Deciphering Species Relationships and Evolution in Chenopodium Through Sequence Variations in Nuclear Internal Transcribed Space
Total Page：16
File Type：pdf, Size：1020Kb
Journal of Genetics (2019) 98:37 © Indian Academy of Sciences https://doi.org/10.1007/s12041-019-1079-0 RESEARCH ARTICLE Deciphering species relationships and evolution in Chenopodium through sequence variations in nuclear internal transcribed spacer region and amplified fragment-length polymorphism in nuclear DNA NIKHIL K. CHRUNGOO1∗, RAJKUMARI JASHMI DEVI1,3, SHAILENDRA GOEL2 and KAMAL DAS2 1Department of Botany, Centre for Advanced Studies, North-Eastern Hill University, Shillong 793022, India 2Department of Botany, University of Delhi, Delhi 110 007, India 3Present address: Institute of Bioresources and Sustainable Development, Takyelpat, Imphal 795 001, India *For correspondence. E-mail: [email protected], [email protected]. Received 22 June 2018; revised 30 September 2018; accepted 2 November 2018; published online 16 April 2019 Abstract. Evaluation of sequence variations in the internal transcribed spacer (ITS) region of 19 accessions, comprising of 11 accessions of Chenopodium quinoa, eight accessions of Chenopodium album and 165 retrieved sequences of different species of Chenopodium belonging to subfamily Chenopodioideae revealed a higher intraspecific genetic diversity in Himalayan C. album than that in C. quinoa. ITS and amplified fragment-length profiles of the accessions suggest the existence of accessions of Himalayan C. album as heteromorphs of the same species rather than a heterogenous assemblage of taxa. While the evolutionary relationship reconstructed from variations in 184 sequences of ITS region from species belonging to Chenopodiaceae, Amaranthaceae, Polygonaceae and Nelumbonaceae established a paraphyletic evolution of family Chenopodiaceae, it also revealed a monophyletic evolution of Chenopodieae I. The reconstruction also established five independent lineages of the subfamily Chenopodioideae with C. album as a sister clade of C. quinoa within the tribe Chenopodieae I. The results also indicate a much younger age for Himalayan chenopods (C. album) than the reported crown age of Chenopodieae I. Keywords. Chenopodioideae; internal transcribed spacer; amplified fragment-length profile; time-measured phylogenetic tree; evolutionary divergence; Chenopodium. Introduction have described it as a complex group which lacked good morphological characteristics to distinguish between Chenopodium is one of the taxonomically most complex species. Most of the work on genetic diversity and phy- genus belongs to the subfamily Chenopodioideae within logeny in Chenopodium has focussed on C. quinoa and the family Chenopodeace. The highly polymorphic habit C. berlandieri subsp. Nuttalliae (Ruas et al. 1999; Gan- of species within this genus has caused more difficulties in gopadhyay et al. 2002) and only a few studies have been their proper taxonomic identification. Taxonomic identi- carried out on its other important species including C. fication of Chenopodium has been controversial because album. Earlier studies carried out to resolve the taxonomic of the highly polymorphic leaf shape, floral structure complexities in this genus clearly indicated the existence and seed morphology (La Duke and Crawford 1979; of C. album as the most polymorphic species of the Kurashige and Agrawal 2005). While Wilson and Man- genus Chenopodium. (Mehra and Malik 1963; Mukherjee hart (1993) have described the genus Chenopodium as a 1986), karyotypic analysis (Bhargava et al. 2006; Kolano ‘taxonomic receptacle’, Rahiminejad and Gornall (2004) et al. 2008), flavonoids (Rahiminejad and Gornall 2004), Electronic supplementary material: The online version of this article (https://doi.org/10.1007/s12041-019-1079-0) contains supplemen- tary material, which is available to authorized users. 1 37 Page 2 of 11 Nikhil K. Chrungoo et al. RAPD profiles (Ruas et al. 1999; Gangopadhyay et al. Materials and methods 2002; Rana et al. 2010), direct amplification of minisatel- lite DNA (DAMD) (Rana et al. 2010) and intersimple Plant materials sequence repeats (ISSR) markers (Rana et al. 2011) Bhar- gava et al. (2006) and Rana et al. (2010) have suggested Seeds of 19 accessions of Chenopodium (table 1) were it to be an aggregate taxon, thereby confusing its identity procured from National Bureau of Plant Genetic resour- compared to Linnaean C. album. C. quinoa is an allote- ces, NBPGR, Shimla, India. The accessions were chosen traploid (2n = 4x = 36) with an estimated genome size on the basis of variations in colour,shape and arrangement of ∼1.5 Gbp (Palomino et al. 2008; Kolano et al. 2016). of their leaves; colour, shape and surface morphology of In addition, C. album is known as a complex of diploid their seeds; texture and type of pollen grains. The selection (2n = 