotocerca GGCGACCCAGAAAACTTCACACCAGCTAACCCACTAGCCACACCCCCCCACATCAAACCCGAATGATACTTCCTATTCGCATACGCCATCCTACGCTCCA HM633400_Muscicapa_adusta ..A.....T...... C...... G..T...... T......

710 720 730 740 750 760 770 780 790 800 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055458_Cercomela_scotocerca TCCCAAACAAACTAGGAGGAGTACTAGCCCTAGCCGCCTCCGTTCTGGTCCTATTCCTAGCTCCCCTCCTACATACATCCAAACTACGCTCACTAACCTT HM633400_Muscicapa_adusta ......

810 820 830 840 850 860 870 880 890 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|... GU055458_Cercomela_scotocerca CCGACCAATCTCGCAAGTCCTATCCTGAGCTCTAGTCACTAACCTACTAATCCTCACCTGAGTGGGAAGCCAACCAGTTGAACACCCCTTCATCATCA HM633400_Muscicapa_adusta ...... T...... C...... A......

Cercomela sordida ND2

10 20 30 40 50 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055414_Cercomela_sordida ATGAACCCCCAAGCAAAACTAATCTTCATCTCCAGCCTACTCCTAGGAACCACCATCACAATCTCAAGCAGCCACTGAATCATAGCCTGAGCCGGACTCG GU055415_Cercomela_sordida ...... A...... G.....G.... GU055416_Cercomela_sordida ...... GC...... T. NRM_Cercomela_sordida ...... T...... T...... A......

110 120 130 140 150 160 170 180 190 200 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055414_Cercomela_sordida AAATCAACACCCTAGCCATCCTCCCCTTAATTTCAAAATCTCACCACCCGCGAGCCATCGAGGCCGCAACCAAATACTTCCTAGTCCAGGCAGCTGCCTC GU055415_Cercomela_sordida ...... A...... A...... GU055416_Cercomela_sordida ...... G...... A...... A...... A...... NRM_Cercomela_sordida ...... G......

210 220 230 240 250 260 270 280 290 300 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055414_Cercomela_sordida CACTTTAATCCTATTCTCTAGCATAGCCAATGCGTGACAGACCGGACAATGAGACATCGCACAACTAACCTGTCCTACGTCATGTCTAGTCCTAACCACA GU055415_Cercomela_sordida ...... T...... C...... A...... A...... G.....T...... GU055416_Cercomela_sordida ...... T...... A...... A...... G.....T...... NRM_Cercomela_sordida ...... A...... G...... C......

310 320 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055414_Cercomela_sordida GCCATCGCAATAAAATTAGGACTAGTCCCCTTCCACTTCTGATTCCCCGAAGTACTCCAAGGCACCTCACTTACCACAGGTCTCCTCCTATCCACAGCCA GU055415_Cercomela_sordida ...... NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GU055416_Cercomela_sordida ...... G...... NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NRM_Cercomela_sordida ...... T..T..C..A.TA..T..C......

410 420 430 440 450 460 470 480 490 500 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055414_Cercomela_sordida TAAAACTTCCACCAATAGCACTGCTCTTTATGACCTCCCAAGCACTTAACCCCACACTTCTAATTACCATGGCCATTATTTCCGCAGCCTTAGGGGGATG GU055415_Cercomela_sordida NNNNNNNN..C...... A.C...... A.....T..GT....A.....A.TT..C....C.G...... CC...... GC...CA..G.. GU055416_Cercomela_sordida NNNNNNNNNNNNNNNNNNNC...... A.....T..GT....A.....A.T...C....C.G...... CC...... AC...CA..G.. NRM_Cercomela_sordida ...... C..C...... A.C...... A.....T..GT....A.....A.....C....C.G.T..A.....CC.C...... AC...CA..G..

