INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, sorne thesis and dissertation copies are in tyPewriter face, while others may be tram any type of comPUter printer.
Th. qu.11ty of thla reproduction la dependent upon the quallty of th. capy submltted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough. substandard margins, and improper alignment can adversely affect reproduction. ln the unlikely event that the author did not send UMI a complete manuscript and there are missing pages. these will be noted. Also. if unauthorized copyright material had ta be removect, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by S8Ctioning the original, beginning at the upper left·hand corner and cantinuing from left to right in equal sections with smaU overlaps.
ProQuest Information and Leaming 300 North Zeeb Raad. Ann Arbor. MI 48106-1346 USA 800-521-0600
• Enzyme substitution tberapy for hyperphenylalaninemia with phenylalanine ammonia Iyase. An alternative to low phenylalanine dietary treatment; effective in mouse models.
By Cbristineh N. Sarkissian
Depanment of Biology McGill University, Montreal
November 2000
A thesis submitted to the Faculty ofGraduale Studies and Research in partial fulfillment of the requirements of the degree of Doctor of Pbüosophy
@ Cbristineb N. Sarkissian (2000) • National LInIy I~I dCaMda =:::::rllïces 311 "''''''1111" 8tre.t a.-ON K1AON' CIMdI
The autbor bas granted a DOD L'auteur a accordé une licence non exclusive licence aIlowiDg the exclusive permeuaat à la Natioual Lihrary ofCanada to Bibüothèque Datiouale du Canada de reproduce, 1081l, distnbute or sen reproduire, pdter, distnbuer ou copies oftbis tbesis in microfOl'lD, YeDdre des copies de cette thèse sous pape!' or electronic formats. la forme de microfiche/film, de reproduction sur papier ou sur fonDat électrODique.
The autbor retaiDs ownersbip ofthe L'auteur conserve la propriété du copyright intbis thesïs. Neidathe droit d'auteur qui protège cette thèse. thesis DOt substantiaJ extracts ftom it Ni la thèse Di des eXbaits substantiels may be printed or otherwise de cene-ci ne doivent être imprimés reproduced witbout the author's ou autrement reproduits saDS son permission. autorisation.
0-612-70148-4 •
To Mum and Dad who gave up ail Iheir comfons and moved Ihree continents, 10 provide us wilh every opponunity to be ail lha! we wanted 10 be.
• • TABLE OF CONTENTS
TABLE OF CONTENTS 1 ABSTRACT IV RÉSUMÉ VI ABBREVIATIONS VIn LIST OF TABLES AND ftGURES X PREFACE XIII ACKNOWLEDGEMENTS XV CONTRIBUTIONS OF AUTHORS XIX
CIIAPI'ER 1: introduction 1 Discovery of PKU 2 Defining Hyperphenylalaninemia 2 The Phenylalanine Hydroxylase Gene 3 Mutations Associated with PAH Deficiency 4 PAR Expression S The PAH Polypeptide and Enzyme 6 Phenylalanine Homeostasis 8 Treatment Outeome 9 Brain Pathogenesis 10 The Challenge of Maternai HPA 13 Relevance of Animal Models 14 Phenylalanine Transamioation Metabolites 19 Treatment 21 Treatment Difficu1ties and Otber Associated Drawbacks 23 Non-Diet TreabDent Options 26 Treatment by Liver Transplants 26 Gene Therapy 26 Tetrahydrobiopterin-Responsive HPA Therapy 27 Enzyme Therapy 28 PAR Enzyme Replaœment 28 Enzyme Substitution Therapy wim 28 Phenylalanine Ammonia Lyase Route of PAL Administntion 30 ProposaI 33 References 37
CONNECI1NG TEXT 66 • 1 CIIAPI'ER 2: A heteroaUeUe mutant mouse model: A new 67 orthologue for human hyperphenylalanlnemia • Abstract 68 Introduction 69 Materials and Methods 70 Results 74 Discussion 76 Acknowledgements 77 References 85
CONNECTING TEXT 89
CIIAPI'ER 3: Measurement of phenyUactate, pheaylaeetate and 90 phenylpyruvate by negative ion cbemical ionizadon - lU chromatography/mass spedrometry in brain of mouse genette models of pheoylketonuria and non- pbenylketODuria hyperphenyl8181Jinemia Abstract 91 Introduction 92 Materials and Methods 93 Results and Discussion 96 Acknowledgements 99 References 109
CONNECTING TEXT 111
CBAPTER 4: A dUferent approach to treatment of phenylketonuria: 112 Phenylalanine degnulation with recombinant phenylalanine ammoaia lyase Abstract 113 Introduction 114 Materials and Methods 115 Results 121 Discussion 122 Acknowledgements 125 References 133
CIIAPI'ER 5: Discussion 139 The Heteroallelic Mouse 140 Metabolic Manipulation 142 Pah Enzyme Activity 142 PAR Enzyme Stability 143 Measuring Bebavior 144 • 0 Reproductive Problems 144 Phenylalanine Metabolites 145 • Logic and Role of Low Phenylalanine Diet 147 PAL Protection and Use as an Alternative to Diet Therapy 148 Future Aims 152 References 154
CLAIMS TO ORIGINALITY 162
APPENDIXA 165
APPENDIXB 173
APPENDIXC 182
APPENDIXD 189
APPENDIXE 193
• m ABSTRACT • Phenylketonuria (PKU) and related forms of oon-PKU hyperphenylalaninemias (HPA) result from deficiencies in phenylalanine hydroxylase (PAH), the hepatic enzyme that catalyses the conversion of phenylalanine (phe) to tyrosine (tyr). Patients are cbaracterised by a metabolic phenotype comprising elevated levels of phe and some of its Metabolites, notably phenyUactate (pLA), phenylacetate (PAA) and phenylpynavate (PPA), in both tissue and body fluids. Treatment from binh witb low-phe diet largely prevents the severe mental retardation that is its major consequence. Mecbanisms underlying the patbophysiology of PKU are still Dot fully understood; to this end, the availability of an onbologous animal model is relevant. A number of N-ethyl-N-nitrosourea (ENV) mutagenized mouse strains bave become available. 1 repon a new heteoraUelic strain, developed by crossing female ENUI (with mUd non-PKU HPA) with a male ENU2/ + carrier ofa 'severe' PKU-causing allele. 1 descnlJe the new bybrid ENUl/2 strain and compare it witb control (BTBRIPas), ENUl, ENU2 and the beterozygous counterparts. The ENUl, ENUl/2 and ENU2 strains display mild, moderate and severe phenotypes, respectively, relative to the control and beterozygous counterparts. 1 descnlJe a DOvel merbod using negative ion chemical ionization gas chromatography/mass spectrometry (NICI-GC/MS) to measure the concentration of PLA, PAA and PPA in the brain of normal and mutant mice. Although elevated
moderately in HPA and more 50 in PKU mice, concentrations of these Metabolites are not sufficient to explain impaired brain function; however phe is present in brain al levels associated with barm. Finally, 1 describe a new modality for treatment of HPA, compatible with better human compliance: it involves enzyme substibltion wim non-absorbable 8Dd proteeted phenylalanine ammonia Iyase (PAL) in the intestiDal lumen, to conven
L-phenylalanine ta the barmless metabolites (trans-einnamic acid and trace • IV ammonia). PAL, taken orally, substitutes for the deficient PAR enzyme and • depletes body pools of excess phe. 1 describe an efficient recombinant approach to produce PAL enzyme. 1 also provide proofs of both pharmacologic and physiologic principles by testing PAL in the onhologous mutant mouse strains with HPA. The till(lings encourage further development of PAL for oral use as an ancillary treabDent ofhumao PKU.
• v RÉSUMÉ • La phénylcétonurie (PCU) et autres formes d'hyperphénylalaninémies (HPA) résultent du malfonctionnement de la pbénylalanine hydroxylase (PAH), l'enzyme bépatique catalysant la conversion de la pbénylalanine (phe) en tyrosine (tyr). Les patients atteints de PeU présentent dans leurs tissues et leurs liquides corporels des niveaux élevés de pbe et certains métabolites, notamment la phényUactate (PLA), la phénylacétate (PAA) et la pbénylpyruvate (PPA). Une diète (à la naissance) à faible teneur en pbe prévient grandement le retard mental sévère, caractéristique de la PCU. Les mécanismes impliqués dans la physiopathologie ne sont pas entièrement compris; c'est pourquoi un modèle animal onhologue est nécessaire. fi existe les soucbes de souris ENUI (avec légère HPA) et ENU2 (avec PCU) obtenues par mutation induite à la N-etbyl-N-nitrourée (ENU). Je décris maintenant une nouveUe souche bétéroallélique, ENUl/2 (ENU19 x ENU21 +0), et compare cette souche avec les contrôles (BTBRIPas), ENUl, ENU2 et leurs hétérozygotes respectifs. Les phénotypes sont: ENUI Oéger), ENUl/2 (modéré), ENU2 (sévère), lorsque comparé aux con~les et bétérozygotes. Je décris une nouvelle méthode utilisant la chromatographie gazeuse d'ionisation chimique d'ions négatifs couplée à la spectrométrie de masse (NICI GCIMS) pour mesurer la concentration de PLA, PAA et PPA dans le cerveau de souris. Même si les niveaux sont élevés dans la souris HPA Oégèrement) et PeU (beaucoup), la concentration de ces métabolites est insuffisante pour expliquer le malfonctionnement du cerveau. Cependant, la quantité de pbe est suffisante pour causer certains dommages. Finalement, je décris un nouveau mode de traitement de HPA qui est compatible avec un usage chez l'humain. Ceci implique la substitution d'enzyme avec la Iyase phenylalanine ammoniaque (LPA) protégée (non-absorbable) dans le lumen intestinale. Ceci permet de convenir la L-pbenylalanine en métabolites • VI inoffensifs (l'acide trans-cjnnamique et des traces d'ammoniaque). La LPA, prise • oralement, peut se substituer à l'enzyme déficiente PAH et éliminer l'excès de phe corporel. Je décris une approche recombinante efficace pour produire l'enzyme PAL. Aussi, je fournis des preuves aux niveaux pharmacologique et physiologique en testant PAL chez les souches de souris mutantes orthologues avec HPA. Ces découvenes encouragent le développement de PAL pris oralement comme traitement auxiliaire de la PeU chez l'humain.
• vu ABBREVIATIONS • ACRS amplification created recognition site ANOVA analysis of variance BBB blood-brain barrier BIL tetrahydrobiopterin bp base pairs BSA bovine serum a1bumin BTBRIPas genetic background of ENU treated mouse models cDNA complemenrary deoxyribonucleic acid CGDN Canadian Genetic Diseases Network CLEC cross-linked enzyme crystals CNS central nervous system CSF cerebrospinal fluid Da dalton DRPR dihydropteridine reductase DNA deoxyribonucleic acid ENU N--ethyl-N-nitrosoucea, a chemical mutagen ENUI paJf"'"ll mouse; mutant ortbologue ofhuman non-PKU HPA ENUI/+ heterozygous counterpart to paJf"'"11 mouse ENUI/2 paJf"'"12 heteroallelic mouse; onhologue of human non-PKU HPA ENU2 p~ lDOuse; mutant onhologue ofhuman PKU ENU2/+ heterozygous counterpatt to paJfNû'2 mouse ENU3 paJf"'ÙIJ mouse; another mutant orthologue of human PKU GCIMS gas cbromatography/mass spectrometry GFAP glial fibrillary acid protein GI gastro-intestinal GTP-eH guanosine triphosphate cyclobydrolase BAL histidine ammonia lyase BPA byperpbenylalaninemia BPLC high performance liquid chromatograpby IFNG interferon, immune gene I.p. intraperitoneal IQ intelligence quotient IR infrared 6-MPIL 6-methyltetrahydropterin MBTFA N-methyl-bis-tritluoroacetamide MRC Medical Research councü (Canada) MRI magnetic resoDaDœ imaging mRNA messenger noonucleic &Cid MRS magnetic resonanœ spectroscopy • VIn III'Z mass/cbarge NlCI negative ion chemical ionization • non-PKUBPA non-phenylketonuria byperphenylalaninemia 00 optical deDSity PAA phenylacetic acid PAAds deuterium labeled PAA internai standard • IX • LIST OF TABLES AND FIGURES CIIAFI'ER 1: Page Fig. 1 Major inputs and nmouts of free L-phenylalanine in buman 3S Metabolism Fig. 2 Schematic representation of PAL enzyme proteeted from 36 degradation for passage tbrough the GI tract CIIAFI'ER 2: Table 1 Matemal effect on number and size of litters and survival 78 to weaning Table 2 Bebavioral assessment 79 Fig. 1 Plasma and brain phenylalanine concentrations of control 9 80 non-PKU HPA and PKU mouse models and their beterozygous cOUDterparts Fig. 2 Plasma phenylalanine clearance rates of ENUI 9 ENUI/2 81 and ENU2 animais loaded with a standard dose of phenylalanine Fig. 3 Pah enzyme activity vs. plasma phenylalanine values of 82 control9 non-PKU HPA and PKU mouse models and their heterozygous counterpans Fig. 4 Westem blot from Pah protein in liver extracts of control, 83 non-PKU HPA and PIeU mouse models and their heterozygous COUDterparts Fig. S Classic mouse models of PKU and non-PIeU HPA, induced 84 by N-etbyl-N-nitrosourea • x CHAPrER3: • Table 1 Relationsbip between brain phe Metabolites and plasma 100 phenylalanine levels in three phenotypes Table 2 Relationsbip between plasma and brain phenylalanine 101 values in three mouse madels Fig. 1 NlCI mass spectra obtained for the PFB derivatives of 102 unIabeled PAA and PAAd5 Fig. 2 NICI mass spectra obtained for the PFB derivatives of the 103 TFA esters of unlabeled PLA, PLAd. and PLAdJ Fig. 3 SIM chromatograms for a calibrating mixture containing 104 unIabeled PAA, internais standard PAAd5 and unlabeled PLA Fig. 4 Calibrating curves, showing linear responses for PLA, 105 PPA and PAA, over physiological ranges Fig. 5 SIM chromatograms obtained for phenylalanine metabolites 106 in the brain of a normal mouse Fig. 6 SIM chromatograms obtained for phenylalanine metabolites 107 in the brain of an ENUI mouse Fig. 7 SIM chromatograms obtained for phenylalanine Metabolites 108 in the brain of an ENU2 mouse CBAPrER4: Table 1 Change in phenylalanine content in vitro solutions under 126 various treabDents Fig. 1 PAL gene from yeast R. toru/oide, cloned in the expression 127 vector pIBX-7 Fig. 2 Purified PAL enzyme separated on a SDSIPAGE 128 Fig. 3 The dose response effect of intraperitoneal PAL on plasma 129 phenylalanine levels • XI • Fig. 4 Effect ofan intraperitoneal injection ofPAL over 24 hours 130 Fig. 5 ln vivo phenylalanine degradation by induced recombinant 131 Don-pathogenic E. coli eeUs expressing PAL Fig. 6 ln vivo phenylalanine degradation by oral administration of 132 PAL with protease iDhibitor aprotinin • XII PREFACE • Format of the Thesis This thesis is composed of tbree cbapters (2 - 4) of scientific experimentation and analyses, aU of which are manuscripts that bave been published. The format is in accordance with the regulations stated in the "Guidelines for Submitting a Doctoral Thesis", which reads as follows: "Guidelines for Thesis Preparation: (C) MANUSCRIPr-BA8ED TBESIS Candidates bave the option of including, as part of the thesis, the text of one or more papers submitted, or 10 be submitted, for publication, or the clearly duplicated text (not the reprints) of one or more published papers. These texts must conform to the "Guidelines for Thesis Preparation" with respect to font size, line spacing and margin sizes and must be bound together as an integral pan of the thesis. (Reprints of published papers can be included in the appendices at the end of the thesis.) The thesis must be more tban a collection of manuscripts. Ali components must he integrated into a cohesive unit with a logical progression from one cbapter to the next. In order to ensure that the thesis bas continuity, connecting texts that provide logical bridges between the different Papers are mandatory. The thesis must conform to a11 other requirements of the "Guidelines for Thesis Preparation" in addition to the manuscripts. The thesis must include the following: (a) a table of contents; (b) an abstract in English and French; (c) an introduction which clearly states the rational and objectives of the research; (d) a comprehensive review of the literature (in addition ta tbat covered in the introduction to cach paper); (e) a final conclusion and summary. As manuscripts for publication are frequendy very concise documents, where appropriate, additional material must he provided (e.g., in appendices) in sufficient detail ta aUow a clear and precise judgement ta be made of the importance and originality of the research reponed in the thesis. ln general, wben co-autbored papers are included in a tbesis the candidate must bave made a substantial contribution ta a11 papers included in the thesis. In addition, the candidate is required ta make an explicit statement in the thesis as ta who contnbuted 10 50ch wort and ta wbat extent. This statement should appear in a single section entided" Contnbutions ofAuthors" as a preface ta the thesis. The • xm supervisor must attest to the ac:curacy of tbis statement at the doctoral oral defense. Since the task of the examiners is made more difticult in these cases, il • is in the candidate'5 interest ta clearly specify the responsibilities of aU the autbors of the co-authored papen. When previously published copyright material is presented in a thesis, the candidate must obraïn, if necessary, signed waivers from the co-autbors and publishers and submit these to the Tbesis Office with the final deposition." Thus, this thesis is submitted in the form of manuscripts, with slight modifications needed to meet the requirements for a uniform presentation. • XIV ACKNOWLEDGEMENTS • 1 bave bad some extraordinary times at McGill, filled with science, life and personal growth. However, the experiences would bave bad no meaning witbout the sbaring. This 1 did with sorne remarkable people, to wbom 1 am forever grateful. To my supervisor, Dr. Charles Scriver, for deciding (one more lime) not to call it quits and for takiDg me on as your 'Iast graduate student'. l'm grateful for al! your belp, for exposing me ta a world tbat 1 would bave otherwise not known, for giving importance to every stage of this project and for encouraging me to transform the seemingly impossible inta reality. 1 will always admire you for your all-embracing view of life and will accord you the status you've wanted, that of an "honorary mouse". To Zipper Scriver, Dr. Scriver's lovely wife, who graciously relinquished endless hours of bome lime, dedicated to my success. To Dr. Orval Mamer who spent exhaustive hours teaching me about OC/MS. 1 am grateful for all your help, your infectious enthusiasm and for reminding me tbat an investigator's 'tirst graduate student' inspires herlhim to solve the world's problems whereas the 'Iast graduate student' is responsible for berlhis retirement. To the other members of my supervisory committee, Dr. Rima Rozen and Dr. Thomas Chang, who endured a nomber of committee meetings. Ta my good friend and colleague Danielle Boulais who spent endless hours helping me with my experiments. 1 am grateful for your attention 10 detail, for your dedication, coming in for those 6:00 a.m. experïmenrs tbat at limes lasted until 12:00 a.m. and your endless generosity. Thank you for the laughter - Your Student! To the mEX team: Dr. Rongsheng Su, Dr. Zhongqi Sbao, Dr. Roben Reft, Françoise Blain, Rosalie Peevers, Marc Pedneault, Pamela Danagher, Dr. King Lee and Dr. Achim Recktenwald. Thank you for a1I your bard work and dedication and for not stopping wben the prospects appeared grime To Dr. David McDonald, for ail your help and advice with the development of the heteroallelic mouse modela • xv Ta Beverly Akerman, for your teehnical help and for your brilliant sense of humor tbat tolerated mine - you kept me going. • To Dr. Paula Waters, for teebnical advice and for your effective review of my various manuscripts. Ta David Côté - you bave the patience ofa saint. 1 can't tbank you enougb for ail your belp with my various computer-related crises. To Yves Sabbagb and Josée Manel, for translating my tbesis abstract and for your friendsbip. Ta Dr. Eileen Treacy, who supported me tbrougbout my years here. Thanks for your endIess generosity and for introducing me 10 the Irish culture in Montreal. Ta Dr. Vazken Der Kaloustian, for your support and encouragement. Ta Dr. Laurent Beek, who gh-ed every r in the English language. l'm grateful for your suppon, your tecbnical advice and most of ail, for the laughter we shared. To Lynne Prevost and Huguette Rizziero. What would Iife bave been Like without you. Thanks for ail your help, and for making me feel like one of the family. Ta George Kritikos, for teacbing me about the direct relationship between laughter and healtb. Tbank you for saving me from crazy neigbbors, for coming to my rescue wben 1 called, for sboveling me out and then back ioto major snow banks, for our great drives on the laleeshore, the trips 10 Ottawa, Toronto, New York and Vermont and those late nigbt backgammon games. To Aniceta Capua, boy you were a tougb nut 10 crack. Thanks for ail your suppon and for taking me on that fateful trip to Rivière du Loup. To other members of our lab, Georgia Kalavritinos, Margaret Fuller, Karan Manbas, Paulo Cordeiro, Emmanuelle Denis, Sbannon Ryan, Keo Phommarinb, SiDa Yale, Sipbala Yale, Gail Dunbar, Ping Zhao and Angéline Boulay. Tbank you for ail your help. To the various associations tbat funded my stay at McGill: The McGilI University-Montreal Cbildren's Hospital Research Institute, the Garrod Association (Canada) and the Auxiliary (Montreal Children's Hospital). • XVI To Mrs. Shirley Forde and Dr. David Logan, my teacbers and mentors, for taking an active interest in my life and providing me wim continuous guidance, • advice and encouragement. Ta tbese strong and incredible individuals: My childhood friends - Karineb Babayan, Armin Maniros, Melinda Amirkhanian, Dr. Naïri Kassabian, PearJamina Jerome, my late friend Karin Hacobian, Katrin Faridani, Dr. Jacqueline Faridani, Karen Anlan, Mona Steitieb, Evelyne Gbaribian, Nickol Lymbenos, Celine Gbaribian and Razmik Nevasanian. My friends from my undergraduate yean - Dr. Andreas Plaitis, Joandice Tigley, Meryl McKay, Dr. Lydia Lee, Liana Heaney, Cheryl Colman and Janice Hylton. My friends from Montreal - Zoi Kilakos, Kyria KiIakos, Maria Kilaos, Evelyne Budkewitseb, Heatber K1eb, Dr. Tina Manino, Kelly Rotbney, Stacy Hewson, Claudia Caniles, David Duncan, Katby Hodgkinson, Dyan Sterling, Dr. Hilary Lemass, Anahid Ajemian and Debbie Lamben. My exercise instructing coUeagues - Diana Destounis, Sophie Dupontgand, DeUa Ruiz, Pamela Lip50n and Chantal Boucher. 1 can't tbank you enough for your suppon and encouragement. You will always be a great inspiration 10 me. To my friend Hugh, bis parents Susan and Hugh Hamilton, bis grandmother Mrs. Lorette Woolfenden and the late Irene and George Thomas, Joffre WoolfeDden and Dorothy Hamilton, who adopted me into their family. 1 know 1 selfisbly wished you into my Iife. Thanks for always reminding me of wby my family immigrated 10 Canada. To my motber's sister, Annie Ethel Conboy, ber brothers Michael and Francis Walsh and their familles for tbeir kindness and for tcaching me about my ancestral history. To Edmond Gbaribian, for being my pillar ofstrengtb. To my wonderful parents Mary Clare and Arsbam, my bramer Khachik and bis wifc Jeanette, my aoots Nora, Bibi and Janet, my uncles Arshak and family and Varoujan Sarkissian and my grandmother Heranoush Saronkhanian. Tbank you for loving me 50 mucb and for ail the suppon and encouragement. Gad blessed me witb the most extraordiDary family; 1 owe ail my successes ta you. • xvn Finally 1 am grateful 10 my two gorgeous nieces, Alexandra and Kelsey, • for putting everything in perspective. • xvm CONTRIBUTIONS OF AUTHORS • Throughout my course of study, 1 bave collaborated with severa! people. As cbapters 2 10 4 of tbis Thesis are published articles by multiple authors, 1 am listing the contributions ofeach author below. AIl three manuscripts presented in this tbesis bave been co-authored by my thesis supervisor, Dr. Charles R. Scriver and myself. For each body of work, Dr. Scriver discussed concepts with me, provided both technical guidance and supervised the project; he also helPed with manuscript preparations. The non-supervisory co-authors of the manuscript "A heteroallelic mutant mouse model: A new onhologue for human hyperphenylalaninemia" (Chapter 2) are Danielle M. Boulais and Dr. J. David McDonaid. Danielle Boulais is the Animal Health Technician working with Dr. C.R. Scriver; Dr. J. David McDonald is an Associate Professor and Chair of the Department of Biological Sciences at Wichita State University. Danielle Boulais was responsible for the general care of the animaIs, aided with blood and tissue collection, assisted in metabolic manipulation experiments and recorded binh rate-survival to weaning and bebavionl assessment. Dr. David McDonaid provided advice on weaning, genotyping and metabolic manipulation. Dr. Orval A. Mamer is the non-supervisory co-author of the manuscript entitled "Measurement of phenyllactate, phenylacetate and phenylpyruvate by negative ion chemical ionization-gas chromatography/mass spectrometry (NICI GCIMS) in brain of mouse genetic models of phenylketonuria and non phenylketonuria hyperphenylalaninemia" (Cbapter 3). Dr. Mamer is the Director of the Mass Spectrometty Unit al McGill University and was responsible for proposing and directing the development of the NICI-GC/MS Methode He provided both teehnical guidance and supervision. The non-supervisory co-authors of the manuscript entided "A differenl approach to treatment of pbenylketonuria: Phenylalanine degradation with • XIX recombinant phenylalanine ammonia Iyase" (Chapter 4) are Dr. Zbongqi Sbao, Françoise Blain, Rosalie Peevers, Dr. Hongsheng Su, Dr. Robert Heft and Dr. • Thomas M. S. Chang. Dr. Zhongqi Sbao is a Senior Scientist at mEX Technologies, Françoise Blain was a Research Scientist al IBEX Technologies, Rosalie Peevers was a Research Associate at mEX Technologies, Dr. Hongsheng Su was an Associate Director al IBEX Technologies, Dr. Robert Heft is the President of IBEX Technologies and Dr. Thomas M. S. Chang is the Director of the Artificial Cells and Organs Research Center at McGill University. Dr. Zhongqi Sbao and Rosalie Peevers were responsible for the production of the live organism (E. coll) used in the mouse studies (in vivo oral administration) and in vitro te5ting of the enzyme in the presence of proœases. Françoise Blain and Dr. Hongsheng Su were responsible for amplification of the PAL gene, construction of the high--expression PAL plasmid and purification of the PAL enzyme. Dr. Robett Heft was responsible for part of the funding. Dr. Chang, Dr. Heft and Dr. Scriver were the primary initiators of this project. They submitted grant applications 10 MaC and CGDN which, following peer review, provided funding for this work. • xx • CHAPTERI Introduction • 1 Pbenylketonuria (PKU) and related byperpbenylalaninemias (HPA) are Mendelian disorders resulting from deficient conversion of pbenylalanine (pbe) to tyrosine • (tyr). They are explained by primary deficiencies of pbenylalanine bydroxylase enzyme (PAR) (Ee 1.14.16.1) activity. If untreated, the patient will most probably experience irreversible impairment of cognitive development. Although bighly investigated, the mecbanisms underlying the patbopbysiology of the disease are still not fully understood (1). Discovery of PKU The story of PKU began in 1934 wben Dr. Asbjmn Felling, a pbysician and biochemist al the University of Oslo School of Medicine, was contacted by the mother of (wo mentally challenged cbildren. She was determined 10 find the cause of their retardation and of the mousy odour tbat seemed 10 be related 10 their condition. Dr. FoUiDg asked the mother 10 bring him urine samples. She retumed with over 5 gallons, from wbicb he identified an excessive amount of phenylpyruvic acid (PPA) - a pbenylketone. Felling, suspecting a Iink between the excretion of PPA and the mental retardation, surveyed several of the surrounding mental institutions and identified other 50ch cases. He noted evidence of autosomal recessive inheritanee. He funher demonstrated that in addition 10 the bigh concentration of PPA, these patients also bad elevated levels ofcirculating phe. He therefore bypothesised that metabolism of dietary phe was defective and 50ggested an inberited metabolic disorder as the cause for mental retardation. He named the disease "oligophrenia phenylpyrouvica" (2-4). Penrose and Quastel renamed the disease "phenylketonuria", literally meaning phenylketones in the urine (5). Penrose postulated tbat the mental retardation bad an identifiable cbemical cause (6). Oefining HyPelphenylalaninemia PKU and related HPAs are among the Most widely studied and well-documented of • the bereditary metabolic disorders. Various classification scbemes exist for the 2 different forms of HPA (the categories defining the level ofseverity). The one used bere identifies 'hyperphenylalaninemia' as an event in individuals baving plasma • [phe] > 120,uM; 'phenylketonuria' as an event in those with plasma [pbe] > 1000 ,uM and a diet phe tolerance < SOO mg/day; the term ~non-PKU HPA' is used for those with 120,uM < plasma [phe] < l000,uM and a diet phe tolerance > 500 mg/day (1;7). 