.. i.d

.i,:ia

'.Ia

14 'fi:A; 1.4

..:'i4 I

:lt&^ I

,rre

..,fiq

,t;4 1

,.d 'l Restriction map is defined as a physical map of DNA showing the relative ,,n 0tir-t^uu positions of restriction enzyme cleavage sites. To understandthe concept of restriction mapping, a clear description of restriction enzymes and the sites t,*x where they cut the DNA is needed. . to understand ia -.{ the concept of DNAdigestion RestrictionEnzymes (Endonucleases) ,"1 Many molecular genetic techniques are rooted in the abiiity to digest (also ' ]d e to understand how ,,"1 referred to as cutting or cleaving) DNA molecules in a specific and predict- ,'.d gel electrophorcsis able way. The key to this technoiogy is the discovery of restriction enzymes separatesdigested ,d or restriction endonucleases in bacteria. Speciesofbacteria make restriction DNA fragments enzymeswhich recognize palindromic (inverted repeats)nucleotide sequences 3 .t r to construct of DNA, called restriction sites, and cleave the DNA at those sites generating :ia a a 5/ phosphate a group the point cleavage. Restriction :d restric-tioh map with and 3/ hydroxyl at of ,;a data obtained from sites are usually 4,6, or 8 basepairs (bp) long. Restriction enzymesare named gel electrophoresis after the bacteria from which they are isolated. This is done with the first letter

.'d of the genus followed by the first two letters of the species.The lpe of strain or substrain sometimesfollows the speciesdesignation in the name. A Roman ,d numeral is always used to indicate whether the particular enz;We was the first

-d isolated,the second,the third, and so on. For example,the first enzyme that was isolated from the strain RY13 of the bacterivrn Escherichia coli (commonly ".d known as E. coli) is cailed EcoRl. Several hundred restriction enzymeshave ..4 been identified and isolated and are available commercially. Restriction enzymesare classifled as Type I and Type II, both types recogniz- .\t ing specific restriction sites.However, there is a major difference betweenthem.

1d Tlpe I restriction enzymesdigest the double-strandedDNA at random far from their restriction .1 sites,thus createindistinct restriction fragments.For this reason, Type I reshiction enzymeshave no practical value in molecular genetics.Type .d II restriction enzymescleave the double-strandedDNAwithin (or very close to) their reshiction sites producing discrete and predictable restriction fragments. This type of restriction enzymes is used in the laboratory for DNA analysis. s4 For example, EcoRi recognizesthe sequence5/GAATTC 3/ and makes a stag-