510 520 530 540 550 560 570 580 590 600 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055414_Cercomela_sordida AACAGGACTAAACCAGACACAAACCCGAAAAATCCTAGCTTTTTCATCTATCTCCCACTTAGGCTGAATGGCTATCATCATTGTCTACAGCCCCAAACTA GU055415_Cercomela_sordida ..T...... A...... C...... G.....C.....C..T...... C...... A..C...... T.....T...T.. GU055416_Cercomela_sordida ..T....T...... A...... C...... G.....C.....C..T...... C...... A..C...... T.....T...T.. NRM_Cercomela_sordida ..T...... A...... C...... G.....C.....C...... C...... A..C...... T.....T......

610 620 630 640 650 660 670 680 690 700 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055414_Cercomela_sordida GCCCTACTAAACTTCTATCTGTACATTCTAATAACCGCAGCTGTATTCCTCACCCTAAATTCAATTAAAACCCTAAAACTCTCCACACTAATAACCACCT GU055415_Cercomela_sordida ...... T...... C..C...... A....C.....TT.A..T.....C.....C..C...... GU055416_Cercomela_sordida ...... T...... C..C...... A....C.....TT.A..T.....C.....C..C...... T...... T.... NRM_Cercomela_sordida ..T..GT...... C..T...... A....C.....TT.A..T.....C.....C..C...... T....

710 720 730 740 750 760 770 780 790 800 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055414_Cercomela_sordida GAACAAAAACCCCAGCACTGAGTGCAACCCTAATACTGATGCTTCTCTCCCTCGCAGGACTCCCTCCCTTAACAGGCTTCCTGCCCAAATGACTAATCAT GU055415_Cercomela_sordida ...... G...... A...... GU055416_Cercomela_sordida ...... A...... NRM_Cercomela_sordida ...... G...... C......

810 820 830 840 850 860 870 880 890 900 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055414_Cercomela_sordida CGAAGAGCTAACCAAACAAGAAATAGCCCCAGCAGCAACAATCATCGCCCTTCTTTCCCTACTAAGCCTGTTCTTCTACCTGCGCCTTGCATACTGTGCA GU055415_Cercomela_sordida ...... G...... G...... GU055416_Cercomela_sordida ...... G...... NRM_Cercomela_sordida ...... G...... A......

910 920 930 940 950 960 970 980 990 1000 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GU055414_Cercomela_sordida ACAATCACACTCCCCCCACACACGACAAACCACATAAAACAATGACACACTAACAAGCCAACCAACATCCTGATCGCCATCCTGGCCACTATGTCCATCA GU055415_Cercomela_sordida ...... T...... A...... A...... AG...... A..T.... GU055416_Cercomela_sordida ...... T...... A...... A...... AG...... A..T.... NRM_Cercomela_sordida ...... A...... AG......

1010 1020 1030 ....|....|....|....|....|....|....|... GU055414_Cercomela_sordida CCCTTCTACCCATCTCACCTATAATCCTGACTATTGTC GU055415_Cercomela_sordida ...... G...... GU055416_Cercomela_sordida ...... NRM_Cercomela_sordida ......

Table S1. Additional Muscicapidae taxa used in the ND2 tree with the Genbank accession numbers.

Taxon Accession N ND2 Locality Cercotrichas coryphaeus MNHN A21745 JX256050 South Africa Chaimarrornis leucocephalus MNHN 14-15 JX256051 China Copsychus malabaricus MNHN JF 0305 JX256052 Cambodge Copsychus saularis MNHN 04-8H JX256053 Thailand Cyornis banyumas MNHN 04-9F JX256054 Thailand Enicurus leschenaulti MNHN 04-9B JX256055 Thailand Erithacus rubecula MNHN 1995-31 JX256056 France Ficedula tricolor MNHN 15-49 JX256057 China Hodgsonius phoenicuroides MNHN 18-34 JX256058 China Irania gutturalis MNHN 36-I02 JX256059 Iran Luscinia cyane MNHN 05-29 JX256060 Laos Monticola saxatilis MNHN 36-I04 JX256062 Iran Muscicapa striata MNHN 1996-24 JX256064 France Pseudalethe poliocephala MNHN 01-11 JX256049 Cameroon Rhyacornis fuliginosus MNHN 14-52 JX256066 China Sheppardia gabela MNHN GA94302 JX256068 Angola Styphrornis erythrothorax MNHN 1998-786 JX256069 Cameroon Tarsiger cyanurus MNHN 16-1F JX256070 China

Figure S1. Neighbour-joining tree obtained from the combination of all open-habitat chat ND2 sequences, with a selection of other Muscicapidae. The sequences obtained by us for this study are indicated in blue. The putative chimaeric sequences used by Outlaw et al. (2010) are in red.