'Variant PKU' is the term used for the patients who do not stricdy tit the description for either PKU or non-PKU HPA (8). In reality these terms simply describe places on the spectrum of a metrical trait called HPA. The prevalence of the PAH-deticient forms of HPA is in its broadest terms 1 in 10,000 live binbs in Caucasian and East Asian populations, with a heterozygote carrier frequency of 1 in 50 (1;8). However, ethnie variation in the frequency of so-called PKU bas long been evident (9), with population rates as high as 1 in 2000 (Turkish) and 1 in 4S00 (Irish) and as low as 1 in 43,000 (Japanese) and 1 in 200,000 (Finn and the Ashkenazi Jewish); the frequency of the non-PKU HPA shows less stratification and is more uniform (1;8). The Phenylalanine Hydro;xylase Gene The PAH-deficient fOnDS of HPA are autosomal recessive traits at clinical and metabolic levels of phenotype and codomioant at the enzymatic level (OMIM 2616(0). They result from mutations in the phenylalanine hydroxylase gene (PAIl) which encodes the PAH enzyme (1). The buman PAR gene is localized on the long ann of chromosome 12, band region q22-24.1 (10). It extends over - lOOkb of genomic DNA (11). It encodes 13 exoDS, which cover less than 3% of the genomic length (11;12). The complete genomic sequence is soon to he reponed (O. Konecki, personal communication); meantime the full-Iength complementary DNA (cDNA) bas been cloned and the nucleotide sequence determined (GenBank U49897.I)(12). The corresponding mRNA spccies is approximately 2500 nucleotides in length and contains the complete genetic code for the functional • PAR enzyme (11;13). The S' untraDslated region encodes cis-acting, trans- 3 activated regulatory elements and S' potential traI1SCript initiation (CAP) sites; it lacks a TATA box and bas sequences similar ta OC boxes, ail features of house • keeping genes (II). Mutations Associated with PAR Deficiency To recognise the rapid evolution of mutation research, one only needs ta go back 32 years. In 1968, Woolf et al. reported the possibility of a tbird allele at the PAR locus, which resulted in distinct phenotypic cbaracteristics, different from bath the 'normal' and the 'typical' PKU allele. They were Dot sure whether an observed phenotype was caused by a variant fonn of PAH enzyme or if it was an effect brought about by other enzymes involved in phe metabolism (14). In 1971, Ara Tourian suggested the possible presence of yet another site for phe-PAH interaction, distinct from its catalytic site, resulting in a genetic variant that caused 'atypical' PKU with PAR enzyme activity of around S% normals in the affected patients (15). Today we know of several hundred ( > 380) disease-causing alleles barbored by the PAR gene on more than 80 different haplotypes (16). The phenotypic outcome of these mutations covers a complete spectrum, ranging from benign polymorphisms to non-PKU HPA and variant PKU to the severely affected PKU phenotype. In the majority of cases, the identification of mutant genotype can broadly predict severity of the disease (17;18) and could indicate the level of phe talerance of the individual patient (17). Disease-causing PAIl mutations fall into 5 classes: missense, small deletions or insertions (usually with frame sbift), modifiers of mRNA splicing, termination (nonsense) alleles; large deletions are rare in this gene (1). The missense aIleles cover - 6S% PAR mutations (19) in comparison to the -50% of disease-causing buman alleles (20). Approximately a half dozcn PAR mutant alleles account for over 50% of BPA cases in the Caucasian population; the remaining mutations are either rare or private aIleles (l;16). Different sets of • alleles are found in Orientals; apin a few prevalent, most rare (16;21). Tbese 4 studies bave provided interesting insigbt on the saying tbat the history of the population cao be history of the alleles. They bave shed ligbt on the variety of • genetic backgrounds on wbich mutations are found and the spatial distnbution and relative frequencies of a number of these mutations (22). Therefore, human genetic diversity at the PAH locus cao teach us a great deal about the occurrence of migration, genetic drift, natural selection (perhaps), recurrent mutation and intragenic recombination over the past 100,000 years (1;9). Disease-causing mutation in PAR bave their effect al tbree phenotypic levels: (1) 6proximate', affecting enzyme structure and function; (il) 6intermediate', affecting metabolic homeostasis; and ili) 6distal,, affecting brain structure/function, with associated cognitive developmental deficiencies (1). PAH Expression Transcription of the PAR gene with its TATA-Iess promoter is regutated by multiple cis-acting elements (11). The PAR gene bas developmental- and tissue specifie transcription/translation, proposed ta he regulated al the transcriptional level (1;23). Sînce the proximal promoter region of the human PAR gene bas no tissue-specifie transcription factor binding sites, it bas been suggested tbat the tissue-specifie expression of the gene resu1ts from the combined effect of the interaction between multiple protein factors and multiple ds-elements (23;24). Phenylalanine hydroxylase is present in a number of organisms from bacteria to humans (25). PAR appears in the cytoplasm (26). In bumans, PAR enzyme is active in hepatoeytes, with new evidence that kidney also barbors significaot phenylalanine hydroxylating activity (1 ;27-30). In addition, there is evidence of some illegitimate transcription as demonstrated by the presence of mRNA in lymphocytes (31). In rodents, phenylalanine hydroxylating (symbol Pah) (Ee 1.14.16.1) activity cao he found in Iiver, kidney and pancreas (32;33). It bas been suggested tbat deteetion of Pah activity in the pancreas is due to the • common developmental origin of the pancreas and Iiver (34). s The PAH PolyPeptide and Enzyme • The PAR gene translates into a 452-amioo acid polypeptide with a molecular weight of 52kD (one subunil 50A x 45A x 45A) (35). The wild-type enzyme fOnDS a homooligomer which is in equilibrium between its tetrameric and dimeric forms (36). The dimer is the minimum functional unit of purified PAH (37). The equilibrium can he shifted ta the tetrameric form and activated by preincubation with phe and by lowering the pH (26;35;36;38;39). The minimum molecular requirements for the normal reaction are: PAH, oxygen, L-phenylalanine and tetrabydrobiopterin (B8.) cofactor (1). With the use of X-ray crystallography, the structure of residues 117-427, containing the catalytic domain of human PAH, was determined al a resolution of 2A (40). These crystallization experiments showed dimeric forms of PAH missing the N-terminal regulation and C-terminal tetramerization domains. Therefore the same team went further to crystallize and determine the stmcture of a truncated fonn of human tetrameric PAU (residues 118-452) (38). Finally the confonnational properties of the N-terminal domain were studied by the use of infrared (IR) spectroscopic methods (39). The enzyme is composed of three domains: regulatory (residues 1-142), catalytic (residues 143-410), and tetramerization (residues 411-452) (13;35;36;41 43). The secondary structural conformations and their internai and intra-subunit (monomer) interactions bave been studied indicating a pronounced asymmetry in the packing of the four subunits (38). The subunit encoded off the PAR gene, men folds ioto tertiary and quatemary structureS, detennining the catalytic efficiency, substrate specificity and binding ability of the enzyme, each of which cao he altered in the presence of a mutation (43). Patients with lypical PKU display < 1% nonnal PAR activity wbile tbase with non-PKU HPA bad more enzymatic activity (> 5% normal) (1). In some cases, interindividual variation in hepatic enzyme activity bas been • attnbuted 10 aIlelic heterogeneity. In addition, aIIelic interaction may play a mie 6 wbere it is much more likely ta reduce the catalytic 8Ctivity than ta enhance it (44). • Mutations affecting the PAH enzyme can he divided into four groups by their apparent effect: (1) 'null' aUeles (no activity); (il) 'Vmax' alleles (reduced activity); (iil) 'kinetic' alleles (a1tered affinity for substrate or cofactor); (iv) 'unstable' alleles (increased turnover and loss of PAH protein) (1;45). The combined expression of two mutant alleles determines the metabolic phenotype. Yet the independent activity of the mutant alleles is imponant for broad prediction of the probable phenotype in newbom HPA cases. If a patient carries two 'severe' mutant alleles each associated with classical PKU, the clinical outeome is classical PKU. However, if there is a 'miId' mutation on one chromosome and a 'null' on the other, the result is Iikely to he a mild pbenotype owing to the codominance of the 'mild' allele (46). To study the effect of a mutation, a number of prokaryotic and eukaryotic in-vitro expression systems bave been adopted, with the mammalian ceU expression systems probably providing a more direct retlection of the buman situation in vivo (47). Most expressed missense mutations in PAR provide evidence of misfoldiDg with an associated increased aggregation (48;49); there are, bowever, a few stable mutant proteins tbat show normal levels of PAH immunoreactive protein with decreased enzymatic activity (47). Mutant proteins tbat bave an increased tendency ta aggregate tend ta bave enbanced degradation. Therefore, Waters et al. proposed tbat degradation of misfolded protein could he a general mecbanism by wbicb missense alleles cause PKU and related forms of HPA (48;50). Variability in the cellular bandling of the protein (background genetics) may alsa bave a significant impact explaining the range of PKUIHPA phenotypes (48;51). • 7 • Phenylalanine Homeostasis Claude Bernard referred to the constancy of the internai milieu as a necessary condition for life (52). The phenylalanine concentration is a metrical trait with an observed steady-state and a central tendency (homeostasis). HPA resu1ts when the non-peptide bound (free) phenylalanine is greater than the normal frequency distributiony reflecting a different (higher) steady-state value (1). The metabolic steady-state is dynamic. Concentrations of Metabolites in the system are fixed tbrough fluxes imposed during standard daily dietary intake. Howevery persistent change in a flux will eventually change the steady-state value (53;54). Enzymes do not act in isolation; these steady-state values are determined by kinetically-linked enzymes tbat interact via their substrates and products. The steady-state of phe is determined by processes tbat lead to the net disposai and the replenishing of the plasma pool (55). Therefore, the fluxes through the system are under the control of the loci covering the overaU mecbanism. The level of contribution by a panicular locus (enzyme) is described by its sensitivity coefficient, Z, which is defined by the fractional change in flux over the fractional change in enzyme activity; the SUDl of ail the coefficients combined is always unity in vivo (56). The free phe pool in the normal subject is derived from two sources: intake of exogenous dietary protein and turnover of endogenous polypeptides. At normal physiologica1 concentrations « 120 i!M),. hydroxylation of phe to tyr by PAH accounts for approximately 75% of the phe runout in the system with the remaining quarter incorporated into protein (sec Fig. 1) (57;58). In addition, different urinary excretion and distribution of amino acids between extracellular and ÎDtraceUular water and tissue companments may also bave small but significant raies in phe runout (46;59). Other Metabolite pathways for the runout are normally of minor consequence (see Fig. 1). However, in the absence ofy or • at reduced levels of PAR activity (wim elevated plasma concentration of phe - 1 0.3 - 0.5 mM), the transamination pathway becomes significant. The correlation • between the excretion of each of the individual phe Metabolites becomes statistically significant al these levels (60). The reaction is not fully operative in the immature newbom (61). Phenylalanine transaminase initiates this alternative pathway by modifying the alanine side-ebain of phe (55). This patbway is a1so active in tissues other than Iiver (1). This initial step involves converting phe 10 phenylpyruvic acid. Pbenylpyruvate is subsequendy convened to phenyllactic acid (PLA), phenylacetic acid (PAA), and phenylacetylglutamine. Decarboxylation ta phenyletbylamine (PEA), a tertiary patbway, is a trivial part of the whole (see Fig. 1) (1;55;62). Treatment Outcome PKU is now a treatable genetic disease and occurrence of the associated mental rewdation is unusual in the treated patient. The treatment entails dietary restriction of phe intake. A large ongoing collaborative study, evaluating the outeome of early-treated PKU cases, showed tbat IQ scores at 6 years of age were directly related to maternaI intelligence, treatment age of onset, and average life lime plasma phe values during treabDent. With early treatment, patients with good dietary maintenance attain an IQ score in the normal range. However, PKU probands, as a group, bave a small IQ deficit relative to their normal sibs. Patients who tenninated treatment early scored lower tban those who continued it longer (63;64). Sbon-temt periods without treabDent, bowever, tend not ta bave a devastating affect on the older patients. One study measuring neuropsychological outeomes showed tbat treated older cbildren sustaining 3 montbs of recurrent HPA suffered minimal if any barm 10 psychological fonction (65). This suppons the idea tbat by Iate cbildhood, the vulnerability of the nervous system ta the • neuro1oxic effect ofphe may be significandy reduced (65). 9 Patients, treated by diet, wim satisfactory IQ outeome, may however display other (non-eognitive) problems. These include significandy increased • tootb wear (66), osteopenia with prominent bone loss (67) and other pbysical phenotypes such as dec:reased sldn and haïr pigmentation, when compared witb controls (8;68). Patients tend to meet tbeir genetic potential and bave normal pubenal development for height, althougb they tend to he mosdy overweight (69 72). They show impaired abstracl reasoning and executive functiODS, bebavior may be more extrovened and they may bave problems witb task orientation. They also bave twice the normal frequency of neurotic and emotional disorder and hyperkinetic bebavior (73-77). ln the event of treabDent termination in adultbood, as is often the case due to the difficulties associated witb the cunent therapy, patients can suifer from agoraphobia, depression and anxiety, witb impaired vigilance and reaction times. They are deficient in social quotients with substantial behavioral problems (75;78 81). Brain PatbOlenesis There are 'thresbold values' for plasma phe mat result in apparent neuroloxicity in PKU patients. For an acute effec:t, a value of 1300 ,uM (82) is assumed; however chronic values> 120 but < 600 ,uM (83) cao still result (in treated patients) in changes visible by magnetic resonance imagine (MRI), and IQ score distributions below the normal range. It is therefore suggested that any degree of persistent HPA could he harmful ta the brain, particularly during carly life. If recurrence of HPA occurs in later life, a reversible acute neurotoxicity will most probably appear al tirst, and if the HPA persists, irreversible chronic neurotoxicity could result (1). Pathogenesis of cognitive development in PKU bas been studied for many years; however 'cause' is poorly understood. Phenylalanine cao interfere with • the development and function of the central nervous system (CNS) by different 10 mecbanisms; however, no single pracess by itself seems sufficient 10 explain the brain phenotype in PKU (84). One of the suggested mecbanisms involves phe • transpon across the blood-bnin barrier (BBB). At least (wo components contribute 10 this effect. One is trans-membrane fluxes of phe into parenchymal cells (acbieving net intraeellular accumulation of phe). It requires a system independent of the one used by several other large neutral amino acids to enter the celle However, these amino acids exit parenchymal cells on the same system as phe. This system is blocked in the presence of high phe concentration (85-91). The other is that large neutral amino acids are transponed across the BBB by a common saturable carrier; phe bas the highest affinity for the system, hence in the presence of excess phe, the cellular influx of these amino acids is impeded (the system is specific for large neutral amino acids). Tberefore, the net concentration of these large neutral amino acids in brain will he reduced as they will he both trapped in the parenchymal tissues and will have to compete at the BBB (86;87;91). The transpon of large neutral amino acids is an imponant control point for the overall regulation of cerebral metabolism, including neurotransmitter production and protein synthesis. The inhibited uptake (by phenylalanine) of amino acids, tyrosine and tryptophan, into the brain results in reduction of serotonin and catecholamine (82;92;93). Serotonin, and the catecholamines (dopamine and norepinepherine) are neurotransmitters tbat act in both central and peripheral systems, are involved with the modulation of psychomotor function, aid in vascular tone maintenance and blood tlow, help control thermoreguJation, and modulate pain mecbanisms. Hence, any changes in this system can have a profound impact on central and peripheral homeostasis and MaY lead ta neurological complications (94). Interindividual variation in phe transpon is apparent with different concentrations of free phe in the brain tissue of affected individuals; this also • influences the brain phenotype in PKU (1). Brain phe concentrations can he Il measured by magnetic resonance spectroscopy (MRS) (95;96). In comparing the • PKU patients, clinical outeome with various blood vs. brain phe levels, it was found that those individuals with high blood and brain pbe levels displayed 'typica1' PKU pbenotype wbi1e those patients (some UDtreated) with high blood and low brain pbe concentrations were of normal inteUigence (95;97;98), suggesting that PKU aduIts with low brain phe concentration (below O.25mM) are likely 10 do weU clinically despite high blood concentrations (97). No statistically significant differences were found in the regional concentrations of pbe (96). Otber studies in«licate that cerebral protein synthesis is inversely related 10 plasma pbe, and tbis effect is apparent at phe concentrations as low as 200-500 J.LM (99). Increased phe concentrations in the brain results in decrease proliferation and increased 1055 of neurons (100-102). DNA content is apparendy reduced in the affected brain cells and its synthesis is impaired (102;103). Elevated phe levels result in dysmyelination and can cause decreased neurotransmitter receptor density and ceU connectivity (104), decreased dendritic arborization and a number of synaptic spines (105), ail associated with brain dysfunction in HPA (106;107). Toxic levels of phe are aJso shown to affect neuronal development during axonal maturation, resulting in hypomyelination in the outer cortica1layers. Myelination appears to be severely inhibited during the critical developmental period (lOS). FinaUy, histological and biochemical analyses of brain samples from PKU mouse onhologues and on in vitro cuItured oligodendrocytes of wildtype mouse brain exposed to high concentrations of phe sbow evidence of myelinating oligodendrocytes, adopting a non-myelinating pbenotype and over-expressing a glial fibrillary acid protein (OFAP). In addition, in the PKU mouse, the increased turnover of myelin is associated wim loss of neurotransmitter (muscarinic acetylcholine) receptor density (104;109;110). • 12 The Challenge ofMaternai BPA • Following the control and normal development of the affected patient, there is one additional concem tbat plagues female patients ~ MaternaI hyperphenylalaninemia is a form of teratogenesis, imposing its oost on the next generation. The phenotypic effect observed here is dependent on the two mutant alleles carried by the mother where the obligatory heterozygous PAR genotype of the fetus is of linle functional significance (111)~ Because the placenta pumps phe 10 the fetus, untreated pregnancies generally result in severe embryopathy and fetopathy, with other complications~ Tbere is a greater tban 80% chance of microencephaly, mental retardation, malformations of the hean (- 7 ~S-12 % probability) and other organs, esophageal atresia, dysmorpbic facial features, and intrauterine growtb retardation in the unbom child (112)~ Congenital cardiac defects occur at the rate of - 7.5 12% in children born 10 mothers with PKU, but ooly at 0.8% in the control population (113). Prevention is therefore essential and treabDent necessary for die weU being of the fetus. The need for preconceptional and intrapanuID treabDent ta prevent HPA teratogenesis was highlighted by Scriver in 1967 (114) and its relevance documented by Lenke and Levy in 1980 in their study of the outeome of over 500 untreated HPA mothers (115). Il is very effective in preventing teratogenesis. The level of HPA is important when assessing the danger ta the fetus, as no cases of congenital hean disease were observed in babies barn ta mothers with mild HPA (116). However, die ultimate reproductive outeome in maternai PKU is dependent on both prenatal metabolic control and postnatal environmental circumstances. Tbese factors gready depend on the educational resources provided for the PKU mother (117)~ Unfortunately -60% of female PKU patients become pregnant unjntentionally and therefore are not in metabolic control. Such pregnancies are usually late-treated and expose fetuses to elevated maternai phe levels (118). In • addition, there are women witb. undiagnosed PKU (who may be weil in the range 13 of normal mental fonction) whose fetoses are at risk (119). Consequendy, a very careful management of maternai HPA is necessary, albeit difficult. Without • treabDent the beneficial effects of newbom screening for PKU would be lost in one generation, as untreated PKU women would give birth ta defective children (120;121). Prevention requires identification and education (with reproductive counseling) of women with HPA in the reproductive age group (112). The MaternaI Phenylketonuria Collaborative Study was established to assess the efficacy of phe-restricted dietary regime and estimate the quality of outeome in reducing morbidity among the offspring of women with PKU (116;118;122). The report states tbat the offspring derives the most benefit when treabDent is instituted before conception or by 8 10 10 weeks' gestation (to levels < 600 ,uM), significandy reducing the chances of teratogenesis. Preliminary data suggests tbat optimum inteUectual status of the offspring follows preconceptional and intrapattum treatment (116). Relevance of Animal Models PKU-related pathologies bave been very difficult 10 study and analyze. Some of the reasons for this are the inberent limitations in using buman beings in controUed studies, including low participant numbers (due to the rarity of PKU), population beterogeneity witb respect to genetic constitution, and participant compliance with the parameters of the experiment (123). To tbis end, the availability and use of animal models bave been invaluable. Surrogate organisms witb uniform genetic background aUow the accumulation of statistica1ly strong data (as a large sample size is possible), and the manipulation of environmental conditions 10 evaluate their contribution 10 the disease (for example, the control of phe intake by animais to reduce variation in blood phe caused by dietary non compliance) (123). For many years, hyperphenylalaninemic animal models were created by the • use of exogenous phe loads and the introduction of cbemical agents 50ch as p- 14 cbloropbenylalanine and a-methylpbenylalanine ta block the Pab reaction (it was necessary ta inbibit Pah activity ta obtain hyperpbenylalaninemia without • hypenyrosinemia). However, these chemica1 agents had additional effects, wbich resulted in secondary consequences (neurocbemica1, among others) (124). The obvious shoncoming of sucb metbods is tbat clear conclusions often cao not be drawn from studies using chemica1ly induced madels. To eliminate tbese drawbacks, Dove and bis group al the University of Wisconsin set out ta create natural mammalian counterpans (onbologues) of buman PKU. The mouse was chosen as the Most appropriate surrogate organism. In the past century, the status of the mouse bas been elevated from pest to madel, and it now serves as one of the best studied 'bonorary bumans' (125). Mice are 2000-3000 limes lighter tban bumans; they have gestation and generation periods of 3 and 10 weeks; the average liner size is between 5-10 pups; they bave a postpartum estrus; they are easy ta bandle with a robust bea1th status; their pregnancies cao be timed by the deteetion of a vaginal plug after mating; and they are the most cost-efficient mammal ta maintain (123;126). Moreover, these animais allow for extensive genetic manipulation and bave a bigh degree of pbysiological similarity ta bumans. There is a growing body ofevidence detailing the similarity between the mouse and buman genomes as weU as the pbenylalanine bydroxylase gene and protein sequences (123;127;128). Tbere is currendy an international effort ta define the mouse structural and functional genome and to create a mouse mutant resource with database and bioinformatics facilities (125). The genetic map of the mouse is the most bigbly cbaracterized mammalian map, rivaled only by the buman map (127). In addition, the map of bomology segments between mouse and man is the one nearest saturation for any pair of spccies in the genome initiative (128). In tact, localization of the mouse PÂlI gene (symbol Pah) was achieved by using the rapidly consolidating map of the buman genome ta identify a putative syntenic group including Pah, PEPB and • fFNG. Sïnce the latter two members of tbis group bad been previously found on 15· mouse chromosome 10, the Pah gene was easily localized 10 chromosome 10 C2 -+ Dl (33). In 1988, the mouse Pah gene was mapped and the cDNA cloned and • sequenced (GenBank X51942) (33;129). Mouse and human genes bave - 87% conservation of sequence, witb 10% of the nucleotide changes silent. No similarities are observed in the UDtraDSlated regions (129). The mouse Pah enzyme bas 453 residues (molecular weigbt, 51,786 Da). Some divergence (- 8%) exists between human and mouse amino acid sequences with the majority of differences in the N-terminal region; there is a 96% similarity at the C-terminal. (12; 129). To create animal models of a particular disease, two different approaches cm be taken: (1) The genotype-driven approach is labor-intensive and generally entails large-scale genome-wide mutagenesis througb gene trapping in embryonic stem ceUs. Here, identification of the mutated gene is relatively trivial; the focus is on characterization of genome mutational change. The very obvious drawback to tbis system is tbat the genotype-driven route gives no indication of the likely phenotypic outcome. Quite olten the model does Dot closely resemble the corresponding human condition, compounded by the fact tbat bomozygous animais carrying a null allele could die prior to any comprehensible analyses. (ü) Phenotype-driven approaches use mutagenic procedures tbat focus on the recovery of novel or sougbt-after phenotypes, without focusing on the underlying gene or pathway tbat bas been disrupted. Here, the problem lies with the identification of the underlying gene (130-132). One phenotype-driven approacb is by chemical mutagenesis using N-ethyl N-nitrosourea (ENU, CzlbN(NO)CONlh). ENU is a DNA-alkylating agent, wbich is currendy the most powerful mutagen known for mouse germline (131 133). It is a potent mouse spermatogonial stem ceU mutagen (134) mainly creating point mutations (i.e. A-T base pair substitutions as weB as small intragenic lesions rather tban large deletions). ENU injected into male mice mutagenizes • premeiotic spermatogonial stem ceUs. Therefore, one treated maIe cao produce a 16 large number of FI animais carrying different mutations (126;135). ENU induees mutations at a frequency of - 10-3 per locus. Tberefore - 1000 gametes • need to he examined from an ENU-treated male mouse for any specifie mutant locus recovery (135;136). Identification of new recessive mutations requires mating of the ENU treated males ta wild-type females. The FI progeny (01) are bred to wild-type miee, establishing families of siblings (02) sharing common mutations. 02 progeny cao he back crossed to G1, producing 03 progeny that cao be assessed for recessive mutant phenotypes. The initial straiDs of hyperphenylalaninemic mice were selected using this breeding strategy, including mutations in the gene for Pah (135;137). To produce these mouse onhologues, inbred ENU-treated BTBRlPas (geDetic background) males were mated ta normal BTBRIPas females. The BTBRlPas strain was chosen because of its excellent breeding ability and because it was inbred for many generatioDS (carrying a uniform genetic background) (138). Selection required the three geDeration breeding scbeme descnbed above followed by the phenotype test (retarded ability of the animaIs to clear a phe load). Four different mutant autosomal recessive lines were initially selected using this strategy. In the tirst one (hph-l), HPA was mutated at the guanosine triphosphate cyclohydrolase locus (OTP-eH catalyzes the tirst step in biosynthesis of BH.. - the essential cofactor for hydroxylase aetivity) (137). The PaJi'I"'S mutant (DOW renamed paJf"IÜll, ENUl) was identified next. This madel is mutated at the Pah locus (139). Once one Pah mutant strain was established (ENUl), funher allelie variants were selected by mating the newly selected FI animaIs 10 the homozygous established mutant; extended HPA foUowing a phe challenge was again the selection criteria (127;136;139-141). ENU aIlowed the generation of multiple alleles increasing the depth of the mouse mutant resource at • this locus (135). 17 To date, tbree mutant Pah enzyme~eficient homoallelic and one heteroallelic mouse onhologues of human PIeU and non-PKU HPA have been • described: ENU1, p~ (ENU2), p~/J (ENU3) and PQh~tUl112 (ENU1/2). The homozygous ENUI mouse was reponed in 1990 (139). ENUI mice bave a c.364 T ~ C transition (VI06A) in exon 3. Val 106 is conserved among the mammalian spccies but is divergent in the others (142). This mutation faIls in the N-terminal regulatory domain of the protein, distant trom the catalytic residues of PAH/Pah, as evidenced by crystallograpbïc analysis of the human enzyme (38;40). This factor, in conjonction with the conservative nature of the predicted Val to Aja substitution, MaY explain the mild phenotype of the ENUI animais (142). On regular diet (Teklad, #8626), these animais display normal plasma phe levels and normal coloration with no abnormal behavior. No apparent effect of maternai phenotype on the fetus is observed; progeny shows normal growth and survivaI of progeny rates. Under conditions of elevated phe in diet, reduced growth is observed (139;141). ENU2 and ENU3 strains were reponed in 1993 (141). 80th strains are classified as PKU counterpans. The ENU2 mutation is a c.835 T ~ C transition (F263S) in exon 7 (142). Phenylalanine 263 is in a highly conserved catalytic domain of the protein. Also present in the active site, whicb is proposed 10 he important for pterin binding (35;43). The presence of mutation in this critical region in conjonction with the radical phe 10 serine substitution may explain the severe pbenotype observed in ENU2 animais. The ENU3 mouse mutation is still not reponed; however, it bas been localized 10 a 301 bp portion of the coding sequence, spanning pan of exon Il and aU of exons 12 and 13 (142). Neitber ENU2 or ENU3 bave measurable bepatic enzyme activity; on normal diets, they both bave 10-20 fold elevated serum phe levels and elevated phenylketoncs in urine. These animais display retarded pre- and postnatal growtb, microcepbaly, pronounced bypopigmentation • and bebavioral abnormaIities which stan 2 weeks ioto adulthood. These include Il toppling wbile grooming, lack of alenness, tao uncoordinated to swim and impaired discrimination, reversai and latent leaming (141;143).. In addition, • ENU2 mouse brain analyses bave sbown reduced amine contents, metabolism and release (144).. 