18), tetraploid (2n = 36) or hexaploid (2n = 54) of accessions was based on the study by Devi and Chrun- cytotypes with endopolyploidy and autopolyploidy as the goo (2015). Plants of each accession were raised to full origin of polyploidy (Kolano et al. 2008). Limited genetic maturity in the experimental garden of the North Eastern resources have long been considered as a major factor Hill University, Shillong. hindering molecular marker-assisted breeding in quinoa PCR amplification of ITS region: Genomic DNA, (Jarvis et al. 2008). While the subfamily Chenopodiaceae to be used as a template for PCR, was isolated from has been considered to be monophyletic on the basis of 10-day-old aetiolated seedlings of all the accessions fol- sequence data of chloroplast rbcL (Kadereit et al. 2003) lowing the method of Murray and Thompson (1980). and matK/trnK (Müller and Borsch 2005) genes, Fuentes- PCR amplification of ITS region from genomic DNA of Bazan et al. (2012b) have argued that Chenopodium,as each accession was carried out with the forward (ITS5: tradtionally recognized, consists of six independent lin- 5 GGAAGTAAAAGTCGTAACAAGG3 ) and reverse eages. The arguement was based on sequence diversity (ITS4: 5 TCCTCCGCTTATTGATATGC3 ) primers in plastid trnL-F and nuclear internal transcribed spacer designed by White et al. (1990). The reaction mixtures (ITS) regions of different species of this genus. Walsh for amplification were optimized with 1 mM MgCl2,0.4 et al. (2015) have however, identified two distinct poly- mM dNTPs, 0.03 U Taq polymerase, 0.2 pmols primers ploid lineages of which one lineage comprised of American and 50 ng of the template DNA. Amplification was per- tetraploid species and the other of Eastern Hemisphere formed in a thermal cycler programmed to one cycle of ‘hot ◦ ◦ hexaploid species. Thus, phylogenetic relationships among start’at 94 C; 35 cycles of denaturation at 94 C for 1.0 min; ◦ ◦ major lineages within Chenopodiaceae still remains poorly annealing at 50 C for 1 min and extension at 72 C for 1 ◦ understood. min and one final step of chain elongation at 72 Cfor10 Table 1. Accessions of C. quinoa and C. album studied in our present investigation. GenBank accession number Accession no. Species Source of nr ITS sequence IC341704 C. album NBPGRa KC577850 NIC22517 C. album NBPGR KC577845 IC341700 C. album NBPGR KC577846 IC447575 C. album Chaura, Kinnaur, Himachal Pradesh, India KC577847 EC359447 C. album NBPGR KC577849 EC359451 C. album NBPGR KC577848 IC411825 C. album Thakma, Leh Jammu and Kashmir, India KC577851 IC411824 C. album Thakma, Leh Jammu and Kashmir, India KC577836 EC507744 C. quinoa NBPGR KC577834 EC507742 C. quinoa Chile KC577835 EC507738 C. quinoa Peru KC577837 EC507739 C. quinoa Ecuador KC577838 EC5077391 C. quinoa NBPGR KC577839 EC507740 C. quinoa USA KC577840 EC5077401 C. quinoa USA KC577841 EC5077402 C. quinoa USA KC577842 EC507741 C. quinoa USA KC577843 EC507747 C. quinoa USA KF709219 EC507748 C. quinoa Argentina KC577844 aNational Bureau of Plant Genetic Resources, Shimla station, India. Species relationships and evolution in Chenopodium Page 3 of 11 37 min. Each reaction mixture was electrophoresed on 1.2% no manual modification and optimization in sequences. agarose gel. The amplicons were visualized under UV light Compensatory base changes (CBCs), which are defined in ChemiDoc XRS+ system (Biorad, California, USA) as base changes in a paired region of a primary RNA after staining the gels with 0.5 μg/mL ethidium bromide. transcript when both nucleotides of a paired site mutate The amplified DNA fragments were eluted from the gel while the pairing itself is maintained (Gutell et al. 1994), and purified with QIA quick Gel Extraction kit (Qiagen, were analysed in the predicted secondary structure of ITS2 Hilden, Germany) following the manufacturer’s protocol. using CBC analyser 1.1 (Wolf et al. 2005). The precipitated DNA was pelletted by centrifuging at 13,000 rpm for 20 min at 4◦C, washed twice with 70% alco- hol and vacuum dried. The dried samples were dissolved Amplified fragment length polymorphism analysis in sterile distilled water. Amplified fragment length polymorphism (AFLP) Nucleotide sequencing analysis of DNA from the accessions of Chenopodium was carried out with LI-COR4300 DNA analyser following Nucleotide sequencing of each amplified DNA was carried the procedure described by Vos et al. (1995). Genomic out by capillary gel electrophoresis in ABI 3130 auto- DNA from each accession was digested with MseIand mated sequencer (Applied Biosystems, California, USA) EcoRI and ligated with respective adaptors at 20◦Cfor using performance optimized polymer-7 (POP-7) as the 18 h. Preamplification of the ligated fragments was per- resolving matrix. Prior to sequencing, each amplicon was formed using adaptor primers with one selective base at subjected to cycle sequencing