Figure S2. Topologies obtained from the mixed-model Bayesian analysis of the concatenated mitochondrial (left) and nuclear (right) genes. The posterior probability values are indicated at the node (threshold 0.80).

Molecular Phylogenetics and Evolution 65 (2012) 1017–1019

Contents lists available at SciVerse ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier.com/locate/ympev

Erratum Erratum to: Convergent evolution of morphological and ecological traits in the open-habitat chat complex (Aves, Muscicapidae: Saxicolinae) [Molecular Phylogenetics and Evolution 65 (2012) 35–45] ⇑ Mansour Aliabadian a,b, , Mohammad Kaboli c, Marc I. Förschler d, Vincent Nijman e, Atefeh Chamani f, Annie Tillier g, Roger Prodon h, Eric Pasquet g,i, Per G.P. Ericson j, Dario Zuccon k,g a Department of Biology, Faculty of Sciences, Ferdowsi University of Mashhad, Mashhad, Iran b Netherlands Centre for Biodiversity Naturalis, Section Zoological Museum of Amsterdam (ZMA), University of Amsterdam, Mauritskade 57, 1092 AD Amsterdam, The Netherlands c Department of Fisheries and Environmental Sciences, College of Agricultural and Natural Resources, University of Tehran, P.O. Box 4111, Karaj, Iran d Institute of Avian Research, ‘‘Vogelwarte Helgoland’’, An der Vogelwarte 21, 26386 Wilhelmshaven, Germany e Oxford Brookes University, School of Social Sciences and Law, Department of Anthropology and Geography, OX3 0BP Oxford, United Kingdom f Department of Environment, Faculty of Agriculture and Natural Resources, Khorasgan (Isfahan) Branch, Islamic Azad University, Isfahan, Iran g UMS 2700 – CNRS, Service de Systématique Moléculaire, Muséum National d’Histoire Naturelle, CP26, 57 rue Cuvier, F-75231 Paris Cedex 05, France h Laboratoire Ecologie et Biogéographie des Vertébrés (EPHE), Centre d’Ecologie Fonctionnelle et Evolutive, UMR 5175, 1919 route de Mende, 34293 Montpellier Cedex 5, France i UMR 7205 – CNRS, Muséum National d’Histoire Naturelle, CP51, 57 rue Cuvier, F-75231 Paris Cedex 05, France j Department of Vertebrate Zoology, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden k Molecular Systematics Laboratory, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden

Molecular Phylogenetics and Evolution, Volume 65, Issue 1, Förschler, M., Khoury, F., Bairlein, F., Aliabadian, M., 2010. Phylogeny of the October 2012, Pages 35–45. mourning wheatear Oenanthe lugens complex. Mol. Phylogenet. Evol. 56, 758– 767. In our paper about the phylogeny of the open-habitat chat com- Glen, R., Bowie, R.C.K., Stolberger, S., Voelker, G., 2011. Geographically structured plex inadvertently the GenBank accession numbers of all newly plumage variation among populations of White-headed Black Chat generated sequences presented in Table 1 were left out. We here (Myrmecocichla arnotti) in Tanzania confirms the race collaris to be a valid taxon. J. Ornithol. 152, 63–70. provide a corrected version of this Table. We would like to apolo- Outlaw, R.K., Voelker, G., Bowie, R.C.K., 2010. Shall we chat? Evolutionary gize for any inconvenience this may have caused to the readers of relationships in the genus Cercomela (Muscicapidae) and its relation to the journal. Oenanthe reveals extensive polyphyly among chats distributed in Africa India and the Palearctic. Mol. Phylogenet. Evol. 55, 284–292. Zuccon, D., Ericson, P.G.P., 2010a. A multi-gene phylogeny disentangles the chat References flycatcher complex (Aves: Muscicapidae). Zool. Scr. 39, 213–224. Zuccon, D., Ericson, P.G.P., 2010b. The Monticola rock-thrushes: phylogeny and Aliabadian, M., Kaboli, M., Prodon, R., Nijman, V., Vences, M., 2007. Phylogeny of biogeography revisited. Mol. Phylogenet. Evol. 55, 901–910. Palearctic wheatears (genus Oenanthe) – congruence between morphometric and molecular data. Mol. Phylogenet. Evol. 42, 665–675.