80th strains display severe maternai effect on the fetus with complete loss of litten within several bOUD of binh (141).. These reproductive problems solely depend on the maternai genotype and dietary pbe intake; patemal or fetal genotype bave no effect (123).. Such pregnancies bave also been terminaled pre-tenn to analyze the bean tissue; a variety of cardiovascular defects beginning at 75% througb gestation was observed.. The defects ranged from mild to serious and were mainly vascular in the mouse (145). A bybrid ENU1/2 mouse onhologue for a non-PKU HPA pbenotype bas been developed.. It is the topic of Cbapter 2 in tbis tbesis and the corresponding publication in Appendix A .. These ortllologous animal models bave provided a surrogate organism for the study of potential therapies and made possible the study of mecbanisms underlying the pathophysiology in PKU and related non-PKU HPA pbenotypes. Phenylalanine Transamjnation MetaboUtes Treated PKU patients wbose blood phe levels range between 300-600 ,uM excrete 6-16 limes the normal amount of the pbe transamination metabolites (60).. In an in vivo study with stable isotopes measuring the disposaI of phe in PKU, Treacy et al.. proposed tbat the variation in formation of pbe transamination Metabolites, and differences in reoal clearance of tbese metabolites, play a mie in diewy phe tolerance in PKU (146).. However, generally these patbways do not significandy reduce the excess pbe in the system and therefore do not nullify its possible toxic effect.. It is also extremely unlikely tbat pronounced HPA cao be caused by a lack of transaminase (SS) .. Therefore, the question remains whether pbe itself or one • of its Metabolites is the cause of the neurotoxicity in HPA. 19 Urine, plasma and cerebrospinal tluid (CSF) sampling and aoaIysis by various methods bave shed some Iight on tbis issue. Elevated urinary levels of • PEA do not result in clinical deterioration providing no suppon for the idea that elevatioDS in peripheral levels of PEA will interfere with normal brain lunction (147). Loo et al. sbowed that elevated organic acid derivatives of phe cause microcephaly and myelin defects in PKU rat models exposed to pbe and para cblorophenylalanine (148). However, the actual metabolite concentrations required 10 bring about this effect were approximately of two orders of magnitude higher tban the levels reached in HPAlPKU (147). In addition, Perry et al. who compared various biochemical characteristics in two aduIt brotbers with untreated PKU (one with a severe mental defect and the other with superior intelligence), found no difference in urinary phe Metabolite levels or in their degree of HPA (149), suggesting tbat 10xicity was not caused by any one of the acid Metabolites at the concentrations presented in HPA1PKU. Wadman later reported on two sisters with normal mental development that bad permanently increased amounts of phe transamination products measured in their urine, while their levels of phe were normal (ISO). Tbese findings provided more suppon for the non-toxic status of phe Metabolites and funher implicated phe as the chief villain associated with HPA pathology. No funher substantial proof of neurotoxicity was gathered since these earlier studies (147) and the data bighly suggest tbat 16there are no abnorma1 Metabolites in PKU, only normal metabolites in abnormal amount"(151). However an effect of phe metabolites in the brain could not be fully ruled out as no method directly measuring brain Metabolites was available (55;84;147;151;152). Tberefore, such a technique and a good comparable natural model (human surrogate) for brain sampling were two very useful resources 10 elucidate this issue. This is the focus of Cbapter 3 in tbis thesis and the corresponding publication in Appendix B. • 20 Treatment Phenylalanine is an essential nutrient and in addition to its requirement for protein • synthesis, it serves as a precursor for tyr and tyr derivatives. In its absence, tyr becomes an essential amino acid. Therefore, the treatment of HPA requires the balanced reduction of systemic phe concentration without excessive depletion plus the provision of satisfactory amounts of tyr, a by-product of phe hydroxylation (1). Hyperphenylalaninemias are multifactorial disorders, as the dietary experience and mutant genolype are bath necessary components of the cause. Accordingly, the metabolic phenotype is aJso multifactorial, providing the opponunity for dietary treabDent (1). PKU treatment is a classic example of eupbenic therapy (Lederberg's term) wbere the aim is to restore the normal phenotype without genetic modification. It is necessary to manipulate the experience to maintain heaJth (1; 153). The experience here is control of dietary phe. An anificiaJ diet to reduce phe intake became available in the mid-1950's (154-156). The story began when Louis Woolf, a biocbemist at the Hospital for Sick Children, London, convinced bis coUeagues 10 put a PKU patient on a diet low in phenylalanine. Sheila Jones, 17 months of age at the lime, was the child chosen for this project. Woolf prepared a diet low in phe, by passing a protein hydrolysate tbrough active cbarcoal (157) and with the belp of John Genard, Evelyne HickmaM and Horst Bickel, administered it 10 Sheila (154;155;158). In a shon lime, Sheila's systemic phenylalanine levels were reduced and although her mental status did not change appreciably, it was evident 10 the research team and her mother that she was benefiting from the treatment. She was able 10 make eye contact for the first lime and smile; she had stopped drooling and was starting ta walk. Because of the skepticism among their coUeagues, Bickel and bis team decided 10 add phe back into the diet without telling Sheila'5 mother. One week later, Sheila was no • longer making eye contact or smiling, was again drooling and had stopped 21 walldng (158;159). It was a long road from these initial experiments ta the institution of dietary therapy. but the proof of principle was there. Efficacy of • dietary treatment in the prevention ofsevere IQ loss. became unifonnly accepted by the late 1960's (1). and a population screening test was saon developed (160) ta identify new...bom patients carly and 10 initiate therapy ta prevent postnatal cognitive impairment. The cunent treabDent regimen involves the careful regulation of dietary L... phenylalanine 10 < SOO mglday, sufficient ta support protein synthesis while preventing excess accumulation of pbe in the free pool. The exact tolerance for phe (200-500 mglday) varies between patients even when the same mutant PAR genotype is present (1). A semi...synthetic diet. low in pbe. presumed to he adequate in other nuttients. is used 10 treat PKU and non-PKU HPA. Setter plasma phe homeostasis is observed if the amino acid intake is distributed throughout the day (161; 162). Up to the carly 1970's. it was suggested that diet, stapped completely at the age of 6-9. would result in normal inteUectual performance and bebavior. At that lime, the main concem was reintroduction of diet during the reproductive years of the affected female population, as a possible teratogenic role of PKU on the unbom child was suspected (163). However, by the 1980·s, reports on problems such as leaming disabilities among patients with early treatment termination, urged reconsideration. It was at this time that recommendations for 'diet-for...life' treatment was introduced (163). In the 1990's, clinicians realized the difficulties inherent in lifetime dietary tteatment. The need 10 consider the quality of life for adolescents and adult PKU patients played a major role in this debate (163), since adults with PKU can 10lerate a much bigher level of phe tban cbildren, without the same devastating outeome. Today, quality of life. dietary cast, and varying genetic and socioeconomic backgrounds bave ail become major components in dietary recommendatioDS for adults (CJ7). Treatment is currendy • recommended until at least the ages of 10-12 when the brain is suspected 10 he 22 fully developed (8; 164;165); however, life-Iong compliance is advised (166; 167). In addition, reintroduction of diet cao be used as a definite option when a patient • who bas abandoned the diet develops associated shoncomings. A significant improvement in attentiveness, a reduction in hyperretlexia and shonening of the latencies of the evoked potentials bas been observed, even if the patient bas been treatment-free for a number of yean (168). The optimal treatment recommendations today generally entail carly onset (within one month of birth) continuous treattnent throughout childbood, adolescence, conception and pregnancy, with more and more evidence for benefits with lifetime control (169). If controlled levels are kept below - 360 ,uM in carly childhood, a positive outeome is expected. The individual should be able to attain normal executive fonction (detined as higher goal-directed mental activity, organizing function and dependent on good control of attention) (170). Delayed treatment generally results in an IQ deficit of - 4 points for each month's delay until treatment onset, for each 300 ,uM rise in average blood phe levels and for each S month period during infancy when blood phe coDcenttatioD stays below 120,uM (171). However, late diagnosis ( - 3 months of age) and treatment still results in significant intellectual improvement. Therefore it is suspected that society could benefit substantially by providing a phe-restricted diet for late-diagnosed mentally retarded persons with PKU (172). TreabDent Difficu1ties and Otber Associated Drawbacks Although dietary treatment is simple in tbeory, it is demanding for the patient and the caregiver in practice. In fact, controlled pbe intake, while meeting the nutritional needs of the patient at various growth periods, is a science by itself. Il involves disruption of culture (food), lifestyle (dietary choice), family bebaviour (divided culinary aetivities) and 50 00. As the patients gets older, bisl her energy and protein requirements decline, the diewy needs evolve and must be adjusted • accordingly (173). The imponanee of complete or almost complete intake of the 23 recommended amount of pbe-free amino &Cid mixture cannot be overstated, as it plays a major role in the control of blood phe level of patients (174). • Maternai PKU also requires treaunent and is now recommended when maternai phe levels exceed 400 JJM (169). Nutrition takes top priority in any pregnancy, but in women with PKU, the goal is 2-fold: (,) providing adequate nutrients for fetal growth and (i,) controlling phe levels to proteet the fetus. The women must consume the low-phe diet that includes multivitamins, vitamin B12, and folie acid before and during pregnancy. Funhermore, the gestational age at which the mother anains metabolic control is an imponant factor associated with outeome (118). The blood phe levels must be adjusted between 120 to 360 JJM prior to conception and throughout the pregnancy (113). Duration of treatment prior to conception should take into consideration the fact that severe or moderate PKU patients, who are planning a pregnancy, may bave more difficulty in getting their blood phe levels within the recommended range (117). The principles of treatment for PKU, non-PKU HPA may be clear enough; however in practice, restoring normal homeostasis in tolerable fasmon, is often sometbing else (153). Although there are general guidelines for treatment of patients at specific developmental periods in Iife, other considerations also come in to play, not (cast of whicb is the genetic background of the patients. Each Patient bas his or her own form of HPA; accordingly, he/she requires bis or ber own stringency of therapy (153), further complicating the treatment pracess. The first consideration is the individuality of the HPA state. Diagnosis that characterizes severity of the disease provides objective and effective criteria for therapy of each particular case (17S). Steady-state concentration of blood phe, blood phe clearance rate following an oral phe cballenge, and dietary phe tolerance are ail values that help in the decision about the degree of phenylalanine intake restriction necessary 10 achieve a satisfactory clinica1 outeome (SS). The recent findings on brain pbe concentration may also bave a role in determjning • dietary stringency and aduIt need for üfe-Iong control, raising the fundamental 24 question of whether treatment should he based on the concentration of phe in the brain or levels in the blood, or bath. It may Mean that patients with high • transport levels would require more strïngent dietary restriction tban recommended by the general guidelines; the reverse being true for those with low transport levels (97). The overall advantages of dietary HPA treatment are obvious. Biochemical abnormalities are reversed, preventing neurologica1 deterioration, which in tum improve neuropsychological performance and prevention of teratogenesis in maternaI HPA. However, the diet is difficult 10 enjoy (poor in organoleptic qualities and boring in composition), and not perfect as full compliance is very difficu1t and requires a great deal of social support. There is aIso a continuai worry about nutrient imbalance and deficiency (176-178). Cause for concem are imperfections in the composition of low phe diets, deteeted deficiencies in trace minerais: selenium, iron, copper and chromiUID; reduced levels of Vitamin D, cholesterol, camitine, Jack of the essential nutrient, the fany acid decosahexanoic acid, and other nutrients which are necessary for normal development (152;153;179-181). In addition, protein catabolism occurs when nutrition is not adequate, releasing phe and increasing the Cree pool (1). Fever and infection cao further complicate the problem as elevated blood phe is observed during such episodes (182). Finally, phe controUed diet ÏDitiated prior to conception, or early in the first trimester, may still result in abnormalities (183). Compliance with dietary therapy remains a major cballenge. Teaching and support of an experienced healthcare team of physicians, nutritionists, genetic counselors, social workers, nurses, and psychologists are very necessary components in improving the chances of successful treatment (8). Efforts 10 improve the organoleptic properties of the diet continue. Sorne of the simplest solutions bave been the production of less offensive amioo &Cid mixtures by varying the formulation (184), or by masking tbem througb the use ofgelatine encapsuIation • (initially introduced to accommodate the delicate 1Oleraoce of pregnant PKU 2S females) (18S). Other resean:h, focusing on expression of genes tbat translate into modified phe-free protein products in corn are in progress (186) and transgenic cow • production of modified human protein (alpba-Iactalbumin) lacking phe, are also current1y in progress (187). Non-Diet Treatment Options Alternative fonDS of therapy deserve consideration. TreabDent by Liver Transplants An onhotopic Iiver transplantation was conducted on a lO-year--old PKU patient from ltaly who also bad concomitant, unrelated end-stage chronic liver disease. The transplantation was successful and a complete correction of the metabolic abnonnalities was observed. Liver function was prompdy restored witb normal phe tolerance; blood [phe] fell from 9.S mg/dl (pre-transplant with phe restricted diet) to 1.0 to 1.2 mg/dl (post transplant on normal diet or witb oral protein load). The success of liver transplantation observed confirmed that the liver is the chief site of the enzymatic defect in classic PKU (188). Although tbis metbod was effective in correcting HPA in the single patient, because of the shortage of donated organs, complications with anti-rejection therapies and the goad results achieved with early dietary restriction, it is not an appropriate option for otherwise uncomplicated PKU in the population of patients (188). Gene TherapY Germline gene therapy could result in a potential ~cure' for the successive generations of PKU individuals, but is the least Iikely option because of teehnica1 and ethical rcasons. On the other band, research into somatic gene therapy bas shown great potential. Human PAH cDNA was expressed in a series of cultured mammalian ceUs. Transient expression was observed here, as integration of the • cDNA was not stable. This problem was overcome by the use of recombinant 26 retroviruses where the gene was traDSmitted to subsequent generations (1). Primary hepatoeyte eultures from the Pah-deficient mouse bave been transfected • with wildtype mouse Pah cDNA. Transdueed cells bave shown high expression levels of mouse Pah-specifie mRNA enzyme aetivity, and immunoreaetive protein (189;190). ENU2 mice, treated with a recombinant adenoviral vector contaîning a human PAH cDNA, showed normal plasma phe levels for one week; however the effect did not persist (191). This method involves further complications such as surgical procedure (ponal vein infusion) and the use of adenoviral vectors (reported 10 be eytopatbie to host ceUs) (192). Other attempts at gene therapy with the ENU2 mouse bave introduced the gene construet with a mouse muscle creatine kinase promoter element. Here they observed Pah expression in cardiae and skeletal musele but not in Iiver and kidney. This experiment aIso required the repeated dosing of the cofactor BH4; however it sueeessfully demonstrated the locus-specifie PAH enzyme activity (it expressed in heterologous tissue}. Euphenylalaninemia was restored when the animais were supplied with abundant cofaetor (193). Finally, one other group reponed the possibility of gene therapy usÎDg T cells from PKU patients. These ceUs bave a small amount of biopterin, but significant dihydropteridine reduetase (DHPR) activity. IntraceUular biopterin content could again be increased by exogenous BH" supplementation. The cells were able ta uptake the retrovirus contaîning the human PAR cDNA. The T lymphocytes were able to express all that is required for phenylalanine hydroxylation reaetion. T lymphocyte.. Tetrahydrobiopterin-Responsive HPA Therapy A subgroup of HPA patients is BH. responsive (194). Efficacy in tbese • panicular persans is attributed to a residual PAH aetivity stabilized when saturated 27 with BH4cofactor (50 called BH4-dependent or BH4-responsive HPA). The panicular combination of the mutant PAH subunits is likely to he important for BH4 • responsiveness. Enzyme Therapy Enzyme therapy could he done either by replacement of PAH (via transplantation) or by PAH enzyme substitution, with another protein involved in phe degradation. PAH Enzyme Replacement: This is an unlikely option, as a series of problems exist associated with its large-sca1e isolation and purification of the proteine In addition, the enzyme requires the (very cosdy) cofactor 10 function. Replacement therapy with PAH will require the intact multi-enzyme complex for catalytic hydroxylating activity (1). Enzyme Substitution Therapy with Phenylalanine Ammonia Lyase (PAL) (EC 4.3.1.5): This is a potential alternative, probably best seen as an adjunct to modest dietary control. PAL is a robust autoeatalytic protein without need for a cofactor (195), an enzyme that stoichiometrically convens L-phenylalanine to trans-cinnamic acid and ammonia by nonoxidative deamination (196-198). PAL carries ail the information required for catalytic activity (199). Some species that bave PAL activity are capable of utiliziDg phe as a sole source of carbon and nittogen (200). In fungal ceUs, tbis enzyme bas a stricdy catabolic role (201). In plants, PAL is a key biosynthetic enzyme catalyzing the tirst specializaf reaction in the synthesis of a variety of polyphenyl compounds (Le. tlavonoids, phenylpropanoids and lignin in plants). Induced activity is observed in response to various stimuli, such as injury, tight and hormones (202-204). Approximately 30 - 40% of plant organic matter is derived from L-phe through the cinnamate • pathway (205). 28 The complete PAL sequence for Rhodosporidium toruloides yeast bas been reported (GenBank KSISI3) (201); it contains a 2148-bp open reading frame • (206). The genomic sequence contaïns six inttons; relatively small in comparison with tbose found in higber eukaryotes, with sizes ranging from So-88bp (201;202;207). It bas three transcription initiation sites with non-translated leaders of 24-35 nucleotides (206). The 25 bases upstream of the stan codon are Ale rich (76 %) as observed in several other lower eukaryotic genes and the 4S bases preceding the transcription initiation sites are pyrimidine-rich (90%), a feature of genes trom filamentous fungi and particularly striking in genes lacking the TATA box and in highly expressed genes (206). The size of PAL mRNA was shown 10 be - 2.5kb with at least SO of these bases cODSistÎng of the 3' polyadenylated tail. The mRNA is monocistronic (one gene copy) (207). The PAL sequence translates into a 716 amino acid polypeptide monomer witb a molecular weight of -77 kDa (206). The enzyme is tetrameric, consisting of four identical monomers, Pairs of wbich fonn a single active site (199;208;209). The molecular weight of the tetramer is estimated to be trom 275 to 300 kDa (197). Little is known about functional groups of PAL; however, there is good evidence that a dehydroalanine is an essential pan of the active site. Site-directed mutagenesis of conserved serine residue 143 in the sister enzyme histidine ammonia-Iyase (HAL, Ee 4.3.1.3) trom PseudomolltlS purida, resulted in complete loss of activity. HAL deamioates L-histidine to trans-urocanic acid (210). HAL and PAL are very similar enzymes with high sequence homology; they catalyze the same reaction type and passess the same prostbetic group (211). Serine 212 is the equivalent residue in R. toruloides PAL (210;212). Serine is the precursor of the active-site dehydroalanine; the conversion is autoeatalytic (195;199). Dehydroalanine is made post-translationally by fonning a prosthetic group covalendy attached 10 the enzyme (199). This modification is suspected to • be the rate-limiting step in the conversion of the PAL 10 a catalytically competent 29 form (212). PAL is also a sulthydryl enzyme (200). The optimum pH range for PAL activity is 8.0 10 10.S and the enzyme remains stable up to SOOC, but is • destroyed above 6QOC (200). The product, trans-eionamic acid, is a barmless Metabolite. It is present in all vegetable matter, is used as a food additive and as a constituent of some cosmetics (196;213) and bas no embryotoxic effects in laboratory animals (214). The liver metabolizes it to benzoic acid and it is then excreted principally as hippurate via urine (215). A small amount of cinnamate, uncbanged, cao also appear in the urine, togetber with some benzoic acid (196). The - 3g of cinnamic acid that would he generated daily with complete dietary phe conversion by PAL is predicted to be barmless to both PKU and normal individuals. The ammonia formed would be metabolically insignificant (196;213). Route of PAL Administration The proposed route of (proteeted) PAL administration is oral and it capitalizes on tbree prior observations: (l) amino acids are in equilibrium between the various companments of body tluids and ultimately in equilibrium with the intestinal lumen, therefore this mode of treatment affects ail body pools (S3;85;216); (il) it will modify phe content of body tluids in the whole organism (217;218); (iil) the proposed theory of extensive enterorecirculation of amino acids states that the most likely major source of intestinal amino acids is probably from gastric, pancreatic, intestinal and other intestinal secretioDS. Tryptic digestion converts the secreted proteins, enzymes, polypeptides and peptides ioto amino acids, wbich are then reabsorbed back into the body as they pass down the intestine. This forms the large enterorecirculation of amino &Cids between the body and intestine (219). Oral PAL therapy will deplete the phe pool in the intestine whether the phe source is dietary or from the endogenous run out of free phe from bound • pools (219). 30 Oral administration of PAL avoids any possible immunological problems tbat may occur with injected enzymes. Such immunological reactions have been • reponed when animais bave been injected with PAL (213;220). Oral delivery of a protein 'drog', though a worthy objective, can be extremely difficult (221). PAL may bave no toxic propenies, however the unproteeted enzyme, exposed to the gastro-intestinal (01) environment, would not survive to complete the job; the strong acidic condition of the stomach and the abundance of proteases and peptidases in the 01 tract are the reasons (221). Duodenal juices rapidly inactivate PAL, with chymotrypsin working approximately 30 tilDes faster tban trypsin, suggesting the presence of a hydropbobic region on the surface of the enzyme (209). PAL activity is stable in duodenal juice with inactivated cbymotrypsin and trypsine In ligbt of the problems associated with oral therapy, it is necessary to create a protective yet paroos barrier that will surround the PAL enzyme before administration. The barrier must provide the foUowing: tirst, it must prevent the relatively large molecuIar weight digestive proteases from gaining access to the enzyme; and second, it must provide full phe access to the PAL enzyme for conversion (see Fig. 2). The problem with the low gastric pH is overcome by enteric coaling of the free or formulated enzyme. Enteric coaling works with neutralization of the expelled stomach contents in the duodenum foUowed by dissolution of the capsules and intimate mixing of enzyme and duodenal contents. Preliminary studies in buman PKU patients showed attenuated HPA foUoWÎDg the administration of PAL in enteric coated gelatin capsules (213). A number of different formulations and mechanisms have been tested to prevent protease inactivation. Artificial ceUs (semipermeable microcapsules) of cellular dimension witb an ultrathin (200A) membrane bave been used to immobilize PAL (222). Administration to chemically induced HPA rats (223) as weil as in naturally-occurriDg HPA in a mouse model bas shown significant • plasma phe reduction (218). Here, encapsulated PAL acts by the diffusion of phe 31 into the artificial eeUs where it is convened into trans-eionamie acid. Trans cionamic acid is then released from the artificial cell. Entrapment of enzyme in • silk fibroin was another proposed metbod of PAL protection. The investigators here showed effective activity and protection of PAL foUowing direct injection into rat duodenum. Efficacy was measured by the appearancc of trans-cinnamate (224). Recendy, adenocarcinoma ccli line Caco-2 (225) as a package delivery system with a protective cell wall bas been successfully attempted. Finally, one other route, using a non-oral-extracorporeal multitubular enzyme reactor, with immobilized PAL, was developed ta deplete circulating phe. Bere a shunt was introduced and the phe-rich blood was pomped through the reactor, the phe depleted blood pumped back into the system. This was successfully tried on a patient with PKU as the plasma phe levels dropped significantly without the enzyme entering the circulation (226). These studies were not continued because PAL was not available in sufficient amounts at reasonable cost. Economical production of PAL is DOW possible, tbanks to cloning technology. Protected free PAL ~enclosed' within the E. coli ceUs and studies with the protease inhibitor aprotinin (in the mouse model), provide positive praof of principle tbat PAL will reduce systemic pbe levels in the PKU and HPA mouse models. Tbus tbere is the pltential for oral enzyme substitution therapy as adjunct alternative therapy for PKU iDdependent of artificial diets. This project is the focus of Chapter 4 and the corresponding publication in Appendix C. • 32 Proposai • As described above, the focus of a number of projects in the past two decades bas been ta improve the treabDent of PKU. Yet 001 one of these attempts was effective enough ta take the place of dietary therapy. However, with current advancements in animal modelling and related biotechnologies, such as cloning, some of the former difficulties associated witb new dmg development and measurement of efficacy bave been overcome. This tbesis focuses on one of these technologies, after an overview ofother options. 1 approached my project on tbree levels: I. An Animal Model: PKU and HPA animal models serve as living systems ta measure orthologous human phenotypic outeomes. Their use eliminates problems in population genetic heterogeneity, in standardizing experimental paramelers, and with measurements tbat would otherwise be unacceptable in human subjects. The tirst objective of this project was ta develop a compound heteroallelic ENUl/2 mouse model and ta describe and compare their organismal phenotypes with those of the control (BTBRIPas), mutant strains (ENUI and ENU2) and their carrier counterparts. To achieve this, the corresponding metabolic parameters, quantitation of Pah protein levels, hepatic Pm enzyme activity, blood and brain phe levels, bebavioral parameters and maternai HPA effect on the fetus were aIl measured. u. A New AnalYtic Approacb: A method was devised for specific measurement of pbe Metabolites in the brain ta funher descnbe these animal models and ta answer the question of wbether phe itself, or one of its Metabolites, is the cause of neurotaxicity in PKU. Sucb measurements must be sensitive enougb ta analyse samples of trivial volume. • Hence the second objective of mis project was ta develop a very sensitive detection 33 method tbat incorporated negative ion cbemical ionization gas cbromatograpby/mass • spectrometry (NICI-OC/MS) ta measure these Metabolites. m. An Alternative 10 Diet Therapy for PKU Improvement in the treabDent of PKU was my ultimate goal. 1 used enzyme substitution therapy [with PAL] to replace the current dietary treatment. The relevance of tbis treatment mode was demonstrated by: (1) developing an economical industrial supply of PAL at mEX; (il) proteeting the enzyme sufficiendy to aIlow shon-term passage tbrougb the 01 tract; and (iii) providing praofs of pbannacologica1 and pbysiological efficacy in the Pab-deficient genetic mouse models. • 34 • L--~ +• •+ + FuIIIarate• + Aœt.oIœtate + COz+fIaO FIG. 1. Major inputs (:» and runouts (--.) of free L-pbenylalanine in buman metabolism. Inputs of this essential amino acid to the pool of freely diffusible solute are from dietary protein [hence the minimal dietary requirement] and turnover of endogenous (bound, polypeptide) pools. Runout is by (1) hydroxylation to tyrosine (reaction 1 catalyzed by pbenylalanine hydroxylase, followed by oxidation); (2) incorporation into bound (polypeptide) pools (reaction 2); and (3) by transamjnation (A) and decarboxylation (8). The approximate proponional importance of the tbree runouts is 3:1:traee at normal steady state. Dis fipre is li reproduelioll 01 Fi, 17-2 /1'0'" HYPERPHENYLAlANlNEMlA: Phell,1Dltlni"e lIytlro%Jlllle DejidDlq ÎII The MeItI1JoIk lIIUl MDleellitu BlIse, 01 l""e';'. Dis.... 8 EtIiIioIl (2001), A1IIIIors: Seme, C.R. tlIUl KiIu""" s. Reprodlleetl witIa ".,..." DI lM JI"blish., The MeGl'tIW-HiII CotllptllÛe,. (Copyright e ~l by The McGraw-BiD Co.puies)• • 3S • trans-cinnamic acid + NU] digestive proteases FIG. Z. Schematic representation of PAL enzyme proteeted from degradation for passage through the 01 tract: A proteetive yet poroos barrier (e.g. byencapsu1ation or cross-linked enzyme crystals) CID shield PAL witbin a microenvironmem, free ofdigestive proteases that are unable ta cross the boundary. Free phenylalanine cao be transponed tbrougb the slighdy poroos banier and be convened by PAL ta trans cinnarnic acid. • 36 • REFERENCES 1. Seriver,C.R. and Kaufman,S. 2001. Hyperphenylalaninemia: Phenylalanine Hydroxylase Deficieney. In The Metabolic and Molecular Bases oflnherited Disease. (8 ed.) Seriver,C.R., Beaudet,A.L., Sly,W.S., Valle,D., Assoc.eds.Cbilds,B., Kinzler,K., and Vogelstein,B., editors. MeGraw Hill., New York. 2. Folling,A. 1934. Uber Ausscheidung von Phenylbrenztraubensaure in den Ham ais Stoffwecbselanomalie in VerbindUDg mit Imbezillitat. Hoppe Seylers Z.Physiol.Chem. 277:169-176. 3. FoUing,A., Mohr,O.L., and Ruud,L. 1945. Oligophrenia phenylpyrouvica. A recessive syndrome in man. Skrifter Der Norske Vitenskapsakademi i Oslo.1.Mat Naturv K/asse.I-48. 4. The Discovery of PKU. National PKU News SpringlSummer (4(1», 74. 1992. s. Penrose,L.S. and Quastel,J.H. 1937. Metabolic studies in phenylketonuria. J Biochem 31 :266-269. 6. Penrose,L.S. 1935. lDheritanœ ofphenylpyruvic amentia (phenylketonuria). lAncer 2:192-194. 7. Scriver,C.R. 1995. American Pediatric Society Presidential Address 1995: Disease, war, and biology: Languages for medicine - and pediatries. Pediillr Res 38:819-829. • 37 8.. Ryan, S .. R. and Scriver, C. R. Phenylalanine Hydroxylase Deficiency. • GeneClinics Nov. 24. 1999. NIH. (http://www/geneclinics.orgtprofiles/pkuldetails.html) 9. Penrose,L.S. 1946. Phenylketonuria: A problem in eugenics. Lancet June 29:949-953. 10. Lidslcy,A.S., Law,M.L., Mone,H.G., Kao,F.T., and Woo,S.L.C. 1985. Regional mapping of the phenylalanine hydroxylase gene and the phenylketonuria locus in the human genome. hoc Nall Acad Sci (USA) 82:6221-6225. Il. Konecki,D.S., Wang,Y., Trefz,F.K., Lichter-Konecki,U., and Woo,S.L.C. 1992. Structural cbaracterization of the 5' region of the human phenylalanine hydroxylase gene. Biochemistry 31 :8363-8368. 12. Kwok,S.C.M., Ledley,F.D., DiLeUa,A.G., Robson,K.J.H., and Woo,S.L.C. 1985. Nucleotide sequence of a fuU-length complementary DNA clone and amino acid sequence of human phenylalanine hydroxylase. Biochemistry 24:556-561. 13. Ledley,F.D., DiLeUa,A.G., Kwok,S.C.M., and Woo,S.L.C. 1985. Homology between phenylalanine hydroxylase and tyrosine hydroxylase reveals common structural and functional detenninants. Biochemistry 24:3389-3394. 14. Woolf,L.I., Goodwin,L., Cranston,W.. I .. , Wade,D.N., Woolf,F., Hudson,F.P., and McBean,M.. S. 1968. A tbird a1Iele al the phenylalacine hydroxylase locus in mild phenylketonuria (hyperphenylalaninemia). The Lancer Jan. 20:114-117. • 31 IS. Tourian,A. 1971. Activation of phenylalanine hydroxylase by phenylalanine. • Biochim Biophys Âcta 242:345-354. 16. Scriver,C.R., Waters,P.J., Sarkissian,C., Ryan,S., Prevost,L., Cote,D., Novale,J., Teebi,S., and Nowacki,P.M. 2000. PAHdb: A locus-specific knowledgebase. Hum MutaI 15:99-194. 17. Kayaa1p,E., Treacy,E., Waters,P.J., Byck,S., Nowacki,P., and Scriver,C.R. 1997. Human Phenylalanine Hydroxylase Mutations and Hyperphenylalaninemia Phenotypes: A Metana1ysis of Genotype-Phenotype Correlations. Am J Hum Genet 61:1309-1317. 18. Guldberg,P., Rey,F., Zschocke,J., Romano,C., Francois,B., Michiels,L., UlIrich,K., Hoffman,G.F., Burgard,P., Schmidt,H. et al. 1998. A European multicenter study of phenylalanine hydroxylase deficiency: classification of lOS mutations and a general system for genotype-based prediction of metabolic phenotype. Am J Hum Genet 63:71-79. 19. Mutation List. 2000. (http://data.mcgill.calcgi-binlpahdb_new/list_mut.pre). 20. The Cardiff Roman Gene Mutation Database (HOMD). 2000. (http://www.uwcm.ac.ukIuwcmtmg/hgmdO.html). 21. Eisensmith,R.C. and Woo,S.L.C. 1995. Molecular Genetics of Phenylketonuria: From Molecular Anthropology to Gene Therapy. In Advances in Genetics. J.C.Hall and Dunlap,J.C., editors. 199-271. 22. Tyfield, L. A., Stephenson, A., Cockburn, F., Harvie, A., Bidwell, J. L., Wood, N. A. P., Pilz, D. T., Harper, P., and Smith, I. Sequence variation at the phenylalanine hydroxylase gene in the British Isles. Am J Hum Genet • 60, 388-396. 1997. 39 23. Wang,Y., DeMayo,J.L., Hahn,T.M., Finegold,M.J., Konecki,D.S., • Lichter-Konecki,U., and Woo,S.L.C. 1992. Tissue- and developmental specific expression of the human phenylalanine hydroxylase/Chloramphenicol acetyltransferase fusion gene in transgenic mice. J Biol Chem 267:15105-15110. 24. Wang,V., Hahn,T.M., Tsai,S.Y., and Woo,S.L.C. 1994. Functional cbaracterization of a unique liver gene promoter. J Biol Chem 269:9137 9146. 