Aus dem Departement Biologie, Einheit für Ökologie und Evolution Universität Freiburg (Schweiz)
Understanding the structure of interactions and the dynamics of spider populations in agricultural ecosystems
INAUGURAL-DISSERTATION
zur Erlangung der Würde eines Doctor rerum naturalium der Mathematisch-Naturwissenschaftlichen Fakultät der Universität Freiburg in der Schweiz
vorgelegt von Odile Bruggisser aus Wohlen (AG)
Dissertation Nr. 1671 UniPrint 2010
Von der Mathematisch-Naturwissenschaftlichen Fakultät der Univer- sität Freiburg in der Schweiz angenommen, auf Antrag von Prof. Dr. Louis-Félix Bersier, Prof. Dr. Soeren Toft (Aarhus University, DK), PD Dr. Sven Bacher und Prof. Dr. Christian Lexer, Jurypräsident Prof. Dr. Heinz Müller-Schärer.
Freiburg, den 11. Juni 2010
Der Dissertationsleiter: Der Dekan:
Prof. Dr. Louis-Félix Bersier Prof. Dr. Titus Jenny
CONTENTS
Zusammenfassung...... 1
Summary ...... 3
General Introduction...... 5
Chapter 1 Bottom-up and top-down control of Argiope bruennichi (Araneae: Araneidae) in semi-natural ecosystems. Bruggisser OT, Aebi A, Fabian Y, Kehrli P, Sandau N,
Blandenier G & Bersier L-F...... 11
Chapter 2 Trends in climate, land use and the dynamics of a ballooning spider assemblage.
Bruggisser OT, Blandenier G & Bersier L-F...... 37
Chapter 3 Spider molecular barcode to track trophic links in food webs. Bruggisser OT, Aebi A, Fabian Y, Kehrli P, Sandau N,
Blandenier G & Bersier L-F...... 59
Discussion and Outline ...... 89
Acknowledgements / Danksagung...... 93
Curriculum vitae ...... 95
PhD thesis – Odile Bruggisser Zusammenfassung
ZUSAMMENFASSUNG
Der gegenwärtige Klimawandel und der zunehmende Verlust an natürlichen Lebensräumen sind mitverantwortlich für den weltweiten Rückgang der Ar- tenvielfalt. Untersuchungen zeigen, dass sich die Stärke und Vielfalt der In- teraktionen zwischen einzelnen Arten wesentlich auf die Stabilität einer Le- bensgemeinschaft auswirken. Ein erweitertes Verständnis der Struktur und Dynamik von Populationen ist daher für den Erhalt von Lebewesen von zentraler Bedeutung. Spinnen sind besonders geeignet zur Untersuchung der Beschaffenheit von Populationen. Als generalistische Räuber verbreiten sie sich auf effiziente Weise („ballooning“) mit Hilfe eines Seidenfadens durch die Luft, und sind in praktisch jedem terrestrischen Nahrungsnetz in hohen Dichten zu finden. Zudem zeichnet sich die Gruppe durch eine grosse Artenvielfalt aus, wobei einzelne Arten unterschiedlich stark auf Störungs- faktoren, Strukturen und physikalische Eigenschaften ihres Habitats reagie- ren. Diese Doktorarbeit gliedert sich in drei Teilstudien, in denen Spinnen- populationen und deren Räuber und Beutetiere in naturnahen Lebensräumen untersucht wurden, um einen Einblick in die Struktur und Dynamik von Le- bensgemeinschaften zu gewinnen. Im ersten Experiment untersuchten wir verschiedener Faktoren, die das Vorkommen der Radnetzspinne Argiope bruennichi in naturnahen Le- bensräumen beeinflussen. Getestet wurden der Einfluss von niedrigeren trophischen Ebenen (Struktur und Diversität der Pflanzen und die Dichte der Beutetiere), sowie von höheren trophischen Ebenen (das Vorkommen von Räubern). In einem Feldversuch manipulierten wir die Artenvielfalt von Pflanzen (2, 4, 6 oder 12 Arten) und somit die Struktur der Pflanzenge- meinschaften innerhalb von 12 verschiedenen Buntbrachen. Die Abundanz von A. bruennichi wurde sowohl von höheren als auch niedrigere trophische Ebenen beeinflussen. Das Vorkommen ihres primären Feindes, der Hornisse (Vespa crabro), hatte einen stark negativen Effekt auf die Abundanz der Spinnen, während sich die Vielfalt der Pflanzen und die Dichte der Beutetie- re positiv auswirkten. Zudem bevorzugte A. bruennichi Lebensräume mit niedrigerer Vegetation. Eine erhöhte Artenvielfalt an Pflanzen wirkte sich positiv auf die Dichte der Beutetiere und somit indirekt auf die Dichte der Spinnen aus. Erstaunlicherweise zeigte unser Versuch nebst diesem indirek- ten Effekt aber auch einen direkten Effekt der Pflanzendiversität auf die Spinnen. Dies könnte darauf hindeuten, dass Spinnen die Fähigkeit entwi- ckelt haben, ihr Habitat anhand der Pflanzendiversität, die indirekt die Beu- tedichte widerspiegelt auszuwählen. Anhand eines Datensatzes über Spinnen, die sich durch die Luft verbreiten (ballooning), und die mit Hilfe einer Saugfalle zwischen 1994 und 2004 gefangen wurden, untersuchten wir in einem zweiten Teil den Effekt von Klimaveränderungen und Habitatverlust auf die Dynamik von Spinnen- populationen. Hohe Dichten an fliegenden Spinnen wurden im Frühling so- wie im Spätsommer beobachtet. Das Flugverhalten der insgesamt 103
Page 1 PhD thesis – Odile Bruggisser Zusammenfassung
Spinnenarten wurde stark von Temperatur, Sonneneinstrahlung und Feuch- tigkeit beeinflusst. Auffallend war eine Veränderung des Flugverhaltens zwischen 1994 und 2004. Wir beobachteten eine Verschiebung der zwei- ten Hauptflugphase in Richtung Frühsommer. Die genauere Betrachtung der verschiedenen Spinnenarten zeigte einen generellen Rückgang epigäischer Spinnenarten, während die Dichte jener Arten, die in höheren Vegetations- schichten leben geringfügig zunahm. Diese Entwicklung spiegelte Verände- rungen der Dichte günstiger Habitate im Untersuchungsgebiet wieder. Der extreme Sommer 2003 mit überdurchschnittlich hohen Temperaturen in ganz Europa hatte einen markanten Einfluss auf die Dynamik der fliegenden Spinnen. Während im Frühjahr überdurchschnittlich viele Spinnen beobach- tet wurden, kollabierte die Population gänzlich gegen Ende des Sommers. Diese Studie zeigt, dass klimatische Extreme und der Verlust an Lebens- räumen ein grösseres Risiko für Spinnenpopulationen darstellen als ein ste- tiger Anstieg der Temperatur. Während Spinnen im ersten und zweiten Teil dieser Studie als Akteu- re im Zentrum standen, untersuchten wir in einem dritten Teil Spinnen als Beutetiere der solitären Wespe Trypoxylon figulus. Diese Wespenart fängt Spinnen als Nahrung für ihre Nachkommen. Ihre Larven fressen Spinnen meist bis auf wenige Überreste auf, was das Erfassen des Beutespektrums dieser Wespenart erschwert. Zudem bevorzugt T. figulus juvenile Spinnen, die aufgrund fehlender Merkmale grösstenteils nicht auf Artniveau bestimmt werden können. Das Ziel dieser Studie war die Erarbeitung einer molekula- ren Methode um trophische Beziehungen zwischen Räubern und Beutetieren zu erfassen. Dazu erstellten wir einen genetischen Barcode eines Abschnit- tes des mitochondrialen Zytochromoxidase I (COI) Gens von 104 Spinnen (46 verschiedene Arten), die zuvor anhand von morphologischen Merkma- len auf Artniveau identifiziert wurden. Wir versuchten Spinnen aus Wes- pennestern bis auf Artniveau zu bestimmen, indem wir solche COI Sequen- zen aus Spinnenüberresten mit dem erarbeiteten Datensatz verglichen. Es gelang uns alle Testsequenzen aus Wespennestern einer bestimmten Spin- nengattung oder Spinnenart zuzuordnen. Zudem erwies sich diese Methode ebenfalls nützlich zur Bestimmung von juvenilen Spinnen. Während der Gebrauch solcher COI Datensätze von verschiedenen Autoren kritisiert wird, möchten wir mit dieser Arbeit auf zwei praktische Vorteile hinweisen: 1. Die Bestimmung von Jungtieren, die nicht über geeignete morphologi- sche Strukturen zur Artbestimmung verfügen, sowie 2. die Ermöglichung eines besseren Verständnisses von Räuber-Beute Beziehungen in Nahrungs- netzen.
Page 2 PhD thesis – Odile Bruggisser Summary
SUMMARY
The maintenance of biodiversity is a major concern in the face of current drastic modifications of land use and climate change. An understanding of the structure and dynamics of communities is therefore an important long- term objective of ecology. Spiders as generalist predators with highly effi- cient dispersal abilities are among the most abundant terrestrial arthropods and play a role in food webs in many ecosystems. Their sensitivity to dis- turbance and to structural and physical aspects of their environment further emphasizes the suitability of this group to investigate basic questions in ecology. The global aim of this thesis was to investigate spiders and their natural prey and predator species in agricultural landscapes to gain insight into the structure, dynamics and stability of communities. First we investigated experimentally the structure of a food web cen- tered on the web-building spider Argiope bruennichi. We were interested in the bottom-up effect of vegetation structure and plant diversity and in the top-down effect of a predator, the hornet Vespa crabro, on the abundance of this spider species. We performed a semi-natural experiment in wild- flower-strips differing in plant diversity and hence in vegetation structure. Our study system showed evidence that the abundance of A. bruennichi is regulated by combined bottom-up and top-down effects, and by direct and indirect interactions between trophic levels. Two main factors were found to characterize this system: the strong negative effect of a single predator, namely hornets, and the positive effect of plant diversity, which affected spider abundance directly and indirectly via potential prey. Overall, this re- sult may indicate that spiders have evolved the ability to distinguish be- tween different habitats according to plant-diversity cues, which reflect prey availability. The analysis of a time-series of 103 different ballooning spider spe- cies observed between 1994 and 2004, and their relation to climatic condi- tions and landscape modifications was the focus of our second study. The analysis revealed a tight relationship between spider population structure and temperature, global radiation and humidity, which confirms the obser- vation of previous investigations. More interestingly, we found evidence for a significant shift in the ballooning phenology of most species, with the summer peak in ballooning activity shifted earlier in the year. In the long term, ground-living species decreased while tree-living spiders increased in abundance, which can be explained by concomitant landscape changes in the study area. We found no evidence that changes in meteorological pa- rameters affected these trends. However, ballooning abundances decreased strongly in summer and fall 2003, when extreme meteorological conditions were prevailing in Europe. Interestingly, this collapse was preceded by very high ballooner abundances. The main results of this study show that spider populations appear to be more at risk from the expected intensification of extreme climatic events and changes in land use than from gradually rising
Page 3 PhD thesis – Odile Bruggisser Summary
temperatures. In the third study, we aimed to develop a molecular method to track trophic links in food webs. This method was needed to identify the prey community of the wasp Trypoxylon figulus feeding in the larval stage on different spider species. Since larvae consume most of the spider prey, the identification of prey remains to the species level is very difficult. Further- more, wasps prefer to trap immature spiders, which for a large majority cannot be identified because distinguishing morphological features are not developed. The study involved the establishment of a spider barcode of 104 individuals from 46 different spider species, previously identified to species level by morphological characteristics. The establishment of a maximum likelihood tree of mitochondrial cytochrome oxidase I (COI) frag- ments revealed terminal clades which corresponded to the morphologically identified species. With the help of the COI fragment database, we were able to identify the remains of spider tissue from T. figulus nests and imma- ture spider individuals to the genus or species level. Despite criticism of the use of COI for the identification of species, our results thus highlight two practical advantages of this method: 1) the identification of species lacking clear morphological differentiation, like immature spiders, and 2) the better understanding of otherwise invisible trophic links in food webs by the iden- tification of species from prey remains.
Page 4 PhD thesis – Odile Bruggisser General Introduction
GENERAL INTRODUCTION
Understanding the structure and extinction creates a gap in the food dynamics of communities is an web (a consumer may have no prey) important long-term objective of or leads to a dynamically unstable ecology, because it is fundamental in community (Petchey et al. 2008). In maintaining biodiversity, a major order to understand trophic links concern in the face of current drastic within complex food webs, it is modifications of land use and climate therefore crucial to understand change. Food web structure received interaction pathways among all particular attention in theoretic organisms involved in the web of a models aiming to predict the effect of given habitat and to evaluate the structural food web complexity on consequences of these interactions the dynamics and stability of com- (Sheppard & Harwood 2005). munities (MacArthur 1955, May The following reasons make 1974, De Angelis 1975, McCann spiders a useful group of organisms 2000, reviewed in Bersier 2007). to investigate community structure, After the work of May (1974) dynamics and stability: 1) most showing that stability was not a spiders possess a highly efficient mathematical consequence of mode of dispersal, involving passive complexity, many ecologists explored aerial movement by ‘ballooning’ on the question of how natural commu- silk threads (Blackwall 1827, Bell et nities could persist. The first attempt al. 2005). This powerful dispersal to put biological realism in dynamical ability was proposed as a main models was the work of De Angelis reason why spiders are found in (1975) who proposed that the nearly every terrestrial ecosystem, probability of food web stability ranging from the Arctic, to high increases with increasing connec- altitudes, deserts or caves (Turnbull tance when the hierarchical nature of 1973); 2) As generalist predators, food web is taken into account. It they evolved many different methods has been shown that the extinction of prey catching, including hunting as of single species in ecological com- well as the passive strategy by munities can affect remaining species trapping prey in a web (Foelix 1979), by causing a cascade of secondary which allow the colonization of a extinctions (e.g., Borrvall et al. 2000; wide variety of ecological niches Koh et al. 2004; Petchey et al. (Turnbull 1973); 3) they are among 2008). For example the removal of the most abundant terrestrial arthro- predator sea star species (Pisaster pods (Turnbull 1973) and can be ochraceus) from a rocky intertidal considered as source (in the view of community leads to the uncontrolled larger predators) as well as consum- dominance of mussels causing local ers of energy, which highlights their extinction of many other species impact in many different food webs ; (Paine 1966). Such “secondary 4) with their sensitivity to structural species extinctions” or “coextinc- and physical aspects of their envi- tions” occur because a primary ronment and the narrow ecological
Page 5 PhD thesis – Odile Bruggisser General Introduction tolerance of some species (Hänggi et tion, how arthropod communities and al. 1995), spiders are known to be their natural prey and predators will good indicators of the state of their be influenced by the loss of plant habitat (Thaler 1985; Blick 1988; diversity. Hänggi 1991; 1993; Pozzi 1996). In a first part of my thesis the Under intensive culture spider distribution and abundance patterns diversity is impoverished (Nyffeler et of the web-building spider Argiope al. 2004; but see also Bruggisser et bruennichi in relation to plant, prey al. 2010), but under favourable and predator species were investi- agricultural management they can gated. A field experiment was even be more diverse and abundant conducted in different semi-natural than in natural habitats (Toft 1989). habitats, where plant diversity, and It can be assumed that spiders, indirectly vegetation structure, was taking a centred place in food webs, manipulated. The aim of this study are potentially regulated by both was to test whether both bottom-up resources (bottom-up) as well as and top-down forces both affect the predators (top-down). Such a com- local distribution of the study spe- bined effect of top-down and bottom- cies. Additionally, I wanted to know up forces regulating species abun- how spider abundances are influ- dances have, to our knowledge rarely enced by plant diversity, whether been demonstrated for arthropods through a direct relationship with (e.g., Spiller & Schoener 1994). plants or whether this effect is There is ample evidence for the indirect, mediated through the effect of vegetation structure on abundance of prey. arthropod species composition In regard to the regional distri- (Lawton 1983, Morris 2000). The bution of A. bruennichi, it has been role of plant diversity is, however, observed that this species is expand- less clear. Recent investigations ing its range from southern into demonstrated that higher plant central Europe within the last dec- diversity leads to better resource use ades (Guttmann 1979, Hänggi et al. and enhanced functioning – in terms 2001). The ability of dispersing by of productivity – thanks to comple- ballooning has been proposed as a mentarity and positive interactions major reason for their successful (Hooper et al. 2005; Spehn et al. colonization of new habitats. It has 2005). It has been found that, on been shown that ballooning depends theoretical ground, the relationship on the occurrence of favourable between diversity and ecosystem conditions of temperature, wind functioning is not that straightfor- speed and rainfall (Legel & van ward when trophic aspects are taken Wingerden 1980; Reynolds et al. into account (Paine 2002, Thébault & 2007). Changes in temperature are Loreau 2003). The effect of plant known to influence the developmen- diversity on trophic interactions has, tal rate of spiders (Li & Jackson so far, less well been investigates. 1996; Bonte et al. 2008), affecting The general homogenisation of their body size (Høye et al. 2009) and habitats, especially involving the loss hence potentially affecting reproduc- of plants diversity, raises the ques- tive success. The influence of
Page 6 PhD thesis – Odile Bruggisser General Introduction temperature on phenotypic traits and based species-identification tools the dispersal behaviour of spiders have recently gained in importance raise the question, whether the and are promising tools to overcome colonisation of the northern hemi- the difficulties in tracking trophic sphere by A. bruennichi may be links in food webs (Tautz et al. 2003; explained by climate change. Differ- Herbert et al. 2003; Blaxter & Floyd ent studies demonstrated changes in 2003). In a third part of this study, I distribution patterns of animal species used a model food web of solitary to be a response to climate change living wasp species of the family (Walther et al. 2002). Alterations in Sphecidae, feeding their larvae with climatic conditions leading to a range spider prey. The wasp larvae con- shift in some species can be ex- sume most of the provided prey, pected to affect other species and which complicates the identification hence to lead to changes in commu- of spider prey to the species level nity structure. Beside climate change (Polidori et al. 2007; Buschini et al. current drastic modifications in land 2008). The aim of the study was to use may additionally lead to struc- establish a genetic barcode database tural changes in communities, since of a spider community, to investigate species which are more resistant to the trophic link between trap-nesting disturbance may outcompete the wasps and their spider prey commu- more sensitive ones (Sakai et al. nities. With this experiment I empha- 2001). Studies investigating the long- sized on the potential of molecular term effect of global change like techniques to answer basic questions climate change and habitat loss on in ecological research. the composition and dynamics of arthropod communities are rare. REFERENCES In a second part, I tackled this research theme by analyzing a Bell JR, Bohan DA, Shaw EM & Weyman dataset of more than 15,000 balloon- GS (2005) Ballooning dispersal using ing spiders, which were caught at silk: world fauna, phylogenies, genet- weekly intervals between 1994 and ics and models. Bulletin of Entomo- 2004 in south-western Switzerland logical Research, 95, 69-114. using a 12 m high suction trap. With Bersier L-F (2007) A history of the study this dataset I aimed to study the of ecological networks. In Biological effect of climatic conditions and Networks. Képès, F. (ed). Complex landscape modifications on the Systems and Interdisciplinary Science, dynamics of a ballooning spider Vol. 3; World Scientific, pp. 365-421. assemblage. Blackwall J (1827) Observations and Studies on interacting species experiments, made with a view to within communities are rare, since ascertain the means by which the the direct observations of predation spiders that produce gossamer effect events in food webs are difficult their aerial excursions. Transactions of especially for highly mobile, under- the Linnean Society of London, 15, ground, rare or cryptic species (Thies 449-59. & Tscharntke 1999; Steffan- Blaxter M & Floyd R (2003) Molecular Dewenter et al. 2001, 2002). DNA- taxonomics for biodiversity surveys:
Page 7 PhD thesis – Odile Bruggisser General Introduction
already a reality. Trends in Ecology habitats of the most abundant spider and Evolution, 18, 268-269. species of Central Europe and associ- Blick T (1988) Ökologisch-faunistische ated specie. Miscellanea Faunistica Untersuchungen an der epigäischen Helvetica 4, CNCF, Neuchâtel. Spinnenfauna (Araneae). Oberfränk- Hänggi A, Jäger P & Kreuels M (2001) ischer Hecken, Diplomarbeit, Spinne des Jahres 2001 – Die Bayreuth. Wespenspinne Argiope bruennichi Bonte D, Travis JMJ, De Clercq N, (SCOPOLI, 1772). Zwertvaegher I & Lens L (2008)
Page 8 PhD thesis – Odile Bruggisser General Introduction
Lawton JH (1983) Plant architecture and mud-dauber wasps (Hymenoptera: the diversity of phytophagous insects. Sphecidae) in northern Italy. Animal Annual Review of Entomology, 28, Biology, 57, 11-28. 23-39. Pozzi S (1996) Les invertébrés de lisières Legel GJ & van Wingerden WKRE (1980) naturelles et dégradées du Canton de Experiments on the influence of food Genève. Bulletin romand and crowding on the aeronautic dis- d’Entomologie, 14, 1-38. persal of Erigone arctica (White 1852) Reynolds AM, Bohan DA & Bell JR (Araneae Linyphiidae). Proc. 8th Intern. (2007) Ballooning dispersal in arthro- Arachnol. Congr. pp. 1–6. pod taxa: conditions at take-off. Biol- Li D & Jackson RR (1996) How tempera- ogy Letters, 3, 237-240. ture affects development and repro- Sheppard SK & Harwood JD (2005) duction in spiders: A review. Journal Advances in molecular ecology: track- of Thermal Biology, 21, 245-274. ing trophic links through predator-prey MacArthur R (1955) Fluctuations of foodwebs. Functional Ecology, 19, Animal Populations and a Measure of 751–762. Community Stability. Ecology, 36, Spehn EM, Hector A, Joshi J, Scherer- 533-536. Lorenzen M, Schmid B, Bazeley-White May RM (1974) Stability and complexity E, Beierkuhnlein C, Caldeira MC, Die- of model ecosystems. 2nd ed. Prince- mer M, Dimitrakopoulos PG, Finn JA, ton University Press, Princeton. Freitas H, Giller PS, Good J, Harris R, McCann KS (2000) The diversity-stability Hogberg P, Huss-Danell K, Jumppo- debate. Nature, 405, 228-233. nen A, Koricheva J, Leadley PW, Morris MG (2000) The effects of Loreau M, Minns A, Mulder CPH, structure and its dynamics on the O'Donovan G, Otway SJ, Palmborg C, ecology and conservation of arthro- Pereira JS, Pfisterer AB, Prinz A, Read pods in British Grasslands. Biological DJ, Schulze ED, Siamantziouras ASD, Conservation, 95, 129-142. Terry AC, Troumbis AY, Woodward Nyffeler M, Sterling WL & Dean DA FI, Yachi S & Lawton JH (2005) Eco- (1994) Insectivorous activities of system effects of biodiversity manipu- spiders in United States field crops. lations in European grasslands. Eco- Journal of Applied Entomology, 118, logical Monographs, 75, 37-63. 113-128. Sakai AK, Allendorf FW, Holt JS, Lodge Paine RT (1966) Food Web complexity DM, Molofsky J, With KA, Baughman and species diversity. The American S, Cabin RJ, Cohen JE, Ellstrand NC, Naturalist, 100, 65-75. McCauley DE, O'Neil P, Parker IM, Paine RT (2002) Trophic control of Thompson JN & Weller SG (2001) production in a rocky intertidal com- The population biology of invasive munity. Science, 296, 736-739. species. Annual Review of Ecology Petchey OL, Hector A & Gaston KJ and Systematics, 32, 305–332. (2008) How do different measures of Spiller DA & Schoener TW (1994) functional diversity perform? Ecology, Effects of top and intermediate preda- 85, 847-857. tors in a terrestrial food web. Ecology, Polidori C, Federici M, Pesarini C & 75, 182-196. Andrietti F (2007) Factors affecting Steffan-Dewenter I, Münzenberg U & spider prey selection by Sceliphron Tscharntke T (2001) Pollination, seed
Page 9 PhD thesis – Odile Bruggisser General Introduction
set and seed predation on a landscape Thaler K (1985) Über die epigäische scale. Proceedings of the Royal Soci- Spinnenfauna von Xerothermstandor- ety of London, Series B: Biological ten des Tiroler Inntales (Österreich) Sciences, 268, 1685–1690. (Arachnida: Aranei). Veröffentlichun- Steffan-Dewenter I, Münzenberg U, gen des Museum Ferdinandeum in Bürger C, Thies C & Tscharntke T Innsbruck, 65, 81-103. (2002) Scale dependent effects of Thies C & Tscharntke T (1999) Land- landscape structure on three pollinator scape structure and biological control guilds. Ecology, 83, 1421–1432. in agroecosystems. Science, 285, Tautz D, Arctander P, Minelli A, Thomas 893–895. RH & Vogler AP (2003) A plea for Turnbull AL (1973) Ecology of the true DNA taxonomy. Trends in Ecology spiders (Araneomorphae). Annual and Evolution, 18, 70-74. Review of Entomology, 18, 305-348. Toft S (1989) Aspects of the ground- Walther G-R, Post E, Convey P, Menzel living spider fauna of two barley fields A, Parmesan C, Beebee TJC, in Denmark : species richness and Fromentin J-M, Hoegh-Guldberg O & phenological synchronization. Ento- Bairlein F (2002) Ecological responses mol. Meddr. 57, 157-168. to recent climate change. Nature, Thébault E & Loreau M (2003) Food web 416, 389-395. constraints on biodiversity–ecosystem functioning relationships. Proceedings of the National Academy of Sciences of the USA, 100, 14949-14954.