DOI of original article: http://dx.doi.org/10.1016/j.ympev.2012.05.011 ⇑ Corresponding author at: Department of Biology, Faculty of Sciences, Ferdowsi University of Mashhad, P.O. Box 1436, Iran. E-mail addresses: [email protected], [email protected] (M. Aliabadian).

1055-7903/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ympev.2012.08.020 1018 M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 1017–1019

Table 1 Samples and sequences included in the phylogenetic analysis, with museum accession numbers and collection localities. The taxonomy follows Dickinson (2003). GenBank accession numbers of sequences published previously are followed by their references. Museum acronyms: BMNH, The Natural History Museum, Tring; IAR, Institute of Avian Research Wilhelmshaven, Vogelwarte Helgoland; MIUT, Museum of Ispahan University of Technology; MNHN, Muséum National d’Histoire Naturelle, Paris; NHMO, Natural History Museum, University of Oslo; NMBV, National Museum, Bloemfontein; NRM, Swedish Museum of Natural History; UMMZ, University of Michigan Museum of Zoology; USNM, United States National Museum, and ZMUC, Zoological Museum of the University of Copenhagen. References: [1] Zuccon and Ericson, 2010a; [2] Zuccon and Ericson, 2010b; [3] Outlaw et al., 2010; [4] Aliabadian et al., 2007; [5] Glen et al., 2011; [6] Förschler et al., 2010. Ã: these ND2 sequences were used only to evaluate the intraspecific divergence in the neighbour-joining tree, but they were not included in the phylogenetic analyses.