25. Chen,D. and Frey,P.A. 1998. Phenylalanine hydroxylase from Chromobaaerium violaceum. J Biol Chem 273:25594-25601. 26. Hufton,S.E., Jennings,I.G., and Cotton,G.H. 1995. Structure and function of the aromatic amino acid hydroxylases. Biochem J 311:353-366. 27. Lichter-Konecki,U., Hipke,C.M., and Konecki,D.S. 1998. PAR expression in human kidney. Am J Hum Genet 63:A269 (Abstr.) 28. Moller,N., Meek,S., Bigelc.ïw,M., Andrews,J., and Nair,K.S. 2000. The kidney is an important site for in vivo pbenylalanine-to-tyrosine conversion in adult bumans: A metabolic role of the kidney. hoc Natl Âcad Sd USA 97:1242-1246. 29. Licbter-Konecki,U., Hipke,C.M., and Konecld,D.S. 1999. Human phenylalanine hydroxylase gene expression in kidney and otber nonhepatic tissues. Molec Genet Metab 67:308-316. 30. Tessari,P., Defenari,G., Robaudo,C., Veuore,M., Pastorino,N., De Baisi,L., and Ganbotto,G. 1999. Phenylalanine hydroxylation acmss the • kidney in humans rapid communication. Kidney lnt 56:2168-2172. 40 31. Ellingsen,S., Knappskog,P.M., Apold,J., and Eiken,H.G. 1999. Diverse • PAH transeripts in lymphocytes of PKU patients with putative nonsense (G272X, Y356X) and missense (P281L, R408Q) mutations. FEBS Leners 457:505-508. 32. Tourian,A., Goddard,J., and Puck,T.T. 1969. Phenylalanine hydroxylase activity in mammalian ceUs. J Cell Physiol73: 159-159. 33. Ledley,F.D., Ledbeuer,S.A., Ledbetter,D.H., and Woo,S.L.C. 1988. Localization of mouse phenylalanine hydroxylase locus on chromosome 10. Cytogenet Cell Genet 47: 125-127. 34. Grompe,M., Al-Dbalimy,M., and Ovenurf,K. 1998. Hepatic repopulation by adult murine pancreatic liver stem ceUs. Am J Hum Genet 63:A3. 35. F1atmark,T. and Stevens,R.C. 1999. Structural insight ioto the aromatic amino acid bydroxylases and tbeir disease-related mutant fonns. Chem Rev 99:2137-2160. 36. Bjorgo,E., Knappskog,P.M., Manincz,A., Stevens,R.C., and Flatmark,T. 1998. Panial cbaracterization and three-dimensional-structurallocalization of eigbt mutations in exon 7 of the human phenylalanine hydroxylase gene associated witb pbenylketonuria. Eu, J Biochem 257:1-10. 37. Davis,M.D., Pamiak,M.A., Kaufman,S., and Kempner,E. 1997. The role of phenylalanine in structure-function relationsbips of phenylalanine hydroxylase revealed by radiation target analysis. Proc Natl Âcad Sei USA 94:491-495. 38. Fusetti,F., Eriandsen,H., F1atmark,T., and Stevens,R.C. 1998. Structure of tetrameric human phenylalanine hydroxylase and its implications for • phenylketonuria. J Biol Chem 273:16962-16967. 41 39. Chebin,R., Thorolfsson,M., Knappskog,P.M., Martinez,A., Ftatmark,T., • Arrondo,J.L.R., and Muga,A. 1998. Domain structure and stability of human phenylalanine hydroxylase inferred from infrared spectroscopy. FEBS Leu 422:225-230. 40. Erlandsen,H., Fusetti,F., Maninez,A., Rough,E., F1atmark,T., and Stevens,R.C. 1997. Crystal structure of the catalytic domain of human phenylalanine hydroxylase reveals the structural basis of phenylketonuria. Nat SlTUct B;014:995-1000. 41. Er1andsen,H., Flatmark,T., Stevens,R.C., and Rougb,E. 1998. Crystallographic analysis of the human phenylalanine hydroxylase catalytic domain with bound cateehol inhibitors at 2.0 Resolution. Bioch 37: 15638 15646. 42. Rufton,S.E., Jennings,I.G., and Cotton,R.G.H. 1998. Structure/fonction analysis of the domains required for the multimerisation of phenylalanine hydroxylase. Biochim Biophys Acta 1382:295-304. 43. Erlandsen,H. and Stevens,R.C. 1999. The structural basis of Phenylketonuria. Molec Genet Metab 68:103-125. 44. ICaufman,S., Mu,E.E., and Kang,E.S. 1975. Phenylalanine hydroxylase activity in Iiver biopsies from hyperphenylalaninemia heterozygotes: deviation from proportionality with gene dosage. Ped Res 9:632-634. 45. Flatmark, T., Knappskog, P. M., Bjorgo, E., and Maninez, A. Molecular cbaracterization of disease related mutant forDIS of human phenylalanine hydroxylase and tyrosine hydroxylase. Pfleiderer, W. and Rokos, R. 1997. Chemistry and Biology of Pteridines and Folates 1997. Germany, June 15 • 20, 1997. Conference Proœeding. 42 46. Guldberg,P., Mikkelsen,I., Henriksen,K.F., Lou,H.C., and Guttler,F. • 1995. In vivo assessment of mutations in the phenylalanine hydroxylase gene by phenylalanine loading: cbaracterization of seven common mutations. EUT J Pediatr 154:551-556. 47. Waters,P.J., Pamiak,M.A., Nowacki,P., and Scriver,C.R. 1998. In vitro expression anaIysis of mutations in pbenylalanine hydroxylase: Linking genotype 10 phenotype and strueture 10 function. Hum MutaI Il:14-17. 48. Waters,P.J., Parniak,M.A., Akerman,B.R., and Seriver,C.R. 2000. Charaeterization of phenylketonuria missense substitutions, distant from the phenylalanine hydroxylase active site, illustrates a paradigm for mecbanism and potential modulation ofpbenotype. Molec Genet Metab 69:101-110. 49. In Vitro Expression. 2000. (http://data.mch.mcgill.calpabdb_new/search.html). 50. Waters,P.J., Parniak,M.A., Hewson,A.S., and Scriver,C.R. 1998. Alterations in protein aggregation and degradation due to mild and severe missense mutations (AI04D, R157N) in the buman phenylalanine hydroxylase gene (PAH). Hum Mutat 12:344-354. 51. Scriver,C.R. and Waters,P.J. 1999. Monogenie traits are not simple. Lessons from phenylketonuria. T1G 15:267-272. 52. Bernard,C. 1878. Les Phénomènes de la Vie. Libraire 1-B Bailliere et Fils., Paris. 879-879 pp. 53. Cobn,R.M., Palmieri,M.l., and McNamara,P.D. 1980.. Non equilibrium thermodynamics, non covalent forces, and water. In Principles of Metabolic Control in Mammalian Species. R.H.Herman, Cohn,R.. M .. , and • McNamara,P.D., editon. Plenum Press, New York.. 63-63 .. 43 54. Murphy,E.A. and Pyeritz,R.E. 1986. Homeostasis VU. A conspectus. Amer • J Med Genet 24:735-735. 5S. Kaufman,S. 1999. A model of buman pbenylalanine metabolism in normal subjects and in pbenylketonuria patients. Proc Natl Acad Sei USA 96:3160 3164. 56. Kacser,H. and Bums,J.A. 1981. The molecuIar basis of dominance. Genetics 97:639-666. S7. Kaufman,S. 1976. Pbenylketonuria: Biocbemical mecbanisms. Adv Neurochem 2: 1-132. 58. Salter,M., Knowles,R.G., and Pogsoo,e.l. 1986. Quantification of the importance of individual steps in the control of aromatic amino acid metabolism. Biochem J 234:635-647. 59. Krempf,M., Hoerr,R.A., Marks,L., and Young,V.R. 1990. Phenylalanine flux in adult men: Estimates witb different tracers and route of administration. Metabolism 39:560-561. 60. Micbals,K., Lopus,M., and Matalon,R. 1988. Phenylalanine Metabolites as indicators of dietary compliance in children with pbenylketonuria. Biochem Med Metab Biol 39:18-23. 61. Scriver,C.R. and Rosenberg,L.E. 1973. Amino Acid Metabolism and Its Disorders. Saunders,W.B., Pbiladelphia. 62. Kaufman,S. 1976. Biochemical mecbanisms. Adv Neurochem 2:1-132. 63. Williamson,M.L., Koch,R., Azen,C., and Chang,C. 1981. Correlates of intelligence test results in treated phenylketonuric cbildren. Pediatrics • 68:161-167. 44 64. Koch,R., Azen,C., Friedman,E.G., and Williamson,M.L. 1984. Paired comparisons between early treated PKU cbildren and their matehed sibling • controls on intelligence and school acbievement test results at eigbt years of age. J Inher Metab Dis 7:86-90. 65. Griffitbs,P., Ward,N., Harvie,A., and Cockbum,F. 1998. Neuropsycbological outeome of experimental manipulation of phenylalanine intake in treated phenylketonuria. J Inher Metab Dis 21:29-38. . 66. Kilpatrick,N.M., Awang,H., Wilcken,B., and Cbristodoulou,J. 1999. Implication of pbenylketonuria on oral healtb. Pediatr Dent 21 :433-437. 67. AI·Qadreh,A., Scbulpis,K.H., Athanasopoulou,H., Mengreli,C., Skarpalezou,A., and Voskaki,L. 1998. Bone minerai status in cbildren witb phenylketonuria onder treatment. Acta Paediatr 87: 1162-1126. 68. Scballreuter,K.U., Wood,J.M., Pittelkow,M.R., Gudicb,M., Lemke,K.R., RodI,W., Swanson,N.N., Hitzemann,K., and Ziegler,l. 1994. Regulation of melanin biosynthesis in the human epidermis by tetrahydrobiopterin. Science 263:1444-1446. 69. HoIm,V.A., Kroomal,R.A., Williamson,M., and Roche,A.F. 1979. Pbysical growth in pbenylketonuria: ll. Growth of treated cbildren in the PKU coUaborative study from birtb 10 4 years ofage. Pediatries 63:700-707. 70. Lyonnet,S., Caillaud,C., Rey,F., Benbelon,M., FrezaI,J., Rey,J., and Munnich,A. 1989. Molecular genetics of phenylketonuria in Mediterranean countries. A mutation associated with panial phenylalanine bydroxylase deficiency. Am J Hum Genet 44:511-517. 71. White,J.E., Kroomal,R.A., and Acosta,P.B. 1982. Excess weigbt among • cbildren witb phenylketonuria. J Amer Coll Nutr 1:293-303. 45 72. McBurnie,M.A., Kronmal,R.A., Schuett,V.E., Koch,R., and Azeng,C.G. 1991. Physical growth of children treated for pbenylketonuria. AM Hum • B;0118:357-368. 73. Griffiths,P., Tarrini,M., and Robinson,P. 1997. Executive fonction and psychosocial adjustment in children with early treated pbenylketonuria: correlation with historical and concurrent phenylalanine levels. J Intellect D;sabil Res 41:317-323. 74. Kalverboer,A.F., van der Schot,L.W.A., Hendrikx,M.M.H., Huisman,J., Slijper,F.M.E., and Stemerdink,B.A. 1994. Social bebaviour and task orientation in early-treated PKU. Acta Paediatr Suppl 407:104-105. 75. Ris,M.D., Weber,A.M., Hunt,M.M., Berry,H.K., Williams,S.E., and Leslie,N. 1997. Adult psychosocial outeome in early-treated phenylketonuria. J [nherlt Metab Dis 20:499-508. 76. Zygulska,M., Eigel,A., Pietrzyk,J.J., and Horst,J. 1994. Phenylketonuria in Southem Poland: A new spliee mutation in ÎDtron 9 al the PAH locus. Hum Mut 4:297-299. 77. Burgard,P., Armbruster,M., Schmidt,E., and Rupp,A. 1994. Psychopathology of patients treated for phenylketonuria: results of the German collaborative study of phenylketonuria. Âcta Paediatr Suppl 407:108-110. 78. Waisbren,S.E. and Levy.H.L. 1991. Agoraphobia in phenylketonuria. J Inher Metab Dis 14:755-764. 79. Lau,R.C., Güttler,F., Lykkelund,C., Brubn,P., and Niederwiesser,A. 1985. • Decreased vigilance and neurotransmitter synthesis after discontinuation of 46 dietary treatment for phenylketonuria in adolescents. Eur J Pediatr 144:17... • 20. 80. Matthews,W.S., Barabas,G., Cusack,E., and Ferrari,M. 1986. Social quotients ofchildren with phenylketonuria before and after discontinuation of dietary treatment. Am J Ment Dejie 91:92-94. 81. Smith,I. 1985. The Hyperphenylalaninemias. In Genetie and Metabolic Disease in Pediatries. I.K.Lloyd and Scriver,C.R., editors. Butterwonbs, London. 1~166. 82. Krause,W., Epstein,C., Averbrook,A., Dembure,P., and Elsas,L. 1986. Phenylalanine alters the Mean power frequeney of electroeneepbalograms and plasma L ...DOPA in treated patients with phenylketonuria. Pediat Res 20: 1112-1116. 83. Biek,U., Fabrendorf,G., Ludoph,A.C., Vassallo,P., Weglage,I., and Ullrich,R. 1991. Disturbed myelination in patients with treated hyperphenylalaninemia: Evaluation with magnetie resonanee imaging. Eur J Pediatr 150: 185-189. 84. Scriver,C.R., Kaufman,S., Eisensmith,R., and Woo,S.L.C. 1995. The Hyperphenylalaninemias. In The Metabolic and Molecular Bases ofInherlted Disease. (7 ed.) Scriver,C.R., Beaudet,A.L., Sly,W.S., and Valle,D., editors. MeGraw Hill Book Co, New York. 1015-1075. 85. Christensen,H.N. 1982. Interorgan amino aeid nutrition. Physiol Rn 62: 1193-1233. 86. Christensen,H.N. 1986. Where do the depleted plasma amino acids go in • phenylketonuria? Biochem J 236:929-929. 47 87. Christensen,H.N. 1987. Hypothesis: Where the depleted plasma amino acids • go in phenylketonuria, and why. Persp Biol Med 30:186-186. 88. Thalbammer,O., Pollak,A., Lubec,G., and Konigshofer,H. 1980. Intracellular concentrations of phenylalanine, tyrosine and a-aminobutyric acid in 13 homozygotes and 19 heterozygotes for PKU compared with 26 normals. Hum Genet 54:213-216. 89. Tbalbammer,O., Lubec,G., Konigsbofer,H., Scheibenreiter,S., and Coradello,H. 1982. Intracellular phenylalanine and tyrosine concentration in homozygotes and heterozygotes for phenylketonuria (PKU) and hyperphenylalaninemia compared with normals. Hum Genet 60:320-321. 90. Andrews,T.M., McKeran,R.O., Watts,R.W.E., McPherson,K., and Lax,R. 1973. Relationsbip between the granulocyte content and the degree of disability in phenylketonuria. QJ Med New Ser XLII:805-817. 91. De Cespedes,C., Thoene,J.G., Lowler,K., and Christensen,H.N. 1989. Evidence for inhibition of exodus of small neutra1 amino acids from non brain tissues in byperphenylalaninemic rats. J Inher Metab Dis 12:166-180. 92. Krause,W., Halmjnski,M., McDonald,L., Demure,P., Salvo,R., Friedes,S.R., and Elsas,L. 1985. Biochemical and neuropsychological effects of elevated plasma phenylalanine in patients wim treated phenylketonuria. J ain Invest 75:4048. 93. Paans,A.M.J., Pruim,J., Smit,G.P.A., Visser,G., Willemsen,A.T.M., and UlIricb,K. 1996. NeurotraDSmitter positron emission tomographic-studies in adults with pbenylketonuria, a pilot study. EUT J Pediatr 155:S78-581. 94. Hyland,K. 1999. Presentation, diagnosÎS, and treatment of the disorders of • monoamine neurotraDSmitter metabolism. Semin Perinatol23:194-203. 41 95. MoUer,H.E., Weglage,J., Widermann,D., and UlIrich,K. 1998. Blood-brain barrier phenylalanine transport and individual w1nerability in • phenylketonuria. J Cereb Blood Flow Metllb 18:1184-1191. 96. MoUer,H.E., Weglage,J., Widermann,D., Vermathen,P., Bick,U., and Ullrich,K. 1997. Kinetics of phenylalanine transport al the human blood brain barrier investigated in vivo. Brain Res 1997:329-327. 97. Moats,R.A., Koch,R., Moseley,K., Guldberg,P., Guttler,F., Boles,R.G., and Nelson,Jr.M.D. 2000. Brain phenylalanine concentration in the management ofadults with phenylketonuria. J [nher Metab Dis 23:7-14. 98. Weglage,J., Wiedermann,D., Môller,H., and U1lrich,K. 1998. Pathogenesis of different clinicaI outeomes in spite of identica1 genotypes and comparable blood phenylalanine concentrations in phenylketonurics. J [nher Metab Dis 21:181-182. 99. Pardridge,W.M. 1998. Blood-brain barrier carrier-mediated transpon and brain metabolism of amino acids. Neurochem Res 23:635-644. 100. Swaiman,K.K. and Wu,S.R. 1984. Phenylalanine and phenylacetate adversely affect developing mammalian brain neurons. Neurology 34:1246. 101. Heuther,G. and Neuhoff,V. 1981. Use of a-methylphenylalanine for studies of brain development in experimental phenylketonuria. J [nher Meta/) Dis 4:67-68. 102. Heuther,G., Neuhoff,V., and Kaus,R. 1983. Brain development in experimentaI hyperphenylalaninemia: disturbed proliferation and reduced ceU numbers in the cerebellum. Neuropediatrics 14:12-19. • 49 103. Jobnson,R.C. and Sbah,S.N. 1984. Effect of hyperphenylalaninemia induced during suelding on brain DNA metabolism in rat pups. Neurochem Res • 9:S17. 104. Hommes,F.A. 1994. Loss of neurotransmitter receptors by hyperphenylalaninemia in the HPH-S mouse brain. Âcta Paediatr Suppl 407:120-121. lOS. Bauman,M.L. and Kemper,T.L. 1982. Morphologie and bistoanatomie observations of the brain in UDtteated human phenylketonuria. Âcta Neuropathol S8:SS-63. 106. Hommes,F.A. and Moss,L. 1992. Myelin turnover in hyperphenylalaninaemia. A re-evaluation with the HPH-S mouse. J [nher Metab Dis IS:243-2S1. 107. Cbangeux,J.P. and Danchin,A. 1976. Selective stabilization of developing synapses as a mechanism for the specification of neuronal networks. Nature 264:70S-712. 108. Reynolds,R., Burri,R., and Herschkowitz,N. 1993. Retarded development of neurons and oligodendroglia in rat forebrain produced by hyperphenylalaninemia results in permanent deficits in myelin despite loog recovery periods. Exp Neurol. 124:357-367. 109. Dyer,C.A., Kendler,A., Pbüibotte,T., Gardiner,P., Cruz,J., and Levy,H.L. 1996. Evidence for central nervous system glial eeU plastieity in phenylketonuria. J Neuropalh & Exper Neurol 5S:795-814. 110. Hommes,F.A. 1993. The effect of hyperphenylalaninaemia on the muscarinic acetyleholine receptor in the HPH-S mouse brain. J [nher Metab • Dis 16:962-974. so 111. Levy,H.L., Lenke,R.R., and Koch,R. 1984. Lack of fetal effect on blood phenylalanine concentration in maternaI phenylketonuria. J Pediatr 104:245 • 247. 112. Levy,H. and Gbavami,M. 1996. Maternai phenylketonuria: A metabolic teratogen. Teratology 53:176-184. 113. Rouse,B., Matalon,R., Koch,R., Azen,C., Levy,H., Hanley,W., Trefz,F., and De La Cruz,F. 2000. Maternai phenylketonuria syndrome: Congenital hean defects, microeephaly, and developmental outeomes. J Pediatr 136:57 61. 114. Scriver,C.R. 1967. TreabDent in Medical Genetics. In Proceedings of the Third International Congress of Human Genetics. J.F.Crow and Neel,J.V., editors. The Johns Hopkins Press, Baltimore. 45-56. lIS. Lenke,R.R. and Levy,H.L. 1980. MaternaI phenylketonuria and byperphenylalaninemia. An international survey of untreated and treated pregnancies. New Engl J Med 303:1202-1208. 116. Platt,L.D., Koch,R., Hanley,W.B., Levy,H.L., Matalon,R., Rouse,B., Trefz,F., De La Cruz,F., Guttler,F., Azen,C. et al. 2000. The International Study of Pregnancy Outeome in Women wim MaternaI Pbenylketonuria. Repon ofa 12-year study. Am J Obstet GynecoI182:326-333. 117. Guttler,F., Azen,C., Guldberg,P., Romstad,A., Hanley,W.B., Levy,H.L., Matalon,R., Rouse,S.M., Trefz,F., De La Cruz,F. et al. 1999. Relationship among genotypes, biochemical phenotype, and cognitive performance in females wim phenylalanine hydroxylase deficiency: Repon from the Matemal Pbenylketonuria CoUaborative Study. Pediatries 104:258-262. • SI 118. Waisbren,S.E., Cbang,P., Levy,H.L., Shifrin,H., Al1red,E., Azen,C., De La Cnaz,F., Hanley,W., Koch,R., Matalon,R. et al. 1998. Neonatal • neurological assessment of offspring in maternai phenylketonuria. J Inher Metab Dis 21 :39-48. 119. Hanley,W.B., Plan,L.D., Bacbman,R.P., Buist,N., Geraghty,M.D., Isaacs,J., Q'Flynn,M.E., Rhead,W.J., Seidlitz,G., and Tishler,B. 1999. Undiagnosed maternaI phenylketonuria: The need for prenatal selective screening or case finding. Am J Obstet GynecoI180:986-994. 120. Scriver,C.R. 1966. Principles of dietary tberapy in hereditary metabolic disease. In Nutrition and Inherited Diseases of Man. L.E.Schacth and Reardon,E., editors. The Minnesota Dept. of Health, Education & Welfare, 87-98. 121. Kirkman,H.N. 1982. Projections of a rebound in frequeney of mental retardation from phenylketonuria. Appl Res Ment Retard 3:319-328. 122. Thompson,G.N., Francis,D.E.M., Kirby,D.M., and Compton,R. 1991. Pregnancy in phenylketonuria: Dietary treatmenl aimed al nonnalizing maternaI plasma phenylalanine concentration. Arch Dis Child 66:1346-1349. 123. McDonald,J.D. 1994. The PKU mouse project: its history, potential and implications. Aaa Paediatr 407:122-1123. 124. Hoshiga,M., Hatakeyama,K., Watanabe,M., Shïmada,M., and Kagamiyama,H. 1993. Autoradiographie distnbution of P4C) tetrahydrobiopterin and its developmental change in mice. J Phannacol cl &per Therapeut 267:971-978. 125. Denny,P. and Justice,M.J. 2000. Mouse as the measure of man? TlG • 16:283-287. S2 126. Hrabé de Angelis,M. and Balling,R. 1998. Large scale ENU screens in • mouse: genetics meets genomics. Mutat Res 4OO:2S-32. 127. McDonald,J.D. 1995. Using bigh-efficiency mouse germline mutagenesis ta investigate complex biological phenomena: genetic diseases, behavior, and development. Proc Soc Exp Biol Med 209:303-308. 128. Nadeau,J.H. 1989. Maps of lineage and synteny homologies between mouse and man. TlG S:82-86. 129. Ledley,F.D., Grenett,H.E., Dunbar,B.S., and Woo,S.L.C. 1990. Mouse phenylalanine bydroxylase. Homology and divergence from human phenylalanine hydroxylase. Biochem.J. 267:399-405. 130. Browo,S.D.M. 1998. Mouse models of genetic disease: New approaches, new paradigms. J [nher Metab Dis 21:532-539. 131. Nolan,P.M., Petecs,J., Strivens,M., Rogers,D., Hagan,J., Spurr,N., Gray,I.C., Vizor,L., Brooker,D., Whithill,E. et al. 2000. A systematic, genome-wide, pbenotype-driven mutagenesis programme for gene function studies in the mouse. Nat Genet 2S:440-443. 132. Hrabé de Angelis,M., Flaswinkel,H., Fuchs,H., Ratbkolb,B., Soewano,D., Marscball,S., Heffner,S., Pargent,W., Wuensch,K., Jung,M. et al. 2000. Genome-wide, large-scale production of mutant mice by ENU mutagenesis. Nat Genet 25:444 447. 133. Russell,W.L., Kelly,E.M., Hunsicker,P.R., Bangham,J.W., Maddux,S.C., and Phipps,E.L. 1979. Specifie locus test shows ethylnitrosourea ta be the Most patent mutagen in the mouse. hocNatl ÂcQ(J Sei 76:5818-5819. 134. Russell,W.L., Hunsicker,P.R., Raymer,G.D., Steele,M.H., Stelzner,K.F., • and Tbompson,H.M. 1982. Dose response curve for ethylnitrosourea 53 specific-locus mutations in mouse spermatogonia. Proe Hml Acad Sei • 79:3589-3591. 135. Brown,S.D.M. and Nolan,P.M. 1998. Mouse mutagenesis - systematic studies of mammalian gene function. Hum Molec Genet 7:1627-1633. 136. McDonald,J.D., Bode,V.C., Dove,W.D., and Sbedlovsky,A. 1990. The use of N-ethyl-N-nitrosouria to produce mouse models for buman pbenylketonuria and hyperpbenylalaninemia. Prog Qin Biol Res 34OC:407 413. 137. Bode,V.C., McDonald,J.C., Guenet,J.-L., and Simon,S. 1988. hph-l: A mouse mutant with bereditary byperpbenylalaninemia induced by ethylnitrosourea mutagenesis. Geneties 118:299-305. 138. Shediovsky,A., Guenet,J.-L., Jobnson,L.L., and Dove,W.F. 1986. Indication of recessive letba1 mutation in the TI1-H-2 region of the mouse genome by a point mutagen. Genet Res 47:135-142. 139. McDonald,J.D., Bode,V.C., Dove,E.F., and Sedlovsky,A. 1990. Pahllpb-': A mouse mutant deficienl in phenylalanine bydroxylase. hoc Natl Acad Sei Us.4 87: 1965-1967. 140. McDonald,J.D. and Bode,V.C. 1988. Hyperphenylalaninemia in the hph-l mouse mutant. Pediatr Res 23:63-67. 141. Sbediovsky,A., McDonald,J.D., SymuJa,D., and Dove,W.F. 1993. Mouse models of buman pbenylketonuria. Genetics 134:1205-1210. 142. McDonald,J.D. and Cbarlton,C.K. 1997. Characterization of mutations al the mouse pbenylalanine hydroxylase locus. Genomics 39:402-405. • 54 143. Zagreda,L., Goodman,J., Druin,D.P., McDonald,D., and Diamond,A. 1999. Cognitive deficits in a genetic mouse model of the most common • biochemical cause of human mental retardation. J Neurosci 19:6175-6182. 144. Puglisi-A1legra,S., Cabib,S., Pascucci,T., Ventura,R., Cali,F., and Romano,V. 2000. Dramatic brain aminergie defieit in a genetie mouse model of phenylketonuria. Neurochemistry Il:1361-1364. 145. McDonald,J.D., Dyer,C.A., Gailis,L., and Kirby,M.L. 1997. Cardiovascular defects among the progeny of mouse phenylketonuria females. Pediat Res 42:103-107. 146. Treacy,E., Pitt,J.J., Seller,J., Thompson,G.N., Ramus,S., and Cotton,R.G.H. 19%. In vivo disposai of phenylalanine in phenylketonuria: A study of two siblings. J [nher Melab Dis 19:595-602. 147. Kaufman,S. 1989. An evaluation of the possible neurotoxicity of Metabolites ofpbenylalanine. J Pediatr 114:895-900. 148. Loo,Y.H., Scotto,L., and Homing,M.G. 1977. Aromatic acid Metabolites of pbenylalanine in the brain of the hyperphenylalaninemic rat: effect of pyridoxamine. J Neurochem 29:411-415. 149. Perry,T.L., Hansen,S., Tischler,B., Bunting,R., and Diamond,S. 1970. Glutamine depletion in pbenylketonuria. A possible cause of mental defect. N Engl J Med 282:761-766. ISO. Wadman,S.K., Kettïng,D., De Bree,P.K., Van Der Heiden,C., Grimberg,M.I., and Kruijswijk,H. 1975. Permanent chemical phenylketonuria and a normal phenylalanine tolerance in IWO sisters witb a • normal mental development. Qin Chim Âcta 65:197-204. 55 151. Knox,W.E. 1972. Phenylketonuria. In The Metabolic Basis of Inherited Disease. (3 ed.) J.B.Stanbury, Wyngaarden,J.B., and Fredrickson,D.S., • editors. McGraw Hill Book Co., New York. 266-295. 152. Scriver,C.R., Kaufmao,S., and Woo,S.L.C. 1989. The Hyperphenylalaninemias. In The Metabolic Basis of Inherited Disease. (6 ed.) Scriver,C.R., Beaudet,A.L., Sly,W.S., and Valle,D., editors. McGraw Hill Book Company, New York. 495-546. 153. Scriver,C.R. and Treacy,E.P. 1999. Is there treatment for "genetic" disease? Mol Genet Metab 68:93-103. 154. Dickel,H., Gerrard,J., and Hickmaos,E.M. 1954. Influence of phenylalanine intake on the chemistry and bebaviour of a phenylketonuric child. Acta Paediat 43:64. 155. Woolf,L.I., Griffitbs,R., and Moncrieff,A. 1955. Treannent of phenylketonuria with a diet low in phenylalanine. Brit Med J 1:57-64. 156. Armstrong,M.D. and Tyler,F.H. 1955. Studies on phenylketonuria. I. Restriction phenylalanine intake in phenylketonuria. J Clin Invest 34:565 580. 157. Woolf,L.I., Griffitbs,R., and Moncrieff,A. 1955. Treatment of phenylketonuria with a diet low in phenylalanine. Brit Med JI:57-64. 158. Gerrard,J.W. 1994. Phenylketonuria revisited. ain Invest Med 17:510-513. 159. Bickel,H. 1996. The tirst treatment of phenylketonuria. EUT J Pediatr 155:S2-S3. • 56 160. Gutbrie,R. and Susi,A. 1963. A simple pbenylalanine metbod for deteetiDg phenylketonuria in large populations of newbom infants. Pediatries 32:318 • 343. 161. MacDonald,A., Rylance,G.W., Asplin,D., Hall,S.K., and Bootb,I.W. 1998. Does a single plasma phenylalanine predict quality of control in phenylketonuria? Arch Dis Child 78: 122-126. 162. Cockbum,F. and Clark,B.J. 19%. Recommendations for protein and amino acid intake in pbenylketonuric patients. Eur J Pediatr 155:S125-5129. 163. Endres,W. 1998. Diet in pbenylketonuria: How long? AM Nutr Metab 42:63-67. 164. Young,V.R. and PeUen,P.L. 1987. Protein intake and requirements witb reference 10 diet and bealth. Amer J Qin NUlr 45: 1323-1323. 165. American Academy of Pediatrics. 1976. Committee on Nutrition. Special diets for infants with inbom errors of metabolism. Pediatries 57:783-783. 166. Medical Researcb COUDeil Working Party on Phenylketonuria. 1993. Pbenylketonuria due to phenylalanine hydroxylase deficieney: an unfolding stary. BMJ 306:115-119. 167. Medical Research Council Working Party on Phenylketonuria. 1993. Recommendations on the dietary management of phenylketonuria. Areh Dis Child 68:426-427. 168. TiefentbaIer,M., Seidl,R., Scheibenreiter,S., Wandl-Vergesslieh,K., and Stoelder-Ipsiroglu,S. 1999. An aduIt patient with phenylketonuria before and one year after reinstitution of diet therapy. Wiener Klinisehe Wochensehrijt • 111:33-36. 57 169. Cockbum,F., Barwell,B.E., Brenton,D.P., Cbapple,l., Clark,B., Curzon,G., Davidson,D.C., Heeley,A.l., Laing,S.C., Lister-Cheese,I.A.F. • et al. 1993. RecommendatioDS on the dietary management of pbenylketonuria. Arch Dis Childh 68:426-427. 170. Griffitbs,P., Campbell,R., and Robinson,P. 1998. Executive function in treated pbenylketonuria as measured by the one-back and two-back versions ofthe continuous performance test. J [nherlt Metab Dis 21: 125-135. 171. Smith,I., Beasley,M.G., and Ades,A.E. 1990. Intelligence and quality of dietary treatment in pbenylketonuria. Arch Dis Childh 65:472478. 172. Koch,R., Moseley,K. , Ning,J., Romstad,A., Guldberg,P., and Gün1er,F. 1999. Long-term beneficial effects of the phenylalanine-restricted diet in late-diagnosed individuals with Pbenylketonuria. Mol Genet Metab 67:148 155. 173. lmura,K. and Okada,A. 1998. Amino acid metabolism in pediatric patients. Nutrition 14:143-148. 174. Duran,G.P., Rohr,F.I., Solnim,A., Guttler,F., and Levy,H.L. 1999. Necessity of complete intake of pbenylalanine-free amino acid mixture for metabolic control of phenylketonuria. J Am Diet Assoc 99:1559-1563. 175. de Freitas,O., Izumi,C., Lara,M.G., and Greene,L.J. 1999. New approacbes to treatment of PKU. NUIT Rev 57:65-70. 176. Smith,l. 1994. Treatment of phenylalanine hydroxylase deficiency. Aaa Paediat 407:60-65. 177. Cockburn,F., Clark,B.J., Caine,E.A., Harvie,A., Farqubarson,J., • Jamieson,E.C., Robinson,P., and Logan,R.W. 1996. Fatty acids in the 58 stability of neuronal membrane: Relevance to PKU. Internat Pediatr Il:56 • 60. 178. Riva,E., Agostoni,C., Biasucci,G., Trojan,S., Luotti,D., Fiori,L., and Giovannini,M. 1996. Early breastfeeding is linked to higher intelligence quotient scores in dietary treated phenylketonuric children. Acta Paediatr 85:56-58. 179. Gropper,S.S., Acosta,P.B., Clarke-Sbeehan,N., Wenz,E., Cbeng,M., and Kocb,R. 1988. Trace element status of children witb PKU and normal cbildren. J Amer Dietet Assoc 88:459-465. 180. Giovannini,M., Agostoni,C., Biasucci,G., Rottoli,A., LuottÎ,D., Trojan,S., and Riva,E. 1966. Fatty acid metabolism in phenylketonuria. Eur J Pediatr 155:S132-S135. 181. Agostoni,C., Riva,E., GalIi,C., Marangoni,F., Lu0 tti,D., and Giovannini,M. 1998. Plasma arachidonic acid and serum thromboxane 82 concentrations in phenylketonuric cbildren are correlated with dietary compliance. Z Emtlhrungswiss 37:122-124. 182. Wannemacber,R.W.Jr., Klainer,A.S., Dinterman,R.E., and Beisel,W.R. 1976. The significance and mecbanism of an increased senon phenylalanine tyrosine ratio during infection. AmerJ Clin NUIT 29:997-1006. 183. Nielson,K.B., Wamberg,E., and Weber,J. 1979. Successful outeome of pregnancy in a phenylketonuric woman after low-phenylalanine diet introduced before conception. Lancet 1 1245. 184. Buist,N.R.M., Prince,A.P., Huntington,K.L., Tuerck,J.M., and Waggoner,D.D. 1994. A new amino &Cid mixture permits newapproacbes ta • the treatment ofphenylketonuria. Aaa Paediatr Suppl 407:75-77. S9 18S. Kecskemethy,H.H., Lobregt,D., and Levy,H.L. 1993. The use of gelatin capsules for ingestion of formula in dietary treatment of maternai • phenylketonuria. J [nher Metab Dis 16:111-118. 186. Hainline, B. E. and Ems-McClung, S. C. Gamma zein: a new high protein phe-free diet supplement. National PKU News 10(3), 1. 1999. 187. Ayares, O. and DtArcy, A. Alpha-lac: Another diet supplement on the horizon. National PIeU News 10(3), 2. 1999. 188. Vajro,P., Strisciuglio,P., Houssin,D., Huault,G., Laurent,J., Alvarez,F., and Bernard,O. 1993. Correction of phenylketonuria after liver transplantation in a child with cirrhosis. N Engl J Med 329:363. 189. Liu,T.-J., Kay,M.A., Darlington,G.J., and Woo,S.L.C. 1992. Reconstitution of enzymatic activity in hepatocytes of phenylalanine hydroxylase-deficient mice. Som.Celi and Molec.Genet. 18:89-96. 190. Cristiano,R.J., Smith,L.C., and Woo,S.L.C. 1993. Hepatic gene therapy: adenovirus enhancement of receptor-mediated gene delivery and expression in primary hepatocytes. Proc Natl Acad Sci USA 90:2122-2126. 191. Fang,B., Eisensmith,R.C., Li,X.H.C., Finegold,M.J., Shedlovsky,A., Dove,W., and Woo,S.L.C. 1994. Gene therapy for phenylketonuria: phenotypic correction in a genetically deficiency mouse model by adenovirus-mediated hepatic gene transfer. Gene Ther 1:247-254. 192. Lin,C.M., Tan,Y., Lee,Y.M., Cbang,C.C., and Hsiao,K.J. 1997. Expression of human phenylalanine hydroxylase activity in T lymphocytes of classical phenylketonuria children by retroviral-mediated gene transfer. J • [nher Metab Dis 20:742-754. 60 193. Harding,C.O., Wild,K., Cbang,D., Messing,A., and Wolff,I.A. 1998. Metabolic engineering as therapy for inbom errors of metabolism • development of mice witb phenylalanine bydroxylase expression in muscle. Gene Ther 5:677-683. 194. Kure,S., How,D.C., Obura,T., Iwamoto,H., Suzukî,S., Sugiyama,N., Sakamoto,O., Fujü,K., Matsubara,Y., and Narisawa,K. 1999. Tetrahydrobiopterin-respoosive phenylalanine hydroxylase deficiency. J Pediatr 135:375-377. 195. Hodgins,D. 1971. Yeast phenylalanine ammonia Iyase: purification, propenies of the identification of catalytica1ly essential dehydroalanine. J Biol Chem 246:2977-2985. 196. Hoskins,J.A., Holliday,S.B., and Greenway,A.M. 1984. The metabolism of cinnamic acid by healthy and pbenylketonuric adults: A kinetic study. Biomed Mass Speetrom Il:296-300. 197. Hodgins,D. 1971. Yeast phenylalanine ammonia Iyase. Purification, properties, and the identification of catalytica11y essential dehydroalanine. J Biol Chem 246:2977-2985. 198. Kane,J.F. and Fiske,M.J. 1985. Regulation of phenylalanine lyase in Rhodotorula glutinis. J BaeterioI161:963-966. 199. Orum,H. and Rasmussen,O.F. 1992. Expression in E. coli of the gene encoding phenylalanine ammonia-lyase from Rhodosporidium toruloides. Appl Microbiol BiotechnoI36:74S-748. 200. Ogata,K., Ucbiyama,K., Yamada,H., and Tocbikura,T. 1967. Metabolism of aromatic amino &Cid in microorganisms. Part ll. Properties of • phenylalanine ammonia-Iyase ofRhodotorula. AgrBiol Chem 31 :600-606. 61 201. Anson,J.G., Güben,H.J., Oram,J.D., and Minton,N.P. 1987. Complete nucleotide sequence of the Rhodosporidium toruloides gene coding for • phenylalanine ammonia-Iyase. Gene 58:189-199. 202. Appert,C., Logemann,E., Hahlbrock,K., Schmid,J., and Amrhein,N. 1994. Structural and catalytic propenies of the four phenylalanine ammonia-lyase isoenzymes for panley (Petroselinum crispum Nym). EUT J Biochem 225:491-499. 