Page 10
Bottom-up and top-down control of Argiope bruennichi in semi-natural ecosystems
Odile T. Bruggisser, Nadine Sandau, Alex Aebi, Gilles Blandenier, Yvonne Fabian, Patrik Kehrli, Russell E. Naisbit & Louis-Félix Bersier
PhD thesis – Odile Bruggisser Chapter 1
Bottom-up and top-down control of Argiope bruennichi (Araneae: Araneidae) in semi-natural ecosystems
Odile T. Bruggisser1*; Nadine Sandau1; Alex Aebi2; Gilles Blandenier3; Yvonne Fabian1; Patrick Kehrli4; Russell E. Naisbit5 & Louis-Félix Bersier1
1 University of Fribourg, Unit of Ecology & Evolution, ch. du Musée 10, CH-1700 Fribourg, Switzerland 2 Agroscope Reckenholz-Tänikon ART, Research Station ART, Reckenholzstrasse 191, CH- 8046 Zürich, Switzerland 3 Centre Suisse de Cartographie de la Faune (CSCF), Passage Max-Meuron 6, CH-2000 Neuchâtel, Switzerland 4 Station de recherche Agroscope Changins-Wädenswil ACW, Nyon, Switzerland 5 University of Neuchâtel, Institute of Biology, Neuchâtel, Switzerland.
ABSTRACT: Bottom-up and top-down forces have generally been recognized as impor- tant mechanisms regulating the abundance of arthropods. Only few studies emphasized, however, the importance of top-down forces regulating the abundance of intermediate sized arthropod predators. More attention has been paid to the bottom-up effect of the vegetation. Nevertheless, it re- mains unclear which aspect of the vegetation (vegetation structure, plant diversity, or plant species composition) plays the most important role. In this study we were interested in the bottom-up and top-down mecha- nisms regulating the abundance and hunting success of the web-building spider Argiope bruennichi in semi-natural systems. We manipulated plant diversity (2, 6, 12, 20 species), and thereby indirectly habitat structure, in 12 wildflower strips in Swiss ecological compensation areas, situated in a region of intensive farmland. Within these wildflower strips, we studied the naturally occurring predator and prey community of A. bruennichi to inves- tigate major interactions in this food web. Our study system revealed that the abundance of A. bruennichi is regulated by combined bottom-up and top-down effects, and by direct and indirect interactions between trophic levels. Three main factors were found to characterize this system: the strong negative effect of a single predator, namely hornets, the positive direct effect of vegetation structure and the positive effect of plant diversity, which affected spider abundance directly and indirectly via potential prey. Overall, this result may indicate that spi- ders evolved the ability to distinguish between different habitats according
Page 11 PhD thesis – Odile Bruggisser Chapter 1
to plant-diversity cues, which reflect prey availability. In this case, we ex- pect an indirect and a direct link, the latter occurring if plant diversity and prey availability are not perfectly correlated.
INTRODUCTION
Trophic regulation by either resources abundance of species (Spiller and (bottom-up) or predators (top-down) Schoener 1994; Elmhagen and has been recognized to be important Rushton 2007). in controlling the distribution and As intermediate predators, abundance of species (Hunter and web-building spiders may be espe- Price 1992). The idea that a combi- cially suited to study the possibility of nation of bottom-up and top-down a combination of bottom-up and top- forces mediates the structure of down forces regulating their distribu- communities has, however, found tion and abundance. Spider species less support. Most attention has been do not select their habitat randomly paid to the bottom-up forces of (Topping and Lövei 1997). Vegeta- plants as the prime determinants tion has been found to be more regulating species composition at important for spiders than prey different trophic levels (Root 1973, availability (Greenstone 1984, Hunter and Price 1992, Balvanera et Bradley 1993). Web-building spiders al. 2006, Haddad et al. 2009). This in particular depend on specific can be explained by the fact that spatial structures of their habitat for plants can be expected to directly web construction (Greenstone 1984, affect consumer (Siemann et al. Rypstra 1986, Uetz 1991), which 1998, Knops et al. 1999, Haddad et makes them particularly sensitive to al. 2001, Johnson et al. 2006) as the vegetation structure of their well as predator (Pearson 2009) habitat (Olive 1980, Rypstra 1986, species because they are not only Gunnarsson 1990, Bradley 1993, primary producers, but also archi- Lubin et al.1993, Petersson 1996, tects, largely determining the physical Balfour & Rypstra 1998). While structure of habitats. The top-down structure can be expected to directly control of trophic interactions by affect the distribution of spiders (e.g. predators has mostly been demon- Pearson 2009), other features of strated for simply structured food- plant communities, like plant diversity webs in terrestrial ecosystems (e.g. or plant identity, have been less well Finke and Denno 2003, 2004, investigated. It is not clear whether Schmidt et al. 2003, Sanders et al. these characteristics might have a 2008). Only few experimental studies direct effect on distribution and on top- and intermediate (medium- abundance or an indirect effect via sized) predators found support for the prey communities. Plant diversity less investigated combined effect of (e.g. Siemann et al. 1998, Knops et bottom-up and top-down forces al. 1999) and especially plant identity regulating distribution patterns and (Schaffers et al. 2008) has been
Page 12 PhD thesis – Odile Bruggisser Chapter 1 shown to affect insect diversity and three characteristics of vegetation abundance, the main prey of spiders. (diversity, species composition, and Since spiders are not top predators, structure). Specifically, we tested the higher-order predators may also following hypotheses: 1) Vegetation control spider abundance and diver- structure has a direct effect on the sity. abundance of spiders. 2) Plant Argiope bruennichi (Scopoli species composition and diversity 1972) is a generalist passive affect spiders indirectly through prey predator. This orb-weaving spider communities. 3) As intermediate may play an important role in natural predators, A. bruennichi abundance is pest control (Rypstra and Carter mediated by a combination of top- 1995). Beside this potential beneficial down and bottom-up forces. effect, the presence of this species may, negatively affect ecosystem MATERIAL AND METHODS services like pollination, since hy- menopterans are among their most To investigate interactions in the important prey (Nyffeler and Benz foodweb centered on A. bruennichi 1981). A. bruennichi is very common we made use of twelve wildflower in southern Europe and has been strips with a specific study design, expanding northwards in recent which had been established in decades (Hänggi et al. 2001, Gutt- purpose of a larger research project. mann 1979). In uncultivated margins In a first part, we will describe the and fallow land within central Euro- study design of the field site, estab- pean agricultural landscape, A. lished for this larger research project. bruennichi is one of the most abun- In a second part we will explain how dant species (Barthel and Plachter A. bruennichi and its prey and 1995). predators were investigated within In this study, we were inter- these fields; Finally, we will explain ested in the top-down and bottom-up the statistical methods, which was mechanisms regulating the abun- adjusted to the specific design of the dance and hunting success of the field site. web-building spider Argiope bruen- nichi (Scopoli 1972) in semi-natural Study design of field site systems. We manipulated the plant The study took place in an intensively diversity and identity of semi-natural managed agricultural landscape habitats (wildflower strips) within an around Grandcour (46° 52' 18'' N, agricultural landscape in Switzerland 6° 55' 50'' W) in the lowlands of and thereby indirectly diversified western Switzerland. In the context habitat structure. Within these of a larger research project to explore wildflower strips, we studied the the structure and functioning of naturally occurring predator and prey metacommunities, 12 experimental community of A. bruennichi to wildflower strips (hereafter, fields) of investigate major interactions in this ~870m2 (9 x 96 m, or 6 x 144 m) system. We considered the following were planted in spring 2007, of factors: presence of predators, which nine were used in the present abundance of potential prey, and work. In purpose of the specific
Page 13 PhD thesis – Odile Bruggisser Chapter 1 questions addressed in the larger diversity plot was chosen by con- research project two factors were strained random draw from the 20 manipulated: diversity of plants (4 plant species pool (obviously, testing levels) and fencing (3 levels). In all combinations is not achievable): 1) contrast to the plant diversity treat- combinations of plants in the 3 ment, the fencing treatment was not fencing levels were the same within relevant for the study on A. bruen- each field; 2) plants were chosen so nichi. The fields were subdivided into that they appeared, within all 12 three fencing treatments, each of fields, the same number of times area 216m2 (Fig. 1). The first treat- (with few exceptions) in the 2, 6 and ment consisted of a fine-meshed (8 12 species levels; 3) within a field, mm mesh size), the second of a wide there was no overlap in the species meshed (25 mm mesh size) 1.2m chosen in levels 2, 6 and 12 species. high fence. The fences were installed The experiment can be described as ~20cm deep in the soil, with a ~10 an incomplete (not all combinations cm long right-angled bend directed of plants are considered) split block outwards from the plot and the design, with fields as random factors, fenced area was open on top. The and diversity factor nested in fencing fencing aimed at preventing the factor. access to large herbivores and/or In contrast to other biodiversity predators, which do not intervene in experiments (e.g., Cedar Creek: the present study; thus, the fencing Tilman et al. 1997, Tilman et al. factor was considered here as 2006; BIODEPTH: Schmid and Hector random blocks. The third treatment 2004; The JENA Experiment: Ro- was, as a control, not fenced. The scher et al. 2005, Marqurd et al. three fencing treatments were 2009) our experimental plots were randomly distributed in each field. not weeded, with the exception of Within each fencing treatment, four the problematic weeds Cirsium plots (6 by 9 meters) differing in arvense and Rumex obtusifolius, and plant diversity (2, 6, 12, 20 sown in the first year (2007) additionally species) were randomly assigned. Chenopodium album and Amaranthus Thus, in total each of the 12 fields retroflexus to prevent light competi- (random factor) consisted of 12 plots tion during germination. In the (3 fencing x 4 diversity treatments). following years, we allowed natural For the experiment, we seeded 20 invasion and the establishment of herbaceous plant species belonging seeds from the seed bank. Weeding to the same functional group (tall was avoided to minimize perturbation herbs); they were chosen from the of higher trophic levels, which were 24 plant species normally used in an important focus of the research Swiss wildflower strip mixtures project. Along the center of each (wildflower strips are ecological field, a 30cm wide path was estab- compensation areas in Switzerland; lished before data acquisition to see Pfiffner and Schaffner 2000, enable sampling in the centre of the Haaland et al. 2010; Table 1). Plant fields and to reduce disturbance while species composition of each plant walking through the fields.
Page 14 PhD thesis – Odile Bruggisser Chapter 1
Sampling of A. bruennichi and related webs, in the majority of cases trophic levels pinching off their legs to transport Argiope bruennichi is a predominantly the spider to their nest. Due to their diurnal forager capturing mostly large foraging range, we recorded the diurnal insects (Pasquet 1984, Baba presence of hornets at the field level and Miyashita 2006, Prokop 2006). (assuming they affected all plots Their web is characterized by a equally, independently of the diver- specific vertical zigzag silk band sity and fencing treatment). (stabilimentum) (Prokop and Gryglák- Prey availability was estimated ová 2005). In 2008 and 2009 all using data from an independent spider webs of adult female A. experiment in six fields, four of which bruennichi were sampled once a year were included in the present work. in each of 9 fields at the end of July Because the most abundant prey of and beginning of August, by transect A. bruennichi are dipterans and observations. On sunny and calm hymenopterans (Nyffeler and Benz days, from 10am until 6pm, webs 1981), we investigated insects were recorded along the central visiting flowers. On calm and sunny transect to a width of 50cm on each days during July and August, insects side, ignoring those built directly were observed once per field and along the path and at the junction of year between 10:00am and plots. For each web, the following 16:00pm. In each plot, insects were information was recorded: identity of counted during 15 minutes in two support plants (only in 2009), randomly positioned 1x1m plastic number and identity of trapped prey frames (placed carefully prior to (at the order level); indication of observations). Species were identified predator attack (remains of spider directly in the field to the order level. legs in the web, see below); web size Vegetation sampling took place (width and height), above ground in 2008 and 2009 between July and height of the centre of the web, and October. In all plots the total number web orientation. All prey species of plant species (2008: 22.17 ± from the webs were collected for 6.45 (mean ± s.d.), max: 42, min: 6; subsequent determination. If not too 2009: 19.31 ± 5.36, max: 35, min: heavily damaged, prey volume was 7) was determined and their individ- estimated from width and length, ual percentage cover estimated using the equation for a prolate (Perner et al. 2005, Woodcock et al. spheroid. 2007). Vegetation structure was Predators of Argiope bruennichi characterized with the following were investigated by the inspection variables: average (2008: 1.39m ± of web damage or by direct observa- 0.38, min: 0.3m, max: 2.1m; 2009: tions during the same period as 0.99m ± 0.25, min: 0.3m, max: spider webs were counted. Observed 1.8m) and maximum vegetation predation acts were all due to a height (2008: 1.94 ± 0.45; 2009: single species, the European hornet 1.48 ± 0.41), and leaf area index Vespa crabro L. (Hymenoptera: LAI (2008: 1.86 ± 0.65; 2009: 3.77 Vespidae). Hornet individuals were ± 0.85). We had previously tested observed attacking spiders on their the relationship between LAI and
Page 15 PhD thesis – Odile Bruggisser Chapter 1 above-ground biomass, and found 2009 (n = 2); IV) 1Æ0 hornets were that LAI is a good surrogate for only present in 2008 (n = 1). The vegetation biomass (correlation). We effect of the presence of hornets on used LAI as an indirect measure of the percentage change in abundance vegetation cover (hereafter, vegeta- of A. bruennichi webs was tested tion cover). with a t-test assuming unequal variance between categories I and II Statistical analysis (i.e., no change) versus III. Plants used for web construction We tested the null hypothesis that Pairewise interactions between plant species were used in proportion trophic levels to their availability with a Χ2 test. We explored how vegetation could The expected frequency with which a explain the distribution, abundance plant species was used for web and trapping success of A. bruennichi construction was calculated by in the 216 (nine fields and two years) multiplying the percent cover of the plots with mixed effect models (Zuur plant species by the total number of et al. 2009). All dependent and plants used for web construction indiependent variables used in this within the given plot (note that one analysis are described in Table 3 web could be attached to several (Analysis of parewise interactions). plant species). As dependent variables, we used We identified two plant species “presence/absence of webs”, “abun- (see Results section) with the highest dance of webs” (excluding plots contributions to Χ2, namely Malva sp. without webs; the latter variable was and Dipsacus fullonum. In subse- Box-Cox transformed, Legendre and quent analyses, we used the log- Legendre 1998), and “trapping transformed cover of both plants success”. The latter variable was separately to describe the effect of composed of a single vector including “plant composition” on the different a combination of the two vectors measurements of spiders. “number of webs with prey” and “number of webs without prey”, Effect of predators created by the command “cbind” in Due to their high mobility, the R. We considered three aspects of influence of hornets on the abun- vegetation as independent variables: dance of A. bruennichi was analyzed plant diversity, composition and at the field level. For each field, the vegetation structure. To describe the percentage change (positive or diversity in each plot, we did not use negative) in spider web number the number of sown species (diver- between 2008 and 2009 was sity treatment), but the actual calculated. The nine fields were species richness measured by the assigned to one of four categories: I) diversity number (or effective number 0Æ0 during the sampling period no of species, Jost 2006), based on hornets were present in both years Shannon diversity. The diversity (n = 5); II) 1Æ1 hornets were number expresses species richness present in both years (n = 1); III) corrected for relative abundance – in 0Æ1 hornets were only present in our case, relative cover of plants
Page 16 PhD thesis – Odile Bruggisser Chapter 1
(Legendre and Legendre 1998). Note logit link function (function glmer of that diversity number was highly package lme4 in R; Bates and correlated with the number of sown Maechler 2009). species (Pearson r = 0.42, t = 6.74, We performed two additional P < 0.01). To describe plant com- analyses, using the same method as postion we considered the log for “abundance of webs”. First, to transformed cover of Malva sp. and further explore the effects of vegeta- of Dipsacus fullonum as two inde- tion on trapping success of spiders, pendent variables. The structure of we used as dependent variable “prey the vegetation in each plot we volume”, including the prey volume described by vegetation cover (LAI) of the largest trapped prey observed and average vegetation height. The in each spider web. Second, in the latter five independent variables were six fields where pollinators were all standardized prior to analyses. sampled, we examined the relation- We used linear mixed-effect ship between “abundance of potential models assuming a random intercept, prey” and vegetation. and using as random factors “fence” (fencing treatment), nested within Direct and indirect interactions “field”, nested within “year”. As between all trophic levels explained above, fencing was used as With the four fields (96 plots in two a random factor since we did not years) for which all information expect this treatment to affect the (abundance of spiders, presence of abundance of A. bruennichi (indeed, hornets, abundance of potential prey, including fencing as a fixed factor and plant diversity, composition and never yielded significant results). To vegetation structure) was available, select the best model, we started we evaluated the relative importance with a “full” model (all explanatory of the explanatory variables on the variables and their pairwise interac- abundance of A. bruennichi. The aim tions; higher order interactions were was to obtain a global view of the not tested), and removed in turn factors affecting spider abundance, variables least affecting the AIC of as customarily achieved with path the model, using maximum likelihood; analysis. However, the structure of once the best model was found, its our experiment, with nested random parameters were estimated with factors (year, field and fence), made restricted maximum likelihood. For this approach impracticable. To solve “abundance of webs”, we applied a this problem, we used a linear mixed linear mixed effect model with effect model (of Gaussian family and Gaussian family and identity link random factors as above) after (function lme of package nlme in R; having standardized all variables. Pinheiro et al. 2008; R Development Standardization renders the variables Core Team 2009). For the dependent dimensionless, and thus the slopes of variables “presence/absence of the linear model can be compared webs” (a binary variable) and “trap- and used as a measure of the impor- ping success” (a proportion variable), tance of the “causal” paths. In the we used a generalized linear mixed present analysis the vegetation was effect model with binomial family and described by three independent
Page 17 PhD thesis – Odile Bruggisser Chapter 1 variables. First, we included plant Figure 2. Among these 24 plant taxa, diversity expressed by plant “diver- use of the Malva sp. group (Malva sity number”. As second independent moschata and Malva sylvestris) was variable we described plant species nearly double that than expected, composition by a single variable: we while only one third of the available performed a Correspondence Analysis Dipsacus fullonum plants were used. (CA) of the plots described by the A total of 2082 (2008: 910; vegetation, and used the coordinates 2009: 1172) prey individuals belong- of the plots on the first ordination ing to 12 different orders were axis as summary variable. We used sampled in webs of A. bruennichi the same approach with vegetation (Table 2). The prey community, structure, the third independent representing prey individuals directly variable, but here used a Principal collected out of spider webs, was Component Analysis (PCA) to mostly composed of dipterans (2008: summarize the three variables 45%, 2009: 26%) and hymenopter- average and maximum vegetation ans (2008 and 2009: 35%). Around height and LAI. All ordinations were 50% of hymenopterans belonged to performed with the package vegan in the family Apidae. In 2008, an R (Oksanen et al. 2009). We further average of 1.63 ± 1.04 (mean ± included a first-order auto-regressive standard deviation) prey individuals correlation structure (corAR1) in the were found per web, while in 2009 linear mixed effect model to com- there were 1.49 ± 0.85. This pound the correlation between decrease in trapping success in 2009 observations from the two years. was further evidenced by a lower percentage of webs containing prey RESULTS (44% in 2008; 36% in 2009; G-test of independence, P < 0.001). A Spider abundance, plant selection and maximum of 8 prey individuals were diet found in one spider web each year. Argiope bruennichi abundances more than doubled between 2008 (917 Simple interactions between trophic webs) and 2009 (1926 webs). In levels 2008, a maximum of 4 spider webs Here, we present the results of per square meter were observed, analyses between A. bruennichi and while in 2009 densities could reach 1) their predators, 2) their potential up to 7 webs per square meter. Web prey, 3) the vegetation, and 4) size and aboveground height did not between the abundance of potential significantly differ between plots or prey and the vegetation. Analysis 1) fields. During the sampling period, A. is performed at the field level, while bruennichi was the dominant adult other analyses are at the plot level orb-weaving spider occurring in our (with one exception). Three aspects fields and other species, like Araneus of vegetation are considered: diver- diadematus or Nuctenea umbratica, sity, structure, and composition. were only occasionally observed. 1) Predators of A. bruennichi. The frequency of use of plant Hornets were present in two fields in species for web building is given in 2008, and in three fields in 2009.