Taxon Sample GADPH Myoglobin ODC ND2 ND3 COI 16S ND2Ã Locality Campicoloides NMBV 06249 GU358973 GU358710 GU358838 GU358779 JX256108 South Africa, Free State bifasciatus [1] [1] [1] [1] MNHN JX255937 JX255919 JX256030 South Africa RSA073 Cercomela dubia BMNH JX255956 JX255993 JX256155 JX256071 Ethiopia 1902.1.20.89 Cercomela familiaris NRM 680265 GU358974 GU358711 GU358839 GU237102 JX256109 Botswana, Francistown [1] [1] [1] [2] MNHN JX255938 JX255920 JX256031 South Africa, GA59064 Berfontein Cercomela fusca UMMZ JX255957 JX255994 JX256156 JX256072 JX256110 India 181352 Cercomela melanura NRM 89950 JX255958 JX255995 JX256157 JX256073 JX256111 Israel, Sinai, Wadi Hebran IAR JA12106 JX255939 JX255921 JX256032 Jordan Cercomela schlegelii NRM 89947 JX255959 JX255996 JX256158 JX256074 JX256112 Angola, Benguella Cercomela scotocerca NRM 89960 JX255960 JX255997 JX256159 JX256075 JX256113 Eritrea, Cheren Cercomela sinuata NRM RA.02 JX255961 JX255998 JX256160 JX256076 JX256114 South Africa, Basutoland Cercomela sordida NRM 558924 GU359040 GU358774 GU358905 GU358832 JX256115 Ethiopia, Addis-Abeba [1] [1] [1] [1] Cercomela tractrac BMNH JX255962 JX255999 JX256161 JX256077 JX256116 Namibia, Witputs 1950.50.434 Myrmecocichla NRM 89928 JX255963 JX256000 JX256162 JX256078 JX256117 Kenya, Eldoret aethiops Myrmecocichla NRM 558941 JX255964 JX256001 JX256163 JX256079 JX256118 Sudan, Zande District albifrons Myrmecocichla arnotti NRM 558901 GU359016 GU358751 GU358881 GU358815 JX256119 South Africa, Transvaal [1] [1] [1] [1] Myrmecocichla FMNH HM595025 Tanzania collaris 438821 [5] Myrmecocichla NMBV 06296 JX255965 JX256002 JX256164 JX256080 JX256120 South Africa formicivora MNHN JX255940 JX255922 JX256033 South Africa, B038907 Kimberley Myrmecocichla BMNH JX255966 JX256003 JX256165 JX256081 JX256121 Eritrea, Senafe melaena 1952.25.13 Myrmecocichla nigra NRM 570041 GU359017 GU358752 GU358882 GU237119 JX256122 Angola, Dembos [1] [1] [1] [2] Myrmecocichla BMNH JX255967 JX256004 JX256166 JX256082 Angola, Vouga tholloni 1957.35.276 Oenanthe alboniger MIUT 2003- JX255968 JX256005 JX256167 JX256083 JX256123 DQ683480 DQ683446 Iran, Firouz Abad 95(18) [4] [4] Oenanthe bottae NRM 558916 JX255969 JX256006 JX256168 JX256124 Saudi Arabia, Taik IAR A1147 JX256084 JX255941 JX255923 Ethiopia Oenanthe chrysopygia NRM 896463 JX255970 JX256007 JX256169 JX256085 JX256125 Russia, Ordubad MIUT 2003- DQ683481 DQ683447 JX256034 Iran, Kashan 96(19) [4] [4] Oenanthe cypriaca NRM 553236 JX255971 JX256008 JX256170 JX256086 JX256126 Cyprus, Ayia Phyla Oenanthe deserti NRM GU359019 9U358754 GU358884 GU237121 JX256127 Iran, Mashhad 20046660 [1] [1] [1] [2] MIUT 2003- DQ683485 DQ683451 JX256035 Morocco, Eastern high 99(22) [4] [4] plateaus Oenanthe finschii NRM 896462 JX255972 JX256009 JX256171 JX256087 JX256128 Russia, Dzhulfa, BMNH A/ DQ683487 DQ683453 JX256036 Iran, Firouz Abad 2005.2.11 [4] [4] Oenanthe heuglini MNHN JX255973 JX256010 JX256172 JX256088 JX256129 Ethiopia 1966.549 Oenanthe hispanica NRM 551781 JX255974 JX256011 JX256173 JX256089 JX256130 Spain, Zafra, hispanica MNHN 1995- JX255942 JX255924 JX256037 France 104 Oenanthe hispanica DZC JX255975 JX256012 JX256174 JX256090 JX256131 Greece, Rhodos melanoleuca 20010729.02 IAR JX255943 JX255925 JX256038 Mali 81418926 Oenanthe isabellina NRM 90181 JX255976 JX256013 JX256175 JX256091 JX256132 Eritrea, Gheleb M. Aliabadian et al. / Molecular Phylogenetics and Evolution 65 (2012) 1017–1019 1019

Table 1 (continued)