203. Tanaka,Y., Matsuoka,M., Yamanoto,N., Obasbi,Y., Kano-Murakami,Y., and Ozeki,Y. 1989. Structure and cbaracterization of a cDNA clone for phenylalanine ammonia-Iyase from cut-injured roots of sweet patata. Plant Physiol 90:1403-1407. 204. Wanner,L.A., Li,G., Ware,D., Somssich,I.E., and Davis,K.R. 1995. The phenylalanine ammonia-Iyase gene family in ATabidopsis thaliana. Plant Mol B;0127:327-338. 205. Razal,R.A., Ellis,S., Singh,S., Louis,N.G., and Towers,G.H.N. 1996. Nitrogen recycling in pbenylpropanoid metabolism. Phytochemistry 41 :31 35. 206. Rasmussen,O.F. and OeNDl,H. 1991. Analysis of the gene for phenylalanine ammonia-lyase ftom Rhodosporid;um toru/oides. DNA Seq 1:207-211. 207. Gilben,H.J., Clarke,I.N., Gilbson,R.K., Stephenson,J.R., and Tully,M. 1985. Molecular cloning of the phenylalanine ammonia lyase gene from Rhodosporidium toruloides inEscherida coli K-12. J BaeterioI161:314-320. 208. Hanson,K.R. and Ravir,E.A. 1970. L-phenylalanine ammonia-lyase IV. Evidence that the prostbetic group contains a dehydroalanyl residue and • mecbanism of action. Arch Biochem Biophys 141:1-17. 62 209. Gilbert,H.J. and Jack,G.W. 1981. The effect ofproteinases on phenylalanine • ammonia-lyase from the yeast and Rhodotorula glutinis. Biochem J 199:715 723. 210. Lager,M., Reck,G., Reed,J., and Rétey,J. 1994. Identification of serine-143 as the Most likely precursor of dehyroalanine in the active site of histidine ammonia-lyase. A study of the overexpressed enzyme by site-directed mutagenesis. Biochemistry 33:6462--6467. 211. Schuster,B. and Rétey,J. 1994. Serine-202 is the putative precursor of the active site dehydroalanine of pbenylalanine ammonia lyasc. Site-directed mutagenesis studies on the enzyme for panley (Petroselium crispum L.). FEBS un 349:252-254. 212. Levy,H.L., Taylor,R.G., and McInnes,R.R. 1995. Disorders of Histidine Metabolism. In The Metabolic and Molecular Basis oflnherited Disease. (7 cd.) Scriver,C.R., Beaudet,A.L., Sly,W.S., and Valle,D., editors. McGraw Hill Book Co., New York. 213. Hoskins,J.A., Jack,G., Wade,H.E., Peiris,R.J.D., Wright,E.C., Starr,D.J.T., and Stem,J. 1980. Enzymatic control of pbenylalanine intake in phenylketonuria. Lancet 1:392-394. 214. Hoskins,J.A. and Gray,J. 1982. Phenylalanine ammonia lyase in the management of pbenylketonuria: the relationship between ingested cinnamate and urinary hippurate in bumans. Res Commun Chem Pathol Pha17llQcoi 35:275-282. 215. Snapper,J., Chiang,T.F., and Cbiang,T.Y. 1940. hoc Soc Exp Biol Med 44:30-34. • 63 216. Christensen,H.N., Feldman,B.H., and Hastings,A.B. 1963. Concentrative • and reversible character of intestinal amino acid transport. Am J Physiol 205:255-260. 217. Bourget,L. and Cbang,T.M.S. 1986. Phenylalanine ammonia-lyase immobilized in microcapsules for the depletion of phenylalanine in plasma in phenylketonuric rat model. Biochim Biophys Acta 883:432-438. 218. Safos,S. and Cbang,T.M. 1995. Enzyme replacement therapy in ENU2 phenylketonuric mice using oral microencapsulated phenylalanine ammonia lyase: a preliminary report. Anijicial Cells, Blood Substitutes, & lmmobilization Biotechnology. 23:681-692. 219. Chang,T.M.S., Bourget,L., and Lister,C. 1995. A new theory of enterorecirculation of amino acids and its use for depleting UDwanted amino acids using oral enzyme-artificial cells, as in removing phenylalanine in phenylketonuria. Ani!Cells Blood Substit lmmobil Biotechnol23:1-21. 220. Fritz,R.R., Hodgins,D.S., and Abell,C.W. 1976. Phenylalanine ammonia lyase. Induction and purification trom yeast and clearance in mammals. J Biol Chem 251:4645-4650. 221. Wang,W. 1996. Oral protein drug delivery. J Drug Target 4:195-232. 222. Bourget,L. and Chang,T.M.S. 1985. Phenylalanine ammonia-Iyase îmmobilized in semipermeable microcapsuIes for enzyme replacement in phenylketonuria. FEBS Leu 180:5-8. 223. Bourget,L. and Chang,T.M.S. 1986. Pbenylalanine ammonia-Iyase îmmobilized in microcapsules for the depletion of phenylalanine in plasma in • phenylketonuric rat model. Biochim Biophys Âcta 883:432-438. 64 224. looue,S., Matsunaga,Y., Iwane,H., Sotomura,M., and Nose,T. 1986. • Entrapment of phenylalanine ammonia-Iyase in silk fibroin for protection from proteolytic attack. Biochem Biophys Res Commun 141:165-170. 225. Hovgaard,L., Jorgensen,S.W., Eigtved,P., Frokjaer,S., and Brondsted,H. 1998. Drug delivery studies in Caco-2 monolayers. VI. Studies of enzyme substitution therapy for phenylketonuria - a new application of Caco-2 monolayers. lnt J Pharm 161:109-114. 226. Ambms,C.M., Anthone,S., Norvath,C., Kalghatgi,K., Lele,A.S., Eapen,G., Ambrus,J.L., Ryan,A.J., and Li,P. 1987. Extracorporeal enzyme reactors for depletion of phenylalanine in phenylketonuria. AM Intem Med 106:531-537. • 65 CONNECTING TEXT • In this Cbapter, 1 describe the breeding ofENUI/2 compound bybrid strain. These animais were developed for two rea5OOS, Mt, because the majority of patients are heteroallelic and second because we needed a model tbat was more pliant 10 metabolic manipulation; as the already available ENUI animais were very difficult 10 control metabolically wbile the ENU2 animais were very fragile during long-term manipulation. To address these objectives, animais (ENUI, ENU2, ENU1/2, ENUI/+, ENU2/+, and BTBRIPas-wildtype counterpatts) were cbaracterised and compared. The animais were genotyped 10 verity strain. Measuring concentration ofphe in plasma and brain, presence of ÎlDJDunoreactive Pah protein and the level of Pah enzyme activity assessed their metabolic phenotype. They were also manipulated with a phe cba1lenge and characterised according 10 their rate of plasma phe clearance. Finally, the clinica1 phenotypes were evaluated according ta the effect of parental phenotype on fetal survival and by measuring behavioural outeome in each strain. • • CHAPTER2 A heteroallelic mutant mouse model: A new orthologue for human hyperphenylalaninemia Cbristineh N. Sarkissian, Danielle M. Boulais, J. David MeDonald, Charles R. Seriver Starus: Published in Molecular Genetics andMetobolism (69) 188-194. 2000. (Copyright <0 2000 by Academie Press) (http://www.apnet.eom) Reprimed by permission of the publisber • 67 ABSTRACT • Hyperphenylalaninemias (HPA) are Mendelian disorders resulting from deficiencies in the conversion of phenylalanine ta tyrosine. The vast majority are explained by a primary deficiency of phenylalanine bydroxylase (PAH) activity. The majority of untreated patients experience irreversible impairment of cognitive development. Althougb it is one of the best known hereditary metabolic disorders y mechanisms underlying the pathophysiology of the disease are still not fully understood; to tbis end y the availability of an onhologous animal model is relevant. Various mutant hyperpbenylalaninemic mouse models with an HPA phenotype, generated by N-ethyl-N-nitrosourea (ENU) mutagenesis at the Pah locus y bave become available. Here we repon a new hybrid strain, ENUl/2, with primary enzyme deficiency, produced by cross breeding. The ENUl, ENUl/2, and ENU2 strains display mild, moderate and severe phenotypes, respectively, relative to the control strain (BTBRIPas). The Pah enzyme activities of the various models correlate inversely with the corresponding phenylalanine levels in plasma and brain and the delay in plasma clearance response following a phenylalanine challenge. The maternai HPA effect on the fetus correlates direcdy witb the degree ofhyperphenylalaninemia; but ooly the ENU2 strain bas impaired learning. • 68 INTRODUCTION • Phenylketoouria (PKU) and related forms of non-PKU hyperphenylalaninemia (HPA) (OMIM 261600) are human autosomal recessive traits, cbaracterized by elevated levels of phenylalanine (phe) in body tluids. These Meodelian disorders result from defieieneies in phenylalanine hydroxylase enzyme (PAR) (Ee 1.14.16.1), whieh catalyzes the conversion of phenylalanine to tyrosine. Untreated patients have elevated levels of phenylalanine in body tluids. Those with persistent HPA from birth are likely to have irreversible impaïrmeot of cognitive developmenl. Furthennore, transplacental transpon of excess phe from the maternai pool to the fetus, during intrauterine development, puts offspring al risk for microcephaly and binh defects. Tbese disease-causing effects of PKU and maternai HPA are preveotable by treatment tbat restores euphenylalaninemia (1). Although PKU is one of the best known hereditary metabolie disorders, the mecbanism underlying the pathophysiology is still not fully understood (2). Funhermore, the curreot dierary treatment of the human disease is not optimal for either compüance or fully normal cognitive outeome. To tbis end, the availability of an onbologous animal model is relevant (3;4). Chemically induced HPA in the rat had long served as the animal "model" for "PKU", however, il had many imperfections (5). These were avoided when a mutant HPA mouse model generated by N-ethyl-N-nitrosourea mutagenesis (6;7) manifesting alI forms of the bannful HPA phenotype, became available (1;8). The mice thus generated had autosomal recessive forms of HPA representing bath locus and aIlelic heterogeneity; for example, the strain first identified (9), called hph-1, was mutated al the GTP-eH locus (10); GTP-eH catalyzes the first step in biosynthesis of tetrahydrobiopterin, a cafaetor essential for hydroxylase activity. Subsequently, other strains all mutated at the Pah locus, but with varying degrees of phenotypic severityl (ortbologues of human PKU and DOD-PKU HPA), became s l palf"'"ll mice with an HPA phenotype were initially named the Pah_ strain; • p~ mice are the PKU counterpart. 69 available (3;8). Here we report a hybrid strain (PahDUl1~, produced by crossing a • homozygous female paJf"'"11 non-PKU HPA mouse with a heterozygous male pa}f'"'2'+ PKU carrier. We describe the organismal phenotypes of the control (BTBRIPas) and mutant straiDs (paJf"'"11 and Pahlftll2l2, the heteroallelic PahBIM/12 strain, and their carrier counterpans), their corresponding metabolic parameters, hepatic Pah enzyme activity, blood and brain phe levels, bebavioral parameters and corroborate prior evidence of maternaI HPA effect on the fetus. We also discuss how this mouse model is heing used 10 measure the response to an alternative therapy for PKU by enzyme substitution with phenylalanine ammonia lyase (BC 4.3.1.5) to degrade excess dietary and endogenous phenylalanine (II). MATERIALS AND METROns ENU Mice Wildtype mice (BTBRlPas background) were treated with alkylating agent (N-ethyl-N-nitrosourea) and mutations mapping to the mouse phenylalanine hydroxylase locus (Pah) were identified by byperphenylalaninemia, a metrical metabolic trait (3;7). The original straiDs paJf"'"11 (phenotype name, ENUI) and Pahnuûl2 (ENU2), kindly given 10 us by W. Dove and A. Sbedlovsky, were bred in Madison, Wisconsin (3;7) and later genotyped (12). The hybrid beteroallelic strain (PahDUl112, ENU1/2) was bred in Montreal, Canada as described berc. The homozygous mutant ENUI mouse is a counterpan of buman non-PKU HPA (7;8); it expresses a missense mutation (c.364T ~ C, VI06A) in exon 3 of the Pah gene (12). The homozygous mutant ENU2 mouse is a counterpan of buman PKU (3;8); il expresses a missense mutation (c.835T -+ C, F263S) in exon 7 of the Pah gene (12). The ENU1/2 strain was developed by selective mating of ENUI ~ x Pa}f'"'2'+(ENU2/+)d. Genotypes at the Pah locus of ail breeders and offspring were verified by DNA aoalysis. AlI procedures descnbed below were • reviewed and approved by the Animal Cale Committee al McGiIl University. 70 Metabolic Manipulation ofAnimal Models • Plasma and brain phe levels were measured in ail mice when fed on breeder mouse chow (Teklad 8626) (Madison, WI). ENU2 mice were then made euphenylalaninemic by placing tbem, for 3 consecutive days, on solid diet devoid of phe (Teldad 97152) supplemented wim water containing 30 mglL L-phe; then injected wim L-phe (1.1 mglg body M, subcutaneously) to produce a controUed predictable HPA state. ENUI and ENU1/2 mice do oot show the HPA state on normal diet; a predictable degree of HPA was produced in these strains by subcutaneous injection of L-phe (1.1 mglg). Metabolic cbaracterizalion Time-dependent plasma clearance of phe was measured after subcutaneous injection of the standard dose of L-phe in the ENUl y ENUI/2 and euphenylalaninemic ENU2 animais. Plasma phe was measured at baseline (zero br) and 1y 2 and 3 br post-ebalIenge. We use this parameter as a measure of phe "runout". Pah Enzyme Assay Liver tissues were prepared and stored at -SOOC until analysis. Protein concentration was measured using the Bio-Rad protein assay kit (Hercules, CA). The assay (13-15), measuring the conversion of [U_14C]-L-phe ta labeled tylOSiney was modified as foUows. Homogenate (100 J.1g) and 0.4 mM 6 methyltetrabydropterin (6-MPH4) (Scbircks Labsy Jona, Switzerland) were added ta the reaction mixture (0.1 M potassium phosphate buffer (pH 6.S), 1000 units catalase (Sigma-Aldrichy Oakville, Ontarioy Canada)y 0.3 mM L-phe, 4 x lOS cpm [U_14C]phe (DuPont NENy Boston, MA) and 10 mM ditbiotbreitol (lCNy Costa Mesa, CA» (final reaction volume = 2SO JJ1). The samples were incubated (with • shaking) al 25° C for 1 br, then boiled for 5 min, plaœd on ice, and aoalyzed 71 accordiDg to Ledley et al. (15). Preliminary experiments established linearity of • activity versus protein concentration and incubation time. Western Blots Liver was homogenized in buffer containing 50 mM Trizma (pH 8.0), ISO mM NaCl, 1% (v/v) NP-40, 0.3 J,LM aprotinin (Roche Molecular Biochemica1s, Laval Quebec, Canada), and 1 mM Pefabloc (Roche Molecular Biocbemica1s). Samples were electrophoresed on 10% SDS-polyacrylamide gel, transferred ta Hybond-e extra nitrocellulose (Amersham, Little CbaifODt, Buckinghamshire, England) and immunoblotted, to deteet mouse Pab protein, widl 1 f,lgIml antï-mouse PHS primary antibody (PbarMingen, Missisauga, Ontario, Canada) (16), deteeted with peroxidase-Iabeled anti-mouse anbbody (1:1000 dilution) (Amersbam) and developed with RPN 2109 ECL (Amersbam). Human PAR was used as a positive control. Effect of Parental PhenotYpe on Fetal Survîval Females were introduced to tbeir breeding pannen immediately foUowing sexual maturity. The phenotypes for the foUowing female homozygous and compound genotypes were studied: wildtype BTBRIPas (Control), ENUl, ENU1/2, ENU2, and heterozygous ENUl/+, ENU2I+. Various male genotypes (and phenotypes) were also studied for possible patemal affect. The effect of maternai HPA on progeny was measured by counting the number of litters and number of progeny al binh and weaning. Blood phe was measured in the dam prior ta breeding and al delivery and weaning. Tests ofBebavior The T-maze a1temation test was conducted as descnbed by Nasir et al. (17). A Win-Stay eighl-arm radial maze task was conducted 1 week following the • completion of the T-maze tests. The latter task, modified as descnbed by 72 Seamans and Phi1Iips (18) and Nasir et al. (17), coDSists of a central octagonal platform with eight anus radiating from the middle (35 x 9 x 12 cm); eight 6-W • Hght bulbs mounted direcdy above food cups (-4cm from the base) were placed at the end of each arm. On the tirst 2 days the mice were acclimated to the maze for 10 minutes; DO food was introduced. For the foUowing three days, the animais were tested (two trials/day). On each trial day, four randomly selected anus were lit and baited with KeUogg's Froot Loops (Etobicoke, Ontario, Canada) cereal. FoUowing food consumption, the light was tumed off. ACter ail four peUets had been retrieved (max. lime alIowed, 10 min) the animal was removed for a 5 min period and then placed back into the maze where the same four arms were lit and baited once again. The arm choices, the time latencies (s/min) ta reach the food in the tirst arm chosen, and the total lime required to complete the daily trial was recorded. DNA Analysis Animais were genotyped for wildtype and mutant alleles as descnbed (11;12). Brain and Blood Samples The brain was removed within 5 s after death and bomogenized (on ice) in 0.1 %(w/v) sodium dodecyl sulfate (19). Allo-isoleucine was added as an internal standard; homogenate was then incubated for 15 min at room temperature foUowed by the addition of 1.5 % (v/v) 5-sulfosalicylic acid dihydrate solution then vonexed and centrifuged al 14,OOOg for 15 min. The supematant was extraeted and frozen al -SOOC until analysis. Blood was coUected from tail ioto heparinized tubes and plasma was obtained by centrifugation. • 73 Amino Acid Analysis Amino acids were measured by HPLC on a Beckman 6300 automatic • amino acid analyzer (Palo Alto, CA). Statistical Analysis We used sing1~factor analysis of variance (ANOVA) between the differeDt genotype5 (conducted for each factor measured).. The Poisson beterogeDeity test confirmed bomogeneity within genotype5. AIl values reported on figures and text are expressed as Mean ± SEM.. RESULTS Metabolic Manipulation and Catabolic Rates for Pbe ENU2 mice exlubit 10- ta 20-fold elevated plasma phe levels and 100fold 11 15 increase in brain phe levels (P = 1.13 X 10- and 4.7 x ur , respectively) when fed wim breeder mouse cbow (Fig.. 1); the corresponding measurements for the ENUI/2, ENUl, ENUI/+, ENU2/+ and BTBRIPas wildtype strains show near Donnai or normal values (ANOVA conducted between these genotypes showed P = 0 .. 17 and 0.. 7 respectively). After the standardized injection to induce HPA in the ENU2 (initially made euphenylalaninemic, see materials and methods), ENUl, and ENUI/2 animais, the time-depeDdent plasma clearance rates (catabolic rates) (Fig. 2) show that ENU2 animais bave the Most severe metabolic pbenotype, ENUI animais the least severe, and ENUI/2 mice an inteDDediate phenotype.. Pah Enzyme ActivilY We examined the relationship between hepatic Pah enzyme activity and plasma phe levels (Fig. 3). The ENU2 mice, witb undeteetable enzyme activity, bave the Most elevated plasma phe levels .. ENUI and ENUI/2 mîce, with -24 and S% normal enzyme activity, respectively, bave near normal plasma phe levels • under standard diet COnditiODS. ENU2/+, ENUl/+ heterozygotes with -49 and 74 61 % normal enzyme activity, bave normal plasma phe levels as expccted for a • recessive trait. EDZY!De Protein Levels Hepatic Pah protein levels, as visualized by immunoblotting of liver extracts, are different in the 3 ENU phenotypes (Fig. 4). These findings imply that enzyme stability may vary with genotype: The ENUI mutation apparendy affects stability (and therefore activity) of the protein, evident by the clearly reduced level of immunoreactive Pah. The ENU2 mutation, which impairs enzyme activity, may also affect stability; it produces somewhat diminished but easily deteetable protein, evident by the substantial amounts of immunoreactivity. The ENU1/2 compound is intermediate in bath protein stability and enzyme activity. These findings were consistent in 6 replicates. MaternaI Effect The ENU2 dams with severe HPA conferred a severe maternai effect on offspring; the other strains did DOt, the effect being dependent on the degree of HPA (Table 1). ANOVA analyses showed a significant reduction in the number of liners and of progeny at bi11h and of those surviving to weaning only from the ENU2 mothers (P < 0.00014 aDd 0.0008, respectively). Behavior The T-maze alternation test assesses simple discrimination learning and short-term memory; we observed impaired bebavior only in the ENU2 animais (Table 2). The Win-Stay eight-arm radial maze task measures reference memory, babit learning, and memory for a visual stimulus. Only the ENU2 model showed impaired behavior (Table 2). • 75 DISCUSSION • Animal models assist the study of disease phenotypes and potential therapies (20). Mouse models offer the added advantage in tbat their genomes are highly homologous with the human genome (21). In addition the mouse and human phenylalanine hydroxylase genes bave - 87% conservation of the nucleotide sequence, with -10% of the changes silent; the corresponding proteins bave 95% conserved amino acid sequences (15). Here we bave descnbed and compared mûJ2 nrul12 phenotypes of control (BTBRlPas) and mutant strains (paJf"'Ül1, Pah , Pah , and their heterozygous counterpans), the mutants being orthologues of human PKU and non-PKU HPA (Fig. 5). The ENUI mouse, which displays a mild phenotype (non-PKU HPA), carries a mutation in exon 3 (12) affecting the N-tenninal region of the enzyme distant from the catalytic residues of PAHIPab, recendy identified by crystallographic analysis of the human enzyme (22;23). The ENU2 counterpan bas a mutation in exon 7, which includes the catalytic region; the site is predicted to bave 1t-stacking interactions with the substrate (24). The resulting phenotype is PKU-like (12). The ENUl/2 heteroallelic counterpan displays an intermediate phenotype. Pah enzyme activities of the various models correlate inversely with the corresponding phe levels in plasma and brain and with plasma phe clearance lime. ENU2 mice with undeteetable enzyme activity bave - 2Q-fold elevated plasma and brain pbe levels, and the slowest clearance rate, wbile ENU1 and ENU1/2 mice with - 24 and 5 % normal enzyme activity, respectively, bave near normal plasma and brain phe levels and more normal clearance rates. The carrier counterparts, baving approximately baIf the normal enzyme activity, display normal plasma and brain phe levels. These metrical traits are thase expected for an autosomal recessive phenotype (2S). Pah protein shows different states of stability in the different ENU • phenotypes. The ENUI mutation results in protein instability, whereas the ENU2 76 mutation bas ooly a minor effect on tbis parameter. Stability in the ENU1/2 • compound is intennediate in comparison. The bebavioral assessment of ENU2 mice sbows impaired simple discrimination in sbon-tenn memory, reference memory, babit learning, and memory for a visual stimulus. The other genotypes were correspondingly unaffected in clinicat measures. These observations coneur witb earlier findings (26). The maternai effect on offspring correlates direcdy with the degree of HPA and is apparent ooly with the ENU2 mothers; the effect is completely independent of patemal genotype. These findings resemble buman data where maternai plasma phe levels below the 400 }lM range are usually associated with normal fetal outeome (1). The ENUl/2 mouse model bas been particu1arly useful for measuring the response ta an alternative therapy for PKU, namely oral administration of phenylalanine ammonia lyase in an effort ta degrade excess phe from the accumulated pools (11). Our present sttldies demoDStrate proof of principle, bath pbarmacological and physiological. The present report describes in detail the parameters available 10 measure the shon- and long-term responses ta tbis therapy and document the advantages of the ENU1/2 strain for tbis work. ACKNOWLEDGEMENTS This work was supponed in pan by the Medical Research COUReil (Canada), the Canadian Genetic Diseases NelWork (CGDN) (NelWorks of Centers of ExceUence), and a contraet for maintenance of the mice from mEX via CGDN. Studentship awards were supponed by the Garrod Association (Canada), McGill University-Montreal Cbildren's Hospital Research Institute, and The Auxiliary (Montreal Cbi1dren's Hospital). • 77 TABLE! • Maternai efl'ect on nomber and size of litters and survival to weaaiDg (Mean ± SE, II = S) MaterDal Average No. Avenge No. ofIitters AvengeNo. Average No. Geaotype of surviVÛII to ofproceay ofproceay Duerslmated weanlnglmeted at surviviDg to female female birtbllitter wean'nllUder Control 1.9 ± 0.2 1.6 ± 0.1 8.0±0.7 7.1 ±0.8 ENUl/+ 2.0±0.3 1.6 ± 0.5 S.1 ± 1.2 7.6 ± 1.4 ENU2I+ 3.1 ± 0.4 1.9±0.3 6.6±0.6 4.9±0.7 ENUI 2.7±O.2 1.9 ±0.2 6.2±0.5 5.0±O.5 ENUl/2 3.1 ± 1.3 2.1 ± 0.4 6.0±0.S 5.3 ±O.S ENU2 1.3 ± 0.2 O±a' 1.3 ± 0.9 o± (lb 4ANOVA, P < O.()(J()J4. bANOVA, P < 0.0008• • 7. TABLEZ • Bebavioralasse Dlent (Me8D ± SE, II =6) Test ENU2 Remaininl geDotypes SipiIlcaDce combiDed (P) T-mue a1temadoD test Increase in average time 20.7 ± 6.7 S.2-10.3 ±0.4-2.1 < O.OOS required 10 reach food (s) The Win-8tay eight-arm radial mue tut Reduction in the No. of S.S ±0.3 6.2-7.S±0.~.S < 0.03 entries inta initially lit arms Increase in average time S8.3 ± IS.S S.6-13.1 ± 1.3-1.9 < 4 x 1 Increase in average lime to 290.0 ± 36.0 71.8-138.6 ± 6.4-13.4 < 8 x 10-12 complete trials (5) • 79 • 1750 =:- 1250 ] j :i!, 750,J • 200 ) ISO .1 100 ... 50 o / ~,,?, ~~ ~' ~,!J- ~ Geaotype • Brain • Plasma FIG. 1. Plasma phe values (pM. Mean ± SE. n = 4): Control (BTBRlPas) mice. 91.2 ± 6 pM; ENUl/+. 58.5 ± 7; ENU2/+. 65.7 ± 1; ENUl, 93.4 + 8; ENU1/2, 147.0 ± 29; ENU2, 1697.4 ± 175. The corresponding brain phe values (pM, mean ± SE) are Control, 76.9 ± 6; ENUI/+, 120.3 ± 10; ENU2/+, 112.5 ± 5; ENUl, 123.6 + 1; ENUI/2, 150.7 ± 42; ENU2, 876.4 + 30. • 80 • 7000 ~ -; 6000 isooo ~ il: 4000 •a 3000 ; 2000 E 1000 o o 1 3 TÜDe(boun) FIG. 2. Plasma phe clearancè rates for A, ENUI; ., ENUI/2; and ., ENU2 animais loaded wim a standard dose ofphe (mean ± SE; n = 5). • 81 • IS00 ..-.. 2S0 ~ ~ ri} 200 JI JI ISO 1 100 a SO i FIG. 3. Pab enzyme activity vs plasma phe values in control and HPA phenotypes (mean ± SEM; n· 4). Enzyme activity and plasma phe levels of the ENUl/2 animaIs are intermediate compared to those of ENUI and ENU2 animaIs (P < 0.05). • 82 • - 220K - 97.4K -66K Pah+ -46K - 30K - 21.SK 1 1 3 4 567 DG. 4. Western blot for Pah protein in liver extraets (representative of 6 replicates). The -52-kDa band (arrow) is the Pah monomer; other faint bands represent non-specifie binding, confirmed by their absence with purified buman PAH (Jane 1) and their presence in the wildtype mouse strain (Iane 7). Lane 1: purified buman PAR (bPAH); Lane 2: ENU2, Lane 3: ENUl/2; Lane 4: ENUl; Lane S: ENUI/+; Lane 6: ENU2/+; Lane 7: Wildtype BTBRIPas. Rainbow Marker used for referenee. • 83 • OG.5. Classic mouse models of PKU and DOD-PKU HPA t induced by N.ethyl N-nittosourea (ENU) mutagenesis: At coDtrol BTBRIPas; B, Palf""l1+ heterozygous carrier/wildtype; Ct pa/f"'ÛII DOD-PKU HPA onhologue; Dt palf"'Ü'+ heterozygous carrier/wlldtype; Et p~ PKU onhologue; Ft pa/f"'Û12 heteroaUelic onhologue. • 14 • REFRENeES 1. Scriver,C.R., Kaufman,S., Eisensmith,R., and Woo,S.L.C. 1995. The Hyperpbenylalaninemias. In The Metabolic and Molecular Bases oflnherited Disease. (7 ed.) Scriver,C.R., Beaudet,A.L., Sly,W.S., and Valle,D., editors. MeGraw Hill Book Co, New York. 1015-1075. 2. Scriver,C.R. and Waters,P.J. 1999. Monogenic traits are oot simple. Lessons from pbenylketonuria. TlG 15:267-272. 3. Sbedlovsky,A., MeDonald,J.D., Symula,D., and Dove,W.F. 1993. Mouse models of buman pbenylketonuria. Genetics 134: 1205-1210. 4. MeDonald,J.D. 1995. Using high-efficieney mouse gennline mutagenesis to investigate complex biological phenomena: geoetic diseases, bebavior, and development. Proc Soc Exp Biol Med 209:303-308. 5. Scriver,C.R., Kaufman,S., and Woo,S.L.. C. 1989. The Hyperpbenylalaninemias. In The Metabolic Basis of Inberited Disease. Scriver,C.R.. , Beaudet,A.L., Sly,W.S., and Valle,D., edîtors. McGraw Hill Book Company, New York. 495-546. 6. Russell,W.L., KeUy,E .. M .. , Hunsicker,P.R., Bangbam,J.W., Maddux,S.C., and Phipps,E.L. 1979. Specifie locus test sbows ethylnitrosourea to be the most patent mutagen in the mouse.. hoc Nall Acad Sci 76:5818-5819. 7. MeDonald,J.D., Bode,V.C., Dove,E.F., and Sedlovslty,A. 1990. Pah1lpb-5: A mouse mutant defieient in pbenylalanine hydroxylase. Proc Nall Acad Sci U&f 87:1965-1967. 8 .. McDonald,J.D. 1994.. The PKU mouse project: its history, potential and • implications. Aaa Paediatr 407:122-1123.. 85 9. Bode,V.C., McDonald,J.C., Guenet,J.-L., and Simon,S. 1988. hph-l: A mouse mutant with bereditary hyperpbenylalaninemia induced by • etbylnitrosourea mutagenesis. Genetics 118:299-30S. 10. Montanez,C.S. and McDonald,J.D. 1999. Linkage anaIysis of the bpb-l mutation and the GTP cyclohydrolase 1 structural gene. Molec Genet cl Metab 68:91..92. Il. Sarkissian,C., Sbao,Z., Blain,F., Peevres,R., Su,H., Heft,R., Chang,T.M.S., and Scriver,C.R. 1999. A different approacb to treatment of phenylketonuria: Pbenylalanine degradation witb recombinant phenylalanine ammonia Iyase. hoc Natl Acad Sei 96:2339-2344. 12. McDonald,J.D. and Charltan,C.K. 1997. Cbaracterization of mutations at the mouse phenylalanine bydroxylase locus. Genomics 39:402-405. 13. Ledley,F.D., Grenen,H.E., and Woo,S.L. 1987. Biochemical cbaracterization of recombinant buman phenylalanine bydroxylase produced in Escherichia coli. J Biol Chem 262:2228-2233. 14. Kaufman,S. 1987. Phenylalanine 4-monooxygenase from rat liver. Methods in Enzymology 142:1-17. 15. Led1ey,F.D., Grenen,H.E., Dunbar,B.S., and Woo,S.L.C. 1990. Mouse phenylalanine hydroxylase. Homology and divergence from buman pbenylalanine bydroxylase. Biochem J 267:399-406. 16. Conon,R.G.H., McAdam,W., Jennings,I., and Morgan,F.J. 1988. A monocolna1 antibody 10 aromatic amioo acid hydroxylases. Biochem J 255:193-196. 17. Nasir,J., Floresco,S.S., O'Kusky,J.R., Diewen,V.M., Richman,J.M., • Zeisler,J., Borowski,A., Marth,J.D., Phillips,A.G., and Hayden,M.R. 86 1995. Targeted disruption of the Huntington's disease gene results in embryonic letbality and bebavioral and morphological changes in • heterozygotes. Cell 81 :811-823. 18. Seamans,J.K. and Phillips,A.G. 1994. Selective memory impainnents produced by traDSient lidocaine-induced lesioDS of the nucleus accumbens in rats. Behav Neurosci 108:456468. 19. Diomede,L., Romano,G., Guiso,G., Caccia,S., Nava,S., and Salmona,M. 1991. Interspecies and interstrain studies on the increased suscepnbility ta metrozol-induced conwIsions in animais given aspaname. Fd Chem Toxic 29:101-106. 20. Scriver,C.R. and ICaufman,S. 2001. Hyperphenylalaninemia: Phenylalanine Hydroxylase Deficiency. In The Metabolic and Molecu/ar Bases ofInherited Disease. (8 ed.) Scriver,C.R., Beaudet,A.L., Sly,W.S., Valle,D., Assoc.eds.Childs,B., Kinzler,K., and Vogelstein,B., editors. McGraw Hill., New York. 21. Nadeau,J.H. 1989. Maps of lineage and synteny homologies between mouse and man. TIG 5:82-86. 22. Erlandsen,H., Fusenï,F., Martinez,A., Hough,E., Flatmark,T., and Stevens,R.C. 1997. Crystal structure of the catalytic domain of buman phenylalanine hydroxylase reveals the structural basis of phenylketonuria. Nal SITUa Biol 4:995-1000. 23. Fusetti,F., Eriandsen,H., F1annark,T., and Stevens,R.C. 1998. Structure of tetrameric human phenylalanine hydroxylase and its implications for phenylketonuria. J Biol Chem 273:16962-16967. • 87 24. Erlandsen,H. and Stevens,R.C. 1999. The structural basis of • PhenyUcetonuria. Molec Genet Metab 68:103-125. 25. Kacser,H. and Bums,J.A. 1981. The molecular basis ofdominance. Genetics 97:639~. 