Page 18 PhD thesis – Odile Bruggisser Chapter 1
Two fields were newly colonized in positive effect. 2009 while one was abandoned (Fig. When considering A. bruennichi 3). It is apparent that the presence of abundance, the only significant direct hornets has a strong effect on A. effect was that of D. fullonum, with bruennichi abundance, which is fewer webs being found in plots with statistically significant despite the high abundances of D. fullonum. small sample size (2-tailed t-test Interestingly, main effects (i.e., the assuming unequal variance between effect of one variable when the other groups 0Æ0 and 1Æ1 versus 0Æ1 of is equal to 0 – in our case to its Fig. 3: d.f. = 5, t = 3.97, mean since all variables were stan- P = 0.01). dardized) of Malva sp. and of vegeta- 2) Potential prey of A. bruen- tion height were of the same sign as nichi. There was a significant positive those for A. bruennichi pres- correlation between pollinator abun- ence/absence, but were not signifi- dances and the presence/absence of cant. the spider (mixed effect model with Trapping success depended on binomial response: n = 92, fixed vegetation structure and plant effect = 0.98, z = 2.69; composition: success was increased P = 0.007). The effect on spider in plots where the vegetation was tall abundance and on trapping success and decreased where Malva sp. was (number of webs with and without abundant. Both relationships can be prey) was also positive, but not explained simply by the fact that significant. plots with increased vegetation 3) Vegetation effects on A. bru- height and decreased Malva sp. ennichi. The effects of the different abundance harbored fewer spider vegetation variables on the pres- webs, and thus those present had a ence/absence, abundance and greater share of potential prey. trapping success of A. bruennichi in Indeed, We also observed that the nine fields and two years trapping success was negatively (n = 216), are summarized in correlated with spider density (Pear- Table 4. The presence/absence of the son r = -0.26, t = -3.59, P < 0.01). spider was influenced by the diversity Plant diversity was found to have an and composition of plants (Malva, effect in conjunction with vegetation Dipsacus cover) and by the structure cover (LAI): it was positive for low of the vegetation. It was positively vegetation cover, but disappeared related to plant diversity and nega- with high cover. tively affected by vegetation height. Prey items were significantly Significant interactions between larger in plots with higher plant explanatory variables revealed that diversity, while in plots with high high vegetation cover (LAI) decreased densities of Malva sp. significantly the negative effect of vegetation smaller prey were trapped (analysis height, and that Malva sp. abundance performed for each web, d.f. = 818; reinforced the negative effect of estimate = 0.29, t = 2.14, vegetation height. Vegetation cover P = 0.033, and estimate = -0.32, only had an effect in conjunction with t = -2.28, P = 0.023, respectively). Malva sp. abundance, by lowering its The structure of the vegetation did
Page 19 PhD thesis – Odile Bruggisser Chapter 1 not affect prey volume. dance once all other effects were 4) Vegetation effects on the removed (the same result was found abundance potential prey. In the six with diversity expressed as diversity fields where pollinator and plants number or as total number of spe- were investigated, pollinator abun- cies). Note that plant diversity was dances were only affected by plant not correlated with vegetation diversity (d.f. = 91, esti- structure or plant species composi- mate = 0.45, t = 2.36, P = 0.02), tion, while both later variables were while vegetation structure and the weakly and non-significantly corre- percent cover of Malva sp. and D. lated. fullonum had no significant effect. DISCUSSION Direct and indirect interactions in the full system Our study system showed evidence All direct and indirect effects on for the combined importance of spider abundance could be analyzed bottom-up and top-down effects and in a subset of 4 fields. The result is of direct and indirect interactions in summarized in Figure 4. The correla- order to understand the abundance of tion between both years was weak a focal species, in our case a web- (Phi=0.021). The observed interac- building spider. Among the web of tions between single trophic levels interactions found to affect A. were largely confirmed in this full bruennichi, three potential factors model. The negative effect of hornets stood out: the strong negative effect and the positive effect of the abun- of a single predator, namely hornets, dance of potential prey on A. bruen- the positive direct effect of vegeta- nichi remained significant once the tion structure and the positive effect effect of all other explanatory vari- of plant diversity, which affected ables had been excluded. Plant spider abundance directly and species composition (measured as indirectly via potential prey. The the plot coordinate of the first axis of latter chain of interaction was a CA on plant community) had no expected; however, the observed effect either on potential prey direct effect of plant diversity in this abundances or on spider abundance. system raises interesting questions Vegetation structure (measured as about selection pressures underlying the plot coordinate of the first axis of habitat choice in this spider. a PCA on three variables) had a direct effect on spider abundance, but not Top-down effects on potential prey abundance. Plant Although the distribution of A. diversity had a marginally significant bruennichi was mediated by the effect on potential prey abundance bottom-up effect of several vegeta- and the latter a significant positive tion variables, their abundances were effect on spider abundance. This is strongly affected by the presence of an indication of an indirect effect of hornets. Due to the observed drastic plant diversity on A. bruennichi. reduction in spider abundance in Surprisingly, however, plant diversity fields where hornets were present also directly affected spider abun- (Fig. 3), top-down forces are certainly
Page 20 PhD thesis – Odile Bruggisser Chapter 1 a key factor determining A. bruen- Pearson 2009). Here, we found that nichi abundance. Compared to vegetation structure significantly bottom-up effects of plants, this influenced spider abundance once all factor is most probably unpredictable other measured variables had been by spiders during the habitat selec- accounted for. Interestingly, such a tion process, which occurs earlier direct effect of vegetation structure (around May, Hänggi et al. 2001) was not observed on the abundance than the main period of activity of of potential prey. hornets (late July to August, Tryja- Contrary to other studies (e.g., nowski et al. 2010). Thus, the effect Perner et al. 2005, Schaffers et al. of hornets should be primarily on 2008) global plant species composi- spider abundance, and less on spider tion did not predict A. bruennichi spatial distribution. It is known that abundance. This discrepancy can be Argiope as well as other web-building simply explained by the fact that spider species add an irregular tangle variability of plant species composi- of non-sticky silk threads, known as tion was comparatively low in our barrier webs around their web to experimental system, where sown prevent attacks from predators plants belonged to a single functional (Robinson and Mirick 1971, Lubin group. This does not, however, mean 1975). In our system, such an that plant identity is neutral for antipredator response was very habitat selection. The presence of A. commonly observed in a single field bruennichi was found to depend in 2009, where predation pressure by positively on Malva sp. and the hornets was strongest. abundance of the spider negatively on Dipsacus fullonum. This result is Bottom-up effects in line with experiments of Pearson We observed a tight interaction (2009), who observed that the between vegetation variables and A. presence of a single invasive plant bruennichi distribution patterns. species enhanced abundances of the Vegetation structure was, compared web-building spider Dictyna spp. In to plant diversity, identity or species their experiement the observed spider composition, a better variable to species seemded to show a prefer- predict distribution patterns of this ence for a certain plant species, as it spider. The importance of vegetation was observed in our experiment with structure for spiders (Rypstra 1986, Malva sp. Halaj et al. 1998, McNett and Plant species composition and Rypstra 2000) as well as for arthro- vegetation structure were found to pods in general (Morris 2000, Perner have no significant effects on poten- et al. 2005) is well supported. tial prey community, and thus could Despite the interest in the relation- not be ascribed any indirect effect on ship between spiders and vegetation spider abundance, unlike plant structure, only few studies analyzed diversity. whether this relationship was direct Direct and Indirect effects of plant or indirect through its influence on diversity prey communities (Rypstra 1983, Several biodiversity studies observed
Page 21 PhD thesis – Odile Bruggisser Chapter 1 a positive relationship between plant plants may directly increase predator diversity and total predator abun- abundance (e.g. pollen for parasi- dance (Siemann et la. 1998, Haddad toids). This is not likely to be the et al. 2001, Haddad et al. 2009). For case for web-building spiders. spider abundance, however, this Secondly, the effect may be apparent response is less clear. In a grassland through a change in the interaction experiment by Perner et al. (2005), between pollinators and predators in total web-building spider abundance more diverse habitats (Wooton was positively but not significantly 1993). The observation that prey size related to plant diversity. In another in webs was larger in plots with grassland experiment, Koricheva et higher plant diversity may support al. (2000) even found a negative this hypothesis. Thirdly, some form effect of plant diversity. This study of habitat selection by predators may however considered epigeic spiders, be a simple and widespread cause for which can be expected to show a such a direct effect. If a predator different response to plants than selects habitats with high plant web-building spiders, since they do diversity because they generally not need plants for web construction. harbor more prey, a direct effect In our system, we found an effect of between plant and predator is plant diversity which could be expected when plant diversity and decomposed into a direct and an prey abundance are not "perfectly" indirect component. correlated (Siemann et al. 1998). A positive effect of plant diver- Habitats may be selected for other sity on pollinators – the main prey of reasons, for example to enhance A. bruennichi – is seen in habitats trapping efficiency, to obtain protec- dominated by flowering plants tion from larger predators (Price et al. (Heithaus 1974, Banaszak 1996, 1980), or to avoid negative effects of Ghazoul 2006). Thus, we can expect meteorological conditions like wind plant diversity to affect spider (Enders 1975). In any case, the abundance indirectly through its observed direct link between plant effect on potential prey. In our diversity and A. bruennichi abun- system, this chain of interactions dance suggests that the spider has was substantiated by the positive evolved the ability to select more effect of plant diversity on the diverse habitats. Such an ability of abundance of potential prey, and in spiders to discriminate between turn of potential prey abundance on different habitat types has been A. bruennichi abundance. proposed by several authors (Green- Our experiment also revealed a stone 1984, Lubin et al.1993, direct effect of plant diversity on McNett and Rypstra 2000, Pearson spider abundance. Three potential 2009), and studies have shown that explanations have been suggested for web-building spiders respond to the direct effect of plant diversity on habitat diversity and complexity predator diversity (Siemann et al. (Rypstra 1986, Greenstone 1984, 1998), which we also expect to Halaj et al. 1998, Rypstra et al. apply for predator abundance. Firstly, 1999). additional resources from a variety of
Page 22 PhD thesis – Odile Bruggisser Chapter 1
Caveats understand the role of spiders in Our study is a semi-natural experi- agricultural food-webs and to maxi- ment where the diversity of sown mize their potential as biological plant species was manipulated. A control agent, spiders have thus to be strict experimental approach to our considered as intermediate predators questions would have required in food-webs where plants, prey independent manipulations of all species and larger predators interact. other factors. This may be feasible for the abundance of potential prey LITERATURE CITED and of hornets, but would involve closed experiments, and possibly Baba, Y., and T. Miyashita. 2006. Does artificial prey communities. Independ- individual internal state affect the ently manipulating diversity, composi- presence of a barrier web in Argiope tion and structure of the vegetation bruennichi (Araneae: Araneidae)? would be even more challenging. Journal of Ethology 24:75-78. Thus, we cannot exclude that our Balfour, R. A., and A. L. Rypstra. 1998. observed relationships are the result The influence of habitat structure on of artifactual correlations. However, spider density in a no-till soybean this uncertainty is at the benefit of agroecosystem. Journal of Arachnol- experimental conditions being closer ogy 26:221-226. to natural situations. Balvanera, P., A. B. Pfisterer, N. Buch- mann, H. S. He, T. Nakashizuka, D. Conclusions Rafaelli, and B. Schmid. 2006. Quan- The significant results of vegetation tifying the evidence for biodiversity variables, of prey and of hornets effects on ecosystem functioning and support the hypothesis that our service. Ecology Letters 9:1146- system is mediated by bottom-up and 1156. top-down forces. Although the Banaszak, J. 1996. Ecological bases of importance of combined bottom-up conservation of wild bees. Pages 55– and top-down effects have been 62 in A. Matheson, S. L. Buchmann, invoked in several models of commu- C. O'Toole, P. Westrich, and I. H. nity organization (Oksanen et Williams, editors. The conservation of al.1981, Leibold 1989, Hunter and bees. Linnean Society Symposium Price 1992, Elmhagen and Rushton Series 18. Academic Press, London, 2007), they have so far rarely been UK. considered together in studies of Barthel, J., and H. Plachter. 1995. arthropods (e.g., Spiller and Schoener Distribution of foliage-dwelling spiders 1994). Spiders are often viewed as in uncultivated areas of agricultural the dominant invertebrate predator of landscapes (Southern Bavaria, Ger- most ecosystems (Wise 1993), and many) (Arachnida, Araneae). Pages their predators have often been 11-21 in V. Ruzicka, editor. Proceed- neglected. Our study highlights the ings of the 15th European Colloquium need to consider the effects of both of Arachnology. Ceské Budejovice: top-down and bottom-up forces to Institute of Entomology. understand the distribution patterns Bates, D. and M. Maechler. 2009. lme4: of these arthropod predators. To Linear mixed-effects models using S4
Page 23 PhD thesis – Odile Bruggisser Chapter 1
classes. R package version 0.999375- p> 31. Haaland, C., R. E. Naisbit, and L.-F. Bradley, R. A. 1993. The influence of Bersier (in press) Sown wildflower prey availability and habitat on activity strips for insect conservation – a patterns and abundance of Argiope review. Insect Conservation and Di- keyserlingi (Araneae: Araneidae). versity. Journal of Arachnology 21:91-106. Haddad, N. M., M. G. Crutsinger, K. Elmhagen, B., and S. P. Rushton. 2007. Gross, J. Haarstad, J. M. H. Knops, Trophic control of mesopredators in and D. Tilman. 2009. Plant species terrestrial ecosystems: top-down or loss decreases arthropod diversity and bottom-up? Ecology Letters 10:197- shifts trophic structure. Ecology Let- 206. ters 12:1029-1039. Enders, F. 1975. Change of web site in Haddad, N. M., D. Tilman, J. Haarstad, Argiope spiders (Araneidae). American J. Ritchie, and J. M. H. Knops. 2001. Midland Naturalist 94:484-490. Contrasting effects of plant diversity Finke, D. L., and R. F. Denno. 2003. and composition on insect communi- Intra-guild predation relaxes natural ties: a field experiment. The American enemy impacts on herbivore popula- Naturalist 158:17-35. tions. Ecological Entomology 28:67- Halaj, J., D. W. Ross, and A. D. 73. Moldenke. 1998. Habitat structure Finke, D. L., and R. F. Denno. 2004. and prey availability as predictors of Predator diversity dampens trophic the abundance and community organi- cascades. Nature 429:407-410. zation of spiders in western Oregon Ghazoul, J. 2006. Floral diversity and Forest canopies. Journal of Arachnol- the facilitation of pollination. Journal ogy 26:203-220 of Ecology 94:295-304. Heithaus, E. R. 1974. The role of plant– Greenstone, M. H. 1984. Determinants pollinator interactions in determining of web spider species diversity: vege- community structure. Annals of the tation structural diversity vs. prey Missouri Botanical Garden 61:675– availability. Oecologia 62:299-304. 691. Gunnarsson, B. 1990. Vegetation Hunter, M. D., and P. W. Price. 1992. structure and the abundance and size Playing chutes and ladders: heteroge- distribution of spruce-living spiders. neity and the relative roles of bottom- Journal of Animal Ecology 59:743- up and top-down forces in natural 752. communities. Ecology 73:724-734. Guttmann, R. 1979. Zur Arealentwick- Johnson, M. T. J., M. J. Lajeunesse, and lung und Ökologie der Wespenspinne A. A. Agrawal. 2006. Additive and (Argiope bruennichi) in der Bundesre- interactive effects of plant genotypic publik Deutschland und den angren- diversity on arthropod communities zenden Ländern (Araneae). Bonner and plant fitness. Ecology Letters Zoologischer Beitreiträge 30:454-486. 9:24-34. Hänggi, A., P. Jäger, and M. Kreuels. Jost, L. 2006. Entropy and diversity. 2001. Spinne des Jahres 2001 – Die Oikos 113:363-375. Wespenspinne Argiope bruennichi Knops, J. M. H., D. Tilman, N. M. (SCOPOLI, 1772). Haddad, S. Naeem, C. E. Mitchell, J. Page 24 PhD thesis – Odile Bruggisser Chapter 1 P. B. Reich, E. Siemann, and J. Groth. Nyffeler, M., and G. Benz. 1981. 1999. Effects of plant species rich- Freilanduntersuchungen zur Nah- ness on invasion dynamics, disease rungsökologie der Spinne: Beobach- outbreaks, and insect abundances and tungen aus der Region Zürich. Anzei- diversity. Ecology Letters 2:286-293. ger für Schädlingskunde Pflanzen- Koricheva, J., C. P. H. Mulder, B. schutz Umweltschutz 54:33-39. Schmid, J. Joshi, and K. Huss-Danell. Olive, C. W. 1980. Foraging specializati- 2000. Numerical responses of differ- ons in orb-weaving spiders. Ecology ent trophic groups of invertebrates to 61:1133-1144. manipulations of plant diversity in Oksanen, L., S. D. Fretwell, J. Arruda, grasslands. Oecologia 126:310–320. and P. Niemela.1981. Exploitation Leibold, M. A. 1989. Resource edibility ecosystems in gradients of primary and the effects of predators and pro- productivity. American Naturalist ductivity on the outcome of trophic 118:240-261. interactions. American Naturalist Oksanen J., R. Kindt, P. Legendre, B. 134:992-949. O'Hara, G. L. Simpson, P. Solymos, Legendre, P. and L. Legendre (1998) M. H. H. Stevens, and H. Wagner. Numerical Ecology. Elsevier, Amster- 2009. vegan: Community Ecology dam. Package. R package version 1.15-3. Lubin, Y. D. 1975. Stabilimenta and Pasquet, A. 1984. Predatory-site barrier webs in the orb webs of Ar- selection and adaptation of the trap in giope argentata (Araneae Araneidae) four species of orb-weaving spiders. on Daphne and Santa Cruz Islands, Biology of behaviour 9:3-19. Galapagos. Journal of Arachnology Pearson, D. E. 2009. Invasive plant 2:119-126. architecture alters trophic interactions Lubin, Y., S. Ellner, and M. Kotzman. by changing predator abundance and 1993. Web relocation and habitat behaviour. Oecologia 159:549-558. selection in a desert widow spider. Perner, J., C. Wytrykush, A. Kahmen, N. Ecology 74:1915-1928. Buchmann, I. Egerer, S. Creutzburg, Marquard, E., C. Roscher, M. Gubsch, A. N. Odat, V. Audorff, and W. W. Weis- Lipowsky, and B. Schmid. 2009. ser. 2005. Effects of plant diversity, Positive biodiversity productivity rela- plant productivity and habitat parame- tionship due to increased plant den- ters on arthropod abundance in mon- sity. Journal of tane European grasslands. Ecography Ecology 97:696–704. 28:429-442. McNett, B. J., and A. L. Rypstra. 2000. Petersson, R. B. 1996. Effect of forestry Habitat selection in a large orb- on the abundance and diversity of weaving spider: vegetational complex- arboreal spiders in the boreal spruce ity determines site selection and dis- forest. Ecology 19:221-228. tribution. Ecological Entomology Pfiffner, L., and D. Schaffner. 2000. 25:423-432. Streifenförmige ökologische Aus- Morris, M. G. 2000. The effects of gleichsflächen in der Kulturlandschaft. structure and its dynamics on the Acker-krautsteifen, Buntbrache, Feld- ecology and conservation of arthro- ränder. Page 44 in W. Nentwig, edi- pods in British Grasslands. Biological tor. Verglag Agrarökoligie Bern, Han- Conservation 95:129-142. nover. Page 25 PhD thesis – Odile Bruggisser Chapter 1 Pinheiro, J., D. Bates, S. DebRoy, D. inhabitants. Journal of Arachnology Sarkar, and the R Core team. 2008. 27:371–77. nlme: Linear and Nonlinear Mixed Robinson, M. H., and H. Mirick. 1971. Effects Models. R package version The predatory behaviour of the golden 3.1-93. web spider Nephila clavipes. Psyche Price, P. W., C. E. Bouton, P. Gross, B. 149:123-139. A. McPheron, J. N. Thompson, and A. Root, R. B. 1973. Organization of a E. Weis. 1980. Interactions among plant- arthropod association in simple three trophic levels: influence of and diverse habitats: the fauna of plants on interactions between insect collards (Brassica oleracea). Ecological herbivores and natural enemies. An- Monographs 43:95-124. nual Review of Ecology and Systemat- Roscher, C., V. M. Temperton, M. ics 11:41-65. Scherer-Lorenzen, M. Schmitz, J. Prokop, P. 2006. Prey type does not Schumacher, B. Schmid, N. Buch- determine web design in two orb- mann, W. W. Weisser, and E. D. weaving spiders. Zoological Studies Schulze. 2005. Overyielding in ex- 45:124-131. perimental grassland communities – Prokop, P., and D. Grygláková. 2005. irrespective of species pool or spatial Factors affecting the foraging success scale. Ecology Letters 8:419–429. of the wasp-like spider Argiope bruen- Sanders, D., H. Nickel, T. Grutzner, and nichi (Scopoli): role of web design. C. Platner. 2008. Habitat structure Biologia 60:165-169. mediates top-down effects of spiders R Development Core Team, 2009. R: A and ants on herbivores. Basic and language and environment for statisti- Applied Ecology 9:152-160. cal computing. R Foundation for Sta- Schaffers, A. P., I. P. Raemakers, K. V. tistical Computing, Vienna, Austria. Sykora, and C. J. F. ter Braak. 2008. ISBN 3-900051-07-0, URL Arthropod assemblages are best pre- http://www.R-project.org. dicted by plant species composition. Rypstra, A. L. 1983. The importance of Ecology 89:782-794. food and space in limiting web-spider Schmid, B., and A. Hector. 2004. The densities; a test using field enclo- value of biodiversity experiments. sures. Oecologia 59:312-316. Basic and Applied Ecology 5:535-542. Rypstra, A. L. 1986. Web spiders in Schmidt M. H., A. Lauer, T. Purtauf, C. temperate and tropical forests: rela- Thies, M. Schaefer, and T. tive abundance and environmental Tscharntke. 2003. Relative impor- correlates. American Midland Natural- tance of predators and parasitoids for sits 115:42-51. cereal aphid control. Proceedings of Rypstra, A. L., and P. E. Carter. 1995. the Royal Society of London, Series B: The web spider community of soy- Biological Science 270:1905-1909. bean agroecosystems in southwestern Siemann, E., D. Tilman, J. Haarstad, and Ohio. Journal of Arachnology 23:135- M. Ritchie. 1998. Experimental test of 144. the dependence of arthropod diversity Rypstra, A. L., P. E. Carter, R. A. on plant diversity. The American Balfour, and S. D. Marshall. 1999. Naturalist 152:738-750. Architectural features of agricultural Spiller, D. A., and T. W. Schoener. habitats and their impact on the spider 1994. Effects of top and intermediate Page 26 PhD thesis – Odile Bruggisser Chapter 1 predators in a terrestrial food web. spider foraging. Pages 331-347 in S. Ecology 75:182-196. S. Bell, E. D. McCoy and H. R. Tilman, D., J. Knops, D. Wedin, P. Mushinsky, editors. Habitat Structure: Reich, M. Ritchie, and E. Siemann. the Physical Arrangement of Objects 1997. The influence of functional in Space. Springer, Berlin. diversity and composition on ecosys- Wise, D. H. 1993. Spiders in ecological tem processes. Science 277:1300- webs. Cambridge University Press, 1302. Cambridge, UK. Tilman, D., P. B. Reich, and J. M. H. Woodcock, B. A., S. G. Potts, E. Pilgrim, Knops. 2006. Biodiversity and eco- A. J. Ramsay, T. Tscheulin, A. Park- system stability in a decade-long inson, R. E. N. Smith, A. L. Gundrey, grassland experiment. Nature V. K. Brown, and J. R. Tallowin. 441:629-632. 2007. The potential of grass field Topping, C. J., and G. L. Lovei. 1997. margin management for enhancing Spider density and diversity in relation beetle diversity in intensive livestock to disturbance in agroecosystems in farms. Journal of Applied Ecology New Zealand, with comparison to 44:60-69. England. New Zealand Journal of Wooton, J. T. 1993. Indirect effects and Zoology 21:121-128. habitat use in an intertidal community: Tryjanowski, P., T. Pawlikowski, K. interaction chains and interaction Pawlikowski, W. Banaszak-Cibicka, modification. American Naturalist and T. H. Sparks. 2010. Does climate 141:71-89. influence phenological trends in social Zuur, A. F., E. N. Ieno, N. J. Walker, A. wasps (Hymenoptera: Vespinae) in A. Saveliev, and G. M. Smith. 