..4 gered cut producing sticky ends that have basepair overhangs(Fig. 3-1A). Or, the enzyme HaeIII recognizes the sequence5/GGCC 3/ and cuts both strands of the DNA between the same nucleotide pairs to produce blunt ends (Fig. '6r, -"4 3-18). By using the same restriction enzyme to cut the DNA from two differ- T. (A) (B) -"41 EcoRI HaelTl ,7 & 5' GAATTC 3' 5NGGCC 3' r, 3' crrAAaG 5' 3' ccacc 5' .4 f.6.91 , Generation of stag- gered (A) (B) i4. and blunt ends .a in pieces of DNA digested 'e., 5, c AATTC 3, 5, cc CC 3, 3, CTTAA G 5, 3, CC GG S' with EcoRl and Haelll, re- -.d Fi .& Staggeredends Bluntends position of cut. n -& F,a .:€ \E € ent species,complementary ends will be createdthat will restriction digests can be separatedby size, and on that r*t allow the DNA from the two speciesto stick together.Thus, basis,a restriction map of the original DNA canbe recon- recombinantDNA can be generated. stucted.Consider the following example. F It should be emphasizedthat bacteria,sown DNA is A 10-kb linear piece of DNA has beendigested once not digested € by the enzymesthey produce. This is because with Enzyme X, once with Enzyme y, and once with a a group of enzymes,called methylases, recognize the sites mixture of EnzyrnesX and Y (refened to as double diges- e that would be recognizedby the cell's restrictionenzymes tion). Then the reskiction fragmentsof eachreaction are p and adda methyl group (-CH") at thosesites on the newly separated,according to their molecular size, by agarose forming daughter strand. This methylation shields the gel electrophoresisfig. 31A). Also, a DNA ladder(see e bacterialDNA from recognitionby the cell,s own restric- Exercise2) hasbeen electrophoresed to estimatetl.e sizes tion en4nnes. e of the fragments.Since the size of the DNA fragmentsin Table3-l showsthe characteristicsof somecommonlv the ladderis known, the sizeof the fragmentsgenerated by e usedrestriction enzymes. EnzymeX, Y, or a combinationof both can be estimated. e As shownin Fig. 3-2A, when the 10-kbpiece of DNA is Constructionof RestrictionMaps cut with En4me X, a7 and3-kb DNA fragmentis gener- e The DNA pieces generated by the action of restriction ated.This indicatesthat thereis only onerestriction site for enzymesin a fragmentof e double-shandedDNA are called En4rme X in the lO-kb DNA fragment. Similarly, when restriction digests. By |' means of gel electrophoresis, the sameDNA is cut wittr En4rme Y, two bandsof sizesg \- and2 kb aregenerated. Here againthere is only onerestric- Tdtc 7-1, Characteristicsof some commonly used e tion site for Enz}rmeY. However,when the 10-kbDNA is restriction enzymes.Position of cut is shown by F arrowheads. digestedwith both en4fmes,tlree bands,5, 3, and2 kb in size,are generated (see Fig. 3-2A). Enzyme Source Sequence e recognized To constructthe restrictionmap of the DNA, the 3-kb Enrpe X site can be arbitrarily placed in one end of the e V DNA and Antltrobacter luteus 5' AGCT3' the 8-kbEnzyme Y sitein the sameend (see Fig. e 3'TCCA5' 3-28 and C). Cutting the DNA with both enzymes,three bandsofsizes 5, 3, and 2kb aregenerated. The resultson e the gel (see V Fig. 3-2A) show that the 2-kb fragmentfrom e Baci I lus arnyloI i quefaciens H 5'GGATCC3' En4rme Y digestion remains unaffected in the double 3',CCTAGC5' digest,whereas the 8-kb fragmentfrom the samedigestion e A hasbeen split into two bandsof 5 and3 kb. This resultindi- e

EcoRl Escherichia coli RY l3 5'CAATTC3' DNA [tr4,ms nnzymc Enzyms e 3'CTTAAC5' ladder X Y X+y A e

v e H aentop h i lus influenza Rd 5'AAGCTT3' t0 I 3'TTCCAA5' 6 II e A I F' 6 : I Ndel Neisseria denitrifi cans 5'CATATG3' e I 3'CTATAC5' II e

:II e Nocardia otitidis-caviarium 5, GCCGCCGC 3, ;" 3'CGCCGGCG5' A r e v '|i* Ps/l Providencia saartii 5'CTCCAG 3' 3'GACGTC 5' 3 P' B A EnzymeX 0_l t0 f V 8 Sacl Slrepl omyce s achro no gene s 5'GAGCTC3' C EnzymeY 01 t0 flsv 3'CTCGAG5' A 3 X 5 Y2 FF* D EnzymesX+Y O_l-- | E+. StreptomJ'c es caesp i I osu s 5'AGTACT]' 3'TCATGA5' t"5. 3-2, Gonstructionof a restriction map for two !!*" A hypotheticalEnzymes X and y. {*,:

* F. cates that there is a single Enzyme X site within the 8-kb A fragment from the Enzyrne Y cut. With this information in l' CCCGCCCCTGGU\5' hand, a restriction map can be constructed (Fig. 3-2D) by 5' CGCCG(;C(;ACCI l' superimposingFig. 3-2B on Fig. 3-2C. In actuality, construction of restriction maps (linear or circuiar) is more complicated than that discussed above. You need to practice several times with data obtained from different gels. Look at Study Questions 3-3 and 34, and construct a restriction map of each. RestrictionDigestion of lambdaDNA Phage lambda (\), which infects E. coli, has a double- .i:r.l -.J stranded DNA which is located in the core of the phage f^4.3-9. Diagram of the phage lambdaDNA molecule ,,r4 head. The DNAmolecule contains 48,502 bp that code for in linear (A) and circular (B) configuration. approximately 50 different phage proteins. The sequence :,;4 above, the two small fragments 564 and 125 bp in size run of nucleotides along the entire lambda genome is known off the gel. With a little effort you can identifu the size of .:;'lA (Sanger et a1., 1982). The lambda DNA molecule has 1 the fragments seen in Lane 3. As a hint, the heaviest band an rurusual structure, in which 12 base single-stranded is 21,226 bp and the lightest band is 831 bp. Lane 4 of Fig. a segmentsare found at the 5/ and 3/ termini of the phage 3-5A shows uncut larnbda DNA used as a control. The size ,tr1 DNA molecule (Fig. 3-3A). These segmentsare self-com- of this fragmentis 48,502bp. plementary, called cos ends. Thus, by forming base pairs ,t\ between the two segments,the linear DNA will circularize 'c1 (Fig. 3-3B). The tambda genome is linear in the phage but Tips on Restriction ,"4 circular in the host. DigestionReactions The 48,502-bp lambda DNA, used in this exercise,was 1, DNA ',,1 isolated from the bacteriophage lambda and is commercialiy The DNA used for reshiction digestion must be prue and available. It is linear and contains five recognition sites for the ,11 fiee of contaminants such as EDTA, ethanol, and phenoi, enzymeEcoRl and seven for the enzyme HindIII (Fig. 3-a). which are used to extract andlor puriff DNA. \ In this exercise,you will digest lambda DNA once with :;4 EcoR7,once with HindIII, and once with a mixhue of both 2. RestrictionEnzyme enzymes(double digestion).You will also use uncut lambda The general rule is that the amount of the enzyme used .tA .J DNA as control. Then, you will load the DNA samplesinto should not exceed 10% of the total volume of the reaction. -A wells of an agarosegel to separatethe digested fragments If an excess of enzyme is used, the length of incubation J by electrophoresis. should be decreased(see also the Incubation Time, below). t.\ Figrire 3-5 depicts the restriction digest of the lambda Altematively, if a smaller amount of enzyme is used, the ;rE'l DNA. As seen in Lane 1 (from left), incubation time should be increased.Restriction enzymes ,d only five of the six should always be stored in a freezer.During the laboratory '.4\ fragments generatedby EcoRI (see Fig. 3-4B) are detect- -J able on the gei. This is due to the fact that the 5643- and work, they can be kept on ice or in a benchtop cooler for a ,,.4 limited amount of time. .J the 5804-bp fragments overlap on the gel appearing as a t:t\ single band (see Band Number 3 from top). "J Furthermore, in Lane 2, only six of the pos- 2 sible eight fragments generated by the enzyme lambd.a o 10,000 20,000 30,000 40,000 48,502bp HindIII are visible (compare Fig. 3-4C with AI I I I .a 3-5A, Lane 2). This is becausethe 564- and the ri .4 125-bp fragments usually run off the gel when EcoR.l 21,226 26,104 31;147 39,16E 4,l,972 48,502 bp rn preparedin a 0.8 to 1oloconcentration. Lane 3 of B .t Fig. 3-5A shows the DNA fragments generated 4 by digestion of lambda DNA with a mixture of Frdgmcnt 21.226 4-873 5.643 7-421 5,804 3.530 stze 4 the enzymes EcoRI and HindllI. The size of the .