26. zagreda,L., Goodman,1., Droin,D.P., McDonald,D., and Diamond,A. 1999. Cognitive deficits in a genetic mouse model of the most common biochemical cause of human mental retardatioD. J Neurosci 19:6175-6182. • 88 CONNECTING TEXT • In Cbapter 3 1 use the animal models ta measure brain concentrations of phenylalanine derived metabolites, PPA, PAA and PLA. The pathogenic effect of these Metabolites in PKU and non-PKU HPA bave long been debated and the objective of this study was to understaDd better their possible contribution tawards the phenotypic outeome. The availability of buman surrogates allowing access to brain tissue sampling and a method sensitive enough ta measure these metabolites were two prior problems tbat prevented the completion of this study. The first problem was overcome witb the availability of non-PKU HPA, PKU and control mouse orthologues, as descnbed in Cbapter 2. The solution ta the second obstacle is described here. A method bas been developed based upln stable isotope dilution techniques, coupled wim negative ion cbemical ionization gas chromatagraphy/mass spectrometry ta measure PPA, PAA, PLA. 1 bave used Ibis metbod ta measure these phe metabolites in the mouse brain tissue. • 89 • CHAPTER3 Measurement of pbenyUactate, pbenylaeetate and pbenylpyruvate by negative ion chemical ionization - gas chromatograpby/mass spectrometry in brain of mouse genetie mollets of pbenylketonuria and non-pbenylketonuria hyperpbenylalaninemia Christineh N. Sarkissian, Charles R. Scriver, Orval A. Mamer Stotus: PubUshed in ÂIIlllytical Biochemistry (280) 242-249, 2000. (Copyright e 2000 by Academie Press) (http://www.apnet.com) Reprinted by permission of the publisher • 90 ABSTRAcr Phenylketonuria (PIeU) (OMIM 2616(0) is the tirst Mendelian disease ta bave an • identified chemica1 cause of impaired cognitive development. The disease is accompanied by hyperphenylalaninemia (HPA) and elevated levels of phenylalanine metabolites (phenylacetate (PAA), phenyllactate (pLA), and phenylpyruvate (PPA» in body tluids. Here we describe a method to determine the concentrations of PAA, PPA, and PLA in the brain of normal and mutant onhologous mice, the latter being models of human PKU and non-PKU RPA. Stable isotoPe dilution techniques are employed with the use of rI{,]-phenylacetic acid and [2,3,3-2}f3]-3-phenyllactic acid as intemal standards. Negative ion chemical ionization NICI-GC/MS analyses are Perfonned on the pentafluorobenzyl ester derivatives formed in situ in brain homogenates. Unstable PPA in the homogenate is reduced by NaB1R4 ta stable PLA, which is labelled with a single deuterium and discriminated from endogenous PLA in the mass spectrometer on that basis. The method demonstrates that these Metabolites are easily measured in normal mouse brain and are elevated moderately in HPA mice and greatly in PKU mice. Rowever, their concentrations are Dot sufficient in PKU 10 be Ktoxic"; phenylalanine itself remains the chemica1 candidate causing impaired cognitive development. • 91 INTRODUCTION Pbenylketonuria (PKU) and related forms of DOn-PKU hyperphenylalaninemia • (HPA) (1) are autosomal recessive disorders of amino acid metabolism, wbich result from primary dysfunction of phenylalanine hydroxylase (PAH), the hepatic enzyme responsible for catalysing the conversion of phenylalanine 10 tyrosine. PKU and HPA patients bave elevated levels in body tluids of phenylalanine (phe) and of metabolites derived from phenylalanine (phenylpyruvate (PPA), phenylacetate (PAA), and phenyUactate (PLA» (2;3). Untreated PKU probands usually bave severe irreversible mental retardation; the risk of mental retardation is less in the conditions with a lower degree ofHPA (non-PKU HPA). The Cree phe pool in the normal subject is derived from two sources: intake of exogenous dietary protein and turnover of endogenous polypeptides. Approximately 2S % of the free pool is normally incorporated into protein; most of the remaining 75% is hydroxylated ta tyrosine and only a trivial fraction is transaminated to PPA onder nonnal conditions (4). PAH enzyme catalyzes the hydroxylation reaction; when its activity is absent or reduced (as in PKU and to a lesser degree in non-PKU HPA), the free phe pool expands, ifdietary phe input is not reduced. At tbis stage, the degradative transamination pathway, involving conversion of phe 10 PPA (the initial reaction in this pathway) becomes significant at a modal phe value of -0.5 mM (2-5). PPA is subsequendy convened to PLA and PAA and phenylacetylglutarnine (1). Wbether these Metabolites actually contribute 10 pathogenesis of cognitive impairment bas long been debated (3;5). Orthologous mouse models of PKU and non-PKU HPA exist (6-8) wbich allow us 10 measure pbe and its metabolites in brain in various degrees of HPA. Here we descnbe a GCIMS method ta measure phenylalanine Metabolites based upon stable isotope dilution teclmiques, coupled with negative ion chemical ionization (NICI). • 92 MATERIALS AND METBODS The method measures PAA as the pentaftuorobenzyl (PPB) ester with flb] • pbenylacetic acid (PAAd5) as internai standard, and PLA as the PFB and trifluoroacetate (TFA) diester witb [2,3,3-11b]-pbenyUactic acid (PLAdJ) as internai standard. PPA is reduced to [2-1H]-pbenyllactic acid (PLAdl) byaddition of sodium borodeuteride (NaB2H4) to the supematant of the tissue homogenate, and is measured in the manner similar ta tbat for PLA. Mouse Models The bomozygous mutant strain Pahnt11212 (pbenotype name, ENU2) and PahDWI11 (ENUI) are onhologues of buman PKU and non-PKU HPA, respectively (bttp://www.mcgill.calpahdb/mouse). They were developed by treating wildtype mice (BTBRlPas background (used as controls» with the alkylating agent N-ethyl N-nitrosourea (6;7;9). Produced in Wisconsin, tbey were kindly given to us by W. Dove and A. Sbedlovsky. They display a range of phenotypic cbaracteristics comparable to those of affected human individuals (10). Preparation of Internai Standard Solution PAAds: A 0.071 mM PAAd5 stock solution was prepared by dissolution of 1.0 mg (CDN isotopes) in 100 ml deionized ibO. PUtb: PPA (17 mg, 0.1 nunol, Sigma Chemical Co.) was dissolved in deuterium oxide (25 ml, CDN Isotopes) and made basic (pH > 12) with 3 drops of 40% NaQ2H in 21h0. The resulting solution was beld at tH C for 1 br and then rotary evaporated to near-dryness. The residue was taken up in a 10 ml a1iquot of 11120 and held at 6QOC for 1 br. This solution was cooled to room temperature and NaB1H4 (approximately 5 lUI, CDN Isotopes) was added. The resulting solution was warmed ta 500c for 10 min, cooled in an ice bath, and slowly acidified to pH < 2 wim 2 N HCI (caution: vigorous evolution of bydrogen). The solution was saturated with NaCl and extraeted with tbree 10 ml volumes of • diethyl ether. The ether extraets were combined, made anbydrous by addition of 93 solid anhydrous N82SOa (2 successive l-g lots), and then evaporated 10 dryness in a dry nitrogen stream. The product, PLAcb. was obtained (14 mg, 83% cnIde • yield) in oil form, Cree of residual PPA as detennined by GCIMS analysis of the trimethylsilyl derivatives. Extensive experience with reductions of ketoacids with NaB2H4 in this laboratory shows tbat these reductioDS are quantitative. The isotopic purity was detennined to be 97% as the triply deuterium- labeled isotopomer. Approximately 14 mg of the cnIde product was dissolved in deionized water (100 ml) 10 he used as the internai standard for PLA and PLAdl determinatioDS. The concentration of this internai standard was detennined by a reverse stable isotope dilution assay, measuring relative ion intensities in a solution with unlabeled PLA of known concentration. The final concentration of the PLAdJ internai standard solution was 0.787 mM. Brain Sample Preparation Brains were removed within S s foUowing decapitation of ENU2, ENU1 and control animais fed with standard rodent diet (Teklad 1No. 8604) (n = 6/genotype) and immediately homogenized in minimal 200C deionized water (1: l, w/v) to which we added the labeled internaI standards (100 ,,1 each of the PLAd3 and PAAd5solutions). The total volume was made up 10 1 ml, adjusted 10 pH 10 12 with dilute KOH, NaB2H4 (2 mg) added immediately, and the tubes placed in SOOC water for 10 min. PFB derivatives were prepared in the manner previously reponed (11) with the following stock solutions: A., methylene chloride (20 ml) and pentafluorobenzyl bromide (0.4 ml., Aldrich Cbemical Co.); B, potassium phosphate buffer (pH 7.4, 100 ml) and tetrabutylammonium hydrogen sulfate (3.4 g, Aldrich Chemical Co.) adjusted to pH 7.4 with 2 N KOR. Solutions A (0.25 ml) and B (0.25 ml) were combined in a separate tube, 0.25 ml of tissue homogenate supematant was added, the mixture was vonexed for 2 min and then placed in an ultrasonic bath for 20 min at room temperature. Hexane (2 ml) was added, the mixture vonexed for 1 min, the hexane layer then removed and dried • by addition of anhydrous sodium sulfate (10 mg) with vonexing for 1 min. The 94 bexane layer was next decanted inta a separate tube, N-metbyl-bis trifluoroacetamide (MBTFA, 50 pl, Pierce Chemical Co.) added then vonexed • and placed into a 500c water bath for 10 min. AIN sodium bicarbonate solution (2 ml) was added to the tube and the mixture vonexed for 1 min. The hexane layer was finally removed into a separate tube, anhydrous sodium sulfate was added and the mixture vonexed for 1 min. An aliquot of this final bexane solution was transferred to an autoinjector vial for OC/MS analysis. Blank Sample Blank samples were prepared with deionized water equal in volume to the brain tissue homogenate supematants. These samples were processed and analyzed as described for the tissue samples. OC/MS Analysis Aliquots (1 ",1) of the derivatized mixtures were analyzed in NICI mode with a Hewlett-Packard 5988A OC/MS fitted with a 30 m x 0.25 mm Ld. capillary column (J &. W Scientific) coated with a 0.25 }lD1 D8-1 film. The helium flow rate was 2 mVmin; the injector and interface temperatures were 2500 C. The column was temperature programmed from 1000 C after a 1 min hold to 1200C al 4CfC/min and then al lOOC/min 10 2800C. The column was baked out at 2800C for 5 min al the completion of each sample analysis. Methane was used as the moderator gas al an indicated source pressure of 0.6 mbar and the ion source temperature was 1200C. Selected ion mode was used 10 measure the intensities of negative ion fragments mlz 135, 140, 261, 262, and 264 wim dweU limes of 50 ms each. These fragments arise by the loss of the pentatluorobenzyl radical from the molecular anions of the PFB derivatives of PAA and PAAcb, and the PFB/TFA derivatives of PLA, PLAdl, and PLAd3, respectively. • 95 Amino Acid Quantitation Whole blood was collected from mouse tails into heparinized tubes, plasma • was separated by centrifugation, and alter deproteinization the amino acid content was analyzed by HPLC on a Beclanan 6300 automatic amino acid analyzer. Whole brain amino acids were analyzed according to the metbod described by Diomede et al. (12). Brain tissue was removed witbin 5 s after decapitation and homogenized (on ice) in 0.5% sodium dodecyl sulfate solution (1:4, w/v). Alloisoleucine was added as an internai standard and the homogenate was then incubated for 15 min at room temperature. A 4% solution of 5-sulfosalicylic acid dihydrate solution (1:0.6, v/v) was added, and the mixture was centrifuged at 14,OOOg for 15 min. The supematant was decanted and frozen at -SOOC until analyzed by HPLC as above. RESULTS AND DISCUSSION NIC! mass spectra obtained for the PFB esters of authentic PAA and PAAw standards are shown in Fig. 1. The most intense ions correspond ta the carboxylate anions (ml, 135 and 140, respectively) produced by the loss of the PeDtafluorobenzyl radical (IS1 Da) from the molecular anions (ml, 316 and 321, respectively, not deteeted). Loss of HF (20 Da) from the molecular anions, wbich is commonly observed in derivatives of tbis nature, is deteetable, althougb not apparent in Fig. 1. The 140-Da fragment in the spectrum ofPAAc:b confirms that alllabelling is intact in the ion measured. SIM analysis ofPAAc:b shows tbat the unlabeled content is 1.39% relative 10 the labelled. This is taken into account in the calculations of the endogenous concentrations ofPAA. NIa spectra for the PFB esters of the UiOuoroaeetyl esters of unIabeUed and labeUed PLA are shown in Fig. 2. The most intense ions (mil 261, 262 and 264) represent the carboxyl anions produced by the 1055 of the pematluorobenzyl radical from the molecular anions mil 442, 443 and 445 (IlOt detected) of unlabelled autbentic PLA, PLAdt syntbesized from PPA by reduction with NaB2H4, and • synthesized PLAd3 (intemal standard), respectively. The PLAdt ÎS01Opomer 96 corresponds 10 PPA in the original homogenate. It is essential tbat the 2-hydroxyl group of the PLA isotopomers he derivatized because decomposition by dehydration • at OC temperatures would lead ta deuteriUDl labelloss. The PLAd3 synthesized and used as internai standard was found by SIM analysis to be 97.17% PLAd3, 2.66% PLAch, 0.001 % PLAdl. and 0.16% PLAdo. Reduction ofauthentic PPA by NaB2JI. yielded PLAdl tbat was 0.29% unIabe1led, a measure of the isotopie purity of the lot of NaB2JI. which was used for the entire study. SIM cbromatograms obtained for one of the calibratiDg mixtures containîng PAA, PAAd5, and unlabeUed PLA are shown in Fig. 3. The PAA isotopomers are represented by the carboxylate anions (mil. 135 and 140) formed by the 1055 of the pentafluorobenzyl moiety from the molecular anions (DOt deteetable). The PLA chromatograms (mil. 261, 262, and 264) would normally represent the carboxylate anions ofUDIabeUed PLA, PLAdl (formed by the reduction ofPPA by NaB2D.), and the internaI staDdard PLAd3, respectively formed by the 1055 ofthe pentafluorobenzyl moiety from the molecular anions of the PFB-TFA derivatives. In Ibis instance, the measured relative intensities are for unlabelled PLA substituted with ooly natura! abundance beavy isotopes. The inteDSities of mil. 262 and 264 measured in the ion cluster relative to ml, 261 are 12.47 and 0.13%, respectively, and compare well with the calculated values of 12.51 and 0.12%, respectively. The calJbration curves for al1 tbree Metabolites, over the expected physiological ranges, are shown in Fig. 4. A linear response is demonstrated for each Metabolite (1t- > 0.98 for each Metabolite). The resplnse for PPA (measured as PLAdl) is approximately 72 % tbat of PLAdo. This is possibly due to lack of purity or bomogeneity in the PPA originally weighed out. Analysis of the PPA as the TMS derivative shows the presence of sma1l but significant quantities of PLA and PAA. The seositivity ofour metbod (for alI tbree Metabolites) is estimated ta he 0.1 umollg brain tissue. Typical chromatograms for normal (Fig. S), ENUI (Fig. 6) and ENU2 (Fig. 7) mouse brain are sbown. In normal mouse brain PAA is detectable (mIz 135) al • low levels, wbile PLA and PPA (mlz 261 and 262) are essentiaIly absent (Fig. 5). 97 The apparently invened peak (retention lime, 9.02 min) in the responses for mlz 135 and 140 results from the elution of a large unidentified peak wbicb temporarily • depletes the thermal electron atmosphere in the ion source. The ENU1 (non-PKU HPA) mouse brain (Fig. 6) contains elevated levels of PLA and PPA (mlz 261 and 262). The minor variation in the PM levels between the ENU1 and normal miœ demonstrates tbat at normal or near normal (physiological) pbe levels the transamination pathway contnbutes insignificandy ta the brain metabolic phenotype in the variant HPA state. The ENU2 (pKU-like) mouse (Fig. 7) shows gready increased concentrations of all three Metabolites. The well-known teodency for deuterium-Iabeled analogs ta elute slighdy earlier tban the corresponding unlabeUed compounds is apparent. The correlation between plasma pbe and brain metabolites is shown in Table 1. BTBRIPas-wildtype and ENU1 animais, displaying normal « 100 ,uM) or low (150-400 ,uM) plasma phe levels, respectively, bave low phe Metabolite levels in brain. This finding implies tbat the transamination pathway cornes into play only at phe levels above 0.4 mM, as implied by the findings in the ENU2 animais, moreover correlatiDg weU with previous observations (see Fig. 15-1 in ref. (5». When present, metabolite levels bave a rank order PLA > PM > PPA. The relationsbip between plasma and brain phenylalanine levels in the mouse models is given in Table 2. Our data are among the tirst reporting direct measurements of brain phe Metabolites in PKU and non-PKU HPA. A preliminary repon by Evans (13) compared brain and body tluid metabolites in control and ENU2 mice. Here we present a formai aoalysis of PLA, PAA, and PPA in brains ofortbologous miœ with PKU and non-PKU HPA and compare them with control values. Our interest was ta study phe Metabolite concentrations in brain independent of their levels in blood or urine; the latter were the focus of Most earlier studîes. The data show tbat brain Metabolite concentrations correIate positively witb plasma pbe levels. More important, the levels of the metabolite measured bere do not reach levels of toxicity • predicted for human subjects by Kaufman (3) and documented in earlier studies (14). 98 Taking into account assumptions about distributions ofmetabolites in the intraœUular and extraeellular space of brain9 the levels of metabolites measured bere are IQ-fold • lower tban those associated wim toxicity in brain (14). Nonetbeless, our PKU (ENU2) mice exlubit the bebavioural and cognitive impairment expected in PKU (10), and which we attribute primarily ta the effect of phenylalanine itself. On the other band9 in certain untreated PKU patients wim normal cognitive fonction, brain phe values are DOt elevated in the presence of high blood values, as measured by MRI (see ref. (15); an independent impediment of bloodlbrain phe transport bas been offered as an explanation. Our use of bath the analytical method and the onhologous mouse model of the human is offered here as a contribution toward resolving a long standing controversy about pathogenesis of the cognitive phenotype in PKU. ACKNOWLEDGEMENTS This worle was supported in pan by the Medical Research Council (Canada), the Canadian Genetic Diseases Network (CGDN) (Networks of Centers of Excellence) and a contract for maintenance of the mice from IBEX via CGDN. Studentship awards were supponed by the McGill University - Montreal Cbildren's Hospital Research Institute, the Garrod Association (Canada) and The . Auxiliary (Montreal Children's Hospital). • 99 TABLEl • Reladoosbip between bnin pile metaboUtes and plasma pbe Ievels in tbree phenotypes (normal, ENUl, and ENU2) (II = 6/pnotype, Mean ± SE) Mouse PlMDla PPA PAA PLA Models Pbenylalanlne (DDlolIl (nmollg (DlDolIg Concentration braiD) brain) bniD) (,aM) Control < 100 1.2 ± 0.1 2.7 ± 0.3 0.2 ± 0.1 ENUl 150400 1.2 ± 0.1 2.2 ± 0.5 0.9 ± 0.3 ENU2 1400-3000 2.2 ± 0.3 7.4 ± 1.6 59.3 ± 21.8 • 100 TABLE 2 • Relationsbips between plasma and bnin phe values in tbree mouse models (pM, D=6, Mean ± SE) Plasma Brain Mouse phenylalanine phenylalanine Models cODcentratioD {J&M) concentration (,&M) Control 74.4 ± 8.8 70.1 ± 6.5 ENUI 181.5 ± 23.3 120.6 ± 8.1 ENU2 1882.7 ± 156.5 886.97 ± 26.6 • 101 • s, i87 /' 20000 i4l0, 200000 1110000 s.. " o DG. 1. NICI mass spectra obtained for the PFB derivatives of unlabelled PAA and PAAd5. Intensities of ions wim masses greater tban 145 Da bave been multiplied by 20, and appear DOt 10 he related 10 the sample. The intense ions at mlz 135 and 140 carry nearly the entirety of the ion current produced and correspond 10 the carboxylate anions formed by the 1055 of the penrat1uorobenzyl radical from the molecular aniODS. Wbile the molecu1ar anions expeeted at mil. 316 and 321, respectively, are DOt detected, very weak ion currents attnbutable 10 1055 ofHF from • the molecular anions (DOt shawn) confirm the nature ofthe derivatives. 102 _s • 400000 300000 aooooo .,. /s 100000 0 100 1100 HO 400 ~ 1.0000 100000 a.s /' .aooo 80000 a~ "0000 .0000 Isa, , 0 l- 100 aoo ... aoo 400 400000 84& /' SIlOOOO sooooo , 110000 40. 1" ./ 0 100 aoo 800 400 FIG. 2. NICI mass spectra obtained for the PFB derivatives of the TFA esters of unlabeUed PLA, PLAdt, and PLAdJ. Intensities of ions with masses greater than 270 bave been multiplied by 50 ta show tbat they appear DOt 10 he related to the sample, as the masses show no iŒrementïng dependent upon labelling. The carboxylate anions at mlz 261, 262, and 264 formai by the loss of the pentafluorobenzyl radical from the molecular anions (mlz 442, 443, and 445, DOt • deteeted) carry nearly all the ion current. 103 • ail •• •-t-...,...... ,...... +=-...... - ...... a.a a.a ••• •••• a .• a.a a.a •••• aaa .... '0•• .~.o 10.0 •••• ~••o '0.0 •••• ".0 FIG. 3. SIM chromatograms for a calibrating mixture containing unIabeUed PAA (mir. 135), internai standard PAAcb (mir. 140), and unlabeUed PLA (mir. 261). Ion currents al mir. 262 (12.47% relative to mir. 261) and 264 (0.13%) are due to natural abundance heavy isotope inclusion in the carboxylate anion formed from the unIabeUed PLA derivative. • 104 • 4.5 • ...o 4 ~ _ W\ 3.5 -c.-o~ <..J < 3 c...J r.o e;. ~ 2.5 .2 ~ ~ 2 ti .J < 1.5 =~=.. e 1 < O.S o o O.S 1 I.S 2 PLAdo or PPAdo or PAAdo added (J.l8) DG. 4. CaltbratioD curves, showing linear responses for., PLA; ., PPA; and ., PAA; over physiologica1 ranges. The abscissa represents weights of unIabeled Metabolites added 10 caltbrating aqueous solutioDS of 1 ml volume containing 114 of PLAch and 1 14 of PAAd5. The ordinale represents the ratio ofareas of unlabelled to labeled analogues obtained for these solutioDS. • lOS • ,.nI• ...... • 1• o•• •••• 10.0 .... Il•• A••• n .• •••• ,... Il.0 FIG. S. SIM chromatograms obtained for phe Metabolites in the brain of a normal mouse. PAA (mlz 135) is clearly present, wbile PLA and PPA (ml, 261 and 262) are not deteeted in the present example. The ion current al mlz 264 is due ta the PLAd3 internai standard. • 106 • -'aDJ .n•• 1771 -- ...... aooo 0 0 ••• o•• ••• •••• ••• ••• ••• •••• .. ...0• ..2'1 .,... .. - O.+-~~"''''''''' .0.0 •••• aa.o 10.0 ,o•• Il.0 OG. 6. SIM cbromatograms obtained for phe Metabolites in the brain of an ENUI mouse. PAA is present at levels somewbat lower tban in the nonnal mouse, and PLA and PPA are elevated slightly relative to the normal mouse. The retention limes seen here are slighdy differem from Fig. 5 because in the interim the analytica1 column was replaced. • 107 • _z.a 0""""' ~ Q11 ••• ••• ••• 10.0 ••• •.a ••• 10.0 ...... • 000 0000 10 4CIOO ... 0000 aooo 1000 o~...,...... ~.... Ol..,...... ~...... ~ 10.0 10•• Il.0 10.0 10.• Il.0 10.0 10•• Il.0 DG. 7. SIM chromatograms obtained for pbe Metabolites in the brain of an ENU2 mouse. PAA, PLA, and PPA are all clearly elevated. The labeUed internai standaIds (mir. 140 and 264) elute sligbdy earlier tban their unlabelled analogues. The retention limes seen bere are again sligbdy different from Fig. S because in the interim the analytical column was replaced• • 108 REFERENCES • 1. Scriver,C.R., Kaufman,S., Eisensmith,R., and Woo,S.L.C. 1995. The Hyperphenylalaninemias. In The Metabolic and Molecular Bases oflnherited Disease. (7 ed.) Scriver,C.R., Beaudet,A.L., Sly,W.S., and Valle,D., editors. McGraw Hill Book Co, New York. 10IS-107S. 2. Knox,W.E. 1972. Phenylketonuria. ln The Metabolic Basis of lnherited Disease. (3 ed.) I.B.Stanbury, Wyngaarden,I.B., and Fredrickson,D.S., editors. McGraw Hill Book Co., New York. 266-29S. 3. Kaufman,S. 1989. An evaluation of the possible neurotoxicity of Metabolites of phenylalanine. J Pediatr 114:895-900. 4. Kaufman,S. 1999. A model of buman phenylalanine metabolism in normal subjects and in pbenylketonuria patients. Proc Natl Âcad Sei USA 96:3160 3164. S. Scriver,C.R., Kaufman,S., and Woo,S.L.C. 1989. The Hyperphenylalaninemias. ln The Metabolic Basis of lnherited Disease. (6 ed.) Scriver,C.R., Beaudet,A.L., Sly,W.S., and Valle,D., editors. McGraw Hill Book Company, New York. 49S-546. 6. Sbedlovsky,A., McDonald,I.D., Symula,D., and Dove,W.F. 1993. Mouse models of human phenylketonuria. Genetics 134:1205-1210. 7. McDonald,I.D., Bode,V.C., Dove,E.F., and Sedlovsky,A. 1990. Pah...... ': A mouse mutant deficient in phenylalanine bydroxylase. Proc Natl Âcad Sci USA 87:1965-1967. 8. Sarkissian, C. N., McDonald, J. D., and Scriver, C. R. Mouse Pah • homologues. 1999. (http://data.mcb.mcgill.calpahdb/mouse/sarkiss.btml). 109 9. McDonald,I.D. and Cbarlton,C.K. 1997. Cbaracterization of mutations at • the mouse phenylalanine hydroxylase locus. Genomics 39:402-405. 10. Sarkissian,C.N., Boulais,D.M., McDonald,I.D., and Scriver,C.R. 2000. A heteroallelic mutant mouse model: A new onhologue for human hyperphenylalaninemia. Mol Genet Metab 69:188-194. Il. Hachey,D.L., Patterson,B.W., Reeds,P.I., and Elsas,L.I. 1991. Isotopic determination of organic keto acid pentafluorobenzyl esters in biological tluids by negative chemical ionization gas chromatography/mass spectrometry. Anol Chem 63:919-923. 12. Diomede,L., Romano,G., Guiso,G., Caccia,S., Nava,S., and Salmona,M. 1991. Interspecies and interstrain studies on the increased susceptability to metrozol-induced convulsions in animais given aspaname. Fd Chem Toxic 29: 101-106. 13. Evans,I.E., Dyer,C.A., Levy,H.L., and Evans,B.A. 1994. Brain and body tluid metabolic profiling of phenylalanine hydroxylase deficient mîce. Proceeding of the 42nd ASMS conference on 11I/lSS speetrometry and allied topics. Chicago. nI USA153, May 9 -lune 3, p.153. 14. Silberberg,D.H. 1967. Phenylketonuria metabolites in cerebellum culture morpbology. Arch Neurol 17:524-529. 15. Scriver,C.R. and Waters,P.I. 1999. Monogenic traits are not simple. Lessons from phenylketonuria. TIG 15:267-272. • 110 CONNECTING TEXT • In Chapter 4, 1 descnbe a different approach for the treatment of Pbenylketonuria. The current dietary therapy is difticult 10 foUow and althougb effons 10 improve the organoleptic propenies are ongoing, imperfections in the composition of the diet and compliance with it are a continuous concerne Therefore an alternative form of treatment using PAL enzyme substitution is suggested bere. Access to human surrogates for pre-clinical drug administration testing and the availability of a commercial supply of PAL were two prior obstacles tbat needed 10 be resolved ta make this work possible. Once again the first problem was overcome when mouse onhologues for PKU and non-PKU HPA became available. These animals were characterised and the protoeol required for metabolic manipulation established in Cbapters 2 and 3. A solution 10 the second obstacle is detailed here in Chapter 4, where an efficient recombinant approach 10 produce PAL enzyme is described and the product tested in ortbologous ENU mutant mouse strains with HPA. Proofs of pbarmacological and physiological principles for the efficacy of PAL therapy are established. • III • CHAPTER4 A different approach to treatment of phenylketonuria: Phenylalanine degradation witb recombinant phenylalanine ammonia Iyase Christineh N. Sarkissian, Zhongqi Sbao, Françoise Blain, Rosalie Peevers, Rongsbeng Su, Robert Reft, Thomas M. S. Chang, Charles R. Scriver Status: published in Proceedings ofthe Natio1lQ/ Academy ofSciences (USA) (96) 2339-2344 (1999) (Copyright 0 1999 Pme. Nad. Acad. Sei. USA) Reprinted with the pennission of the publisber • 112 ABSTRACT • Phenylketonuria (PKU), with its associated hyperphenylalaninemia (HPA) and mental retardation, is a classie genetie disease and the first to bave an identified chemical cause of impaired cognitive development. Treatment from binh with low phenylalanine diet largely prevents the deviant cognitive phenotype by ameliorating HPA and is recognjzeA as one of the first effective treatments of a genetie disease. However, compliance with dietary treatment is difficult and when it is for lite, as now recommended by an intemationally used set of guidelines 9 is probably unrealistic. Herein we descnbe experïments on a mouse model using another modality for treabDent of PKU companble with bener compliance using ancillary phenylalanine ammonia Iyase (pAL, EC 4.3.1.5) 10 degrade phenylalanine, the barmfu1 nutrient in PKU; in tbis treatment, PAL acts as a substitute for the enzyme phenylalanine monooxygenase (pAR, EC 1.14.16.1) wbich is deficient in PKU. PAL, a robust enzyme without need for a cofactor, convetts phenylalanine to trans cinnamic acid, a barmIess metabolite. We describe (l) an efficient recombinant approach 10 produce PAL enzyme, (il) testing of PAL in onbologous N-ethyl-N nitl'OSourea (ENU) mutant mouse sttains with HPA, and (iil) proofs of principle (pAL reduces HPA) - both pharmacologie (with a elear dose-response effect vs. HPA after PAL injection) and physiologie (proteeted enterai PAL is significandy effective vs. HPA). These findings open a new way to facilitate treabDent of tbis elassic genetie disease. • 113 INTRODUCTION • Pbenylketonuria (PKU) (1) is the prototypical human Mendelian disease (OMIM 2616(0) demoDStrating benefits from treatment (2). PKU and a related fonn of less barmful hyperphenylalaninemia (HPA, termed non-PKU HPA) result from impaired activity of phenylalanine hydroxylase (pAH; EC 1.14.16.1), the enzyme catalyzing conversion of the essential amino 8Cid nutrient phenylalanine ta tyrosine. The enzyme is responsible for disposai (by oxidative catabolism) of the majority of nutrient phenylalanine intake. The untreated PKU patient with persistent postnatal HPA is likely ta expcrienœ irreversible impairment of cognitive development. Antenatal HPA, caused by traosplacental transpott of phenylalanine from the maternai pool ta the fetus during a pregnancy in wbich there is maternai HPA, will hann the embryo and fetus. These disease-causing effects of PKU and matemal HPA are preventable by treatment ta restore euphenylalaninemia (1). Present treatment relies on the observation that a (semi-synthetic) diet low in phenylalanine (3-5) will prevent HPA and thus the disease. Because it involves a major alteration of lifestyle, dietary treatment is difficult. Moreover, dierary therapy cao he associated with deficiencies of severa! nutrients (1), some of wbich may he detrimental 10 brain development (6;7). Moreover, most low phenylalanine treatment products bave organoleptic properties sufficiendy unsatisfactory tbat compliance with the tteabllent is compromised (8;9). Such concerns bave greater relevance now tbat better and longer compliance with tberapy of PKU and non-PKU HPA in all persons at risk bas been recommended (10; Il). A combination of oral enzyme therapy witb phenylalanine ammonia lyase (pAL; EC 4.3.1.5) and controlled low protein diet might replace dependence on the semisynthetic diet, for tteabDent of PKU after infancy (10;12). PAL is a robust, autoeatalytic enzyme mat, unlike PAR, does DOt require a cofactor (13). PAL convens phenylalanine ta metabolica11y iDsignificant amounts ofammonia and trans cinnamic acid, a barmless metabolite; the latter is convened ta benzoic 8Cid and rapidly excreted in urine as bippurate (14). A preliminary repon indicates tbat HPA • 114 is attenuated by oral administration of microencapsulated PAL in the rat with cbemically induced HPA (15) and aIso, in pre1iminary studies, in naturally • occurring HPA in a mouse model (16-18). Pre1iminary studies in buman PKU patients sbowed anaIogous responses after the administration of PAL in enteric coated gelatin capsules (19) or during use of an extraeorporeal enzyme reactor (20). The human and even the animal studies were not continued because PAL was Dot available in sufficient amounts at reasonable cast. (l) We used a construet of the PAL gene from Rhodosporidium toruJoides (21) under the conttol of a high-expression promoter and expressed it in a strain of Escherichia coli ta obtain large amounts of PAL (22). (il) We used existing (23) and new strains (C.N.S., J. D. McDonald, and C.R.S. at http://data.mcb.mcgill.caIpahdb/mouse/sarkiss.banl) of the mutant N-ethyl-N nittosourea (ENU)-treated mouse as onbologous models of human PKU and HPA to study enzyme substitution tberapy with PAL. (i;1) We showed tbat i.p. PAL injection lowers plasma phenylalanine in the mouse model (praof of pbarmacological principle), and oral gavage of tbese mice with PAL enzyme, protected from inactivation by digestive enzymes, lowers plasma phenylalanine (praof of pbysiological principle). Tbese developments point ta an alternative approacb to treabDent of PKU, compatible with current guidelines (10;11). MATERIALS AND METROns Syntbesis ofRecombinant PAL Amplijication ofthe PAL Gene: R. toruloides [ATCC DO. 10788] was purchased from the American Type Culture Collection. Cells were grown in minimal medium containing phenylalanine as the sole carbon source (24), total RNA was extraeted witb bot acidic phenol (25) from a mid-logaritbmic-pbase culture, and mRNA was isolated with the PolyATtract mRNA Isolation System (Promega). A cDNA pool was then syntbesized using the RiboClone cDNA Synthesis System (Promega). • liS Oligonucleotides (RTJP, St-AAGAAT1'CATGGCACCCTCGCTCGACT CGATcrCG-3', and Rn, S'-CCGAATICfAAGCGATCITGAGGAGGACGT • 3'), synthesized on an Ecosyn D300 DNA syntbesizer (Eppendort) were designed to feature an EcoRl site al their S' end and to he homologous to S' and 3' ends of the published sequence of the R. toruloides PAL gene (refs. (26) and (21); GenBank accession no. X51S13). PCR amplification (28) was performed in 100 pl containing 100 pmol ofeach primer, 20 mM Tris-HCI (pH 8.0), 2 mM MgCh, 10 mM KCI, 6 mM (NH4)2S04, 0.1 % TritonAX-lOO, nuclease-ftee BSA al 10 mg/ml, ail four dNPrs (each al 0.2 mM), 30 ng of cDNA as the template, and 5 units of Plu DNA polymerase (Stratagene). Samples were incubated in a DNA thennal cycler (BamsteadlThermolyne) al 9SOC for 30 s, at SOOC for 1 min, and 720C for 3 min; repeated for 35 cycles. The PCR product was analyzed on a 1% agarose gel containing 0.6 mg of etbidium bromide per ml and subsequently cloned in pBluescript KS+ (Stratagene). Identity