2009. Poland? European Journal of Entomol- Mixed Effects Models and Extensions ogy 107:203-208. in Ecology with R. Springer, New Uetz, G. W. 1991. Habitat structure and York. Page 27 PhD thesis – Odile Bruggisser Chapter 1 TABLE 1. List of species sown in the wildflower strips used presenting this study. Plant family Plant species Seed density Life history Months of (g/ha) flowering Apiaceae Daucus carota 150 Biannual 6-8 Pastinaca sativa 80 Biannual 7-8 Asteraceae Achillea millefolium 20 Perennial 6-9 Anthemis tinctoria 20 Perennial 6-8 Centaurea cyanus 500 Biannual 6-10 Centaurea jacea 200 Perennial 6-9 Cichorium intybus 120 Perennial 7-9 Leucanthemum vulgare 80 Perennial 5-10 Tanacetum vulgare 3 Perennial 6-9 Boragninaceae Echium vulgare 200 Perennial 5-10 Caryophyllaceae Agrostemma githago 600 Biannual 6-8 Silene alba 100 Biannual 6-9 Clusiaceae Hypericum perforatum 60 Perennial 6-9 Dipsacaceae Dipsacus fullonum 2 Biannual 7-8 Lamiaceae Origanum vulgare 60 Perennial 7-9 Malvaceae Malva moschata 20 Perennial 6-9 Malva sylvestris 60 Biannual 4-9 Papaveraceae Papaver rhoeas 150 Biannual 5-9 Scrophulariaceae Verbascum thapsus ssp. 50 Biannual 6-9 Verbascum lychnitis 30 Perennial 6-9 Page 28 PhD thesis – Odile Bruggisser Chapter 1 TABLE 2. Percentage of observed prey individuals in Argiope bruennichi spider webs in 2008 and 2009. order 2008 2009 Diptera 45 26 Hymenoptera 35 35 Hemiptera 7 11 Coleoptera 6 17 Lepidoptera 3 4 Thysanoptera 1 1 Mecoptera 1 0 Araneae 1 2 Orthoptera 1 0 Acari 0 1 Caelifera 0 2 Neuroptera 0 1 Total 910 1172 Page 29 PhD thesis – Odile Bruggisser Chapter 1 TABLE 3. Independent and dependent variables used in the analysis of pairwise interactions between trophic levels (see Table 4) and in the global analysis of direct and indirect effects in all trophic levels (see Figure 4). Analyses of pairewise interactions Variable type Variable name Comment Dependent variable presence/absence of webs binary variable abundance of webs excluding plots without webs; Box-Cox transformed trapping success number of webs with and number of webs without prey (proportion variable) prey volume prey volume of largest prey observed in each web; Box-Cox transformed abundance of potential prey number of flower visiting insects in each plot; Box-Cox transformed Independent variable Vegetation structure: vegetation cover measured as quantitative variable leaf area index (LAI) average vegetation heigth quantitative variable Plant composition: cover of Malva sp log-transformed percentage (1 to 100) cover cover of Dipsacus fullonum log-transformed percentage (1 to 100) cover Plant diversity: diversity number quantitative variable Global analysis of all interactions Dependent variable abundance of webs quantitative variable, Box-Cox transfor- med Independent variable Vegetation structure: 1st PCA axis based on the plots quantitative variable described by the variables of vegetation structure Plant composition: 1st CA axis based on the plots quantitative variable described by the cover of individual plant species Plant diversity: diversity number quantitative variable Page 30 TABLE 4. Effect of vegetation variables on the presence/absence (nb. of observations: 206), abundance (d.f. = 112) and trapping success (d.f. = 111) of Argiope bruennichi analyzed by generalized linear mixed effect models (SE standing for standard error). “Trapping success” represents a single vector including a combination of the two vectors “number of webs with prey” and “number of webs without prey”. The results shown here represent the best models obtained by backward elimination. Significant effects are shown in bold. presence/absence of webs abundance of webs trapping success Estimate SE ZPEstimate SE TPEstimate SE Z P Plant diversity 0.789 0.318 2.485 0.013 Average vegetation height -0.928 0.351 -2.649 0.008 -0.035 0.109 -0.325 0.746 0.178 0.059 3.014 0.003 LAI (vegetation cover) 0.185 0.145 1.292 0.199 -0.139 0.086 -1.625 0.104 Malva cover 0.616 0.347 1.776 0.076 0.031 0.088 0.349 0.728 -0.138 0.053 -2.592 0.010 Dipsacus cover -0.221 0.095 -2.317 0.022 Plant Diversity x LAI -0.092 0.045 -2.044 0.041 Veg. height x LAI 0.829 0.379 2.185 0.029 0.183 0.094 1.939 0.054 Veg. height x Malva cover -0.917 0.372 -2.462 0.014 0.194 0.092 2.105 0.037 LAI x Malva cover -0.810 0.346 -2.340 0.019 Malva cover x Dipsacus cover 0.583 0.301 1.937 0.053 -0.124 0.081 -1.535 0.127 PhD thesis – Odile Bruggisser Chapter 1 2 12 6 20 2 12 6 20 2 12 6 20 50cm study transect 9 m 6 m predator and herbivore control predator exclusion exclusion FIG. 1. Experimental setup of one of the twelve wildflower strips. Each field consisted of twelve plots including 3 fencing and 4 plant diversity treatments. The number of plant species sown is indicated by the numbers (2, 6, 12, 20) at the top of each plot. A fine meshed fence (represented by the dotted line around the first four plots) was established in order to exclude major predator and herbivore species. A wide-meshed fence (here represented by the dashed line surrounding the last four plots) was used to exclude the main predators only; four plots were not fenced, serving as a control. The dotted line through the centre of the field represents the sampling area where spider webs were investigated. Page 32 PhD thesis – Odile Bruggisser Chapter 1 900 800 observed 700 predicted 600 500 400 300 200 100 0 Sil alb Sil Cic int Cic Ant tin Ant Ori vul Ori Lin vul Lin Epi sp Epi ful Dip arv Cir Mal sp Mal Ver lyc Ver Fab sp Poa sp Leu vul Tan vul Cen sp Cen Ver tap Ver Ech vul no. of times plant used for constructionweb Ach mil Pas sat Pas Son arv Son Dau car Dau Hyp per Hyp Con can Con Rum obt Rum plant taxa used for web construction FIG. 2. Twenty four plant taxa most often used for web construction in nine fields in 2009. Gray boxes indicate the observed number of times a spider web was attached to a given plant species. White boxes represent the predicted number of times the plant species would be used for web construction if chosen in proportion to their abundance. Name of plant species or groups of species: Poa sp: Poacea sp.; Mal sp: Malva moschata or M. sylvestris; Cen sp: Centau- rea cyanus or C. jacea; Ori vul: Origanum vulgare; Epi sp: Epilobium sp.; Ant tin: Anthemis tinctoria; Dip ful: Dipsacus fullonum; Tan vul: Tanacetum vulgare; Sil alb: Silene alba; Cir arv: Cirsium arvense; Ach mil: Achillea millefolium; Cic int: Cichorium intybus; Leu vul: Leucanthemum vulgare; Hyp per: Hypericum perforatum; Dau car: Daucus carota; Rum obt: Rumex obtusifolius; Pas sat: Pastinaca sativa; Ver tap: Verbascum thapsus spp.; Son arv: Sonchus arvensis; Ver lyc: Verbascum lychnitis; Fab sp: Fabaceae sp., Ech vul: Echium vulgare; Con can; Conyza canadensis; Lin vul: Linaria vulgaris. Page 33 PhD thesis – Odile Bruggisser Chapter 1 500% 400% 300% 200% 100% 0% -100% % change% of webs per plot (2008, 2009) 0 0 0 1 1 0 1 1 categories of predator presence between 2008 and 2009 FIG. 3. Percentage change in the total number of Argiope bruennichi webs between 2008 and 2009 recorded in nine different fields, belonging to four categories related to the occurrence of the hornet species Vespa crabro. Black bars indicate the observed and gray boxes the average percentage change between 2008 and 2009. Category 0Æ0 represents fields where V. crabro was absent in both years; 0Æ1 fields where hornets were only present in 2009; 1Æ0 fields where hornets were present in 2008 but not in 2009; 1Æ1 hornets present in both years. Page 34 PhD thesis – Odile Bruggisser Chapter 1 Vespa crabro -0.574 0.026 Argiope bruennichi 0.177 0.024 0.165 Abundance of 0.508 0.039 potential prey <0.001 0.175 0.015 0.071 0.035 0.099 0.910 0.468 0.614 -0.157 0.178 Diversity Plant species Structure 0.643 0.090 composition 0.140 0.183 FIG. 4. Significant (continuous arrows) and non-significant (dotted arrows) interactions observed between the different trophic levels. Values indicate estimates of standardized slopes, with p-values (italic) obtained from linear mixed effect models. Dashed arrows indicate correlations (Pearson r, p-value in italic) between the different measurements of the plant community. Plant diversity is expressed as plant “diversity number”, plant species composition rerpresents the coordinates of the plots on the first ordination axis of a Corre- spondence Analysis (CA) of the plots described by the vegetation, vegetation structure includes the first ordination axis of a Principal Component Analysis (PCA) on the three variables average and maximum vegetation height and LAI. The abundance of potential prey speices was established by direct observations of flower visiting insects at the plot level. Page 35 PhD thesis – Odile Bruggisser Chapter 1 Page 36 Trends in climate, land use and the dynamics of a ballooning spider assemblage Odile T. Bruggisser, Gilles Blandenier & Louis-Félix Bersier PhD thesis – Odile Bruggisser Chapter 2 Trends in climate, land use and the dynamics of a ballooning spider assemblage Odile T. Bruggisser1*; Gilles Blandenier2 & Louis-Félix Bersier1 1 University of Fribourg, Unit of Ecology & Evolution, ch. du Musée 10, CH-1700 Fribourg, Switzerland 2 Centre Suisse de Cartographie de la Faune (CSCF), Passage Max-Meuron 6, CH-2000 Neuchâtel, Switzerland Abstract 1. Long-term observations provide growing evidence that global change, notably habitat loss and climate change, has an impact on population dy- namics. A decrease in abundances and shifts in distribution patterns and phenology have been observed in plant, vertebrate and aquatic invertebrate populations. The effect of global change on terrestrial invertebrate popula- tions is, however, less well investigated. 2. We used a unique long-term data set to study the effect of climatic conditions and landscape modifications on the dynamics of a ballooning spider assemblage. Ballooning in spiders is a passive dispersal behaviour involving the use of their silk threads. More than 15,000 ballooning spiders were caught at weekly intervals between 1994 and 2004 in south-western Switzerland using a 12 m high suction trap. 3. First, we hypothesized that meteorological conditions influence short term changes in spider abundances and long term shifts in phenology. Second, for long term trends in spider abundance, land use changes should affect species differently and in proportion to changes in their specific habitat availability, whereas climatic effects should influence species irre- spectively of habitat. 4. We found a strong relationship between spider assemblage structure and meteorological parameters. On a weekly basis, the assemblage re- sponded to temperature, global radiation and humidity. Over the eleven years, a significant shift in ballooning phenology of most species was ob- served, with the summer peak in ballooning activity shifted earlier in the year. 5. In the long term, ground-living species decreased while tree-living spi- ders increased in abundance, which can be explained by concomitant land- scape changes in the study area. We found no evidence that changes in meteorological parameters affected these trends. However, ballooning abundances decreased strongly in summer and fall 2003, when extreme meteorological conditions were prevailing in Europe. Interestingly, this col- lapse was preceded by very high ballooner abundances, a pattern that we explain with a “climatic trap” hypothesis. Page 37 PhD thesis – Odile Bruggisser Chapter 2 6. Spider populations appear to be more at risk from the expected intensi- fication of extreme climatic events and changes in land use than from gradually rising temperatures. Introduction Long-term observations of the tion pattern (Walther et al. 2002), development of population dynamics and the effect of rising temperatures are essential to improve our under- is especially pronounced in fresh standing of the life history and water ecosystems affecting macroin- ecology of populations as well as for vertebrate assemblages (Chessman management and conservation 2009). To investigate the long-term purposes (Caughley 1977; Tuljapur- effect of global change on population kar & Caswell 1997). This is espe- dynamics, mostly plant, vertebrate or cially important in the face of current aquatic invertebrate populations have drastic modifications of land use and been examined. Similar studies on climate change. The 20th century terrestrial invertebrate populations was reported to be the warmest are however rare (e.g., Aebischer since 1500 (Luterbacher et al. 2004). 1991; Parmesan et al. 1999). Furthermore, a general increase in Here we make use of an unusual extreme climatic events, like heat dataset which allows us to investi- waves, extreme precipitation and gate the long-term dynamics of a windstorms, has been observed in whole invertebrate community. A the present and predicted for the ballooning spider assemblage has future (Beniston 2007). been monitored over 11 years (1994- European land use change over 2004) in an agricultural landscape in the last decade was mostly charac- Switzerland (Changins). More than terized by the growth of urban areas, 15’000 spider individuals belonging leading to a displacement of agricul- to 103 different spider species were tural and natural ecosystems (Hough- collected in weekly samples. Balloon- ton 1994). Land use change has ing in spiders is a dispersing behav- been shown to be a major cause of iour involving passive aerial move- reduced biodiversity globally (Stoate ment carried by silk threads (Black- et al. 2001; Collins & Storfer 2003). wall 1827; Bell et al. 2005). Balloon- Furthermore, there is evidence that ing has been demonstrated to be climate change is influencing the induced by food limitation and ecology and behaviour of many plant habitat crowding (Weyman & Jepson and animal taxa (Parmesan & Yohe 1994) but little is known about the 2003; Root et al. 2003). Plants proximate stimuli that trigger this change their flowering phenology behaviour. In addition to the spider’s (Alsos et al. 2007; Franks, Sim & physiological state, the occurrence of Weis 2007), birds tend to migrate favourable conditions of temperature, earlier (Gordo & Sanz 2006; Jonzén wind speed and rainfall are definitely et al. 2006), butterflies and zoo- important (Legel & van Wingerden plankton species shift their distribu- 1980; Reynolds, Bohan & Bell 2007). Page 38 PhD thesis – Odile Bruggisser Chapter 2 It has been shown that temperature the latter influence both short term affects the developmental rate of changes in spider abundance and spiders as well as their dispersal long term shifts in phenology. behaviour (Li & Jackson 1996; Bonte Second, for long term trends in et al. 2008). Furthermore there is spider abundance, we hypothesize ample evidence that dispersal that land use changes affect spiders behaviour strategies are plastic and differently and in proportion to condition-dependent rather than changes in their specific habitat fixed. Therefore the strong selection availability, but that climatic effects pressure, emerging from climate should generally influence spiders change and habitat fragmentation, is irrespectively of habitat. expected to influence the evolution of dispersal rate (Bowler & Benton Material and Methods 2005; Ronce 2007). This raises the question of the future dynamics of Study site ballooning spiders under the current Ballooning spiders were trapped in drastic global change. the western region of the Swiss The interpretation of the effect Plateau at the Station de Recherches of global change on the number of en Production Végétales de Changins migrating individuals is not straight- (6°14'0'' E/46°24'8'' N, 440m forward, since global change can a.s.l.) (see Blandenier 2009). The influence ballooning behaviour and/or landscape surrounding the sampling population abundance. Ballooning site is mainly characterized by spiders represent the migrating agriculture, woodland or housing and fraction of a spider population, and infrastructure. Between 1992 and several authors provided evidence 2004 in a radius of five kilometres that ballooning abundance is linked (excluding lake and forests of the to overall population density (Wey- Jura Mountains), agricultural surface man, Jepson & Sunderland 1995; area decreased by 3% (1992: 30.5 Thomas & Jepson 1999; Blandenier km2; 2004: 29.6 km2), housing and 2009). Furthermore, an increase or infrastructure increased by 7% decrease in the number of migrating (1992: 11.3 km2; 2004: 12.1 km2), individuals will obviously affect and forest surface did not change population size in the next genera- (10.8 km2) (data from the Swiss tion. Therefore, we assume that Federal Statistical Office). changes in ballooning abundance reflect an overall trend of population Sampling of ballooning spiders density. For this reason we focus on Ballooning spiders were sampled by a the short- and long term dynamics of Rothamsted Insect Survey suction ballooning spiders and their phenol- trap (Taylor & Palmer 1972; Derron ogy and analyze how spider abun- & Goy 1987) between 16 April 1994 dances are related to the trend of and 31 December 2004 (except for meteorological and landscape vari- the following periods: 17 December ables. First, because ballooning 1994 to 18 March 1995, 3 Decem- propensity depends on meteorologi- ber 1995 to 17 March 1996 and 12 cal conditions, we hypothesize that February to 22 April 1998). The trap Page 39 PhD thesis – Odile Bruggisser Chapter 2 absorbed 42-43 m3 air per minute at Data analysis 12.2 m altitude. Trapping was We first examined changes in species continuous, with samples removed composition and in phenology based on a weekly basis (see Blandenier on weekly and fortnightly data, 2009). respectively. Secondly, we concen- Adult spiders were determined trated on yearly trends in ballooning to species; immatures to family or spider abundance and in meteoro- genus level (see Appendix 1 for a list logical parameters, and analyzed the of trapped spiders). We obtained a relationship between the two. Finally, database of 519 weekly samples we gave special attention to the year containing 10587 immature and 2003, which exhibited extreme 4811 adult spider individuals from meteorological conditions. 103 species and 16 families. Spider The weekly response of the bal- taxa were separated into 5 different looning assemblage to meteorological ecological groups, with regard to parameters was analyzed by ordina- their distribution in the vegetation. tion (Canonical Correspondence According to Blandenier (2009) we Analysis CCA; Jongman, ter Braak & distinguished generalists (21% of Van Tongeren 1995). Total spider observed species) from ground abundance in each week was square- (39%), herb (4.5%), tree (10.5%) root transformed prior to analysis to and herb and tree (24%) living taxa reduce skewness, and rare species (see Appendix 1). were downweighted (option available in Canoco, version 4.5; ter Braak Meteorological parameters 1997-2002) to reduce their influ- Meteorological data were provided on ence. Singletons were excluded. The a daily basis by the meteorological influence of meteorological parame- station of Changins (MeteoSwiss) ters was tested by forward selection located around 300 m southwest of and their relative significance by the spider sampling suction trap. To Monte Carlo Permutation for time be consistent with the spider sam- series (cyclical shift permutations pling regime, measures were consid- under the reduced model with 9’999 ered for each week. Environmental permutations; ter Braak & Smilauer parameters considered were average, 1998). absolute minimum and absolute The evolution of the long-term maximum temperature [°C]; absolute phenological pattern of ballooning minimum temperature at five centi- spiders was first examined graphi- metres above herb layer [°C]; cally by plotting total spider abun- average relative humidity [%]; the dance against time (fortnight win- sum of precipitation [mm]; and the dows of one year). The detection of sum of global radiation [MJ/m2]. statistically significant changes in Additionally, daily average wind phenology was carried out with an velocities [m/s] were measured at original Monte Carlo test where 12.2 m height, 10 m northwest of whole years are the permutable the chimney of the suction trap. units. The procedure is as follows: Page 40 PhD thesis – Odile Bruggisser Chapter 2 Starting with the raw abundances Nty cosinus function. We used the of the species or group of species of Gaussian family for meteorological interest for each fortnight t in year y, data and the Poisson family for we compute the proportional abun- spider abundances. The two models, dance within each year: with and without the linear series as p = N N . In this way we give explanatory variable, are compared ty ty ∑t ty the same weight to each year using the function ANOVA; signifi- irrespective of their total abundance. cantly better performance of the For each fortnight, we then compute former model is evidence of a yearly trend. To test the relationship the correlation rt between years y between ballooner abundance and proportions pty. A positive rt indicates that the abundances (response variable) and meteorologi- increased for that fortnight, and vice cal data (explanatory variable) at a versa. The two-tailed statistical yearly time scale, we used a similar approach as above, but replaced the significance of each rt was evaluated by permuting whole years and linear series with the trend of the meteorological variable extracted computing randomized rt to build the reference distribution (2000 simula- with the function STL. The latter tions). To evaluate if a change in stands for Seasonal Decomposition et phenology was consistent at the of Time Series by Loess (Cleveland al. 1990), which decomposes an assemblage and taxon level, we first observed time series into three parts: performed the test with all immature a seasonal component, a trend, and a and adult taxa pooled, and then remainder (with the options separately with the 26 most abun- s.window = "periodic" and ro- dant taxa (i.e., with total abundance bust = TRUE). > 50 individuals; see Appendix 1). Finally, we examined five addi- For the latter we checked with a tional relationships at the yearly time binomial test for each fortnight if the scale: 1) the existence of a trend in majority of these 26 taxa behaved the weekly meteorological parame- similarly to the whole assemblage, ters; 2) the existence of a trend in i.e. if correlation coefficients went in the following descriptors of weekly the same direction. community composition: species We used mixed effect models to richness, Shannon diversity, beta test for yearly trends in the meteoro- diversity measured as compositional logical parameters and spider abun- change (Tokeshi 1990), and even- dances of the 26 most abundant ness, estimated with Hurlbert's taxa. We followed the approach of (1971) probability of interspecific Crawley (2007) and used R Package. encounter; 2) the relationship be- The method compares the perform- tween community descriptors and ance of two mixed effect models meteorological data; 4) the existence (function glmer of the library lme4), of a trend in the coefficients of one with a linear series as explana- variation (CVs) of meteorological tory variable, and one without. In parameters; 5) the relationship both models weekly data were used, between the CVs of spider abun- year was a random factor and dances and those of meteorological seasonality was described by a sinus- Page 41 PhD thesis – Odile Bruggisser Chapter 2 parameters. In cases 1 to 3, analyses terized by extremely high tempera- were similar to those with spider tures and low precipitation levels abundance (mixed effect models, during summer. For 82 of the 365 with Poisson family for species days, average temperature exceeded richness and Gaussian family for the 20C° (average between 1994 and other dependent variables; we 2004 excluding 2003: 37.6 considered only weeks where 20 or days ± 7.8 s.d.); global radiation more individuals were sampled). For was greater than 20Mj/m2 for 97 cases 4 and 5, CVs were computed days (average: 76.3 ± 7.1 s.d.); over the whole year based on weekly humidity was above 80% for only 82 measures of environmental parame- days (average: 117.6 ± 14.2 s.d.); ters, and the relationships analyzed and during the summer months (June with Spearman rank correlation. In to August), 65 days were observed the case of multiple tests, we used without precipitation (average: the conservative Holm correction of 54 ± 4.5s.d.). P-values (Legendre & Legendre 1998). Short-term response of the spider To test whether temperatures assemblage to meteorological and spider abundances were signifi- parameters cantly different in 2003 and 2004 Figure 1 displays an ordination biplot compared to all other years, we of a Canonical Correspondence performed a Dixon’s Q-test for Analysis (CCA) relating spider outliers. The test was computed for species and meteorological parame- the period of peak spider abundances ters. It summarizes the individual in June, August and October. Also, response of spiders at a weekly time we evaluated the effects of both scale. Forward selection of explana- years on the results of all analyses tory variables revealed the following described above, simply by excluding statistically significant parameters: them. We report only instances average temperature (F = 22.1, where the exclusion of these years P ≤ 0.001), global radiation (F = 8.0, yielded different results. P = 0.002), and humidity (F = 3.5, P = 0.008). Maximum temperature, Results minimum temperature, minimum temperature above the herb layer, Meteorological trends precipitation and wind velocities had Table 1 summarizes the yearly no significant influence on the evolution of meteorological parame- assemblage composition (all P- ters for the periods 1994 until 2004 values ≥ 0.05). The eigenvalues of at the study site. During this period, the first and second canonical axes no significant change in the investi- were low compared to the trace gated meteorological parameters was (0.127, 0.044, and 2.83, respec- observed, but the variability of tively), which can be explained by minimum temperature significantly the large number of samples (519 increased while the variability of weeks). Despite these low values, global radiation significantly de- the three canonical axes were creased. The year 2003 was charac- significantly related to the distribu- Page 42 PhD thesis – Odile Bruggisser Chapter 2 tion of ballooner abundances abundances in the end of September. (F = 22.4, P = 0.001), the first axis Species trends. At the species was significant (F = 11.4, level, significant increases were P = 0.001), and the second only found for Nuctenea umbratica, marginally (F = 7.9, P = 0.084). mainly living in upper vegetation like When examining the CCA biplot (Fig. bushes and