Taxon Sample GADPH Myoglobin ODC ND2 ND3 COI 16S ND2Ã Locality BMNH A/ DQ683492 DQ683458 JX256039 Iran, Ispahan 2005.2.1 [4] [4] Oenanthe leucopyga NRM 90334 JX255977 JX256014 JX256176 JX256092 JX256133 Algeria, Ouad Itlou leucopyga IAR HA01112 DQ683508 DQ683474 JX256040 Morocco, Tazenakht [4] [4] Oenanthe leucopyga NHMO 22655 JX255978 JX256015 JX256177 JX256093 JX256134 Israel ernesti Oenanthe leucura NRM 90197 JX255979 JX256016 JX256178 JX256094 JX256135 Algeria, Tilatou IAR JX255944 JX255926 JX256041 Morocco 82004655 Oenanthe lugens IAR 503 JX255980 JX256017 JX256179 JX256095 JX256136 HM046858 HM046838 Morocco, Boumalne halophila [6] [6] Oenanthe lugens IAR 396 JX255981 JX256018 JX256180 JX256096 JX256137 HM046860 HM046840 Jordan, Wadi Raman lugens [6] [6] Oenanthe lugens NRM JX255982 JX256019 JX256181 JX256097 JX256138 Iran persica 20046701 BMNH A/ DQ683497 DQ683463 JX256042 Iran, Ispahan 2005.2.7 [4] [4] Oenanthe lugubris IAR 447 JX255383 JX256020 JX256182 JX256098 JX256139 HM046871 HM046871 Ethiopia, Jemmu [6] [6] Oenanthe moesta NRM 90315 JX255984 JX256021 JX256183 JX256099 JX256140 Algeria, Bordj Saada MIUT 2003- DQ683500 DQ683466 JX256043 Morocco, Eastern high 103(26) [4] [4] plateaus Oenanthe monacha NRM 90320 JX255985 JX256022 JX256184 JX256100 JX256141 Egypt, Suez IAR BG22386 JX255945 JX255927 JX256044 Israel Oenanthe monticola NRM 90042 JX255986 JX256023 JX256185 JX256101 JX256142 South Africa, Great Namaqualand MNHN JX255946 JX255928 JX256045 South Africa RSA037 Oenanthe oenanthe NRM 966643 GU359020 GU358755 GU358885 GU358816 JX256143 Sweden, Stockholm [1] [1] [1] [1] BMNH A/ DQ683502 DQ683468 JX256046 Iran, Ispahan 2005.2.4 [4] [4] Oenanthe phillipsi MNHN 1974- JX255987 JX256024 JX256186 JX256102 JX256144 JX255947 Ethiopia 1550 Oenanthe picata NRM JX255988 JX256025 JX256187 JX256103 JX256145 Iran 20046664 MIUT 2003- DQ683509 DQ683475 Iran, Touran 7.1(27) [4] [4] Oenanthe pileata NRM 90366 JX255989 JX256026 JX256188 JX256104 JX256146 Tanzania, Tanga MNHN 36- JX255948 JX255929 JX256047 South Africa, E05 Berfontein Oenanthe pleschanka NRM JX255990 JX256027 JX256189 JX256105 JX256147 Sweden (vagrant) 20046694 MIUT 2003- DQ683507 DQ683473 JX256048 Iran, Dar Gaz 26(30) [4] [4] Oenanthe NHMO 23723 JX255991 JX256028 JX256190 JX256106 JX256148 JX255949 JX255930 Israel xanthoprymna Thamnolaea NRM GU359034 GU358769 GU358899 GU358828 JX256149 JX255950 JX255931 Nigeria, Jos cinnamomeiventris 20086147 [1] [1] [1] [1] Outgroup Phoenicurus NRM GU359022 GU358757 GU358887 GU237122 JX256150 Sweden, Stockholm phoenicurus 20016219 [1] [1] [1] [2] MNHN 22-43 JX255951 JX255932 JX256065 France, Ahetze Saxicola rubetra NRM GU359028 GU358763 GU358893 GU237123 JX256151 Sweden, Stockholm 20016186 [1] [1] [1] [2] ZMUC JX255952 JX255933 JX256067 Denmark, 131941 Kongelunden Saxicola (torquata) NRM 947295 JX255992 JX256029 JX256191 JX256107 JX256152 JX255953 JX255934 Vietnam stejnegeri Monticola gularis NRM GU359006 GU358741 GU358871 GU237106 JX256153 Vietnam, Kon Tum 20036789 [1] [1] [1] [2] MNHN JF031 JX255954 JX255935 JX256061 Cambodia Monticola solitarius NRM GU359007 GU358742 GU358872 GU358808 JX256154 Captivity, unknown 20016756 [1] [1] [1] [1] MNHN 22-33 JX255955 JX255936 JX256063 France, Corsica