of the PAL gene was verified by sequence analysis using an AutoRead sequencing kit and an automated A.L.F. DNA sequencer (pbarmacia). E. coli Strains and Plasmids: E. coli XL-IBlue was the host used for general cloning and vector construction; E. coli YI091 was the hast for fermentation to produce PAL. E. coli mX-4, used in the animal study, was isolated from a Sprague-Dawley rat and identified by using apî20Ee bacterial identification kit (BioMerieux, Charbonnier les Bains, France). Plasmid pBluescript was used for cloning PCR-amplified PAL fragments. Construction of High-Expression PAL P/Qsmid pIBX-7: Plasmid pIBX-I (29) was modified by site-directed muragenesis, cbanging the unique BamHI site ta an EcoRi site to aIIow cloning ofthe 2.2-kb PAL PCR fragment; the produet was then funher moditied. wbich resulted in the deletion of the EcoRI sites. To increase expression• an additional tac promoter (Ptac) was syntbesized by PCR and cloned downstream • 116 of the existing Plac. The S· Sbine-Delgamo sequence (AGGAG) is separated from the ATG codon by a 9-nt sequence (ACAGAATIT). Kanamycin resistanee for • selection of PAL-contaïning ceUs was conferred by substituting the Kanamycin resistance gene for the ampicillin resistance gene of pIBX-l. The plasmid was transformed into E. coli (hosts YI091 and IBX-4) and induced witb isopropyl:P-D tbiogalactoside (1 mM) for expression. The expression levels are similar in both hosts when cultured in shaken tlasks (data not shown). Purification o/PAL Enzyme from Cell Extract: Frozen E. coli cells (YI091; 500 g) expressing plasmid pIBX-7 were suspended in 2 L of Buffer A (30 mM Tris-HCL, pH 8.0/10 mM phenylalanine/2 mM cysteine) 10 wbich DNase 1 (S mglL) and 5 mM CaCh were added. The ceU suspension was homogenized tbree limes in a Rannie Minil..ab 8.30R high-pressure homogenizer (APV Canada, Montreal) al 700 bar (1 bar = 100 kPa); between passages, the suspension was cooled to 12°C. The homogenate was cenaifuged (14,100 x g) for 1 br at 4°C, the supematant containing PAL protein diluted 2-3 fold in water and loaded on a column containing 1.25 L Q Sepharose Big Beads (Pbarmacia). Wasbes were performed at a linear tlow rate of IS3 mlIbr with tbree column volumes of Buffer A foUowed by 3 column volumes of Buffer B (30 mM Tris-Hel, pH 8.0/10 mM phenylalanine/2 mM cysteine/l M NaCI). PAL protein is eluted wim Buffer B in a linear gradient (3% - 100%) in six column volumes; the fractions wim PAL actiVÎty were pooled. Ammonium sulpbate was added slowly 10 the eluates (final concentration, 50%), stirred (30 min) at room temperature and then centrifuged (14,700 x g for 30 min at 4OC). The final PAL protein peUet was dissolved in a minimal amount of Buffer C (SO mM sodium phospbate, ph7.S/S mM phenylalanine/l mM g1utathione). ENUMice The ENU mouse models, deficient in hepatic Pah enzyme actiVÎty, were created by treariog wildtype mice (BTBRIPas background) wim the alkylating agent • 117 ENU. The original strains Palf""lll(ENUI) and P~(ENU2), from W. Dove and A. Shedlovsky, (University of Wisconsin, Madison), were produced in • Wisconsin (23;30) and genotyped by 1. D. McDonald (31). We produced the hybrid heteroa1lelic strain P~I2(ENUI/2) in our facilities (sec http://www.mcgill.caIpabdb/ Pah Mouse 1 Mouse Pab Homologues). (AlI procedures descnbed below bave been reviewed and approved by the Animal Care Committee, McGill University). The bomozygous mutant ENUI mouse is a counterpart of buman non-PKU HPA. It bas a missense mutation in the Pah gene [co 364T~ in exon 3 (VI06A») (30;31), and on breeder diet (product 8626, TekIad, Madison, WI), it bas bath a normal plasma phenylalanine level and DOnnai bebavior but cao he made byperphenylalaninemic under controUed conditions witb a pbenylalanine load [by s.c. injection or gavage of L-pbenylalanine at LI mglg (body weight»). The bomozygous mutant ENU2 mouse is a counterpan of buman PKU. It bas a missense mutation [co 835T~C in exon 7 (F263S») (23;31). On breeder diet, it bas 10- 10 20-fold elevated plasma phenylalanine and pbenylketones in urine; eupbenylalaninemia in tbis sttain was achieved for these studies by placing mice on a diet free of phenylalanine (product 2826, Teklad) with ad libitum water containing L-pbenylalanine (30 mgIL), for 3 consecutive days. After establishing euphenylalaninemia, ENU2 animais received staDdardized s.c. injections of L phenylalanine [O.lmglg (body weigbt)] 10 achieve reproducible HPA. We developed the new ENUI/2 suain by crossing female ENUI and male ENU2/+; ail parents and offspring were typed by DNA analysis. The mutant heteroallelic animais bave a normal plasma phenylalanine level on breeder diet but easily achieve a modest elevation, to levels between mat of untreated ENUI and ENU2, by s.c. injection or gavage of L-phenylalanine [I.lmglg (body weight)]. The ENU strains are funher descnbed on our web site (see above). • 118 Protoeols ta Study the Effect of PAL Enzyme on Phenotype i.p. Administration ofRecombinant PAL (for ProofofPharmacological Prindple): • Studies were donc on mice, younger tban 1 year of age (ail tbree straïns). Bach animal served as its own control; a sbam (saline) injection was given in the tirst week, followed by the PAL injection 1 week later (same day of the week and lime ofday). Efficacy of i.p. PAL was measured by change in the plasma phenylalanine between the tirst and second week; animais (n = S per trial) received 2, 20, and 100 units of PAL. ENUI and ENUI/2 animais were fasted ovemight before ta the experiment. Food was reintroduced alter PAL administration. During the tirst week, 0.2m1 of saline i.p. was followed direcdy by an L-phenylalanine cballenge [I.lmglg (body weight) by gavage] for the ENUI and ENUI/2 mice; tail blood samples taken at zero min and l, 2, 3, and 24 br alter the phenylalanine cba1lenge. For the second-week protoeol, PAL (replacing saline) was diluted ta the dosage required with O.IM Tris·HO (pH S.S). Gavage of Recombinant PAL (for Proof ofPhysiological Prindple): Studies were done in mice younger tban 1 year of age. Each animal served as its own control and efficacy of PAL tteabDent was measured by change in plasma phenylalanine. We used two different PAL preparations: (1) recombinant PAL inside E. coli cells (lBX-4) and (il) unproteeted PAL (purified from YI091 E. coli cells) in solution with aprotinin (protease inlubitor). Saline gavage was used as the control treabDent. Plasma phenylalanine levels were adjusted in ENU2 animaIs (n = 4) to achieve euphenylalaninemia. In the fint week, the animais received a phenylalanine load (O.lmglg (body weight) by s.c. injection] on day 4, followed al lhr and 2hr by gavage of saline bicarbonate (6 mg, 10 neutralize gastric acidity). Tail blood samples were taken befote treabDent (at lime zero minus S min), and four tilDes at hourly interVaIs after the phenylalanine cbaIlenge. In the second week, the gavage contaîned (1) 2S units of PAL (as induced recombinant E. coli ceUs, 01>500) or (il) • 119 200 units ofPAL, in combiDation with 10 mg ofaprotinin in the sodium bicarbonate • buffer. ln Vitro Assays of PAL EJ/ea: We measured efficacy of the PAL preparation in vitro by analyzing its effect on a solution containing 4mM pbenylalanine (initial concentration) at 370C and pH 8.S. We compared (,) the individual effects of non recombinant E. coü ceUs (OI>fJOO = 50), chymottypsin (100 mg/ml), and mouse intestinal tluid (diluted 1:10 with Tris buffer at pH 8.S) with (il) the effect of naked recombinant PAL eitber aJone or in the presence ofcbymotrypsin (100 mg/ml) or of intestinal tluid (1:10 dilution with Tris buffer al pH 8.S) and (iil) the effect of E. coli ceUs (OD600 = SO) expressing PAL (S units) aJone or in the presence of cbymottypsin (100 mg/ml) or mouse intestinal fluid (1:10 dilution witb Tris buffer al pH 8.S). Analytica1 Plasma Phenylalanine Concentration: We coUected blood from tait inta beparinized tubes, extracted plasma, and measured pbenylalanine by HPLC (Beckman System Ooldl'M, DABS amino-acid anaIysis Kit). DNA Analysis: Animais were genotyped, as descnbed (31), for the paJr2 mutation. We developed a method ta deteet the paJf"I" mutation tbat elimjnates a amplification created recognition site (ACRS) for tbe restriction enzyme TaqI. We used PCR, with primers S'-GAGAATGAGATCAACCfGACA-3' and S' ITGTCTCOOGAAAGCrCATCG-3', ta amplify a 169-bp segment of exon 3 (mouse Pah) from blood spots coUected on Guthrie cards. The product subjected 10 TaqI digestion yields a distribution of fragments witb a distinct banding pattern for l each of three posstble genotypes: Pah+ + generates two fragments (148bp and 21bp) , paJf"I"l+ generates three (169bp, 148bp and 21bp) and paJrlll generates one fragment (169bp). • 120 • RESULTS Synthesis and Purification of PAL We obtained PAL byexpressing the p1BX-7 construet (Fig. 1) in E. coli, followed by purification on a Q-Sepbarose column. The produet is a yeast (R. toruloides) PAL enzyme, at 80% purity (Fig. 2). The yield in our present system is 100-150 units/g E. coU ceUs, with a Km of 2SO ~, at specifie activity of 2.2-3.0 units/mg of PAL protein; 1 unit of PAL dearninates 1.0 ,umol L-phenylalanine 10 trans-einnamate (and NIb) per minute at pH 8.S and 300c. Effect of PAL in ENU Mice We used the ENU mouse onhologues of human PKU and non-PKU HPA 10 obtain proof of pharmacologie and physiologie prineiples by demonstrating efficaey of PAL enzyme against the byperpbenylalaninemie pbenotype. Pilot Study PKU mice (ENU 2; n = IS) on reguiar diet were tteated with PAL (2, 20 or 100 units) by i.p. injection without any additionaI manipulations. Within 3 br, the postinjection value for blood phenylalanine bad fallen (range, 0-984 ILM) from the pretrealmem value (range, 389-2,012 pM). These prelirnjnary observations demoDStrated both an apparent treatment response and troublesome inter- and intra individual variation. Accordingly, we controUed for the latter by adopting the protoeols descnbed above. Proof of Phtunulcological Principle: A single i.p. injection of PAL enzyme significandy lowered plasma phenylalanine in PKU mice (ENU2; P < O.OS) and showed a dose-response (Fig. 3); at each point, data are nonnal;zed ta the control (sbam-treated) values for each animal ta accommodate inter- and intra-individual variation. The non-PKU HPA mice (ENUI) and the heteroallelie HPA stain • 121 (ENUl/2) also responded ta PAL treatment (data not shown). The effect of a single i.p. PAL injection in ENUI mouse model persisted for 24 br (P < 0.02; Fig. 4); • ENUl/2 and ENU2 mice bath bad similar 24 br responses (data not shown). ProofofPhysiolog;cal Prindple: To demonstrate the effect of orally administered PAL on plasma phenylalanine levels required protease..resistant PAL formulations. Recombinant PAL enzyme activity was proteeted against inactivation by gastric acidity and intestinal digestive enzymes by retaining and shielding it in the E. coli cells where it was synthesized. We used these cells in the absence of a different fonn of PAL protection. Recombinant PAL enzyme proteeted by the ceU wall and membrane of E. coli resists inactivation by proteolytic intestinal enzymes in vitro; otherwise activity of naked enzyme is abolished (data not shown). PAL enclosed in E. coli ceUs was shown ta reduce phenylalanine content of the in vitro solution (Table 1). When given by oral gavage, recombinant PAL (15 units) expressed in an E. coli strain isolated from Sprague..Dawley rat lowered plasma phenylalanine in ENU2 mice by 31 % in 1 br (P < 0.04) and 44% in 2 br (P < 0.0004) (Fig. 5). Otber experiments in vivo, conducted with aprotinin (protease inhibi1Or) and recombinant PAL enzyme purified from E. coli (YI091), gave funher proof of physiological principle. This formulation resists inactivation by chymotrypsin and mouse intestinal tluid in vitro (data not shown). Oral gavage of naked PAL (200 UDÎts) combined with aprotinin (protease inlubi1Or) lowered plasma phenylalanine in ENU2 mice: by 50% in 1 br (P < 0.017) and 54% in 2 br (P < 0.023) (Fig. 6). DISCUSSION Wc descnbe a method 10 produce recombinant PAL (Fig. 1) that may enable the use of this enzyme ta degrade excess phenylalanine in PKU where the normal pathway for its disposa1 is impaired.. Why would this alternative be useful if, as is generally assumed, carly treatment of PKU by a semisynthetic low phenylalanine diet is one • 122 of the success stories of medical genetics (1;2)7 The aoswers lie in the incidence of PIeU, our expectations for its treatment, and the anticipated "prevalence" of patient • treabDent years. The combiDed incidence of PIeU and non-PIeU HPA is on the order of l • 123 he put into practice unless the alternatives fail. The third metbod (Iow phenylalanine diet therapy) was inaugurated in the 19505 (3-5) and bas &ehieved its • primary goal: it bas prevented mental retardation in the adequately treated patient (1;34). However, dietary treaUllent of PKU and HPA is difticu1t; it involves rigorous compliance, a major alteration in lifestyle, and use of treabDent products tbat bave unusuaI organoleptie qualities. Moreover, measurements of cognitive and neurophysiologie outeomes show subtle deficits (lQ scores are 0.5 5D helow normal), and tbere are lacunae in neuropsychologica1 and neuro-physiological performance. Accordingly, there is growing interest in the second form of treabDent (enzyme therapy). Enzyme therapy could he donc by replacement (of PAH enzyme) or by substitution (with another enzyme 10 degrade excess phenylalanine). Replacement of PAH requires the intact multienzyme complex for catalytie hydroxylating activity (1); it could he done best perbaps only by hepatic transplantation and this approach bas not been pursued. But if the PAL enzyme could he administered by mouth ta the PKU patient, it would bave a certain appeal; therapy with enzymes proteeted from inactivation is feasible for the treabDent of metabolic conditions (35;36). We propose mat PAL will "substitute" for defieient hepatic PAH activity and degrade phenylalanine in the PAH-deficient organisme To test tbis hypothesis, we used the induced mutant (ENU) mouse orthologues of buman PKU and non-PKU HPA (23). We tirst demonstrated praof of pharmacologie principle: given by injection, PAL acts in vivo 10 lower ambient blood phenylalanine levels (Fig. 3). We then demonstrated proofof physiologie principle; PAL placed in the intestinal lumen acts in vivo 10 suppress HPA (Figs. 5 and 6). The latter is a significant finding that capitalizes on tbree prior concepts and observations: (l) amino aeids are in equilibrium between various comparunents of body tluids (37;38) and uItimately in equihbrium witb the imestiDal lumen (39), 50 mat treatment of intestinal lumen phenylalanine will affect all body pools. (il) PAL p1aced in the intestinal lumen will modify phenylalanine content of body tluids in the whole animal (15;18). (iil) • 124 PAL placed in the intestiDallumen will act on bath the dietary pbenylalanine and the endogenous runout of Cree phenylalanine from its boUDd pools (40). AccordinglY9 • the appropriate dosage and scbedule (ta avoid UDder- or overtreatment) of oral PAL9 perbaps in combination with a controUed and modesdy low protein diet9 sbould control the pbenylalanine pool size without need of the drastic restriction of dietary phenylalanine as now practiced and requiring anificial diets. Ancillary treabDent of PKU witb PAL and prudent protein intake would become analogous to treabDent of diabetes meUitus with insulin9 with an additioDa1 feature - the enterai route would avoid problems with immune recognition ofPAL. UDtil DOW 9 the cost of PAL bas probibited any consideration of therapy; even animal studies were eunailed. The recombinant enzyme we descnbe here may avoid this constraint and bas enabled our investigations. The relatively low specifie aetivity of the recombinant PAL product and relative inefficiency at pH 7.0 (lBEX, unpublisbed data), may be offset by the long contact lime between enzyme and substrate during passage througb small and large intestine. The formulation currendy under development is focused on completely proteeting the PAL enzyme against a protease enviromnent. ACKNOWLEDGEMENTS We tbank Dr. Achim Recktenwald for preparation of the enzyme, Pamela Danagher and Dr. King Lee wbo gave invaluable assistance during the carly stages of mis project and Margaret Fuller and Beverly Akerman for tecbnica1 help and guidance. We also acknowledge the advice of the perceptive reviewers of tbis manuscript. This work was supponed in pan by the Medical Research Council (Canada), the Canadian Genetic Diseases Network (CODN) (Networks of Centers of ExceUence), and a contraet for maintenance of the mice from IBEX via CaDN. Studentship awards were supponed by the McGill University-Montreal Cbildren9 s Hospital Research Institute, the Garrod Association (Canada) and The Auxiliary (Montreal Cbildren's Hospilal). • 115 TABLEl • CbaDge in phenylalanine cODtent 01 in vitro solutions under various treatmeots Experimental Treatmentf Decre8se in Conditions Phenylalanine (fJ, CODtro1)(9 Control Non·recombinant E. coli cells o Chymouypsin o intestinal tluid o PAL In induced recombinant E. coli cens 76 ln induced recombinant E. coli cens 72 + chymotrypsin in medium ln induced recombinant E. coli cens 66 + intestinal tluid in medium , Treatments were for lhr foUowed by measurement ofL·pbenylalanine content. (9 Initial concentration, 4 mM L·phenylalanine. • 126 • Ptac PtIIc q Lac. PAL Orl R Kan ftG. 1. PAL gene from yeast R. toruloides was cloned in the expression vector pIBX-7 wbere transcription is controUed by the strong inducible tac promoter and tenninated by the rRNA transcription terrninator sequences rrnBTl and rmBT2. Lacfl represses the tac promoter, benœ isopropyl jl-D-tbiogalactoside is required to release it from the promoter. The kanamycin resistance gene (Kan~ is included in the construct to aIlow selection ofceUs contaiDing the plasmid. • 127 • 1 2 I7A PAL-. Il ... 31 21.1 DG. %. Purified PAL enzyme (5 /4) separated on 4-15% gradient SDSIPAGE. MolecuIar mass markers in kDa are to the right. Lanes: 1, sample of PAL with - 20% impurities indicated by additiona1 bands; 2, low-range molecuIar mass standards (Bio-Rad). • 128 • 1000 ftG.3. Injection i.p. of recombinant PAL enzyme reduces plasma phenylalanine in the ENU2 mouse (y axis is logaritbmic scale) over time (x axis) (P < O.OS). Reduction of plasma phenylalanine by PAL shows a dose-resplose relationsbip (z axis). Data are normaUzed ta the control (sbam-tteated) values for each animal at each point. Data depicted are the average of 5 paired series. The range of control (100%) values was 390-2,0131&M for animais receiVÏDg 2 units of PAL, 572-1,488 1&M for animais receiviDg 20 units, and S04-1,4741&M for animais receiving 100 UDÏts• • 129 • i , , i , l ' , , , i o !50 100 otir • SMm 24 tir ----"""'---41•..--- otir ------1 • 1 PAl 24 tir +--_.._-- DG. 4. A single i.p. injection of recombinant PAL enzyme (100 units at zero time), reduces plasma phenylalanine level in ENUI mice by 95% al 24 br (P < 0.02) relative ta sbam-treated contrais. Data for five paired series (means ± 1 SD) are nonnalized ta paired control values ta accommodate inter- and intra-individual variation, The range of control values (100% al zero time) was 41-528 ~; every animal showed a response ta PAL. • 130 • , , 1 o 123 .. TIme (hrs) ftG. 5. Plasma phenylalanine levels in ENU2 mice after oral administration (25 units per mouse) of induced recombinant E. coli cens expressing PAL: 31 % reduction within 1 br (P < 0.04) and 44% reduction in 2 br (P < 0.0(4). Data are normalized to control values (mean ± 1 SD). ., sbam; •, PAL enclosed in E. coli. The range of control values (100%) was 425-800~; every animal showed a response to PAL. • 131 • o 2 3 .. Time (hrs) nG. 6. Plasma phenylalanine levels in ENU2 mice after combined oral administration of naked PAL enzyme (200 units per mouse) and protease inlubitor (aprotinin): 50% reduction within 1 br (P < 0.017) and 54% in 2 br (P < 0.023). Data are normalized to control values (means ± 1 SD)... sbam; ., unproteeted PAL plus aprotinin. The range of control values (100%) was 4S8-1,OSI~; every animal showed a response ta PAL. • 132 REFERENCES • 1. Scriver,C.R., Kaufman,S., Eisensmith,R., and Woo,S.L.C. 1995. The Hyperphenylalaninemias. In The Metabolic and Molecular Bases ofInherited Disease. (7 ed.) Scriver,C.R., Beaudet,A.L., Sly,W.S., and Valle,D., editors. ~lcGraw Hill Book Co, New York. 1015-1075. 2. Scriver,C.R. 1967. TreabDent in Medical Genetics. In Proceedings of the Third International Congress of Human Genetics. J.F.Crow and Neel,J.V., editors. The Johns Hopkins Press, Baltimore. 45-56. 3. Bickel,H., Gerrard,J., and Hickmans,E.M. 1953. lnt1uence of phenylalanine intake on phenylketonuria.lAncet n:812-S13. 4. Woolf,L.I., Grlffïtbs,R., and Moncrieff,A. 1955. TreabDent of phenylketonuria with a diet low in phenylalanine. Brit Med J 1:57-64. S. Armstrong,M.D. and Tyler,F.H. 19S5. Studies on phenylketonuria. I. Restriction phenylalanine intake in phenylketonuria. J Qin Inven 34:565-580. 6. Cockbum,F., Clark,B.J., Caine,E.A., Harvie,A., Farqubarson,J., Jamieson,E.C., Robinson,P., and Logan,R.W. 1996. Fany acids in the stability ofneuronal membrane: Relevance to PKU. Internat Pediatr Il:56-60. 7. Riva,E., Agostonî,C., Biasucci,G., Trojan,S., Luotti,D., Fiori,L., and Giovannini,M. 1996. Early breastfeeding is linked to higher intelligence quotient scores in dietary treated phenylketonuric children. Aaa Paedialr 85:56-58. s. Scriver,C.R. 1971. Mutants: Consumers witb special needs. Nutr Rev 29:155 158. • 133 9. Buist,N.R.M., Prïnce,A.P., Huntington,K.L., Tuerck,J.M., and Waggoner,D.D. 1994. A new arniM &Cid mixture permits new approaches 10 • the treatment ofphenylketonuria. Acta Paediatr Suppl 407:75-77. 10. Medical Research Council Working Pany on Phenylketonuria. 1993. Phenylketonuria due 10 phenylalanine hydroxylase deficiency: an unfolding story. BMJ 306:115-119. Il. Medical Research Council Working Pany on Phenylketonuria. 1993. Recommendations on the dietary management of phenylketonuria. Arch Dis Child 68:426-427. 12. Scriver,C.R., Kaufman,S., and Woo,S.L.C. 1989. The Hyperphenylalaninemias. In The Metabolic Basis ofInherited Disease. (6 ed.) Scriver,C.R., Beaudet,A.L., Sly,W.S., and Valle,D., editors. McGraw Hill Book Company, New York. 495-546. 13. Hodgins,D. 1971. Yeast phenylalanine ammonia Iyase: purification, propenies of the identification of catalytically essential dehydroalanine. J Biol Chem 246:2977-2985. 14. Hosldns,J.A., Holliday,S.B., and Greenway,A.M. 1984. The metabolism of cinnamic acid by hea1thy and phenylketonuric adults: A kinetic study. Biomed Moss Speetrom Il:296-300. 15. Bourget,L. and Chang,T.M.S. 1986. Phenylalanine ammonia-lyase immobilized in microcapsules for the depletion of phenylalanine in plasma in phenylketonuric rat model. Biochim Biophys Acta 883:432-438. • 134 16. Sarldssian"C., Lee,K.C., Danagher"P., Leuog,R." Fuller,M.A., and Scriver,C.R. 1996. Enzyme substitution tberapy with phenylalanine ammonia • Iyase for the trealJDeDt of phenylalanine hydroxylase-deficient hyperphenylalaninemia (HPA). Amer J Hum Genet S9:A207(1183) (Abstr.) 17. Sarkïssïan,C.N., Sbao,Z., BIain,F., Peevers,R., Su,H., FuIler,M.A., and Scriver,C.R. 1997. Effect of oral phenylalanine ammonia Iyase (PAL) on plasma phenylalanine levels in a genetic mouse orthologue of PKU. Am J Hum Genet 61:A35 (182) (Abstr.) 18. Safos,S. and Chang,T.M. 1995. Enzyme replacement tberapy in ENU2 phenylketonuric mice using oral microencapsulated phenylalanine ammonia lyase: a preliminary repon. Anijicial Celu, Blood Substitules, cl lmmobilization Biotechnology. 23:681-692. 19. Hoskins,J.A., Iack,G., Wade,H.E., Peiris,R.J.D., Wrigbt,E.C., Starr,D.J.T., and Stem,J. 1980. Enzymatic control of phenylalanine intake in phenylketonuria. Loncet 1:392-394. 20. Ambrus,C.M., Antbone,S., Norvath,C., Kalgbatgi,K., Lele,A.S., Eapen,G., Ambrus,J.L., Ryan,A.J., and Li,P. 1987. Extracorporeal enzyme reactors for depletion ofphenylalanine in phenylketonuria. AM lntem Med 106:531-S37. 21. Gilben,H.J., Clarke,I.N., Gilbson,R.K., Stephenson,J.R., and TuIly,M. 1985. Molecular cloning of the phenylalanine ammonia lyase gene from Rhodosporidium tondoides in Eschericia coli K-12. J BaaerioI161:314-320. 22. Omm,H. and Rasmussen,O.F. 1992. Expression in E. coli of the gene encoding phenylalanine ammonia-lyase from Rhodosporidium toruloides. Appl Microbiol BiotechnoI36:745-748. • 135 23. Sbediovsky,A., MeDonald,J.D., SymuIa,D., and Dove,W.F. 1993. Mouse • models ofhuman pbenylketonuria. Genetics 134:1205-1210. 24. Gilben,H.J. and Tully,M. 1982. Synthesis and degradation of phenylalanine ammonia-lyase ofRhodosporidium toruloides. J BaeterioI150:498-S0S. 25. Ausubel,F.M., Brent,R., Kingston,E., Moore,D.D., Seidman,J.G., Smitb,J.A., and Strubl,K. 1997. Saccharomyces cerevisiae. In CU"en1 Protocols in Molecu/ar Biology. John WiJey & Sons Inc., New York. 26. Fukubara, N., Yosbino, S., Yamamoto, K., Se, T., Sone, S., Nakajima, Y., Suzuld, M., and Makiguchi, N. L-Pbenylalanine Ammonia Lyase. EuroPea11 Patent Application(O 260 919). 1988. 27. Rasmussen,O.F. and Oerum,H. 1991. Analysis of the gene for pbenylalanine ammonia-lyase from Rhodosporidium loruloides. DNA Seq 1:207-211. 28. MuIlis,K., Faloona,F., Scbarf,S., Saiki,R., Hom,G., and Erlieh,H. 1986. Specifie enzymatie amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbour - Symp Quant Biol SI:263-269. 29. Su,H., Blain,F., Musil,R.A., Zimmermann,J.J.F., Gu,K., and Benneue,O.C. 1996. Isolation and expression in Escherichia coü of hepB and bepC, genes coding for the glycosaminoglycan - degrading enzymes beparinase n and beparinase m, respectively, from Flavobacterium heparinum. Appl Environ MicrobioI62:2723-2734. 30. McDonaId,J.D., Bode,V.C., Dove,E.F., and Sed1ovsky,A. 1990. Pah....s: A mouse mutant defieient in pbenylalanine bydroxylase. hoc Natl Acad Sei US4 87:1~S-I~7. 31. McDoœld,J.D. and Cbarlton,C.K. 1997. Cbaracterization of mutations al the mouse phenylalanine hydroxylase locus. Genomics 39:402-405. • 136 32. Waten,P.J., Pamiak,M.A., Nowaeki,P., and Scriver,C.R. 1998. In vitro expression analysis of mutations in phenylalanine hydroxylase: Linking • genotype ta phenotype and structure ta function. Hum Muttlt Il:14-17. 33. Fang,B. , Eisensmitb,R.C., Li,X.H.C., Finegold,M.J., Shedlovsky,A., Dove,W., and Woo,S.L.C. 1994. Gene therapy for phenylketonuria: phenotypic correction in a genetical1y defieiency mouse model by adenovirus mediated hepatic gene transfer. Gene Ther 1:247-254. 34. MacCready,R.A. 1974. Admissions of phenylketonuric patients to residential institutions before and after screening programs of the newbom infant. J Pediatr 85:383-385. 35. Chang,T.M.S. and Pomanzsky,M.J. 1968. Semipermeable mierocapsules containing cata1ase for enzyme replacement in acataiasaemie mice. Nature 218:243-245. 36. Prakasb,S. and Chang,T.M.S. 1996. Mieroencapsulated genetically engineered live E. coli DHS cells administered orally 10 maintain normal plasma urea level in uremie rats. Nat Med2:883-887. 37. Coho,R.M., Palmieri,M.J., and MeNamara,P.D. 1980. Non equihbrium thermodynamics, non covalent forces, and water. In Principles of Metabolie Control in Mammalian Species. R.H.Herman, Coho,R.M., and MeNamara,P.D., editon. Plenum Press, New York. 63-63. 38. Cbristensen,H.N. 1982. Interorgan amino acid nutrition. Physiol Rev 62:1193 1233. 39. Cbristensen,H.N., Feldman,B.H., and Hastings,A.B. 1963. Concentrative and reversible ebaracter of intestinal amino acid traDSpOrt. Am J Physiol 205:2S5 260. • 137 40. Cbang,T.M.S., Bourget,L., and Lister,C. 1995. A new theory of enterorecirculation of amino acids and its use for depleting unwanted amino • &Cids using oral enzyme-artificial ceUs, as in removing phenylalanine in phenylketonuria. Ani!Cells Blood Substit Immobil Biotechnol23:1-21 . • 138 • CHAPTER5 Discussion • 139 ln the history of lite sciences, mutants bave been imponant resources for gaining insigbt into the biological fonction of genes (1). Orthologous animal models bave • served science by providing surrogates for human subjects in the study of disease phenotypes and their potential therapies (2). The particular advantages in mice as the onhologue are (1) bigbly bomologous genome segments between mouse and man (3), (il) the shon mouse generation time, (iil) large liner size, (ill) their relatively small cost in care and maintenance and (v) the possibility of producing a model (transgenic) if a 'natural' one is DOt available (1;4). Access to mouse models bas been a great belp towards the understanding of underlying disease mechanisms (1). The initial development of mouse models of human disease entails either a genotype-driven approach wbich required lengthy process of gene mutagenesis followed by isolation of the mutant strain and funber inbreeding, or a phenotype driven approach (i.e. by ENU tte8b1lent) whicb focuses on the recovery of novel or sougbl after phenotypes witbout focusing on the underlying gene. Identification of the associated gene is secondary. Either method resu1ts in models tbat ooly bave the potential ta measure the metrical traits of a specific mutant allele, and since conclusions about the role of a gene product drawn from a single mutation may be misleading (especially with the genotype-driven approach where the mutation may produce an atypical phenotype), il is importanl, if al aU possible, to try and look al more than one mutant aUele al a particular locus (S;6). The BeteroaUelic Mouse ln the presence of formerly established mutant lines, the potential developmenl of heteroallelic animal models becomes an added advantage. Generation of heteroallelic mouse models provide the opportunity to produce additional variants of disease pbenotypes, in sorne iDstauces, also allowing the expression of mutant genes tbat wouId otberwise not he viable in the bomoallelic fonn. In addition, when • various alleles are available, series of heteroallelic models cao he developed 140 providing a spectnIID of phenotypic cbaracteristics associated witb the disease in question. For HPA, heteroallelism at the (human) PAR locus is representative of • - 75% of probaDds in the population (7), therefore the corresponding mouse models cao provide a better understaDding of phenotypes associated with tbis disorder. To this end, the heteroallelic mouse model developed here contnbutes ta a more complete understanding ofthe human condition. ln Cbapter 2 and in the mouse genetic Pah homologues web page presented in Appendîx D, we report on a new beteroallelic ENUI/2 mouse model and describe and compare phenotypes of control (BTBRIPas) and mutant onhologues of human PKU and non-PKU HPA strains (ENU2, ENUI and ENUI/2) and their heterozygous counterparts. The mutations associated with each of the homoallelic models were described in Chapters 1 and 2. The ENUI mouse displays a mild phenotype (non-PKU HPA) and cames a mutation tbat affects amino acid residue 106 (VI06A). Val 106 is conserved among mammalian species but is divergent in others; it is in a region tbat carries the majority of divergence (8). To date, no human PAH mutation bas been identified affecting this amino acid residue. The nearest affected human amino acid changes accur at alanine 104 (AI04D) associated with variant PKU (7;9) or at serine 110 (SIIOL) (9); bath mutants appear to affect secondary structure and protein stability (10). They are bath located in N-terminal regulatory domain of the PAH enzyme (10). The ENU2 mouse bas a severe PKU-like phenotype and cames a mutation affecting amino acid residue 263 (F263S). One human PAR mutation bas been reponed al this residue (F263L) (9). Position 263 is located 4.9 A away trom the Fe atom in the active site; substitution with leucine in the human protein is suspected to interfere with the protein's 1t-stacking interactions witb the substrate (10). The substitution occurs at a position direcdy adjacent to amino acids involved in the pterin binding (10-15). In the ENU2 aIlele (F263S), a similar relationship may existe The • majority ofamino acid changes in tbis region are a5S0Ciated with variant ta severe 141 PKU phenotypes (7;16). As sbown bere, the heteroallelic (VI06A1F263S) • ENUl/2 mouse counterpart displays an intermediate HPA phenotype. Metabolic Manipulation Like human subjects, the mice are pliant to metabolic