trees (Hänggi, Stöckli & 1) for the spider species classified in Nentwig 1995) and for Mermessus ecological groups, no clear pattern trilobatus (Eperigone trilobata), emerges. Only tree-living spiders are described as an expanding alien globally correlated with increased species from North America (Witten- temperature and global radiation. berg 2005). Four ground-living species common in agricultural Long-term trends of spider abun- habitats, Araeoncus humilis, Bathy- dances phantes gracilis, Erigone atra, and We first examined if a change in Oedothorax apicatus, decreased phenology was apparent during the significantly (Table 2). study period; second, we tested for At the assemblage level, the to- trends in ballooning spider abundance tal abundance of adult ballooning and in descriptors of the community; spiders (coeff = -0.722, P = 0.152) and finally, we tested if yearly and immatures (coeff = -0.873, change in spider abundance could be P = 0.051) showed non-significant explained by meteorological parame- negative trends (mixed effect model, ters. with coeff the slope of the linear Phenology. Figure 2 illustrates term representing time). Although the weekly dynamics of ballooning these trends are not statistically spider abundances between 1994 significant, a decline is evidenced by and 2004. The phenological pattern the observation that 19 of the 26 is characterized by two main peaks most abundant taxa (Table 2) of abundances, a “summer peak” decreased (binomial test, between May and August and an P = 0.029). For ground-living taxa, a “autumn peak” between October and significant negative trend was November. The second peak is observed (coeff = -0.370, mainly attributed to high abundances P = 0.044). Tree-living species, of adults of the most frequently however, significantly increased trapped Linyphiid species. During the during the study period (co- study period, a significant change in eff = 0.325, P = 0.047). When the phenology of ballooning activities excluding the years 2003 and 2004 was observed for the entire dataset from the analyses, only the increase (Fig. 3). The analyses for the 26 of all tree-living species remained most abundant ballooning taxa were significant, but the signs of the other in line with the global results (plus trends remained the same. For and minus signs in Fig. 3). The timing community descriptors, we observed of the first peak was brought for- no yearly trend in species richness, wards, which is apparent as in- Shannon diversity, evenness or beta- creased abundances in the beginning diversity. of July followed by decreased Page 43 PhD thesis – Odile Bruggisser Chapter 2 Response to long-term meteorological Extreme climatic event trends. Using trends in meteorologi- In Figure 2, the distribution of spider cal parameters as explanatory abundance in 2003 and 2004 is variable, mixed effect models re- clearly different from the preceding vealed no or weak relationships with years. In these two years ballooning the abundances of the 26 most abundances were significantly lower common spider taxa. Linyphiidae sp during the usual second peak of (coeff = -4.552, P = 0.014) and O. ballooning activity in September until apicatus (coeff = -3.882, P < 0.01) November. This pattern is illustrated were negatively related to trends in in Figure 4. Temperatures in 2003 global radiation, while N. umbratica were significantly higher than the showed a positive response (co- preceding nine years in June eff = 5.757, P < 0.01) to this (Q = 0.58, P = 0.05) and August parameter. N. umbratica was also (Q = 0.62, P = 0.03) and some- positively correlated with average what lower in October (Q = 0.44, temperature (coeff = 3.930, P = 0.23) (Fig. 4a). While the P < 0.01), but negatively with abundance in the “summer peak” average humidity (coeff = -5.350, was significantly higher compared to P < 0.01). For Araneidae sp., a all other years (Q = 0.62, positive response to average humid- P = 0.02), it crashed in the “autumn ity was observed (coeff = 2.679, peak” (Q = 0.57, P = 0.052) (Fig. P = 0.048). 4b). We also analyzed if the variabil- ity of spider abundance was corre- Discussion lated with the variability of meteoro- logical parameters with Spearman Our analysis of a ballooning spider rank correlation. We found a strong assemblage revealed evidence of an relationship between the coefficient interaction between spider dispersal of variation (C.V.) of average tem- patterns and current global change, perature (ρ = 0.845, P < 0.01), namely landscape modification and minimum temperature (ρ = 0.827, climate change. This conclusion is P < 0.01) and minimum temperature supported by the following observa- 5cm above herb layer (ρ = 0.646, tions: 1) on a weekly basis, the P = 0.036) the coefficient of ballooning assemblage responded to variation of total spider abundance. temperature, global radiation and For maximum temperature, humidity, humidity. 2) The phenological pattern precipitation, global radiation and changed, in the form of increased wind velocities no significant correla- ballooning spider abundances in July tion was found. At the yearly time followed by decreased abundances in scale, none of the community September. 3) Tree-living species descriptors (species number, diver- increased, while most ground-living sity, evenness, beta diversity) spider species decreased in abun- evidenced a trend or a relation to dances over the study period. 4) The meteorological parameters. extreme climatic event of 2003 had a Page 44 PhD thesis – Odile Bruggisser Chapter 2 strong impact on ballooning abun- a new approach to tackle this dances, which may be indicative of a problem. To our knowledge, we are “climatic trap” (see below). the first to provide statistical evi- dence of a change in the phenology Relationship to meteorological of ballooning activities of a spider parameters assemblage. This observed shift was At weekly timescales the ballooning consistent for many species, sug- assemblage showed a clear response gesting a general mechanism. to temperature, global radiation and Developmental rates of arthropods humidity (CCA, Fig. 3). The impor- are strongly dependent on tempera- tance of meteorology has already ture (Li & Jackson 1996). Increasing been demonstrated by several temperatures lead to accelerated authors: clear sky, warm ambient development rates of spiders (Li & temperatures and light winds have Jackson 1996; Bonte et al. 2008) been shown to favour ballooning and would thereby move forward the (Richter 1970; Bishop 1990; Rey- timing of their ballooning activity. nolds, Bohan & Bell 2007). A direct Spiders can thus be added to the list link between ballooning activity and of taxonomic groups for which global radiation or humidity has not changing phenological patterns can been observed before, but is not be attributed to climate change unexpected because they are closely (Walther et al. 2002). associated with the other conditions. Wind speed has been shown to be a Trends in ballooning abundances very important factor in ballooning Ballooning abundances of ground- action: wind speed at 2m altitude living species, accounting for more exceeding 3m/s reduces rising air than one third of the ballooning movements and hence ballooning assemblage (39%), decreased during success (Richter 1970; Reynolds, the study period, while the abun- Bohan & Bell 2007). In our investiga- dances of tree-living species (11%) tion, we failed to detect this relation- showed a positive trend. Trends in ship, but this may be explained ballooning abundances can imply simply because wind speed data changes in population densities on were averaged over weekly intervals the ground and/or behavioural to match the spider sampling periods. changes of dispersal strategy. In our In general, the tight link between system, the following factors can be ballooning spider abundances and considered: change in habitat avail- meteorological parameters at a short- ability and quality, and change in time scale implies that this dispersal meteorological conditions. behaviour should be affected by long- Spider population size will term changes in climatic conditions. clearly be affected by a decline in habitat surface area and quality. For Phenology example, intensification of agricul- The detection of a shift in the ture, including increased pesticide phenological pattern can be a difficult use and soil cultivation, has been task for multiple time series with shown to reduce spider densities several modes, and we provide here (Aebischer 1991; Topping & Sunder- Page 45 PhD thesis – Odile Bruggisser Chapter 2 land 1994). The effect of meteoro- Consequently, the increase in tree- logical parameters on abundances is living spider abundances can be more difficult to predict. One can interpreted as a response to habitat generally assume that the response availability, since some species from of species abundance to meteoro- this group (e.g. Nuctenea umbratica, logical parameters follows a unimodal Zygiella x-notata, Keijia tincta, function, with the optima of the Theridion mystaceum) are able to live response curves differing between in trees within urban areas and even species. Thus, positive or negative on buildings (Hänggi, Stöckli & trends can be expected depending on Nentwig 1995). As the decrease of the position of the species on the ground-living spiders mirrors the loss curve and on the magnitude of of habitat availability, a causal link is change of the variable of interest. reasonable. To summarize, it is not Ballooning behaviour has been possible to assign a clear role of found to be affected by temperature climatic variables on the population during development: in an experimen- trends for both groups of species. tal study involving the Linyphiid This does not, however, exclude the spider Erigone atra, long distance possibility that changes in land use migration was found to be negatively and climate act synergistically. associated to elevated temperatures during development (Bonte et al. Increased variability 2008). Interestingly, fragmentation At yearly timescales, ballooning resulting from habitat loss can also abundances were unrelated or affect dispersal behaviour: isolated weakly related to meteorological spider populations may evolve parameters. However, yearly balloon- decreased ballooning propensities, ing variability was strongly and presumably as a consequence of the positively related to the variability of higher mortality risk involved in average temperature. As a conse- finding suitable habitats (Bonte et al. quence, the stability of ballooning 2003). Finally, habitat quality is also populations may depend on the expected to influence spider behav- stability of meteorological conditions. iour, as ballooning propensity has Besides increasing temperature and been observed to increase when food precipitation, current climate change availability decreases (Weyman & is characterized by an increase in the Jepson 1994). variability of meteorological condi- Over the period of our observa- tions (Schär et al. 2004; Beniston & tions, there was to our knowledge no Goyette 2007). The variability of the change in farming and silvicultural dynamics of ballooning spiders can practices (Jacques Derron, comm. thus be expected to increase in the pers.). We did, however, observe future, potentially exposing popula- changes in habitat availability in the tions to stochastic loss. study region: while the surface of woodland did not change, a marked Extreme climatic events increase in housing and infrastructure In 2003, meteorological conditions in (+7%) together with a decrease of Europe were extremely warm and dry arable land (-3%) was observed. from May until late August, and very Page 46 PhD thesis – Odile Bruggisser Chapter 2 cold in October. Models suggest that change in abundance, as this mirrors such extreme heat waves will the pattern of habitat modification in become more intense, frequent, and the study region. Climate can, longer lasting over the coming however, have a huge impact, as century (Beniston 2004; Meehl & exemplified by the extreme condi- Tebaldi 2004). tions of 2003. The combination of All observed ballooning spider changes in land use by human species witnessed an abrupt de- populations and the predicted crease in August and an almost increase in abnormal climatic events complete collapse in fall. One possi- may prefigure a difficult future for ble explanation for this crash is the spider populations. death of many individuals, especially those living on the ground (most Acknowledgements Linyphiids). Spiders are able to regulate their body temperature by We thank Dr Jacques Derron, Gabriel retreating to cooler places in their Goy and their colleagues from the habitat (Foelix 1979). Thermoregula- Station de Recherches en Production tion in general involves an increase in Végétales de Changins for data transpiration, which leads to death of provision, Professor Anthony C. spiders if water loss exceeds 20% of Davison from the EPFL Lausanne, their body weight (Cloudsley- George Sughiara and Dr Sven Bacher Thompson 1957). from the University of Fribourg for We observed only one extreme statistical advice and support. This climatic event in our dataset, which study was funded by the University makes it difficult to draw general of Fribourg. conclusions. However, we can hypothesize that our observations References typify a “climatic trap” (Fig. 5): a situation where, during development, Aebischer, N.J. (1991) Twenty years of climate firstly has a positive effect on monitoring invertebrates and weeds in reproduction and abundances, but cereal fields in Sussex. In: Firbank LG, secondly reaches the physiological Carter N, Darbyshire JF, Potts GR limits for an organism and strongly (eds), The Ecology of Temperate impacts their populations when they Cereal Fields. 32nd Symposium of the are unusually large (Fig. 4b). British Ecological Society, Blackwell Scientific Publications, Oxford, pp. Conclusions 305–331. Alsos, I.G., Eidesen, P.B., Ehrich, D., Our data confirms the tight link Skrede, I., Westergaard, K. Jacobsen, between ballooning abundance and G.H., Landvik, J.Y., Taberlet, P., meteorological parameters at short Brochmann, C., Etienne, R.S. & timescales. It is thus not surprising to McKane, A. (2007) Frequent long- find a shift in ballooning phenology distance plant colonization in the over the 11 years of the study. changing Arctic. Science, 316, 1606- However, climatic effects are not 1609. necessary to explain the long-term Bell, J.R., Bohan, D.A., Shaw, E.M. & Page 47 PhD thesis – Odile Bruggisser Chapter 2 Weyman, G.S. (2005) Ballooning Bonte, D., Travis, J.M.J., De Clercq, N., dispersal using silk: world fauna, Zwertvaegher, I. & Lens, L. (2008) phylogenies, genetics and models. Thermal conditions during juvenile Bulletin of Entomological Research, development affect adult dispersal in 95, 69-114. a spider. Proceedings of the National Beniston, M. (2004) The 2003 heat Academy of Sciences of the United wave in Europe: A shape of things to States of America, 105, 17000- come? An analysis based on Swiss 17005. climatological data and model simula- ter Braak, C.J.F. & Smilauer, P. (1998) tions. Geophysical Research Letters, CANOCO reference manual and user’s 31, 2022-2026. guide to Canoco for Windows – soft- Beniston, M. (2007) Entering into the ware for canonical community ordina- "greenhouse century": Recent record tion (version 4). Microcomputer temperatures in Switzerland are com- Power, Ithaca, NY. parable to the upper temperature Bowler, D.E. & Benton, T.G. (2005) quantiles in a greenhouse climate. Causes and consequences of animal Geophysical Research Letters, 34, dispersal strategies: relating individual L16710. behaviour to spatial dynamics. Bio- Beniston, M. & Goyette, S. (2007) logical Reviews, 80, 205-225. Changes in variability and persistence Caughley, G. (1977) Analysis of of climate in Switzerland: Exploring vertebrate populations. John Wiley 20th century observations and 21st and Sons, Chichester, England. century simulations. Global and Plane- Chessman, B.C. (2009) Climatic change tary Change, 57, 1-15. and 13-year trends in stream macro- Bishop, L. (1990) Meteorological invertebrate assemblages in New aspects of spider ballooning. Envi- South Wales, Australia. Global ronmental Entomology, 19, 1381- Change Biology, 15, 2791-2802. 1387. Cleveland, R. B., Cleveland, McRae, W. Blackwall, J. (1827) Observations and S. J.E. & Terpenning, I. (1990) STL: experiments, made with a view to A Seasonal-Trend Decomposition ascertain the means by which the Procedure Based on Loess. Journal of spiders that produce gossamer effect Official Statistics, 6, 3–73. their aerial excursions. Transactions Cloudsley-Thompson, J.L. (1957) of the Linnean Society of London, 15, Studies in diurnal rhythms. V. Noctur- 449-59. nal ecology and water-relations of the Blandenier, G. (2009) Ballooning of British cribellate spiders of the genus spiders (Araneae) in Switzerland: Ciniflo (Bl.). Journal of the Linnean general results from an eleven-year Society of London, Zoology, 43, 134- survey. Bulletin of the British Arach- 154. nological Society, 14, 308-316. Collins, J.P. & Storfer, A. (2003) Global Bonte, D., Vandenbroecke, N., Lens, L. amphibian declines: sorting the hy- & Maelfait, J.P. (2003). Low propen- potheses. Diversity and Distributions, sity for aerial dispersal in specialist 9, 89-98. spiders from fragmented landscapes. Crawley, M.J. (2007). The R Book. Proceedings of the Royal Society of Wiley & Sons, Chichester, UK. London B, 270, 1601-1607. Derron, J.O. & Goy, G. (1987) Utilisa- Page 48 PhD thesis – Odile Bruggisser Chapter 2 tion des pièges à aspiration pour la 312, 1959-1961. prévision des épidémies de virus. Legel, G.J. & van Wingerden, W.K.R.E. Revue Suisse Agric., 19, 129-132. (1980) Experiments on the influence Foelix, R.F. (1979) Biology of Spiders. of food and crowding on the aeronau- pp. 245-256. Harvard University tic dispersal of Erigone arctica (White Press, London, England. 1852) (Araneae Linyphiidae). Proc. 8th Franks, S.J., Sim, S. & Weis, A.E. Intern. Arachnol. Congr. pp. 1–6. (2007) Rapid evolution of flowering Legendre, P. & Legendre, L. (1998) time by an annual plant in response to Numerical ecology. 2nd English edn. a climate fluctuation. Proceedings of Amsterdam, The Netherlands: El- the National Academy of Sciences of sevier, pp. 445. the United States of America, 104, Li, D. & Jackson, R.R. (1996) How 1278-82. temperature affects development and Gordo, O. & Sanz, J.J. (2006) Climate reproduction in spiders: A review. change and bird phenology: a long- Journal of Thermal Biology, 21, 245- term study in the Iberian Peninsula. 274. Global Change Biology, 12, 1993- Luterbacher, J., Dietrich, D., Xoplaki, E., 2004. Grosjean, M. & Wanner, H. (2004) Hänggi, A., Stöckli, E. & Nentwig, W. European seasonal and annual tem- (1995). Habitats of central European perature variability, trends, and ex- spiders – Characterisation of the tremes since 1500. Science, 303, habitats of the most abundant spider 1499-1503. species of Central Europe and asso- Meehl, G.A. & Tebaldi, C. (2004) More ciated specie. Miscellanea Faunistica intense, more frequent, and longer Helvetica 4, CNCF, Neuchâtel. lasting heat waves in the 21st cen- Houghton, R.A. (1994) The worldwide tury. Science, 305, 994-997. extent of land-use change. BioSci- Parmesan, C., Ryrholm, N., Stefanescu, ence, 44, 305-313. C., Hill, J.K., Thomas, C.D., Desci- Hurlbert, S.H. (1971) The non concept mon, H., Huntley, B., Kaila, L., Kull- of species diversity: a critique and berg, J., Tammaru, T., Tennent, alternative parameters. Ecology, 52, W.J., Thomas, J.A. & Warren, M. 577-586. (1999) Polewards shifts in geographi- Jongman, R.H.G., Ter Braak, C.J.F. & cal ranges of butterfly species associ- Van Tongeren, O.F.R. (1995). Data ated with regional warming. Nature, Analysis in Community and Land- 399, 579–583. scape Ecology, 4th edn. Cambridge Parmesan, C. & Yohe, G. (2003) A University Press, Cambridge, UK. globally coherent fingerprint of cli- Jonzen, N., Linden, A., Ergon, T., mate change impacts across natural Knudsen, E., Vik, J.O., Rubolini, D., systems. Nature, 421, 37-42. Piacentini, D., Brinch, C., Spina, F., Randall, D., Burggren, W. and French, K. Karlsson, L., Stervander, M., Anders- (2002) Eckert animal physiology: son, A., Waldenström, J., Lehikoinen, mechanisms and adaptations, 5th A., Edvardsen, E., Solvang, R. & edition. W.H. Freeman and Company, Stenseth, N.Chr. (2006) Rapid ad- New York. vance of spring arrival dates in long- Reynolds, A.M., Bohan, D.A. & Bell, distance migratory birds. Science, J.R. (2007) Ballooning dispersal in Page 49 PhD thesis – Odile Bruggisser Chapter 2 arthropod taxa: conditions at take-off. dances patterns. Journal of Animal Biology Letters, 3, 237-240. Ecology, 59, 1129-1146. Richter, C.J.J. (1970) Aerial dispersal in Topping, D.J. & Sunderland, K.D. relation to habitat in eight wolf spider (1994) A spatial population dynamics species (Pardosa: Araneae: Lycosi- model for Leptyphantes tenuis (Ara- dae). Oecologia, 5, 200-214. neae: Linyphiidae) with some simula- Ronce, O. (2007) How does it feel to be tions of the spatial and temporal like a rolling stone? Ten questions effects of farming operations and about dispersal evolution. Annual land-use. Agriculture, Ecosystems and Review of Ecology Evolution and Environment, 48, 203-217. Systematics, 38, 231-253. Tuljapurkar, S. & Caswell, H. (1996) Root, T.L., Price, J.T., Hall, K.R., Structured-population models in ma- Schneider, S.H., Rosenzweig, C. & rine, terrestrial, and freshwater sys- Pounds, J.A. (2003) Fingerprints of tems. New York: Chapman & Hall. global warming on wild animals and Walther, G.-R., Post, E., Convey, P., plants. Nature, 421, 57-60. Menzel, A., Parmesan, C., Beebee, Schär, C., Vidale, P.L., Luthi, D., Frei, T.J.C., Fromentin, J.-M., Hoegh- C., Haberli, C., Liniger, M.A. & Ap- Guldberg, O. & Bairlein, F. (2002) penzeller, C. (2004) The role of in- Ecological responses to recent climate creasing temperature variability in change. Nature, 416, 389-395. European summer heatwaves. Nature, Weyman, G.S. & Jepson, P.C. (1994) 427, 332–336. The effect of food supply on the Stoate, C., Boatman, N.D., Borralho, colonisation of barley by aerially dis- R.J., Carvalho, C.R., de Snoo, G.R. & persing spiders (Araneae). Oecologia, Eden, P. (2001) Ecological impacts of 100, 386-390. arable intensification in Europe. Jour- Weyman, G.S., Jepson, P.C. & Sunder- nal of Environmental Management, land, K.D. (1995) Do seasonal 63, 337–365. changes in numbers of aerially dis- Taylor, L.R. & Palmer, J.P. (1972) Aerial persing spiders reflect population sampling. In H.F. van Emden density on the ground or variation in (ed.).Aphid technology. London, Aca- ballooning motivation? Oecologia, demic Press: 189-234. 