^4 fragments can be predicted by superimposing 25,157 37,459 HindlII n Fig. 3-48 on Fig. 3-4C. As a result, 13 o _.d frag- C q ments will be generated (try to identify these -"d fiagments), 10 of which wili be visible on the * gel (see Fragrrenl 23.130 2,027 2,322 9,416 5g t25 6.557 4,36r ;c Fig. 3-5A, Lane 3). This is becausethe sl7,c ft two fragments of size 5148 and 4973bp overlap ,4 and appearas a single thick band on the gel (see t^4.3-4. (A)The linearmap of the phagelambda DNA. Arrows * .E Band Number 2 from the top) and, as mentioned show the recognitionsites for EcoRl (B)and Hindlll (C) enzymes. #.1 ,a4 ,a;G F, E* F'€*{ 7. DoubleDigestion F bp Doubledigestion is a commonproce- e F 12,216 dure in restriction digestion, during 't which a pieceof DNA is digestedby 1,199 two enzymesat the same time (see, e 10,180 e.g. Fig. 3-5A). 9,162 In double digestion, e 8,144 it is essentialto choosea buffer that e 7,126 ensuresthe most activity for both 6,108 en4lmes. Furthermore, if BSA is F 5,090 requiredfor eitherenzyme, it mustbe 4,072 adddedto the doubledigestion reac- e 3,054 tion. BSA will not inhibit the activity e 2,036 of the enzymethat doesnot require e 1,636 it. A completelist of suggestedbuf- fers for double digestion can be e 1,018 found in the TechnicalReference of f,. the New England Biolabs Catalog, 2002-2003(or newereditions) (New e 506-517 EngladBiolabs, Ipswich, MA). In the a case that 396 no single buffer is found for a double digestion reaction, the e 344 digestionmust be donesequentially. e 298 First, the reaction is digestedwith 220 one enzyme + buffer combination, a 201 then the digestedreaction is frrrther e digestedwith the secondenzyme + f:t.3-5.(A) Restrictiondigest of the phagelambda DNA and (B)the 1-kb buffer combination.Seek advice from e DNA ladder.Note that {A)and (B) are not to the same scale. the laboratoryinstructor for choosing e a buffer for doubledigestion. 3. Buffer e Materials To ensure optimal activity, restriction enzymesare used Phagelambda DNA, e with appropriatebuffers. The manufachrersprovide concentration100 nglpl a buf- BcoRI fer with eachrestriction e enzyme.Some restriction en4trnes, EcoRIbuffert in additionto a buffer, requirebovine serumalbumin (BSA) HindIlI e for optimal activify. The BSA is usually suppliedby the Hindlll buffert manufacfurersat 100x concentration.It mustbe dilutedto I x TBE (Tris*Borate-EDTA) buffer, to be usedfor electrophore- e) 10x in distilledwater before use. sisand preparing the gel: € Perl000mLofdH"O 4. IncubationTemperature 54 g Tris e The incubation temperaturefor most restriction enzymes 27.5 gBoic acid e is 37'C. However, consult manufacturer,srecommenda- 20 mL 0.5MEDTA, pH 8.0 tion beforeincubating reactions. An i:rcubatoror waterbath, This is 5 x TBE and is usedas a stock; the working solu- adjustedto 37"C, canboth be usedfor restrictiondieestion. tion is 1x TBE, i.e., 1 part stock+ 4 partsdH"O. To prepare0.5 MEDTA seeExercise 2. ei 5. IncubationTime DNA ladder,as describedin Exercise2 e' Incubation time varies dependingon the amount of the dIIrO Agarose enrqe used(see also RestrictionEnzyme, above) and the e: Gel-loadingdye, as described in soluceof theDNA employed.Usually a 45-min Exercise2 to l-h incu- Ethidium bromide e' bation solution,as describedin Exercise2 is sufficient to digest viral or bacterial DNA under Ice optimal conditions, whereaseukaryotic €", DNA requires an Agarosegel electrophoresisunit, as describedin Exercise2 overnightincubation. Microwave oven F$ 200 mL flasks 6. Oder of Preparation of Digestion Reactions Microtubes,0.6mL * In preparingdigestion reactions, it is extemely important Microtube racks Ft to add the solutionsin the following order: distilled water, Microcentrifuge buffer, BSA (if required),DNA, and enzyme.The reaction Micropipettors must be thoroughlymixed prior to incubationto achievea t!*-- completedigestion. T Note: ManuJacturers provide enzymes with appropriate buffers; consuit manufacturers' recommendafi on. F:

p**.

*t 7 .., :i-g

,.::q Tips 10.Estimate the size of the bands in Lanes 2 to 5 by the : 37oCincubator help of the DNA ladder in Lane I . Gel stainingdishes, as needed 11.Fill in the Table shown below: ,.1 Gloves W protectiveglasses or shields Fragment sizes ''1 Agarosegel photodocumentation system, as described in Exercise2 Lane 1 Lane2 Lane3 Lane 4 Lane 5 .,"4 -nrd Procedure

l 1. Placefow 0.6-mLmicrotubes on ice and label them E fi{' (for EcoRI), H (for HindIII), EH (for Ec oRI + HindIlI), l andNO (forno enryrmecontrol). 2. Set up digestion reactions in the order shown below:

-:.J Tube E TubeH pL pL 1q ffiro 13 dHro IJ EcoRI buffer 2 .IlindIII er ,* !t bu 2 12.Compare your gel with the sample gel shown in Fig.3-5. LambdaDNA 3 LambdaDNA 3 .t:4 EcoRI 2 HindlIl 2 W A"o,f;*^4 TubeEH .11t TubeNO 3-1. kr the representationof the piece of DNA shownbelow, ffiro IJ dHro t5 find and name restriction enryme recognition sites. j1!' ScoRI buffert I EcoRI buffer 2 LambdaDNA 3 LambdaDNA 3 5/AATCTCCTATACGCCGATCCTGAOCCTATCCCAOCTCCATAGTAICAGTACTGCCT 3/ ,,.nt EcoRI t 3/ TTAGACGATA-TCCGCCTAOCACTCGCATACGCTCCACCIA*ICATACTCATGACCGA 5 / HindIlT I

f Note that in the double digest (Tube EH) the EcoRI digestion buffer is used.

J. Tap the bottom of the tubes with a finger to mix the reagents,then centrifuge briefly (about 5 s). 4. Digest the DNAby placing the tubes ina37"C incuba- tor for 45 min. Note: Limiting the time of incubation will result in 3-2. What is partial digestion and how does it occur? partial digestion of the DNA; that is, only a portion of the available restriction sites will actually be cut with the enzyme. This also can occru when sufficient amount of enzyme is not used. During the incubation time, prepare a 0.8% (w/v) aga- 2 rose gel with I x TBE buffer, and setup the electropho- ,? resis unit as describedin Exercise 2. 5. After 45 min, remove the tubes from the incubator, add ; 5 pL of gel-loading dye to each tube, and mix well by 3-3. A 10-kb linear DNA fragment was digestedonce pipetting ? up and down. with EnzymeA, once with En4rme B, and once with 6. Briefly centrifuge the tubes to push the contentsto the Enzyme C. The following fragments were obtained. a? bottom of the tubes. Load the gel as indicated below. EnzymeA:2 kb EnzymeB: 0.6kb EnzymeC: 3 kb ? 8kb 9.4kb 7kb ? WellNo. Samole Restriction enzymedigests using two enzl'mes in I ? 3 ;lL of DNA ladder combination produced the following fragments. 2 10pL ofthe contentoftube E 3 '? 10pL ofthe contentoftube H EnzrlmeA+B:0.6kb EnzymeA+C:2kb EnzymeB+C:0.6kb ^ ; 10pL ofthe contentoftube EH 1.4kb 3kb 3kb 5 8kb 5kb 6.4kb 3 10pll, of the contentof fubeNO a 8. Electrophorese at 90 V for about 45 min. You Construct the reskiction map of the DNA. may shorten the electrophoresis time by choosing B *{ a higher vohage; seek advice from the iaboratory F instructor. 9. View the DNA bands on a IJV transiiluminator and P photograph the gel. 3 4 # P'{; 6; 3*4. When a circular piece of DNA is subjectedto diges- e.' tion with restriction en4/rnes, fragments with the following sizes are produced. F.

EcoRI:21kb BamHI:6,4kb Hindlll:2lkb E 14.6kb P' + Ec oRI Hintlm : 3.8kb EcoRI+ B amLII:1.2 kb BamHI + Iltndltr: 2.6 kb ; t7.2kb 6.4kb 3.8kb I3.4kb 14.6kb 7 Constructthe restrictionmap of the DNA. a F. t F_ t 3-5. Below is a picture representing a25-kb piece of ft DNA. What size fragmentswouidyou expect after digesting the DNAwith each of fhe enzymesor com- z bination of the enzymeslisted below? r*-

P E: F._ B: lr_ H: t B+H 1. E+H F* P- t e F'

D

;

F F

7 F. ?

7' t!'' F-'

ad. t

F:

trr"

F.

6- *,.