101, 487-493. Thomas, C.F.G. & Jepson, P.C. (1999) Wittenberg, R. (2005) An inventory of Differential aerial dispersal of Liny- alien species and their threat to biodi- phiid spiders from a grass and a ce- versity and economy in Switzerland. real field. Journal of Arachnology, 27, CABI Bioscience Switzerland Centre 294-300. report to the Swiss Agency for Envi- Tokeshi, M. (1990) Niche apportionment ronment, Forests and Landscape. or random assortment: species abun- Page 50 PhD thesis – Odile Bruggisser Chapter 2 Table 1: Yearly trends in meteorological parameters during the period 1994- 2004 at the study site. Trends in averages were tested using mixed effect models; coeff is the linear relationship with time. Trends in coefficients of variation were tested using Spearman rank correlation ρ. Significant values are shown in boldface. average coefficient of varia- tion Meteorological parameters coeff P-value ρ P-value Average temp. [°C] 0.029 0.517 0.164 0.624 Maximum temp. [°C] 0.040 0.440 -0.518 0.107 Minimum temp. [°C] 0.005 0.918 0.755 0.010 Min. temp. 5cm above 0.036 0.477 0.2 0.548 herb layer [°C] Humidity [%] -0.250 0.138 0.624 0.164 Precipitation [mm] -0.194 0.528 -0.155 0.653 Global radiation [MJ/m2] 0.585 0.056 -0.636 0.040 Wind velocity [m/s] 0.009 0.482 -0.009 0.989 Page 51 PhD thesis – Odile Bruggisser Chapter 2 Table 2: Yearly trends in abundances of the 26 most common taxa tested by mixed effect models. Adult taxa are in boldface type, immatures in normal font; stratum indicates the position in the vegetation: GEN = no defined stratum, G = ground, H = herb, T = tree, HT = herb and tree; n gives the total abun- dance. taxon stratum n trend (coeff.) p-value Linyphiidae sp. GEN 4878 - 0.542 0.042* Araneidae sp. GEN 1571 - 0.196 0.534 Philodromus sp. HT 1209 - 0.023 0.537 Meioneta rurestris G 1228 0.040 0.581 Araeoncus humilis G 706 - 0.126 0.001*** Nuctenea umbratica T 666 0.325 0.034* Porrhomma microphthalmum G 541 0.019 0.720 Erigone dentipalpis G 533 - 0.062 0.071 Theridion sp. GEN 434 0.051 0.015* Pardosa sp. G 350 - 0.073 0.040* Erigone atra G 358 - 0.064 0.011* Araniella sp. HT 332 - 0.013 0.348 Tenuiphantes tenuis G 245 - 0.016 0.149 Mermessus trilobatus G 219 0.083 0.025* Bathyphantes gracilis G 159 - 0.036 0.009** Zygiella sp. T 138 - 0.013 0.526 Mangora acalypha HT 126 0.008 0.320 Oedothorax apicatus G 121 - 0.039 <0.001*** Tetragnatha sp. GEN 125 - 0.019 0.105 Diaea sp. HT 108 0.004 0.619 Thomisidae sp. GEN 106 - 0.007 0.420 Philodromus rufus HT 67 - 0.007 0.271 Salticidae sp. GEN 67 - 0.006 0.445 Xysticus sp. G 66 - 0.005 0.348 Pachygnatha sp. GEN 64 - 0.029 0.060 Microlinyphia sp. H 60 - 0.0003 0.962 Page 52 PhD thesis – Odile Bruggisser Chapter 2 global radiation average temp. humidity -1.0 1.0 -1.0 1.0 Figure 1: Canonical correspondence analysis (CCA) of ballooning spider abundances in relation to meteorological conditions in the 519 weeks of observation. The biplot shows taxa and the significant meteorological parameters: weekly average temperature [°C], humidity [%] and sum of global radiation [MJ/m2]. Filled squares represent ballooners living on the ground, grey triangles in trees, open squares on herbs, and open triangles in trees and on herbs. Stars repre- sent taxa with no defined habitat preference. Page 53 PhD thesis – Odile Bruggisser Chapter 2 150 40 1994 75 20 0 0 150 40 1995 75 20 0 0 150 40 1996 75 20 0 0 150 40 1997 75 20 0 0 150 40 1998 75 20 0 0 150 40 1999 75 20 0 0 150 40 2000 75 20 0 0 150 40 2001 75 20 0 0 150 40 2002 75 20 0 0 150 40 75 ∗ 2003 20 0 0 150 40 ∗ 2004 75 20 0 0 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Figure 2: Weekly patterns of ballooning spider abundances between 1994 and 2004. The bold line represents the phenology of adult total abundances (right axis), the thin line that of immatures (left axis). The two asterisks in the last two graphs highlight the abnormal absence of the second peak of ballooners in 2003 and 2004. Page 54 PhD thesis – Odile Bruggisser Chapter 2 0.8 0.6 0.4 0.2 0 -0.2 correlation -0.4 -0.6 -0.8 02_11 03_11 03_25 04_08 04_22 05_06 05_20 06_03 08_26 09_23 10_07 10_21 11_04 11_18 12_02 01_14 01_28 02_25 06_17 07_01 07_15 07_29 08_12 09_09 12_16 12_30 01_01 - + (-) + ++(+) - (-) (-) (-) -- fortnight Figure 3: Evolution of the phenological pattern of adult and immature ballooning abun- dances between 1994 and 2004. The x-axis represents fortnights, the y-axis shows the correlation coefficients with year (bold line: adults; thin line: imma- tures). A positive correlation indicates that abundances increased during that fortnight. The dotted horizontal lines represent the 2.5% and 97.5%, the dashed lines the 5% and 95% significance thresholds, computed with a permu- tation test. Plus and minus signs below the x-axis indicate that a higher than expected proportion of the 26 most abundant taxa increased or decreased, respectively (binomial test; P≤0.05, except for signs in brackets: 0.05 Page 55 PhD thesis – Odile Bruggisser Chapter 2 a) average temperature b) total spider abundance 25 600 ∗ ∗ 500 20 ♦ ♦ 400 ∗ 15 ♦ 300 ♦ 10 ∗ 200 5 ∗ 100 ♦ ♦ ∗ 0 0 JUN AUG OCT JUN AUG OCT Figure 4: Boxplots showing a) median temperatures in June, August and October be- tween 1994 and 2002; and b) median spider abundances in June, August and October between 1994 and 2002. The average values for 2003 (asterisks) and 2004 (diamonds) are superimposed on the graphs. Page 56 PhD thesis – Odile Bruggisser Chapter 2 a) b) abundance abundance time ambient growth rate metabolic rate body temperature temperature 0 ULT LLT OT ULT ambient temperature Figure 5: Illustration of the climatic trap hypothesis. a) Relation of ambient temperature to body temperature and metabolic rate for ectoderms (from Randall, Burggren & French 2002), and putative effect on population growth rate. LLT, lower lethal temperature; OT, optimal temperature; ULT, upper lethal temperature b) A logistic growth with K=1 and r a function of ambient temperature, modelled by a beta distribution, similar to the curve in the lower left panel. Trajectory of species abundance (black line) and temperature (grey line) for an extreme climatic event akin to that observed in Fig. 4. Page 57 PhD thesis – Odile Bruggisser Chapter 2 Page 58 Spider molecular barcode to track trophic links in food webs Odile T. Bruggisser, Louis-Félix Bersier, Gilles Blandenier, Yvonne Fabian, Nadine Sandau & Alex Aebi PhD thesis – Odile Bruggisser Chapter 3 Spider molecular barcode to track trophic links in food webs Odile T. Bruggisser1*; Yvonne Fabian1; Nadine Sandau1; Gilles Blandenier2, Louis- Félix Bersier1 & Alexandre Aebi3 1 University of Fribourg, Unit of Ecology & Evolution, ch. du Musée 10, CH-1700 Fribourg, Switzerland 2 Centre Suisse de Cartographie de la Faune (CSCF), Passage Max-Meuron 6, CH-2000 Neuchâtel, Switzerland Forschungsanstalt Agroscope Reckenholz-Tänikon ART, Zürich, Switzerland 3 Agroscope Reckenholz-Tänikon ART, Research Station ART, Reckenholzstrasse 191, CH- 8046 Zürich, Switzerland Abstract: The investigation of trophic links in food webs is crucial to understand the structure and stability of communities. Due to inherent difficulties to track trophic links in food webs, field observations on the quantitative structure of food webs remain rare. The observation of predation events in the trap- nesting wasp Trypoxylon figulus is difficult because wasp larvae consume most of the spider prey provided by the female when she lays the egg. Furthermore wasps prefer to trap immature spiders, which for a large ma- jority can not be identified on the base of morphological features. The aim of this study was to develop and test a molecular barcode approach to fully characterize the trophic links among the mud-dauber wasp T. figulus and its spider prey community and to test whether immature spiders can be molecularly identified to the species level. Maternally-inherited bacterial endosymbionts were screened to consider the potential effect of mater- nally inherited symbionts on mitochondrial haplotype diversity. The 104 mi- tochondrial cytochrome oxidase I (COI) fragments of 46 spider species (12 families) and the 47 ribosomal 28S RNA segments of 37 species (11 fami- lies) clustered in terminal clades, corresponding to their classification based on morphological traits. In most cases we were able to confidently assign immature spiders and prey remains to the species level. With this study we emphasize on two practical advantages of COI se- quence databases for species identification, which somehow counter the criticism on this method: 1) the identification of species, lacking a clear morphological differentiation, like immature spiders, and 2) the better un- derstanding of otherwise invisible trophic links in food webs by the identi- fication of species from prey remains. Page 59 PhD thesis – Odile Bruggisser Chapter 3 Introduction Understanding how ongoing reduc- The direct observations of tro- tions in natural surface area and phic links, like predation events in complexity will affect species food webs is in general relatively diversity and trophic links in food straightforward for large vertebrate webs is paramount in face of the or invertebrate predators, but can be current biodiversity crisis. The difficult in highly mobile, under- extinction of single species in ground, rare or cryptic species. ecological communities, character- Traditional ecological sampling ized by trophic and competitive methodology like faeces analyses can species interactions, can affect in some cases allow the visual remaining species by causing a identification of prey remains, cascade of secondary extinctions provided that identification charac- (e.g., Paine 1966; Borrvall et al. ters were not destroyed by digestion 2000; Koh et al. 2004; Petchey et al. (e.g. Green & Tylere 1989; Burger et 2004, 2008). For example the al. 1999). The sound morphological removal of predator sea star species identification of solid prey remains is, (Pisaster ochraceus) from a rocky however, often imprecise at the intertidal community leads to the species level for many taxonomic uncontrolled dominance of mussels groups. A general lack of simple causing local extinction of many identification keys for small or cryptic predator species (Paine 1966). Such species may cause additional prob- “secondary species extinctions” or lems. For example, the morphological “coextinctions” occur because a determination of the genetically well primary extinction creates a gap in distinct, cryptic bug species from the the food web (a consumer may have family Adelgidae (Insecta: Hemiptera: no prey) or leads to a dynamically Aphidoidea) is difficult because of unstable community (Petchey et al. their small size and morphological 2008). In order to understand trophic plasticity caused by environmental links within complex food webs, it is and host plant effects (Foottit et al. thus crucial to understand interaction 2009). Even in well known groups pathways among all organisms like spiders, sexual dimorphism and involved in the web of a given intra-specific genitalia polymorphism habitat and to evaluate the impor- pose problems for a sound morpho- tance of these interactions (Sheppard logical identification (Barrett & Hebert & Harwood 2005). Most studies 2005, Coddington & Levi 1991). investigating the effect of environ- Furthermore, the vast majority of mental change concentrated on immature spiders can not be deter- single species groups (e.g., McNett & mined to the species level on the Rypstra 2000; Lassau & Hochuli basis of morphological characters. A 2004) thereby ignoring trophic problem enhanced by the fact that systems, mostly due to inherent immatures occur at high abundances difficulties to track trophic links and play an important ecological role. (Thies & Tscharntke 1999; Steffan- DNA-based species identifica- Dewenter et al. 2001, 2002). tion tools have recently gained in Page 60 PhD thesis – Odile Bruggisser Chapter 3 importance and are promising Tormos et al. 2005; Polidori et al. techniques to overcome the difficul- 2007). In an experiment by Kruess & ties in the morphological identifica- Tscharntke (2002) Trypoxylon figulus tion of cryptic species and in tracking (Linnaeus 1758) was the most trophic links in food webs (Tautz et abundant species (43%) found in al. 2002, 2003; Herbert et al. trap-nests, placed in different grass- 2003b; Blaxter & Floyd 2003). Due land habitats in Schleswig-Holstein, to its high evolutionary rate Cyto- Germany. While adult T. figulus chrome Oxydase subunit I (COI) of wasps preferentially feed on floral the mitochondrial DNA (mtDNA) was and extra-floral nectar (Kevan & used for the identification of a very Baker 1983, 1999) their larvae feed large number of taxonomic groups on paralyzed web-building (Linyphii- (Lepidoptera: Hebert et al. 2003a, dae, Araneidae, Tetragnathidae, and 2004a, birds: 2004b; collembola: Theridiidae) or wandering (Thomisi- Hogg & Herbert 2004) and recently dae, Oxyopidae, and Salticidae) for spider species (Barrett & Herbert spiders (Blackledge et al. 2003; 2005). Sequence database for Araújo & Gonzaga 2007; Polidori et several groups of species are already al. 2007). The spider prey is trapped established, with a specific diagnos- by the female and transferred to the tic mtDNA sequence tag or barcode nest, which consist of a linear series (e.g. Theron & Cloete 2000). of cells, with partitions of mud or Wasp species, using holes of a other material. Immature spiders suitable diameter to build their nests, represent the most favoured prey and their association to natural prey (Polidori et al. 2007; Santoni & Del and predator species have recently Lama 2007; Buschini et al. 2008). gained in interest as a model system Little has however been reported on or “indicator food web” to investi- the spider species range used by T. gate the effect of environmental figulus. A single Sphecid wasp may change on trophic systems have a considerable effect on a (Tscharntke et al. 1998; Gathmann & spider population, as one female can Tscharntke 1999; Tylianakis et al. catch 100-300 spiders in the course 2007). These so called trap-nesting of one summer (Bristowe, 1941). wasp species reflect environmental One single egg is laid on the trapped changes through their species spiders and, after hatching, larvae richness and ecological functions or consume most of the provided prey, interactions like pollination, preda- which complicates the identification tion, and the mortality due to natural of preys to the species level. In most enemies (Tscharntke et al. 1998). studies investigating the prey com- Solitary living wasp species of the munity of solitary living wasps, nests family Sphecidae can easily be were inspected before the end of the trapped and monitored by offering larval development was complete artificial nesting sites. In particular (Araújo & Gonzaga 2007; Polidori et species of the mud-dauber wasp al. 2007; Buschini et al. 2008). The genus Trypoxylon are known to disruption of larval development to preferentially use man-made provided investigate the wasp’s prey commu- nests (Kruess & Tscharntke 2002; nity hinders the investigation of other Page 61 PhD thesis – Odile Bruggisser Chapter 3 members of the community centered size of 900 m2 around Grandcour on trap-nesting wasps, such as (46°52'18'' N, 6°55'50'' O) and 14 parasitic wasps, which attack larvae wildflower strips in the surroundings in brood cells (e.g. Evans & O’Neill of Fribourg (46°48'0'' N, 7°9'0'' E) 1988; Strohm 2001; Taki et al. in Switzerland. A few species from 2008). Several hymenopteran two additional regions, close to Bern parasitoids from the family Chrysidi- (46°57'4'' N, 7°26'19'' O) and dae, Pimplinae or Eurytomidae inflict Gruyère (46°29'11'' N, ca. 20% mortality by attacking T. 7°12'35'' O), collected in previous figulus larvae in brood cells (Gath- studies, were added to the database. mann &Tscharntke 1999; Asís et al. The distance between the two 1994). sampling areas is ca. 20 kilometers. In this study we established Pitfall traps consisted of plastic cups the genetic barcode database of a (6.5 cm diameter, 8 cm depth) filled spider community, to investigate the to one third with Gault’s solution trophic link between trap-nesting (Walker & Crosby, 1988) and some wasps and their spider prey commu- drops of detergent to break the nities. The study was performed in surface tension and to accelerate the ecological compensation zones wetting and killing of arthropods (wildflower strips) in Switzerland’s (Topping & Luff 1995). Traps were agricultural landscape. Over the last protected against rainwater with a decade, these ecological compensa- 15 × 15 cm plastic roof. Three traps tions zones have been established in were placed in the fields around the matrix of European intensive Fribourg for two week in June 2006 agriculture landscapes to conserve and fourteen traps in each field biodiversity. Wildflower strips are around Grandcour in August and perfectly suited to investigate such September 2007. Traps were placed an “indicator food web” centered on along a transect line, leading through trap-nesting wasp species, because the centre of the field with a minimal they are relatively simple habitats, distance of 5 meters between traps. and their study has strong theoretical A foliage hoover type SH 85C (Stihl, and practical value for conservation. Dieburg, Germany) with a suction The objective of this work was to tube of 0.11 m diameter was used to develop and test a molecular barcod- collect two vacuum samples (D-Vac) ing approach to fully characterize the per wildflower strip between 10.00h trophic links among the mud-dauber and 16.00h once during warm and wasp T. figulus and its spider prey. sunny days around Fribourg during October 2006 and around Grandcour Material and Methods during July and September 2007 and 2008. For this purpose, a metal Spider sampling: frame was used to delimit an area of The composition of spider communi- 1x1 meter in the centre of each field. ties of wildflower strips was investi- The apparatus was lowered to just gated between 2006 and 2008 by above the ground to sample the pitfall trapping and vacuum sampling ground and vegetation within the in 15 wildflower strips of an average sample area for one minute. All Page 62 PhD thesis – Odile Bruggisser Chapter 3 trapped spiders were conserved in mtDNA extraction, amplification and 80% ethanol, to prevent hardening of sequencing: spider’s cuticle which is crucial for Cytochrome Oxydase I (COI) haplo- morphological identification. Samples type were obtained from three were stored at 4° Celsius. Spiders groups of spiders: a) identified were identified to the species level species based on morphological by using taxonomic keys based on characteristics, b) immatures and c) external morphology (Nentwig et al. spiders consumed by T. figulus 2003). (Table S1). Both latter groups were used as test samples for our barcode Trap-nesting wasps sampling: database. To avoid potential con- Fourteen trap-nests were placed tamination from gut content material, along a transect leading through the genomic DNA was extracted from a centre of each field between May single leg of one to six individuals per and October 2008 in 10 different species. DNA was extracted using fields, located in the surroundings of Dneasy tissue kit (Quiagen, Hilden, Grandcour. Traps, consisted of grey Germany), following the manufac- plastic tubes (20cm long, 10 cm tures’ instructions or by recently diameter), fixed by an elastic band on established method using hot sodium a wooden pole (1.5m long) and hydroxide and Tris (HotSHOT, protected from rain by a wooden Montero-Pau et al. 2008). board (25x25cm). Each plastic tube Polymerase chain reaction was filled with 150-180, 15-20 cm (PCR) was used to amplify a 579 bp long, internodes of the common reed segment of the mitochondrial COI Phragmites australis (diameter in the gene (see Table 1 for a list of primers range of 2 and 10mm) (Gathmann et used). PCR reactions were carried al. 1994). In October all traps were out in 25 μl containing 2 μl of DNA transferred to a cooling chamber extract, 0.5 μl of dNTPs (10 mM), (4°C; 5% RH) in the laboratory to 0.5 μl of each primer (20 uM), 0.5 μl simulate winter conditions. After 16 of MgCl2 (25 mM), 18.375 μl of weeks traps were removed from the sterile water, 2.5 μl of 10x buffer cooling chamber and each reed solution (Quiagen) and 0.125 μl internode was dissected under a TopTaq DNA polymerase (5000 U ml- binocular. Adult wasps and parasi- 1, Quiagen, Hilden, Germany). PCR toids were reared from larvae and reactions were performed on a pupae in glass tubes sealed with Biometra T-Gradient Thermocycler cotton wool. Emerging adults of T. (Biolabo Scientific Instruments). The figulus and of potential prey species following cycling conditions were were counted and identified to the used for COI: initial step of 3min at species level by experts on the base 94C°, followed by 40 cycles of 30s of external morphology characters. at 94C°, 30s at specific annealing Remains of spiders consumed by the temperature and 1min at 72C° and a wasps were transferred into individ- final step of 10min at 72C° (see ual Eppendorf tubes in 100% Et-OH Table 1). One negative control (2 μl for further genetic analysis. of distilled water) was run with every Page 63 PhD thesis – Odile Bruggisser Chapter 3 set of PCR reactions. Bands were Endosymbiont screening: visualized by gel electrophoresis Maternally-inherited endosymbionts using 1.5% agarose gel, stained with such as Wolbachia and Cardinium ethidium bromide. Gels were run for infect 66% and 6-7%, respectively, 45 minutes at 120 V and photo- of arthropod species (Hurst & Jiggins graphed under UV light. Remaining 2000; Zchori-Fein & Perlman 2004; primers and nucleotides were re- Hilgenboecker et al. 2008). Such moved by incubating 20 μl of PCR endosymbionts and mitochondria are product with 0.8 μl of Shrimp in linkage disequilibrium and by Alkaline Phosphatase (SAP, 5000 U causing cytoplasmic incompatibility ml-1) and 1.2 μl of Exonuclease I (10 between hosts with different infec- mM, with dilution buffer) for 1 hour tion status (infected versus non- at 37 C°. Purified PCR products were infected or infected with different sequenced in both directions on an bacteria strains) they can select a Automatic Sequencer 3730xl under given mitochondrial haplotype in a BigDyeTM terminator cycling condi- process named “selective sweep” tions with appropriate primers. (Werren 1997; Bourtzis et al. 1998). Such phenomenon can have a rRNA extraction, amplification and dramatic influence on their host sequencing: haplotype diversity and lead to To rule out biases due to demo- interpretation mistakes when using graphic processes such as founder only mitochondrial sequence data to effect or bottlenecks, we additionally infer genetic similarity among species considered a gene fragment of the or populations (Hurst & Jiggins nuclear DNA to confirm the observed 2005). To evaluate the endosymbiont pattern in mitochondrial haplotype incidence and prevalence in the diversity between species. Therefore, spider community and to control for we sequenced the ribosomal RNA endosymbiont-mediated bias in our sub-unit 28S region D1-D3 of dataset, the majority of individuals representative samples of every used in this study were molecularly spider family or genus included in our screened for the following endosym- study. The 583-bp segment of rRNA bionts: Arsenophonus, Cardinium, was amplified by polymerase chain Flavobacteria, Spiroplasma poulsoni, reaction (PCR). Cycling conditions Rickettsia spp. and Wolbachia (Table and PCR reactions were as above. 2). One negative (2 μl of autoclaved For some species of the family MiliQ water) and one positive control Gnaphosidae, Linyphiidae, Lycosidae, consisting of the DNA extract of a Tetragnathidae, Theridiidae and specimen known to be infected with Thomisidae, a nested PCR using 2 μl an endosymbiont (Table 1) was run of a 1/100–1/1000 dilution of the with every set of PCR reactions. PCR product obtained with the O/C Visualization, purification and direct primers was needed to obtain a good sequencing were performed as quality sequence (see Table S1). above. Page 64 PhD thesis – Odile Bruggisser Chapter 3 Sequence analysis: spiders found in different experi- Forward and reverse sequences were ments largely depended on the aligned using Bioedit sequence editor sampling effort, the period of meas- (Hall 1999) and further adjusted by urements and the sampling area. An eye. Sequence data were trans- estimation of the expected spider formed in a distance matrix by using diversity in a given habitat is difficult. the uncorrected distance option We are aware that the number of (maximum likelihood) available in the species used in this experiment is an version 4.0b10 of PAUP (Swofford underestimation of the real diversity. 2002). The distance matrix was then Comparing the list of spider species used to produce a phenogram via the in our dataset with the ones ob- neighbor joining clustering method served in wildflower strips in other implemented in PAUP. Bootstrap studies (Schmidt-Entling & Döbeli values for branches support were 2009), some families like Corinnidae, calculated in PAUP (Swofford 2002). Hahniidae or Liocranidae are missing, The haplogyn spider species Pholcus as well as some species from the phalangioides (Pholcidae) and Scyto- family Linyphiidae or Theridiidae. des thoracica can be considered as However, most of the common sister group of the entelegyn spiders spider species found in wildflower and were, therefore, used as out- strips in the Plateau of Switzerland groups in this study, (Coddington are included in our analysis. Voucher 2005; Kral et al. 2006). All COI and specimens from all spider species 28S sequences were confronted with used in this experiment are preserved the nucleotide database in GenBank at the Department of Ecology and (BLAST) as a quality check and to Evolution, University of Fribourg, avoid the introduction of wrongly Switzerland. Derived COI sequences assigned sequences (miss- were deposited in GenBank (Acces- identification or laboratory contami- sion numbers XX) and specific nation) in our database. information on the geographical provenance of samples can be found Results in Table S1. Spider community: Trap-nesting wasp community: DNA was extracted from a total of A total of 403 T. figulus nests were 129 spider individuals belonging to found in ten different fields and 58 49 species from 12 families (Table different trap-nests. The density of T. S1). Up to 130 spider species were figulus in the different fields was described in Swiss ecological com- highly variable. While in some fields pensation areas such as extensified only two nests were observed, grassland, traditional orchards, others had up to 140 nests (mean 33 hedges and wild flower strips (Jean- ± 48.4 s.d.). Predation on wasp neret et al. 2003). Considering the larvae was observed in 30% of the spider diversity exclusively found in investigated nests. The most impor- wildflower strips around 70 species tant parasitoid was the parasitic can be expected (Schmidt-Entling & wasp species Melittobia acasta Döbeli 2009). The diversity of (Hymenoptera: Eulophidae). Further Page 65 PhD thesis – Odile Bruggisser Chapter 3 natural enemies of T. figulus such as Linyphiids, where multiple individuals Chrysis cyanea (Hymenoptera: were tested, the monophyly of Chrysididae) (Villers, 1789), Tricho- different species was confirmed with des apiarius (Coleoptera: Cleridae) a high bootstrap support (e.g., and Megatoma undata (Linnaeus, Tenuiphantes tenuis, Meioneta 1758) (Coleoptera: Dermestidae) rurestris, Centromerita bicolor or were found. Porrhomma microphthalmum). In other families, the monophyly of Phenogram of COI sequences: different species was also observed Parts of the COI gene (579 bp) from with high bootstrap support (e.g., 104 distinct COI sequences (haplo- Neottiura bimaculata (Theridiidae), types) belonging to 46 spider species Alopecosa pulverulenta (Lycosidae) from 12 families were successfully or Misumena vatia (Thomisidae)). At sequenced and used in phylogenetic the genus level, the monophyly of analysis (Table S1). The latter different taxa was confirmed with a sequences included three individuals high bootstrap support in most from two outgroup species Pholcus cases. With the exception of the phalangioides (Pholcidae) and Scyto- genus Pardosa, all the genera with des thoracica (Scytodidae), 10 multiple species representatives immature and 19 test samples of (Erigone, Pachygnatha, Enoplogna- spider remains out of T. figulus tha, Xysticus and Drassodes) clus- nests. Phylogenies based on COI tered in clearly distinctive clades. At genes were constructed using PAUP the family level, we also found a v. 4.0b10 software with strict moderate level of associations, with maximum likelihood (ML) inference. the monophyly confirmed in eight of The appropriate model of evolution the 12 families. From the three non- was estimated with ModelTest v. 3.7 monophyletic families (Linyphiidae, (Posada & Crandall, 1998), and the Theridiidae and Gnaphosidae) no best likelihood score was evaluated more than two separated groups with the Akaike Information Criterion were found. This separation was (Posada & Buckley, 2004). The best most often due to one genus not model of nucleotide substitution was clustering with the rest of the genera the transversional model with within this family. invariant sites and rates at variable Test samples obtained from sites following a Gamma distribution the DNA of unknown immature (TVM+I+G). The latter model spiders (represented by the numbers recognizes four separate transversion 1 to 10 in Fig. 1) could be molecu- rates and a single transition rate. The larly identified to the species or the full neighbor-joining tree revealed genera level. Two samples (8 and 9) evidence for the clustering of con- clustered with a high bootstrap specifics and congeners in a pattern support with the spider species we expect from morphological Tetragnatha montana or Pachygnatha identification (Fig.1). At the species clercki (Tetragnathidae) respectively. level, the monophyly of different taxa For the remaining samples (1-7 and was confirmed with a high bootstrap 10) we found high similarity at the support. Especially in the family of genera level. Page 66 PhD thesis – Odile Bruggisser Chapter 3 The majority of the 19 other frequencies in the datat set. The test samples (11-29) obtained from gamma + invariable sites model spider tissue out of the nest of T. further accommodates site-to-site figulus were assigned to known variability of evolutionary rate using species. Eleven test samples (16, 17, eight site-rate categories and an 19, 20, 22-25, 27-29) from different estimated proportion of invariant traps formed a highly supported sites. clade with Theridion impressum With the exception of the genus (Theridiidae). Six samples (11, 12, Pardosa, which did not form a 14, 15, 21, 26) formed a highly monophyletic clade, the examination supported clade with Larinioides of the full neighbor-joining tree cornutus (Araneidae). A high boot- confirmed the clustering of conge- strap value supported the grouping of ners and conspecifics as it was found the test sample 18 with Mangora in the COI tree (Fig. 2). In compari- acalypha (Araneidae). The test son to the COI tree, the phylogenetic sample 13 grouped within the family analysis of the 28S sequences Araneidae, could, however, not be revealed the clustering of clearly assigned to a specific species. A distinctive familial clades. comparison of the obtained sequence with a nucleotide database in Gen- Endosymbionts: Bank confirmed the similarity of this A total of 99 spider individuals sample with samples obtained from belonging to 44 spider species (12 spiders of the family Araneidae. families) and 10 immatures were tested for the presence of the Phenogram of 28S sequences: following endosymbiont species; A total of 47 distinct sequences from Arsenophonus, Cardinium, Flavobac- parts of the more slowly evolving teria, Rickettsia, Spiroplasma poul- 28S gene (spanning the D1-D3 soni and Wolbachia. Ten individuals regions) (583 bp) were obtained, (10%) belonging to 6 species from 4 belonging to 37 spider species from families were infected by either 11 families, whereof 3 sequences Cardinium or Wolbachia (Table 2, Fig. belonged to the outgroup species 1). We did not observe any co- Pholcus phalangioides or Scytodes infected individuals, hosting two thoracica respectively (Table S1). To different bacterial species. Cardinium construct the 28S phylogenetic tree infection was found in 4.5% of the we used the same criteria for the species and in 4% of all tested construction of the models like in the individuals, while Wolbachia was phylogenetic analysis of the COI found in 9% of all species and in 6% sequences (see above). The best of all individuals tested. High infec- substitution model was the General tion rates for males and females were Time Reversible plus Invariant sites found in Pachygnatha degeeri (113, plus Gamma distributed model 174 and 175) and for females in the (GTR+I+G). In this model each outgroup species Pholcus phalan- possible nucleotide change includes gioides (262, 263 and 265). In separate transition probabilities, Bathyphantes gracilis (148) and which are scaled to the nucleotide Oedothorax apicatus (215) only Page 67 PhD thesis – Odile Bruggisser Chapter 3 females were infected. From the in the dataset of COI sequences were infected individuals, only seven were found to be monophyletic with considered in the analysis of COI strong bootstrap support. COI only sequences. The tow COI sequences failed to clearly distinguish 6 out of from P. phalangioides (262 and 163) 46 spiders to the species level, considered in the phylogenetic species previously identified based on analysis were highly similar, which morphological characters (Table S1; was not the case for the sequences Fig. 1). The absence of monophyly in of the two P. degeeri (113, 174) the species Drassodes lapidosus, individuals. Although the number of Drassodes pubescens, Drassyllus screened individuals is low, there is pusillus and Zelotes latreillei which all no strong evidence of a selective belong to the family Gnaphosidae, is sweep (correlation between endo- most likely due to demographic symbiont infection and low or null processes like founder effects or haplotype diversity). bottlenecks. The use of the COI gene does however not provide accurate Discussion deep phylogenetic resolution to answer this question. A detailed Spider identification through molecu- analysis of more species from this lar markers (COI, 28S): family may help to clarify these Our phylogenetic analysis provides inconsistencies between genetic and evidence that the identification of morphological identification. spider species based on molecular According to several authors, markers (COI, 28S) is accurate. The the ability of barcodes to precisely high potential of COI sequences for assign individuals to species is not the identification of a large number of assured for individuals from different different spider species has already geographical origin (Sperling 2003; been reported (Barrett & Herbert Moritz & Cicero 2004; Prendini 2005; Greenstone et al. 2005). The 2005). The relatively high bootstrap latter studies were, however, exclu- values between individuals from the sively based on the use of one monophyletic species Oedothorax molecular marker of the mitochon- apicatus, Theridion impressum drial DNA (COI). Demographic (Linyphiidae) and Neottiura bimacu- processes such as founder effect or lata (Theridiidae) may be indeed due bottlenecks can affect the intraspeci- to their difference in sampling site fic mitochondrial haplotype diversity. (see Table S1). Since the monophyly Therefore the sole use of mitochon- of these three species was neverthe- drial DNA for molecular barcoding less confirmed by the analysis, we studies may be prone to data misin- can assume that the two populations terpretations (Tautz et al. 2002, in the different sampling areas of this 2003; Mallet & Willmott 2003; study are not strictly genetically Moritz & Cicero 2004; Wheeler et al. isolated from each other. In favor of 2004). To account for this problem, this assumption is the relatively small we incorporated ribosomal RNA distance between the two sampling sequence (28S) data in our investiga- sites (20 km) and the fact that they tion. Almost all species represented were not separated by any geo- Page 68 PhD thesis – Odile Bruggisser Chapter 3 graphic barrier like mountains or large classification of species recognized water bodies. Furthermore nearly all through previous morphological spider species investigated are identification, and highly agreed in known to disperse over large dis- the monophyly of the different clades tances by ballooning (Blandenier found in the COI tree. This further 2009) enabling genetic exchanges emphasizes the accuracy of the between remote populations. In some phylogeny of COI generated in our species, like Pardosa proxima (Lyco- analysis and supports the use of a sidae), COI sequences were even COI-based identification system to found to be identical between distinguish spider species. individuals coming from either study site. The effect of inherited symbionts in The lack of support for the phylogenetic studies: clade of the genus Pardosa (Lycosi- Goodacre et al. (2006), who investi- dae) corresponds to previous obser- gated the infection with endosymbi- vations (Murphy et al. 2006). While onts in a large variety of spider the monophyly of the Lycosidae is species, found Wolbachia, Cardinium, well supported (Dondale 1986; Rickettsia and Spiroplasma to be the Griswold 1993) the relationship most important ones. In our experi- within the family are poorly under- ment we detected Wolbachia or stood and a stable subfamilial Cardinium but not Rickettsia nor classification does not exist. Discrep- Spiroplasma. The observed infection ancies between gene trees and rate with Wolbachia (9%) was lower species trees (Maddison 1997; than could be expected from litera- Nichols 2001) can further lead to not ture (66% in arthropods), while strictly correlated distinctions Cardinium infection (4.5%) was in between morphology and genetics in the range of infection rates of other lycosid spiders (Vink & Paterson arthropods (6-7%) (Hurst & Jiggins 2003). The timing of speciation 2000; Zchori-Fein & Perlman 2004; event in morphological trades used Hilgenboecker et al. 2008). The for species classification may differ observed endosymbiont incidence from the timing of the evolution of may, however, be underestimated, COI gene sequences. To consider because the infection within some different gene sequences in several species may not have been detected individuals from the same species due to small sample sizes. Further- are, therefore, important. As sug- more, bacterial titer differs depending gested by Murphy et al. (2006) the on tissue types and with age (Ijichi et position of some genera within their al. 2002). Since DNA was extracted respective subfamilies may be in from spider legs, we may have failed doubt and more work is needed to to detect endosymbionts in some clarify these inconsistencies between spiders. genetic and morphological identifica- COI sequences used for phy- tion. logenetic analysis were not biased by The analysis of the slower correlations between endosymbiont evolving and thereby more conserved infections and haplotype diversity. 28S sequences confirmed the We can, therefore, assume that the Page 69 PhD thesis – Odile Bruggisser Chapter 3 observed clustering of species based ecological studies (Greenstone et al. on COI sequences was not misinter- 2005). Although our dataset did not preted due to the presence of include COI sequences from all endosymbionts. In the case of species that might be trapped by T. Pholcus phalangioides, two individu- figulus in this habitat type, a surpris- als had identical COI sequences, ingly high number of spider test which might be the indication of samples out of wasp nests could be mitochondrial haplotype selection by assigned to a specific spider species. endosymbionts (selective sweep) for To be able to use COI sequences to more similar sequences. The high track trophic links in food webs, we genetic similarity of these two emphasize the importance of large individuals might thus have been due COI sequence databases of many to the presence of Wolbachia. To be species from different communities able to know whether the infections and geographic regions. of endosymbionts or demographic Our investigation highlights processes are responsible for these another major advantage of COI results, more detailed analyses are sequence databases: the identifica- needed. This could for example be tion of trophic links in food webs. By achieved by mating experiments the use of this genetic marker, we between infected females and were able to assign spider remains uninfected males. found in nests of the mud-dauber wasp T. figulus to the family Ther- The potential use of COI to track idiidae and Araneidae. This is in line immatures and trophic links in food with the current knowledge of the webs: prey spectrum of Trypoxylon wasps Although the use of COI for the in general, which have been found to identification of species has largely show a preference for spiders from been criticised (Lipscomb et al. the family Araneidae, Theridiidae 2003; Tautz et al. 2003; Scotland et and/or Linyphiidae, while spiders al. 2003; Scoble 2004; Prendini from other families like Lycosidae, 2005), our analysis highlights the Salticidae or Thomisidae are less great potential of this genetic marker often trapped (Asís et al. 1994; for the identification of immature Polidori et al. 2007; Buschini et spiders, where the development of al.2008). Furthermore, there is good genital structures, crucial for species evidence that most of the test identification, is not complete. In line samples taken from the T. figulus with the observation of Greenstone traps belonged to the three spider et al. (2005), COI sequences of this species T. impressum, Mangora study proved to be useful for the acalypha and L. cornutus. The latter identification of immatures in most species has been found in the prey cases to the species level. Immature spectrum of another Trypoxylon spider individuals may occur, depend- species T. albonigrum (Eberhard ing on the season, in identical or 1970) and all three spider species higher densities as adults in the field, have been observed in nests of other which highlights the need of a sound mud-dauber wasp species from the method for their identification in family Sphecidae (Sceliphron spirifex Page 70 PhD thesis – Odile Bruggisser Chapter 3 and S. caementarium, Drury) in an Acknowledgements experiment performed in northern Italy (Polidori et al. 2007). To our We thank Patrik Kehrli, Jacques knowledge the prey spectrum of T. Studer and the farmers for the figulus has not been fully investi- realisation of this project. Special gated so far. thanks go to Felix Amiet for wasp The two parasitoid species of species identification, Christine T. figulus found in this experiment Müller† and Mathias Albrecht for their corresponded to observations of the comments and suggestions, Renate predator spectrum of previous Zindel, Barbara Walser, Christoph studies (Tscharntke et al. 1998; and Cathy Haag for their help in the Gathmann & Tscharntke 1999). lab and data analysis. This study was However, the two beetle species T. funded by the Swiss National Foun- apiarius and M. undata have, to our dation and by the Foundation du knowledge, not been reported as Fonds de la recherche de l’Université natural enemies of T. figulus so far. de Fribourg, Switzerland. The investigated system of a wasp species and its prey spectrum, as References presented here, is only one example to illustrate the potential use of COI Araújo M, Gonzaga M (2007) Individual sequences for tracking trophic links specialization in the hunting wasp in food webs. Trypoxylon (Trypargilum) albonigrum (Hymenoptera, Crabronidae). Behav- Conclusion ioral Ecology and Sociobiology, 61, 1855–1863. The use of a COI sequence database Asís JD, Tormos J, Gayubo SF (1994) for the identification of spiders Biological Observations on Trypoxylon demonstrated by Barrett and Herbert attenuatum and Description of Its (2005) was largely criticised because Mature Larva and Its Natural Enemy they only considered one mitochon- Trichrysis cyanea (Hymenoptera: drial gene which can be subject to Sphecidae, Chrysididae). Journal of demographic processes like bottle- the Kansas Entomological Society, necks, founder effects, or genetic 67, 199-207. drift and selective sweeps through Barrett RDH, Hebert PDN (2005) endosymbiont infection. In this study Identifying spiders through DNA bar- the latter potential bias were taken codes. Canadian Journal of Zoology, into account by the consideration of 83, 481-491. an additional nuclear gene and by a Blackledge TA, Coddington JA, Gillespie survey of the endosymbionts infect- RG (2003) Are three-dimensional ing spiders. With this experiment, we spider webs defensive adaptations? emphasize the major advantage of Ecology Letters, 6, 13-18. genetic barcodes for the detection of Blandenier G (2009) Ballooning of otherwise invisible trophic links in spiders (Araneae) in Switzerland: food webs, which is crucial for the general results from an eleven-year study of important ecological ques- survey. Bulletin of the British arach- tions on the stability of communities. nological Society, 14, 308-316. Page 71 PhD thesis – Odile Bruggisser Chapter 3 Blaxter M, Floyd R (2003) Molecular behaviour of two wasps, Agenoideus taxonomics for biodiversity surveys: humilis (Pompilidae) and Scelipron already a reality. Trends in Ecology caementarium (Sphecidae), on the orb and Evolution, 18, 268-269. weaving spider Araneus cornutus Borrvall C, Ebenman B, Jonsson T (Araneae). Psyche, 77, 243-251. (2000) Biodiversity lessens the risk of Evans HE, O’Neill KM (1988) The natural cascading extinction in model food history and behaviour of North Ameri- webs. Ecology Letters, 3, 131–136. can beewolves. Comstock, Ithaca, Bourtzis K, Dobson SL, Braig, HR et al. NY. (1998) Rescuing Wolbachia have Foottit RG, Maw HEL, Havill NP, et al. been overlooked…. Nature, 391, (2009) DNA barcodes to identify 852–853. species and explore diversity in the Bristowe WS (1941) The community of Adelgidae (Insecta: Hemiptera: Aph- spiders, 2. London: Ray Society. ididae). Molecular Ecology Resources, Burger JC, Patten MA, Rotenberry JT, et 9, 188–195. al. (1999) Foraging ecology of the Gathmann A, Tscharntke T (1999) California gnatcatcher deduced from Landschafts-Bewertung mit Bienen fecal samples. Oecologia, 120, 304– und Wespen in Nisthilfen: Artenspekt- 310. rum, Interaktionen und Bestimmungs- Buschini MLT, Borba, NA & Brescovit, schlüssel. Naturschutz und Land- AD (2008) Patterns of prey selection schaftspflege Baden-Württemberg, of Trypoxylon (Trypargilum) lactitarse 73, 277–305. Saussure (Hymenoptera: Crabronidae) Gathmann A, Greiler H-J, Tscharntke T in southern Brazil. Brazilian Journal of (1994) Trap-nesting bees and wasps Biology, 68, 519-528. colonizing set-aside fields: succession Coddington J (2005) Phylogeny and and body size, management by cut- classification of spiders In: Spiders of ting and sowing. Oecologia, 98, 8-14. North America: an identification man- Gillespie RG (2002) Biogeography of ual (eds Ubick D, Paquin P, Cushing spiders on remote oceanic islands of PE, Roth V), pp. 18–24. American the Pacific: archipelagoes as stepping Arachnological Society. stones? Journal of Biogeography, 29, Coddington J, Levi HW (1991) Sys- 655-662. tematics and evolution of spiders Green RE, Tylere GA (1989) Determina- (Araneae). Annual Review of Ecology tion of the diet of the stone curlew and Systematics, 22, 565-592. (Bwhinus oedicnemus) by faecal Dondale CD (1986) The subfamilies of analysis. Journal of Zoology, 217, wolf spiders (Araneae: Lycosidae). In: 311-320. Actas X Congr. Int. de Arachnol., Vol Greenstone MH, Rowley DL, Heimbach 1 (eds Barrientos, JA), pp. 327-332. U, et al. (2005) Barcoding generalist Jaca, Spain, Inst. Pirenaico de Ecol. predators by polymerase chain reac- Duron O, Bouchon D, Boutin S, et al. tion: carabids and spiders. Molecular (2008) The diversity of reproductive Ecology, 14, 3247-3266. parasites among arthropods: Wolba- Griswold CE (1993) Investigations into chia do not walk alone. BMC Biology, the phylogeny of the lycosoid spiders 6, 27. and their kin (Arachnida: Araneae: Eberhard WG (1970) the predatory Lycosoidea). Smithsonian Contribu- Page 72 PhD thesis – Odile Bruggisser Chapter 3 tions to Zoology, 539, 1–39. Hogg ID, Hebert PDN (2004) Biological Goodacre SL, Martin OY, Thomas CFG, identifications of springtails (Hex- et al. (2006) Wolbachia and other apoda: Collembola) from the Canadian endosymbiont infections in spiders. Arctic using mitochondrial DNA bar- Molecular Ecology, 15, 517-527. codes. Canadian Journal of Zoology, Hall TA (1999) BIOEDIT: a user-friendly 82, 749–754. biological sequence alignment editor Hurst GDD, Hammarton TM, Bandi C, et and analysis program for Windows al. (1997) The diversity of inherited 95/98/NT. Nucleic Acids Symposium parasites of insects: the male killing Series, 41, 95–98. agent of the ladybird beetle Coleome- Hebert PDN, Cywinska A, Ball SL, et al. gilla maculata is a member of the (2003a) Biological identifications Flavobacteria. Genetical Research, through DNA barcodes. Proceedings 70, 1–6. of the Royal Society of London, Se- Hurst GDD, Jiggins FM (2000) Male- ries B: Biological Sciences, 270, 313– Killing bacteria in insects: mecha- 322. nisms, incidence, and implications. Hebert PDN, Ratnasingham S, deWaard Emerging Infectious Disease, 4, 329- JR (2003b). Barcoding animal life: 336. cytochrome c oxidase subunit 1 di- Hurst GDD, Jiggins FM (2005) Problems vergences among closely related with mitochondrial DNA as a marker species. Royal Society London. Series in population, phylogeographic and B, 270 (Supplement): S96–S99. phylogenetic studies: the effects of Hebert PDN, Penton EH, Burns JM, inherited symbionts. Proceedings of Janzen DH, Hallwachs W (2004a) the Royal Society of London. Series Ten species in one: DNA barcoding B, Biological Sciences, 272, 1525– reveals cryptic species in the 1534. neotropical skipper butterfly Astraptes Ijichi N, Kondo N, Matsumoto N,, et al. fulgerator. Proceedings of the Na- (2002) Internal spatiotemporal popu- tional Academy of Sciences, USA, lation dynamics of infection with 101, 14812–14817. three Wolbachia stains in Adzuki bean Hebert, PDN, Stoeckle MY, Zemlak , et beetle, Callosobruchus chinesis (Col- al. (2004b) Identification of birds eoptera: Bruchidae). Applied and through DNA barcodes. PLoS Biology, Environmental Microbiology, 9, 393- 2, 1657–1663. 405. Hedin MC, Maddison WP (2001) A Jeanneret P, Schüpbach B, Pfiffner L, et combined molecular approach to al. (2003) The Swiss agri- phylogeny of the jumping spider sub- environmental programme and its family Dendryphantinae (Araneae: effects on selected biodiversity indi- Salticidae). Molecular Phylogenetics cators. Journal of Natural Conserva- and Evolution, 18, 386–403. tion, 11, 213-220. Hilgenboecker K, Hammerstein P, Kevan PG, Baker HG (1983) Insects as Schlattmann P, et al. (2008). How flower visitors and pollinators. Annual many species are infected with Wol- Review of Entomology, 28, 407–453. bachia?–A statistical analysis of cur- Kevan PG, Baker HG (1999) Insects on rent data. FEMS Microbiol Letters, flowers: pollination and floral visita- 281, 215–220. tions. In: Insect ecology (eds Huffaker Page 73 PhD thesis – Odile Bruggisser Chapter 3 CB, Rabb RC), 2nd edn. John Wiley Murphy NP, Framenau VW, Donnellan and Sons, New York. SC et al. (2006) Phylogenetic recon- Koh LP, Dunn RR, Sodhi NS et al. (2004) struction of the wolf spiders (Araneae Species coextinctions and the biodi- : Lycosidae) using sequences from the versity crisis. Science, 305, 1632. 12S rRNA, 28S rRNA, and NADH1 Kral J, Musilova J, St’ahlavsky F, et al. genes: Implications for classification, (2006) Evolution of the karyotype and biogeography, and the evolution of sex chromosome systems in basal web building behavior. Molecular clades of araneomorph spiders (Ara- Phylogenetics and Evolution, 38, 583- neae: Araneomorphae). Chromosome 602. Research, 14, 859–880. Nentwig W, Hänggi A, Kropf C et al. Kruess A, Tscharntke T (2002) Grazing (2003) Central European spider- intensity and the diversity of grass- determination key. hoppers, butterflies, and trap-nesting http://www.araneae.unibe.ch/ bees and wasps. Conservation Biol- Nichols R (2001) Gene trees and species ogy, 16, 1570–1580. trees are not the same. Trends in Lassau SA, Hochuli DF (2004) Effects of Ecology and Evolution, 16, 358-364. habitat complexity on ant assem- Paine RT (1966) Food Web complexity blages. Ecography, 27, 157–164. and species diversity. The American Lipscomb D, Platnick N, Wheeler Q Naturalist, 100, 65-75. (2003) The intellectual content of Petchey OL, Downing AL, Mittelbach taxonomy: a comment on DNA tax- GG, et al. (2004) Species loss and the onomy. Trends in Ecology and Evolu- structure and functioning of multitro- tion, 18, 65–66. phic aquatic systems. Oikos, 104, Mallet J, Willmott K (2003) Taxonomy: 467–478. renaissance or Tower of Babel? Petchey OL, Hector A, Gaston KJ (2008) Trends in Ecology and Evolution, 18, How do different measures of func- 57-59. tional diversity perform? Ecology, 85, Maddison WP (1997) Gene Trees in 847-857. Species Trees. Systematic Biology, Polidori C, Federici M, Pesarini C, et al. 46, 523-536. (2007) Factors affecting spider prey McNett BJ, Rypstra AL (2000) Habitat selection by Sceliphron mud-dauber selection in a large orb-weaving spi- wasps (Hymenoptera: Sphecidae) in der: vegetational complexity deter- northern Italy. Animal Biology, 57, mines site selection and distribution. 11-28. Ecological Entomology, 25, 423-432. Posada D, Buckley TR (2004) Model Montero-Pau J, Gómez A, Munoz J selection and model averaging in (2008) Application of an inexpensive phylogenetics: advantages of akaike and high-throughput genomic DNA information criterion and bayesian extraction method for the molecular approaches over likelihood ratio tests. ecology of zooplanktonic diapausing Systematic Biology, 53, 793-808. eggs. Limnology and Oceanography: Posada D, Crandall KA (1998) Methods, 6, 218-222. Modeltest: testing the model of DNA Moritz C, Cicero C (2004) DNA barcod- substitution. Bioinformatics, 14, 817- ing: promise and pitfalls. PLoS Biolo- 818. gy, 2, 1529-1531. Prendini L (2005) Comment on "Identify- Page 74 PhD thesis – Odile Bruggisser Chapter 3 ing spiders through DNA barcodes". Strohm E, Laurien-Kehnen C, Bordon S Canadian Journal of Zoology, 83, (2001) Escape from Parasitism: Spa- 498-504. tial and Temporal Strategies of a Santoni MM, Del Lama MA (2007) Sphecid Wasp against a Specialised Nesting biology of the trap-nesting Cuckoo Wasp. Oecologia, 29, 50-57. Neotropical wasp Trypoxylon (Trypar- Swofford DL (2002) PAUP* Phylogenetic gilum) aurifrons Schuckard (Hymen- Analysis Using Parsimony (* and topera, Crabronidae). Revista Bra- Other Methods), Version 4. Sinauer sileira de Entomologia, 51, 369-376. Associates, Sunderland, Massachu- Schmidt-Entling MH, Döbeli J. (2009) setts. Sown wildflower areas to enhance Tautz D, Arctander P, Minelli A, et al. spiders in arable fields. Agriculture, (2002) DNA points the way ahead in Ecosystems and Environment, 133, taxonomy. Nature, 418, 479. 19-22. Tautz D, Arctander P, Minelli A, et al. Scoble MJ (2004) Unitary or unified (2003) A plea for DNA taxonomy. taxonomy? Philosophical Transactions Trends in Ecology and Evolution, 18, of the Royal Society of London, Se- 70-74. ries B: Biological Sciences, 359, 699– Taki H, Viana BF, Kevan PG, et al. 710. (2008) Does forest loss affect the Scotland RW, Hughes C, Bailey D, et al. communities of trap-nesting wasps (2003) The Big Machine and the (Hymenoptera: Aculeata) in forests? much-maligned taxonomist. Sys- Landscape vs. local habitat condi- tematics and Biodiversity, 1, 139– tions. Journal of Insect Conservation, 143. 12, 15-21. Sheppard SK, Harwood JD (2005) Theron J, Cloete TE (2000) Molecular Advances in molecular ecology: track- techniques for determining microbial ing trophic links through predator-prey diversity and community structure in foodwebs. Functional Ecology, 19, natural environments. Critical Reviews 751–762. in Microbiology, 26, 37-57. Sperling F, (2003) DNA barcoding. Deux Thies C, Tscharntke T (1999) Landscape et machina. Newsletter of the Biologi- structure and biological control in cal Survey of Canada (Terrestrial agroecosystems. Science, 285, 893– Arthropods). Opinion Page, 22, 895. http://www.biology.ualberta.ca/bsc/n Topping CJ, Luff ML (1995) Three ews22_2/opinionpage.htm. factors affecting the pitfall catch of Steffan-Dewenter I, Münzenberg U, linyphiid spiders (Araneae: Linyphii- Tscharntke T (2001) Pollination, seed dae). Bulletin of the British Arach- set and seed predation on a landscape nological Society, 10, 35-38. scale. Proceedings of the Royal Soci- Tormos J, Asís JD, Gayubo SF, et al. ety of London, Series B: Biological (2005) Ecology of crabronid wasps Sciences, 268, 1685–1690. found in trap nests from Spain (Hy- Steffan-Dewenter I, Münzenberg U, menoptera: Spheciformes). Florida Bürger C, et al. (2002) Scale depend- Entomologist, 88, 278-284. ent effects of landscape structure on Tscharntke T, Gathmann A, Steffan- three pollinator guilds. Ecology, 83, Dewenter I (1998) Bioindication using 1421–1432. trap-nesting bees and wasps and their Page 75 PhD thesis – Odile Bruggisser Chapter 3 natural enemies: community structure Walker AK, Crosby TK (1988) The and interactions. Journal of Applied preparation and curation of insects. Ecology, 35, 708-719. DSIR Information Series 163. Ento- Tylianakis JM, Tscharntke T, Lewis OT mology Division, DSIR, Auckland, (2007) Habitat modification alters the New Zealand. structure of tropical host–parasitoid Werren JH (1997) Biology of Wolbachia. food webs. Nature, 445, 202-205. Annual Review of Entomology, 42, Vink CJ, AM Paterson (2003) Combined 587-609. molecular and morphological phyloge- Wheeler QD, Raven PH, & Wilson EO netic analyses of the New Zealand (2004) Taxonomy: impediment or wolf spider genus Anoteropsis (Ara- expedient? Science, 303, 285. neae: Lycosidae). Molecular Phyloge- Zchori-Fein E, Perlman SJ (2004) netics and Evolution, 28, 576-587. Distribution of the bacterial symbiont von der Schulenburg JHG, Habig M, Cardinium in arthropods. Moecular Sloggett JJ, et al. (2001) Incidence of Ecology, 13, 2009-2016. malekilling Rickettsia spp. (α- Zhou WG, Rousset F, O'Neill SL (1998) proteobacteria) in the ten-spot lady- Phylogeny and PCR-based classifica- bird beetle Adalia decempunctata L. tion of Wolbachia strains using wsp (Coleoptera: Coccinellidae). Applied gene sequences. Proceedings of the and Environmental Microbiology, 67, Royal Society London, 265, 509– 270–277. 515. Page 76 Table 1: Genes and primers used in polymerase chain reaction (PCR) for the construction of spider phylogenies and for the molecular screen of maternally-inherited endosymbionts. Organism Gene Primer (5’ – 3’) Annealing Positive Size Reference temperature control Araneae COI B LCO-1628 –ATAATGTAATTGTTACTGCTCATGC 47 C° NA 768 bp Gillespie (2002) cDNA HCO-2396 –ATTGTAGCTGAGGTAAAATAAGCTCG Araneae COI B ChelF1 -TACTCTACTAATCATAAAGACATTGG 47 C° NA 660 bp Barrett & Hebert cDNA ChelR1 –CCTCCTCCTGAAGGGTCAAAAAATGA (2005) Araneae 28S 28S ‘‘O’’ -GAA ACTGCTCAAAGGTAAACGG 55 C° NA 800 bp Hedin & Maddison rDNA 28S ‘‘C’’ –GGTTCGATTAGTCTTTCGCC (2001) Araneae 28S G700 -TGCGGACCTCCACCAGAGTTTCT 50 C° NA 800 bp Murphy et al. (2006) rDNA G701 -ACTGCTCAGAGGTAA ACGGGAGG Arsenophonus 16S ArsF -GGGTTGTAAAGTACTTTCAGTCGT 52C° Nasonia 581- Duron et al. (2008) rDNA ArsR2 -GTAGCCCTRCTCGTAAGGGCC vitripennis 804 bp Cardinium 16S CHR -TACTGTAAGAATAAGCACCGGC 60-50 C° Holocnemus 450 bp Zchori-Fein & rDNA CHR -GTGGATCACTTAACGCTTTCG pluchei Perlman (2004) Flavobacterium 16S FL1 -AATGTTAAAGTTCCGGCG-3 60-50 C° Adalia 800 bp Hurst et al. (1997) rDNA FL2 -CTGTTTCCAGCTTATTCGTAGTAC decempuntata Rickettsia spp. 16S RSSUF -CGGCTTTCAAAACTACTAATCTA 60-50 C° Bemisia 450 bp von der Schulenburg rDNA RSSUR -GAAAGCATCTCTGCGATCCG tabachi et al. (2001) Spiroplasma 16S SpoulF -GCTTAACTCCAGTTCGCC 55 C° Drosophila 421 bp Duron et al. (2008) rDNA SpoulR -CCTGTCTCAATGTTAACCTC melanogaster Wolbachia wsp WSP 81F -TGGTCCAATAAGTGATGAAGAAAC 60-50 C° Culex pipiens 540 bp Zhou et al. (1998) WSP 691R -AAAAATTAAACGCTACTCCA Table 2: Incidence and prevalence of maternally inherited endosymbiotic bacteria infecting wild flower strip spider species. N indicating the total number of individuals tested; f: females, m: males, im: immature (male or female). Prevalence Total number of individuals Arsenophonus Cardinium Flavobacteria Rickettsia Family Name N f m im f m im f m im f m im f m im f m im f m im Araneidae Aculepeira ceropegia 2 0 0 2 0 0 0 0 0 0 Argiope bruennichi 2 0 2 0 0 0 0 0 0 0 Larinioides cornutus 2 2 0 0 0 0 0 0 0 0 Spiroplasma Mangora acalypha 2 0 0 2 0 0 0 0 0 0 sp. 2 0 0 2 0 0 0 0 poulsoni 0 Wolbachia 0 Gnaphosidae Drassodes lapidosus 1 0 1 0 0 0 0 0 0 0 Drassodes pubescens 1 0 1 0 0 0 0 0 0 0 Drassyllus praeficus 1 0 1 0 0 0 0 0 0 0 Zelotes latreillei 1 0 1 0 0 0 0 0 0 0 Linyphiidae Bathyphantes gracilis 4 3 1 0 0 0 0 0 0 0 0 0 0 0 0.33 0 Centromerita bicolor 5 3 2 0 0 0 0 0 0 0 0 0 0 0 0 0 Dicymbium nigrum 1 0 1 0 0 0 0 0 0 0 Erigone atra 3 3 0 0 0 0 0 0 0 0 Erigone dentipalpis 5 3 2 0 0 0 0 0 0 0 0 0 0 0 0 0 Linyphia triangularis 1 1 0 0 0 0 0 0 Meioneta rurestris 6 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 Microlinyphia pusilla 1 0 1 0 0 0 0 0 0 0 Oedothorax apicatus 4 2 2 0 0 0 0 0 0 0 0 0 0 0 0.5 0 Pelecopsis parallela 1 1 0 0 0 1 0 0 0 0 Porrhomma microphthalmum 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 Tenuiphantes tenuis 5 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 Prevalence Total number of individuals Arsenophonus Cardinium Flavobacteria Rickettsia Family Name N f m im f m im f m im f m im f m im f m im f m im Linyphiidae Walckenaeria nudipalpis 1 1 0 0 0 0 0 0 0 0 Alopecosa Spiroplasma Lycosidae pulverulenta 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 Arctosa lutetiana 2 0 2 0 0 0 0 0 poulsoni 0 Wolbachia 0 Aulonia albimana 1 0 1 0 0 0 0 0 0 0 Pardosa agrestis 2 2 0 0 0 0 0 0 0 0 Pardosa amentata 1 1 0 0 0 0 0 0 0 0 Pardosa hortensis 2 2 0 0 0 0 0 0 0 0 Pardosa proxima 3 3 0 0 0 0 0 0 0 0.33 Pardosa pullata 1 1 0 0 0 0 0 0 0 0 Pirata uliginasus 1 1 0 0 0 0 0 0 0 0 Pholcidae Pholcus phalangioides 3 3 0 0 0 0 0 0 0 1 Pisauridae Pisaura mirabilis 1 1 0 0 0 0 0 0 0 0 sp. 5 0 0 5 0 0 0 0 0 0 Salticidae Marpissa muscosa 1 0 1 0 0 0 0 0 0 0 Scytodidae Scytodes thoracica 1 0 0 1 0 0 0 0 0 0 Tetragnathidae Pachygnatha clercki 2 0 2 0 0 0 0 0 0 0 Pachygnatha degeeri 3 2 1 0 0 0 1 1 0 0 0 0 0 0 0 0 sp. 2 0 0 2 0 0 0 0 0 0 Theridiidae Enoplognatha latimana 3 0 3 0 0 0 0 0 0 0 Enoplognatha ovata 2 2 0 0 0 0 0 0 0 0 Neottiura bimaculata 1 1 0 0 0 0 0 0 0 0 Theridion impressum 2 2 0 0 0 0 0 0 0 0 Prevalence Total number of individuals Arsenophonus Cardinium Flavobacteria Rickettsia Family Name N f m im f m im f m im f m im f m im f m im f m im Thomisidae Xysticus cristatus 1 0 1 0 0 0 0 0 0 0 Xysticus kochi 1 0 1 0 0 0 0 0 0 0 Ozyptila simplex 1 0 1 0 0 0 0 0 0 0 Spiroplasma Sp. 1 0 0 1 0 0 0 0 0 0 poulsoni Wolbachia Zoridae Zora spinimana 1 0 1 0 0 0 0 0 0 0 PhD thesis – Odile Bruggisser Chapter 3 Figure 1: Neighbour-joining tree of COI mtDNA haplotypes from 46 spider species (2 outgroup species) of semi-natural habitats in Switzerland. Number 1- 10 indicating immature spider test samples, 11-29 representing test samples of spider tissue from unknown species collected in nests of the wasp species Trypoxylon figulus. Endosymbiont infection: *Cardinium, **Wolbachia. Page 81 PhD thesis – Odile Bruggisser Chapter 3 Figure 2: Neighbour-joining tree of 28S rRNA haplotypes from 37 spider species (2 outgroup species) of semi-natural habitats in Switzerland. Page 82 Table S1: Spider specimens used for this study. Individuals not tested for endosymbionts or not represented in the COI or 28S tree are indicated by na. COI mtDNA 28S rRNA Primers Primers Chel Primers Label in 28S Study Family Species HCO/LCO F1/R1 Primers O/C G700/G701 Endosymbiont Label in COI tree tree site Araneidae Aculepeira ceropegia 1 1 197 Acu_cer 197 Acu_cer FR Aculepeira ceropegia 1 1 = 197 Acu_cer 198 Acu_cer FR Araneus diadematus 1 na 334 Ara_dia na BE Argiope bruennichi 1 1 201 Arg_bru 201 Arg_bru GR Argiope bruennichi 1 = 201 Arg_bru na GR Larinioides cornutus 1 na 323 Lar_cor na GR Larinioides cornutus 1 1 = 323 Lar_cor 276 Lar_cor GR Larinioides cornutus 1 1 283 Lar_cor 283 Lar_cor GR Mangora acalypha 1 199 Man_aca na FR Mangora acalypha 1 1 = 199 Man_aca 200 Man_aca FR Nuctenea umbratica 1 na 310 Nuc_umb na Gru sp. 1 2 na GR sp. 1 1 na GR Gnaphosidae Drassodes lapidosus 1 1 131 Dra_lap 131 Dra_lap FR Drassodes pubescens 1 1 132 Dra_pub 132 Dra_pub FR Drassyllus praeficus 1 1 108 Dra_pra 108 Dra_pra FR Micaria pulicaria 1 na 311 Mic_pul na GR Zelotes latreillei 1 1 134 Zel_lat 134 Zel_lat FR Linyphiidae Bathyphantes gracilis 1 Wolbachia = 134 Zel_lat na FR Bathyphantes gracilis 1 1 123 Bat_gra 123 Bat_gra FR Bathyphantes gracilis 1 149 Bat_gra na FR Bathyphantes gracilis 1 151 Bat_gra na FR Centromerita bicolor 1 125 Cen_bic na FR Centromerita bicolor 1 = 125 Cen_bic na FR Centromerita bicolor 1 1 170 Cen_bic 170 Cen_bic FR Centromerita bicolor 1 171 Cen_bic na FR COI mtDNA 28S rRNA Primers Primers Chel Primers Label in 28S Study Family Species HCO/LCO F1/R1 Primers O/C G700/G701 Endosymbiont Label in COI tree tree site Linyphiidae Centromerita bicolor 1 173 Cen_bic na FR Dicymbium nigrum 1 1 187 Dic_nig 187 Dic_nig FR Erigone atra 1 101 Eri_atr na FR Erigone atra 1 = 101 Eri_atr na FR Erigone atra 1 1 161 Eri_atr 161 Eri_atr FR Erigone dentipalpis 1 164 Eri_den na FR Erigone dentipalpis 1 = 164 Eri_den na FR Erigone dentipalpis 1 1 166 Eri_den 166 Eri_den FR Erigone dentipalpis 1 167 Eri_den na FR Erigone dentipalpis 1 168 Eri_den na FR Linyphia triangularis 1 287 Lin_tri na GR Meioneta rurestris 1 1 122 Mei_rur 122 Mei_rur FR Meioneta rurestris 1 1 153 Mei_rur 153 Mei_rur FR Meioneta rurestris 1 154 Mei_rur na FR Meioneta rurestris 1 = 154 Mei_rur na FR Meioneta rurestris 1 = 154 Mei_rur na FR Meioneta rurestris 1 = 154 Mei_rur na FR Microlinyphia pusilla 1 238 Mic_pus na GR Oedothorax apicatus 1 Wolbachia 215 Oed_api na GR Oedothorax apicatus 1 143 Oed_api na FR Oedothorax apicatus 1 212 Oed_api na GR Oedothorax apicatus 1 = 212 Oed_api na GR Pelecopsis parallela 1 1 Cardinium 142 Pel_par 142 Pel_par FR Porrhomma microphthal- mum 1 1 236 Por_mic 236 Por_mic GR Porrhomma microphthal- mum 1 1 237 Por_mic 237 Por_mic GR Tenuiphantes tenuis 1 126 Ten_ten na FR Tenuiphantes tenuis 1 = 126 Ten_ten na FR COI mtDNA 28S rRNA Primers Primers Chel Primers Label in 28S Study Family Species HCO/LCO F1/R1 Primers O/C G700/G701 Endosymbiont Label in COI tree tree site Linyphiidae Tenuiphantes tenuis 1 180 Ten_ten na FR Tenuiphantes tenuis 1 1 182 Ten_ten id FR Tenuiphantes tenuis 1 1 183 Ten_ten 183 Ten_ten FR Walckenaeria nudipalpis 1 1 147 Wal_nud 147 Wal_nud FR Lycosidae Alopecosa pulverulenta 1 1 112 Alo_pul 112 Alo_pul FR Alopecosa pulverulenta 1 140 Alo_pul na FR Arctosa lutetiana 1 222 Arc_lut na FR Aulonia albimana 1 110 Aul_alb na FR Pardosa agrestis 1 1 118 Par_agr 118 Par_agr FR Pardosa agrestis 1 = 118 Par_agr na GR Pardosa amentata 1 1 117 Par_ame 117 Par_ame FR Pardosa hortensis 1 na 227 Par_hor FR Pardosa hortensis 1 na 229 Par_hor FR Pardosa proxima 1 Wolbachia 216 Par_pro na GR Pardosa proxima 1 217 Par_pro na GR Pardosa proxima 1 = 217 Par_pro na FR Pardosa pullata 1 na 111 Par_pul FR Pirata uliginosus 1 1 129 Pir_uli 129 Pir_uli FR Pholcidae Pholcus phalangioides 1 1 Wolbachia = 129 Pir_uli 262 Pho_pha FR Pholcus phalangioides 1 Wolbachia 263 Pho_pha na FR Pholcus phalangioides 1 Wolbachia na 265 Pho_pha FR Pisauridae Pisaura mirabilis 1 114 Pis_mir na FR sp. 1 3 na FR sp. 1 4 na FR sp. 1 5 na FR sp. 1 6 na FR sp. 1 7 na FR Salticidae Marpissa muscosa 1 1 206 Mar_mus 206 Mar_mus FR COI mtDNA 28S rRNA Primers Primers Chel Primers Label in 28S Study Family Species HCO/LCO F1/R1 Primers O/C G700/G701 Endosymbiont Label in COI tree tree site Scytodidae Scytodes thoracica 1 1 120 Scy_tho 120 Scy_tho GR Tetragnathidae Pachygnatha clercki 1 1 139 Pac_cle 139 Pac_cle FR Pachygnatha clercki 1 = 139 Pac_cle na GR Pachygnatha degeeri 1 1 Cardinium 113 Pac_deg 113 Pac_deg FR Pachygnatha degeeri 1 1 Cardinium 174 Pac_deg 174 Pac_deg FR Pachygnatha degeeri 1 1 Cardinium = 174 Pac_deg 175 Pac_deg FR Tetragnatha montana 1 na 318 Tet_mon na GR sp. 1 8 na GR sp. 1 9 na GR Theridiidae Enoplognatha latimana 1 207 Eno_lat na GR Enoplognatha latimana 1 1 208 Eno_lat 208 Eno_lat GR Enoplognatha latimana 1 1 209 Eno_lat 209 Eno_lat GR Enoplognatha ovata 1 1 210 Eno_ova 210 Eno_ova GR Enoplognatha ovata 1 1 211 Eno_ova 211 Eno_ova GR Neottiura bimaculata 1 na 314 Neo_bim na GR Neottiura bimaculata 1 na = 314 Neo_bim na GR Neottiura bimaculata 1 na 317 Neo_bim na GR Neottiura bimaculata 1 1 102 Neo_bim 102 Neo_bim FR Theridion impressum 1 204 The_imp na FR Theridion impressum 1 1 205 The_imp 205 The_imp GR Thomisidae Misumena vatia 1 na 319 Mis_vat na BE Misumena vatia 1 na 320 Mis_vat na BE Misumena vatia 1 na = 320 Mis_vat na BE Misumena vatia 1 na 322 Mis_vat na BE Ozyptila simplex 1 na 138 Ozy_sim FR Xysticus cristatus 1 1 121 Xys_cri 121 Xys_cri FR Xysticus kochi 1 1 106 Xys_koc 106 Xys_koc FR sp. 1 10 na GR Zoridae Zora spinimana 1 1 130 Zor_spi 130 Zor_spi FR COI mtDNA 28S rRNA Primers Primers Chel Primers Label in 28S Study Family Species HCO/LCO F1/R1 Primers O/C G700/G701 Endosymbiont Label in COI tree tree site Test sample (from wasp nest) 1 na 11 na GR Test sample (from wasp nest) 1 na 12 na GR Test sample (from wasp nest) 1 na 13 na GR Test sample (from wasp nest) 1 na 14 na GR Test sample (from wasp nest) 1 na 15 na GR Test sample (from wasp nest) 1 na 16 na GR Test sample (from wasp nest) 1 na 17 na GR Test sample (from wasp nest) 1 na 18 na GR Test sample (from wasp nest) 1 na 19 na GR Test sample (from wasp nest) 1 na 20 na GR Test sample (from wasp nest) 1 na 21 na GR Test sample (from wasp nest) 1 na 22 na GR Test sample (from wasp nest) 1 na 23 na GR Test sample (from wasp nest) 1 na 24 na GR Test sample (from wasp nest) 1 na 25 na GR Test sample (from wasp nest) 1 na 26 na GR Test sample (from wasp nest) 1 na 27 na GR Test sample (from wasp nest) 1 na 28 na GR Test sample (from wasp nest) 1 na 29 na GR Legend: Study sites : FR = Fribourg; BE = Bern; GR = Grandcour; Gru = Gruyère PhD thesis – Odile Bruggisser Chapter 3 Page 88 PhD thesis – Odile Bruggisser Discussion and Outline DISCUSSION AND OUTLINE The global aim of this thesis was to prey and predator density. This could investigate spiders and their natural be achieved by the observation of the prey and predator species in agricul- system within cages. First, a clear tural landscapes to gain insight in the separation of the effect of prey and structure, dynamics and stability of predators may help to understand communities. Three investigations on whether the abundance of this spider different topics were performed, is more influenced by the availability which makes it difficult to draw a of prey or by the presence of the general synthesis. In the following I predator. Second, hornets also will discuss the three different consume Argiope’s prey, and are experiments separately and empha- thus both predators and competitors size new issues which can be raised of this spider. The dynamics of this by our results. “intraguild predation” system (Holt & Polis 1997) is worth being studied for 1) Bottom-up and top-down control its own. Finally, it would be interest- of Argiope bruennichi (Araneae: ing to see whether plants may Araneidae) in semi-natural ecosys- provide protection from predators. tems This could be tested by the manipula- With this study system we were able tion of different plant features within to demonstrate that the abundance of cages and by adding a predator. an intermediate predator, in our case the web-building spider Argiope 2) Trends in climate, land use and the bruennichi can be influenced by both dynamics of a ballooning spider bottom-up (plant and prey) and top- assemblage down (predator) effects. Furthermore, The main results of this study the observation of an indirect and showed that spider populations direct effect of plant diversity em- appear to be more at risk from the phasizes the importance of maintain- expected intensification of extreme ing plant biodiversity in agricultural climatic events and changes in land ecosystems, to preserve high densi- use than from gradually rising tem- ties of generalist predators for natural peratures. We were surprised to pest control. observe a shift in the phenology of Synthesis and perspectives the ballooning population within the In our experiment, only plant diversity relatively short period of eleven was manipulated. A better approach years. This indicates that the re- would be the manipulation of all sponse of different species to climate trophic levels in this system. By doing change may be faster evolving than so, we might have gained a more expected. precise view of the importance of the Synthesis and perspectives different factors affecting the abun- From the observation of ballooning dance of this spider species. In spiders collected at one study site further experiments, we should, for only, it is difficult to draw general example include the manipulation of conclusions. Furthermore, since Page 89 PhD thesis – Odile Bruggisser Discussion and Outline ballooning spider densities do not 1) the identification of species lacking one-to-one reflect spider population a clear morphological differentiation, densities, we are not able to predict like immature spiders and 2) the the precise relationship between better understanding of otherwise climate or habitat change and spider invisible trophic links in food webs by populations. It would therefore be the identification of species from prey interesting to concentrate on the remains. continuous collection of spiders 1) at Synthesis and perspectives different sites and 2) by the use of The established methods to track different trapping methods. This trophic links between the wasp would however imply a great sam- Trypoxylon figulus and its spider prey pling effort which is generally very will, in a next step, be used to fully costly. characterize the prey community of Further interesting questions, this wasp in our experimental sys- which could be addressed at this tem. Wasp females may collect dataset, are the investigation of different prey species in habitats interactions between different spider differing in plant structure and species. Since the response of diversity. Furthermore, plant diversity different species to changing climatic and structure may affect the parasi- conditions may not be the same, we toid community of the wasp larvae. would expect some species to The method established to identify become more abundant than others. spider species can be applied as well This may provoke an increase or for the identification of parasitoid decrease in competitive interactions species, which will allow gaining between species and hence lead to insight in the network of interactions changes in community composition. involving T. figulus larvae. Establish- Methods to investigate competition ing the barcodes for all (or the most between species in time-series exist common) species in our system (Ives et al. 2003), but not to detect would certainly be a breakthrough to changes in community structure with determine and quantify trophic time. We are currently exploring an interactions at the scale of the whole approach base on wavelet analyses food web. Currently, the lack of such (Cazelles et al. 2008), which yielded high-quality and quantitative data is a promising preliminary results. major hurdle for the development of food web models, a primary task in 3) Spider molecular barcode to track the face of current global change. trophic links in food webs In this study we use the trophic interaction between a wasp species REFERENCES and its spider prey to show the potential of molecular tools to track Cazelles B, Chavez M, Berteaux D, trophic links in food webs. Despite Ménard F, Vik JO, Jenouvrier S & criticism of the use of cytochrome Stenseth NC (2008) Wavelet analysis oxydase I for the identification of of ecological time series. Oecologia, species, our results highlight two 156, 287–304. decisive advantages of this method: Holt RD & Polis GA (1997) A theoretical Page 90 PhD thesis – Odile Bruggisser Discussion and Outline framework for interguild predation. community stability and ecological American Naturalist, 149, 745-764. interactions from time-series data. Ives AR, Dennis B, Cottingham KL & Ecological Monographs, 73, 301–330. Carpenter SR (2003) Estimating Page 91 PhD thesis – Odile Bruggisser Discussion and Outline Page 92 PhD thesis – Odile Bruggisser Acknowledgements ACKNOWLEDGEMENTS After four years of feeling like a farmer in the field, like a worker at the as- sembly line in the lab and like a beginner behind the analysis of my data- sets, I decided that I am experienced enough to finish my PhD career. All this would not have been possible without the help of many people to whom these last few words are dedicated. I would like to express my thanks to Louis-Félix Bersier who always took the time for all my questions, patiently explained me the statistics and allowed me to participate at conferences all over the world. With his affec- tion for coffee brakes he taught me to see work from the stress-free side. Thank you, Louis-Félix for the great time in your group, I really learned a lot and enjoyed almost every minute. Thanks to Alex Aebi for introducing me in the world of molecular techniques and his useful suggestions during writing the manuscript. Thanks also to Gilles Blandenier who kindly provided me the dataset on bal- looning spiders. Thank you, Gilles it was a great pleasure to work with you. Sincere thanks are given to Søren Toft for being the external referee fort this thesis. Sven Bacher for his critical comments and useful sugges- tions during the whole time of my thesis. Christian Lexer and Christoph Haag for their help in molecular questions. Christine Müller†, for the propo- sition to work with trap-nesting wasps and Matthias Albrecht and colleges of his group in Zürich for helping me with the dissection of the wasp nests. Russ Nasebit, for correcting the English and his valuable suggestions, Patrik Kehrli for the design of the study system and his useful comments. Jaques Studer and all farmers for the realisation of our project. Martin Schmidt and Wolfgang Nentwig for their help in spider questions. Special thanks are given to Lis und Hanspeter Bruggisser for their mental and financial support, Cecile Bruggisser for her mental support in any situation, Andi Perrin for his great support, patience and for listening. Vielen dank, ohne Euch, wäre ich nicht soweit gekommen! Philipp Arnold, Joelle Ast, Rolf Brechbühl, Marco Cattilaz, Thomas Clerc, Robin Collins, Catherine Cuennet, Yvonne Fabian, David Frei, Markus Gallus, Min Hahn, Cathy Haag-Liautard, Dorothea Lindtke, Anne-Catherine Pasche, Therese Plüss, Rudolf Rohr, Nilgün Sailer, Nadine Sandau, Till Sander, Barbara Walser, Alain Werro, Isabelle Zaugg, Renate Zindel… and all I forgot to mention. Thank you for your help in the field, with technical problems, in the lab, and for all the fruitful discussions about or not about science. Tank you all! Page 93 PhD thesis – Odile Bruggisser Acknowledgements Page 94 PhD thesis – Odile Bruggisser Curriculum vitae Curriculum vitae PERSONAL Name Bruggisser Odile Date of birth 30. 11. 1980 Present address 3014 Bern Greyerzstrasse 81 E-mail [email protected] Nationality Swiss Civil status single Language skills German (native language) French (very good knowledge in spelling and writing) English (very good knowledge in spelling and writing) Spanish (good knowledge in spelling and writing) EDUCATION 2006 – present PhD thesis: Understanding the structure of interactions and the dynamics of spider populations in agricultural ecosys- tems. Unit of Ecology and Evolution, University of Fribourg 2005 – 2006 Diploma-thesis: Effect of vineyard management on biodiversity at three trophic levels (plants, grasshoppers, spiders). Community Ecology, University of Bern 2004 – 2005 Exchange semester: Universidad Autonónoma Madrid, Spain 2001 – 2004 Undergraduate Studies: University of Bern, Switzerland. 1994 – 2001 High school: Deutsches Gymnasium Biel WORKSHOPS AND COURSES 2009 May Project Management in Research 2008 Feb-May Amphibienkurs: Feldherpetologischer Kurs (Karch) 2008 April Field Animal Experimentation - Practical Module 1 2007 Nov-Dec Scientific Writing Clinic 2007 Sep-Oct An Introduction to the Practice of Statistics Using R 2005 Jul Summer academy on Alp Flix, course of spider taxonomy and systematic Page 95 PhD thesis – Odile Bruggisser Curriculum vitae ACTIVITIES IN THE FIELD OF BIOLOGY 2009 “Journée de la Biodiversitée” en Parc naturel regional Gruyère Pays-d’Enhaut, Switzerland: animation of young pupils on the ecology of spiders 2008 “Geo Tag der Artenvielfalt” in the Parc Ela, Bergün, Switzerland. Expert in spider taxonomy 2007 “Geo Tag der Artenvielfalt” in the Sensegraben, Switzer- land. Expert in spider taxonomy PUBLICATIONS AND PRESENTATIONS Publications: Bruggisser OT, Schmidt-Entling MH, Bacher S (2010): Effects of vineyard management on biodiversity at three trophic levels. Biological conservation, 143, 1521-1528. Bruggisser O, Schmidt MH, Bacher S (2005): Effect of vineyard management on biodiversity at three trophic levels. Verhandlungen der Gesellschaft für Ökologie, Band 35, 173. Oral presentations: Bruggisser OT, Blandenier G, Bersier LF (2009) The role of plants in an Argiope bruennichi – prey system. 25th Euro- pean Congress of Arachnology (ECA), Alexandroupolis, Greece. (Third price for “best student’s talk”) Bruggisser OT, Blandenier G, Bersier LF (2008) Spider community dynamics and climate change. BES Annual Meeting 2008, Imperial College, London, England. Bruggisser OT, Blandenier G, Bersier LF (2007) Climate change increases the variability of spider dispersal dynamics ESA/SER Joint Meeting San Jose, USA. Bruggisser OT, Schmidt MH, Bacher S (2006) Effect of vineyard management on spider biodiversity in northern Switzerland. 23th European Congress of Arachnology (ECA), Sitges, Spain. Posters: Bruggisser OT, Blandenier G, Bersier LF (2009) Detecting shifts in competitive interactions in time series. Biology 09, Bern, Switzerland. Page 96