manipulation. (See Chapter 2, Fig. 2). An extended HPA can be induced in the ENUI and ENUl/2 mice by injection or oral gavage with phe-containing solutions. For the ENU2 animais, euphenylalaninemia cao he established after a three-day dietary control of phe intake. An oral dose or injection of phe can quicIdy reestablish PKU phenotype in the ENU2 animal. Although HPA can be easily induced in the ENU1 strain, the plasma phe clearance rate is fast and therefore levels do not remain high for an extended period of tilDe; in contrast, the plasma phe clearance rate is slowest in the ENU2 animal making controlled HPA difficult to establisb and maintain. The ENU1/2 model, with its attenuated clearance rate, displays HPA, suitable for experiments requiring highly monitored plasma phe regulation. Pah Enzyme ActivitY Hepatic Pab enzyme activities of the various models correlate inversely with the corresponding plasma and brain phe levels (See Cbapter 2, Fig. 1 and 3). The ENU2 mice on normal diet with bighly elevated plasma and brain phe levels have no deteetable Pah activity, while ENVI and ENU1/2 mice with -24 % and S% normal enzyme activity respectively have near normal plasma and brain pbe levels. Enzyme activity in the kidney (as measured in bumaos by Lichter-Konecki et al. 1988 (17», may also bave an affect on the overall phenotype of the mice. This was oot measured in our studies, however one would expcct these mutations to bave similarly deleterious effects. The ENU1/2 animais could be considered functionally hemizygous for their ENUI aIIeles since they carry the ENU2 allele tbat apparendy abolishes PAH activity (18). However, the tact tbat the activity of • the enzyme in the heteroal1elic mouse is lower tban the average of the ENUl and 142 ENU2 hints at a possible negative complementation between the alleles. The carrier counterpans with approximately 50% normal enzyme activity, display • nonnal plasma and brain pbe levels, an expected result for autosomal recessive pbenotypes. These observations agree witb the suggestion by Kacser and Burns tbat "enzymes do not act in isolation" (19). AIl systems fonction in response 10 a series of enzymes tbat are kinetically linked 10 other enzymes via their substrates. Fluxes tbrougb sucb systems are therefore a product of the systemic properties, and 50 variation at one locus must be measured as pan of the wbole system (sensitivity coefficient). There are as many coefficients for a given flux as there are enzymes in the system; the sum of these coefficients is equal 10 1, with each coefficient being small. Therefore any large change in a specific enzyme's activity (a single coefficient) results in a negligible change in the flux. Fifty percent activity los5, as is the case with our heterozygote, results in a minimal change in phenotype (19). Pah Enzyme Stability Variation in Pah protein stability is observed in the different ENU treated HPA mouse models. Premature degradation of mutant protein cao be triggered by structural abnormalities tbat are generally associated with altered oligomerization and increased aggregation of the protein (20). This may explain the results observed from the western blots for the ENUI mutant protein, which displayed apparent protein instability. The ENUI mutation does not lie in close vicinity 10 the PAH epitope (amino acids 139-155) reeognised by the PHS monoclonal ann"body (13). Therefore loss of the epitope does not explain the lack of deteetable PAR on the western blots. On the other band, some misseose mutations bave minimal or no effect on the stability of the enzyme but result in loss of activity, as the affected residue is critical for proper enzyme function. This is the suspected cause of the phenotype observed in the ENU2 mouse where the protein is stable but does not bave any detectable aetivity. In the ENU1/2 model the oligomer assembly, • with interaction between the IWo different mutant subunits, results in a compound 143 with an intermediate stability in comparison 10 the ENU1 and ENU2 mutant • proteins. MeasuriDg Bebavior Bebavior measurement is difficult in the animal Madel. However maze tests bave been developed tbat measure 'executive fonction' in animais (21-23). The T-maze altemation test and the Win-Stay eigbt-arm radial maze task, which were used here, measure simple discrimination leamiDg, shott-term memory on spatial-reversai and reference memory, babit leamiDg and memory for visual stimulus, respectively. In studying and comparing the various mouse models, the ENU2 mice (on normal diet) were the only ones showing impaired behaviour. No significant difference was observed between wildtype, ENU1, ENUl/2 and their heterozygous counterpans (none of these mutant animais was dietarily manipulated). Reproductive Problems Reproductive problems associated with maternaI HPA in bumans are also observed with the PKU mouse. These are again independent of either patemal or fetal genotype, depending solely on the maternai genotype and dietary pbe intake (24). The maternai effect on offspring correlates direcdy with the degree of HPA, witb 1055 of progeny ooly observed with ENU2 mothers. The level of HPA bas also been effectively manipulated in the ENU2 mouse model allowing a measure of the dose-response relationsbip between maternaI HPA and pregnancy outeome (25). A number of investigators bave looked at the possible cause of these problems. It is apparent that mice, like bumans, bave a transplacental gradient for phe, favoring the fetus (25). This elevated HPA is the cause of cardiovascular developmental defects, different from those observed with burnans. They were vascular (26), in comparison 10 those most reponed in humans, wbich were cardiac (2). Once apin, no significant differences were observed between • wüdtype, ENUl, ENUl/2 and their heterozygous counterpans (again, none of the 144 animais were manipulated dietarily). The natural HPA experienced by the ENUI and ENUl/2 animais was oot high enough ta significantly affect reproductive • status. These findings do resemble buman data sinee maternai plasma pbe levels below 400 J.lM range are usually associated with normal fetaI outeome (2;27). Phenylalanine MetaboUtes The steady state level of plasma pbenylalanine is determined by those processes tbat lead ta the net disposai of pbe and those that replenish the plasma pool (28). For the normal population, the disposal pathway mainly involves bydroxylation of pbenylalanine ta tyrosine with a partial fraction of pbe used for net increase in body protein in growing children. However in the absence or reduced function of PAR, a secondary route, the transamination pathway, becomes significant. This patbway converts pbe ta PPA, whicb is subsequendy convened to PLA and PAA and pbenylacetylglutamine. Wbether these products are the ones responsible for the brain abnormalities associated witb PKU bas long been debated. In the past, ooly analyses of urine, plasma and CSF sampies were possible. These studies strongly suggested that the levels of transamination products achieved in vivo would not be taxie ta brain (29). However, their potential toxicities in the brain could not be fully ruled out as no method was available tbat directly measured brain Metabolite levels. In Chapter 3 we descnbed a novel metbod for measuring the concentrations of PPA, PLA and PAA in mouse brain tissue. To acbieve tbis, we used NICI GC/MS. This metbod requires the reduction of the PPA Metabolite ta a singly deuterium-Iabeled PLA (pLAdl) as PPA is very unstable and decomposes in basic environments necessary for sample extraction. In addition, as PLAdl, it cao be measured in a standard stable isotope dilution assay, using PLAd3 as internaI standard, wbich is also used ta measure the natura! PLA Metabolite. PLA, PLAdl and PLAd3 are men derivatized wim PFB and TFA, and PAA and PAAd, (internai • standard) with PFB. The extra derivatization of PLA isotopomers wim TFA is 145 necessary, as the 2-hydroxyl group of the phenyUactic acid would otberwise decompose by debydration wben passing tbrough the gas ebromatograph. • Derivatization transforms the acids into thennally stable, ebemically inert compounds tbat are volatile at temperatures below 3000c. The gas ehromatograpby column separates the compounds based on volatility. As the molecules elute from the column and pass through the ionization cbamber, tbey acquire an electron and become negatively charged. This ionization destabilises the molecular stnlcture, which results in the loss of the pentafluorobenzyl radical for eacb of the PAA and PLA molecules and their isotopomers. The ions are then passed tbrough a quadrupole mass analyzer, whicb sons the ioDS according to their mass/cbarge ratio. The ions produced by PAA and PLA were initially identified by a complete scan of their NICI mass spectra to identify the MOst intense ioDS. SIM was tben applied, wbich measures the intensities of only the intense-significant ions identified in the full scans of the PFB esters of authentic PAA and PAAd5 internaI standard and the PFB and tritluoroacetyl esters of unlabeUed and labeUed PLA. SIM enbances the measured intensities by a few oRlers of magnitude. To calcu1ate the fiDaI endogenous concentrations of the compounds, the isotopie impurities of the internai standards and the natura! abundances of heavy isotopes in the constituent atoms were measured and taken into account in the subsequent calculations. Calibration curves for ail three Metabolites, over the expected physiological ranges, demonstrated a linear response. The sensitivity of tbis metbod is estimated to be -0.1 nmol/g brain tissue. The use of deuterium-Iabelled analogues as internaI standards contnbutes greatly to the accuracy of this method, as endogenous PPA (as reduced to PLAdl), PLA and PAA are compared wim virtuaIly the same Molecules, affected in the same manoer duriDg each step ofsample preparation and analysis. This NICI-GCIMS metbod was used to measure the concentration of PPA, • PLA, and PAA in the brain tissue of wildtype, ENUl and ENU2 mice. Metabolite 146 levels correlated direcdy with the corresponding plasma and brain pbe levels indicating tbat at normal or near normal phe levels, the transarnination pathway • contributes insignificandy 10 the brain metabolic profile. The ENU2 mouse levels of Metabolites measured in brain tissue did not reacb levels of toxicity necessary for pathogenesis, as documented in earlier studies (29;30); levels were in fact lQ-fold lower tban tbose associated with 1Oxicity, yet the ENU2 mice exlubit bebavioural and cognitive impairment. We attnbute tbis effect 10 phe itself until evidence indicates otherwise, and therefore agree tbat "there are no abnorma1 metabolites in PKU, oo1y normal Metabolites in abnormal amounts" (31). In this way the combined use of both the analytica1 method and the onhologous mouse models bas made a contribution toward resolving a long-standing controversy about PKU associated pathologies. Logic and Rote of Low Phenylalanine Diet With pbenylalanine once again verified as 6the villain' associated with the natura! course of the mutant pbenotype, it is reassuring tbal the mode of therapy applied for the PaSt four and a half decades bas becn functioning to eliminate the problem direcdy al the source. Low-phe dietary therapy was inaugurated in the 1950'5 (32-34) and bas since been the mainstay of treatment. It is effective because the dietary experience cao he purposefully modified affecting the internai milieu (2;35). It lowers and normalizes the steady-state value of phe concentration, reestablishing euphenylalaninemia. This treatment modality acbieved its primary goal by preventing mental retardation and providing a positive pregnancy outeome (27;36;37). Yet the process is anytbing but simple, requiring rigorous compliance and a major alteration in lifestyle. DifficuIties stem in pan trom the restrictions usociated with constant dietary coostraints and in part from the poor organoleptic qualities of the treabDent itself (2;38). In addition, outeomes (whether a product • of imperfect overall compliance or deficits in diet composition) remain less tban 147 optimal, displaying subtle deficits in IQ scores and neuropsychological and physiological performance (2). • The problems associated with the diet...based treabDent are even more cogent with recent recommendations for 'life long treabDent' (37). There is now a growing interest in other forms of treatment that may be less rigorous and far less sociaUy imposing. Various alternative treabDents of PKU and their apparent feasabilities were described in Cbapter 1. Enzyme substitution therapy with phenylalanine ammonia lyase (Cbapter 4) in tbis context is relevant. Prior attempts (3943) al PAL treatment did not progress beyond the occasional experiment, as the limited supply and costly acquisition of the purified form of the PAL enzyme prohibited any consideration of human therapy. Treatment with PAL, purified from natura! sources, bas a predicted daily cost of 10 to 10,000 times the yearly...approximated $5000 (CDN) cost/patient of the diet therapy (lBEX Technologies, personal communication). For the PAL modality of treabDent to he economically feasible, the cost had to be lower or equal to tbat of dietary treabDent. PAL Protection and Use as an Alternative 10 Diet TherapY Cloning teebnology offers the opponunity for an economical supply of PAL 10 eoable enzyme substitution as an alternative treatment for PKU. The PAL gene from yeast R. toruloides bas been inserted into a plasmid onder the control of a high expression modified double Ptac promoter and expressed in non...invasive strains ofE. coli. Active enzyme is easily isolated and purified from the bacteria. The recombinant enzyme descnbed bere provides a vinually limitiess supply of PAL at sustainable cost. Stabilized (protected) PAL, taken orally, could 'substitute' for the native mutant PAR protein; the bypothesis is as follows: PAL would fonction by • depleting bath dietary phe and the endogenous runout of free phe from its bound 148 pools (44) as ail systemic phe pools are in flux equilibrium witb the intestinal lumen (41;45-47). Recent profiles of the amino acids in the duodenum, jejunum • and ileum bave indicated extremely bigh (10-100 fold) concentration of intestinal free amino acids as compared 10 the plasma (44;48). Chang et al. proposed tbat the major sources of intestinal amino acids are from gastric, pancreatic and intestinal and other secretions and not from the dietary source, thus tbis phe pool would be endogenous in origin (44;48). The secretions are bigbly concentrated witb peptides, polypeptides, proteins and enzymes, whicb are broken down into amino acids by tryptic digestion in the intestine. These amino acids are reabsorbed as they pass down the intestine (indicated by the steady decrease in amino acid concentrations down the intestine), constituting the large recirculation of amino acids between the body and the intestine (44;48). Oral ingestion of stabilized PAL would metabolize phe from ingested foods as weil as the gastric, pancreatic and intestinal secretions, preventing the undesirable amino acid from reabsorption back into the body (44). The enzyme is protected (stabilized) to avoid degradation and digestion in the gastro-intestinal tract. In addition, the enzyme will pass tbrough the intestine, metabolize phe and then be excreted in the s1OOl, bypassing problems with immune response associated with accumulation of syntbetic injectable drugs (39;41;49-51). PAL, Dot requiring a cofactor, convens phenylalanine to the Metabolites trans-einnamic acid and trivial amoUDts of ammonia (52). The trans-cionamate metabolized by the Iiver to benzoic acid, is tben excreted in the urine as bippurate (53); it bas no toxic propenies (52;54;55). To test the efficacy of recombinant PAL, we used mutant ENU mouse onhologues of non-PKU HPA and PKU and demonstrated both praof of pbarmacological and physiological principles. The tirst objective was necessary 10 verity the efficacy of the recombinant PAL in depleting systemic phe levels. lotta-peritoneal injection of PAL acted in vivo to lower ambient blood phe levels. • The effect persisted over 24 bours foUowing PAL treatment, with plasma phe 149 levels markedly lower tban those measured at zero lime prior 10 PAL administration. • The second objective was 10 show tbat PAL cao be administered orally and proteeted from degradation by intestinal digestion while actively depleting pbenylalanine. This was effectively demonstrated using two different systems. Filst, recombinant PAL was expressed in a non-pathogenic E. coli organism tbat provided an environment for PAL, proteeting it from the action of digestive enzymes, wbich were unable ta penetrate the ceUs. The free phe, in the intestinal lumen, was transponed through the bacterial membrane and convened by PAL to 'rans-einnamic acid. PreUminary experiments were canied out in two stages to measure the efficacy of the E. coli system. ln vitro pbe conversion was measured. Control cells (empty of PAL), chymotrypsin solution and intestinal tluid were compared to ceUs filled wim active PAL, in protease free environment and exposed to chymotlypsin solution and intestinal fluid. The tirst three had no effect on phe levels in solution, whereas the cells filled witb active PAL rapidly reduced phe levels by an average of -71%, with a minimal impairment of the PAL effect on phe by cbymotrypsin or intestinal enzymes in the media. In addition, naked PAL, unproteeted by cellular membrane, lost aU activity witbin minutes upon exposure 10 chymotrypsin and intestinal fluid. Our second approach was to observe the in vivo effect of PAL proteeted from degradation inside the E. coli vebicle. Gavage of ENU mice with tbis system acted 10 offset hyperphenylalaninemia in the mouse model. We tben studied a second system. PAL was delivered in solution witb aprotinin protease inhtbitor. This mixture, placed in the intestiDal lumen, again acted in vivo effectively depleting the systemie phenylalanine levels. The long contact time between enzyme and substrate during passage tbrougb smal1 and large intestine cao offset, in part, the relatively low specifie • activity of recombinant PAL (2.2-3.01U/mg). In addition, systems adopted here ISO were interim experimental approacbes used purely for proof-of-physiological • principle. The application of tbis form of therapy in bumans would ideally require a PAL enzyme of bigber specific activity and require a formulation tbat will (a) effectively proteet the protein against protease attack9 and (b) Dot disturb the intestinal environment9 allowing for normal digestion. With sucb a formulation, a more appropriate prediction of the dosage and treatment regiment for the various fonns of HPA will he possible. The assumption stands tbat as with dietary therapy, PAL treatment will he adjusted on an individual basis. However, unlike dietary treatment9 PAL should control the phenylalanine pool size without drastic life style restrictioD 9 making it far more user friendly. What would be considered an awesome fcat with the current treatment could he more easily acbieved with PAL; far better compliance on a day 10 day basis and potentially for a lifetime. It will also eliminate the worries associated with diet related nutrient imbalance and deficiency (56-58) as no major dietary adjustments (trom the nonn) will be required with the PAL treatment modality. ln The Metabolie and Moleeular Bases ofInherited Disease9 Scriver et al. recognized the major milestones in the PKU joumey since its discovery in 1934. Among them were the discoveries in the 1950'5 of deficient PAR enzyme as the major cause of PKU and the restriction of dietary pbe intake, a functional treatment for tbis disease; in 1963, the Guthrie test was inttoduced wbich allowed for population screening and in the 198O's, the PAIl gene was mapped and cloned (2). Here wc recognized the 1990's development of mouse models wbich opened the door to investigations tbat would bave othenvise been impossible with human subjects. For the future decade, we hope 10 go a step furtber by inttoducing a new oral drug therapy for HPA. The work we bave done bere could transform the treatment of PKU ta a more companble approach (adding a positive effect with a mecbanism vs. removing a negative intluence by drastically cbanging life • style and culture) and more imponandy, improve the lives of the affected patients. (SI Future Aims • The findings in this tbesis may bave implications on a numher of levels. The heteroallelie ENUl/2 mouse model, displaying HPA tbrough metabolie manipulation, is suitable for experiments requiring a model with plasma phe levels tbat don't tluetuate constandy. Different severities of HPA, easily induced and maintained in tbis animal model, would he helpful in measuring clinical parameters such as maternai effect (viz McDonald, 2(00) (25) and bebavior. We see tbree ongoing initiatives with PAL: 1. The goal here is ta produce a PAL fonnulation tbat will bave long-term efficacy. Various oral protein drug strategies bave been attempted at IBEX with the aim of improving PAL protection, bioavailability and producing a fonnulation bt is fit for repeated administration. Cross-Linted Enzyme Crystal (CLEC) fonnulation, involving bateh crystallization of PAL and ehemical cross-linking, bas been suggested as a beuer option for PAL delivery; both steps are equally eritical in producing a stable protein with good mecbanical properties (IBEX unpublished data). CLEC technology bas been used with other proteins 10 produce catalysts tbat bave increased stability against denaturation by heat, organie solvents and exogenous proteases (59). This stability may he explained by the exclusion of proteases, owing to the size of the solvent channels (60). With PAL, the small substrate (pbe) will easily penetrate the body of the crystal 10 reaet witb the active sites. 2. Animais continue 10 he a 1001 for ongoing studies with PAL therapyas we bave DOW developed a protoeol for long-term PAL administratiOD, using a route tbat provides direct access 10 the duodenum (See Appendix E). This route will serve at the interim experimental stage wbile enterie coaling, wbieh proteets against the &Cid environment of the stomach (a possible contributor 10 enzyme inactivation), is not applied. 3. Long-tenn efficacy of oral formulated PAL will he demonstrated by extended (week-long) stable plasma and brain eupbenyJalaninemia and normal pbe • Metabolite (pAA, PPA and PLA) levels (measured by NICI-GCIMS) in the mouse. 152 First-in-man studies will follow praof of long-tenn efficacy established in the mouse model. Like in animais, the end point here will be ta establish long-tenn • euphenylalaninemia in patients, following routine oral dosing of PAL. This fonn of treatment will ultimately replace the cunent dietary treatment of PKU. • 153 • REFERENCES 1. Hrabé de Angelis,M. and Balling,R. 1998. Large scale ENU screens in mouse: genetics meets genomics. Mutat Res 400:25-32. 2. Scriver,C.R. and Kaufman,S. 2001. Hyperphenylalaninemia: Pbenylalanine Hydroxylase Deficiency. In The Metabolic and Molecular Bases ofInherited Disease. (8 ed.) Scriver,C.R., Beaudet,A.L., Sly,W.S., VaUe,D., Assoc.eds.Cbilds,B., Kinzler,K., and Vogelstein,B., editors. McGraw Hill., New York. 3. Nadeau,J.H. 1989. Maps of lineage and synteny bomologies between mouse and man. TlG 5:82-86. 4. McDonald,J.D. 1994. The PKU mouse project: its history, potential and implications. Âcta Paediatr 407: 122-1123. 5. Brown,S.D.M. 1998. Mouse models of genetic disease: New approaches, new paradigms. J Inher Metab Dis 21:532-539. 6. Brown,S.D.M. and Nolan,P.M. 1998. Mouse mutagenesis - systematic studies of mammalian gene function. Hum Molec Genet 7:1627-1633. 7. Kayaalp,E., Treacy,E., Waters,P.J., Byck,S., Nowacki,P., and Scriver,C.R. 1997. Roman Phenylalanine Hydroxylase Mutations and Ryperphenylalaninemia Phenotypes: A MetaDa1ysis of Genotype-Phenotype Correlations. Am J Hum Genet 61:1309-1317. 8. McDonald,J.D. and CharIton,e.K. 1997. Characterization of mutations at the mouse phenylalanine hydroxylase locus. Genomics 39:402-405. 9. Mutation LisL 2000. • (http://data.mcgill.calcgi-biDIpahdb_newllist_mut.pre). 154 10. Erlandsen,H. and Stevens,R.C. 1999. The structural basis of • Phenyketonuria. Molec Genet Metab 68:103-125. 11. Erlandsen,H., Bjorgo,E., F1atmark,T., and Stevens,R.C. 2000. Crystal structure and site-specific mutagenesis of pterin-bound human phenylalanine hydroxylase. Bioch 39:2208-2217. 12. Teigen,K., FroysteiD,N.A., and Maninez,A. 1999. The structural basis of the recognition of phenylalanine and pterin cofactors by phenylalanine hydrxylase: Implications for the catalytic mecbanism. J Mol Biol 294:807 823. 13. Jennings,I.G., Kemp,B.E., and Cotton,R.G.H. 1991. Localization of cofactor binding sites with monoclonal anti-idiotype antibodies: Phenylalanine hydroxylase. hoc Natl Âcad Sei USA 88:5734-5738. 14. Cotton,R.G.H., HoweUs,D.W., Saleeba,J.A., Dianzani,I., Smooker,P.M., and Jennings,I.G. 1993. Structure function studies of the phenylalanine hydroxylase active site and a summary of structural features. In Chemistry and Biology of Pteridines and Folates. J.E.Ayling, editor. Plenum Press, New York. 55-57. 15. Bjorgo,E., Knappskog,P.M., Maninez,A., Stevens,R.C., and Flatmark,T. 1998. Panial cbaracterization and tbree-dimensional-structural localization of eight mutations in exon 7 of the human phenylalanine hydroxylase gene associated wim pbenylketonuria. EUT J Biochem 257:1-10. 16. GenotypelPhenotype. 2000. (http://data.mch.mcgill.calpabdb_new/search'''pben.html). 17. Licbter-Konecki,U., Hipke,C.M., and Konecki,D.S. 1998. PAR expression • in human Iddney. Am J HIlm Genet 63:A269 (AbsU'.) lSS 18. Guldberg,P., Mikkelsen,1. , Henriksen,K.F., Lou,H.C., and Guttler,F. 1995. In vivo assessment of mutations in the phenylalanine bydroxylase gene • by phenylalanine loading: characterization of seven common mutatioDS. Eur J Pediatr 154:551-556. 19. Kacser,H. and Bums,J.A. 1981. The molecular basis of dominance. Genetics 97:639-666. 20. Scriver,C.R. and Waters,P.J. 1999. Monogenic traits are not simple. Lessons from phenylketonuria. TlG 15:267-272. 21. Seamans,J.K. and Phillips,A.G. 1994. Selective memory impainnents produced by traDsient Iidocaine-induced lesions of the nucleus accumbens in rats. Behav Neurosci 108:456-468. 22. Seamans,J.K., Floresco,S.B., and Pbillips,A.G. 1995. Functional differences between the prelimbic and anterior cingulate regions of the rat prefrontal cortex. Behav Neurosci 109:1063-1073. 23. Nasir,J., Floresco,S.B., O'Kusky,J.R., Diewen,V.M., Ricbman.J.M., Zeisler,J., Borowski,A., Manh,J.D., Phillips,A.G., and Hayden,M.R. 1995. Targeted disruption of the HuntiDgton's disease gene results in embryonic letbality and bebavioral and morpbological changes in beterozygotes. Cell 81 :811-823. 24. Sbedlovsky,A., McDonald,J.D., Symula,D., and Dove,W.F. 1993. Mouse models ofbuman pbenylketonuria. Generics 134:1205-1210. 25. McDonald,D. and Cho,S. 2000. The effect of maternaI byperpbenylalaninemia on the offspring of the BTBR- Pahcma2 mouse model for pbenylketonuria: A matemal phenylketonuria model. Amer J Hum Genet • 67:276 (Abstr.) 156 26. McDonald,J.D., Dyer,C.A., Gailis,L., and Kirby,M.L. 1997. • Cardiovascular defects among the progeny of mouse pbenylketonuria females. Peditlt Res 42:103-107. 27. Scriver,C.R., Kaufman,S., Eisensmitb,R., and Woo,S.L.C. 1995. The Hyperpbenylalaninemias. In The Metabolic and Molecular Bases oflnherited Disease. (7 ed.) Scriver,C.R., Beaudet,A.L., Sly,W.S., and Valle,D., editors. McGraw Hill Book Co, New York. 1015-1075. 28. Kaufman,S. 1999. A model of human pbenylalanine metabolism in normal subjects and in pbenylketonuria patients. Proc Natl Acad Sci USA 96:3160 3164. 29. Kaufman,S. 1989. An evaluation of the possible neurotoxicity of metabolites ofpbenylalanine. J PediQlr 114:895-900. 30. Silberberg,D.H. 1967. Pbenylketonuria metabolites in cerebellum culture morphology. Arch Neurol 17:524-529. 31. Knox,W.E. 1972. Pbenylketonuria. ln The Metabolic &sis of lnherited Disease. (3 ed.) I.B.Stanbury, Wyngaarden,J.B., and Fredrickson,D.S., editors. McGraw Hill Book Co., New York. 266-295. 32. Bickel,H., Gerrard,J., and Hiclanans,E.M. 1953. Influence of pbenylalanine intake on pbenylketonuria. Lancet 0:812-813. 33. Woolf,L.I., Griffitbs,R., and Moncrieff,A. 1955. Treatment of pbenylketonuria witb a diet low in phenylalanine. Bril Med J 1:57-64. 34. Armstrong,M.D. and Tyler,F.H. 1955. Studies on pbenylketonuria. I. Restriction phenylalanine iDtake in pbenylketonuria. J Qin lnvest 34:565. • 157 35. Bernard,e. 1878. Les Phénomènes de la Vie. Libraire 1-8 Bailliere et Fils., • Paris. 879-879 pp. 36. Waisbren,S.E., Chang,P., Levy,H.L., Shifrin,H., Allred,E., Azen,C., De La Cruz,F., Hanley,W., Kocb,R., Matalon,R. et al. 1998. Neonatal neurological assessment of offspring in maternaI phenylketonuria. J Inher Metab Dis 21 :39-48. 37. Cockbum,F., BarweU,B.E., Brenton,D.P., Cbapple,1., Clark,B., Curzon,G., Davidson,D.C., Heeley,A.J., Laing,S.C., Lister-Cbeese,I.A.F. et al. 1993. RecommendatioDS on the dietary management of phenylketonuria. Ârch Dis Childh 68:426-427. 38. Ryan, S. R. and Scriver, C. R. Phenylalanine Hydroxylase Deficiency. GeneClinics Nov. 24. 1999. NIB. (http://www/geneclinics.orglprofiJes/pkuldetails.html). 39. Bourget,L. and Chang,T.M.S. 1985. Phenylalanine ammonia-Iyase immobilized in semipermeable microcapsules for enzyme replacement in phenylketonuria. FEBS Lett 180:5-8. 40. looue,S., Matsunaga,Y., Iwane,H., Sotomura,M., and Nose,T. 1986. Entrapment of phenylalanine ammonia-lyase in silk fibroin for protection from proteolytic attack. Biochem Biophys Res Commun 141:165-170. 41. Bourget,L. and Chang,T.M.S. 1986. Phenylalanine ammonia-lyase immobilized in microcapsules for the depletion of phenylalanine in plasma in phenylketonuric rat model. Biochim Biophys Âcta 883:432-438. 42. Ambrus,C.M., Anthone,S., Norvath,C., Kalgbatgi,K., Lele,A.S., • Eapen,G., Ambrus,J.L., Ryan,A.J., and Li,P. 1987. Extracorporeal enzyme 151 reacton for depletion of phenylalanine in phenylketonuria. AM Intem Med • l(l6:531-537. 43. Safos,S. and Cbang,T.M. 1995. Enzyme replacement therapy in ENU2 phenylketonuric mice using oral microencapsulated phenylalanine ammonia lyase: a preliminary repon. Anificial Cells. Blood SubstilUtes, cl Immobilization Biotechnology. 23:681-692. 44. Cbang,T.M.S., Bourget,L., and Lister,C. 1995. A new theory of enterorecirculation of amino acids and its use for depleting UDwanted amino acids using oral enzyme-artificial cells, as in removing phenylalanine in pbenylketonuria. AnilCells Blood Substit Immobil Biotechnol 23: 1-21. 45. Cobn,R.M., Palmieri,M.J., and McNamara,P.D. 1980. Non equilibrium thennodynamics, non covalent forces, and water. In Principles of Metabolic Control in Mammalian Species. R.H.Herman, Cobn,R.M., and McNamara,P.D., editors. Plenum Press, New York. 63-63. 46. Christensen,H.N. 1982. Interorgan amino acid nutrition. Physiol Rev 62: 1193-1233. 47. Cbristensen,H.N., Feldman,B.H., and Hastings,A.B. 1963. Concentrative and reversible cbaracter of intestinal amino acid transport. Am J Physiol 205:255-260. 48. Cbang,T.M.S. and Lister,C. 1988. Plasma/intestinal concentration patterns suggestive of entero-portal recirculation of amino acids: Effects of oral administration of asparaginase, g1utaminase and tyrosinase immobilized by microencapsulation in anificial cells. Biomot.ÂTt.CeIIs An.Org. 16:915-926. • 159 49. Chang, T. M. S. and Prakash, S. Therapeutic uses of microencapsulated genetically engineered cells. Molecular Medicine Today, Elsevier Science • Ltd.,221-227. 1998. so. Chang,T.M.S. 1995. Artificial cells with empbasis on bioencapsulation in bioteebnology. Biotechnol Annu Rev 1:267-295. 51. Wang.W. 1996. Oral protein drug delivery. J Drug Target 4:195-232. 52. Hoskins,l.A., Holliday,S.B.• and Greenway,A.M. 1984. The metabolism of cionamic acid by bealthy and phenylketonuric adults: A kinetic study. Biomed Mass Speetrom Il:296-300. 53. Snapper,l., Chiang,T.F., and Chiang,T.Y. 1940. hoc Soc Exp Biol Med 44:30-34. 54. Hosldns,l.A., lack,G., Wade,H.E., Peiris,R.J.D., Wright,E.C., Starr,D.l.T., and Stem,J. 1980. Enzymatic control of phenylalanine intake in pbenylketonuria. Lancet 1:392-394. 55. Hosldns,1.A. and Gray,1. 1982. Phenylalanine ammonia Iyase in the management of phenylketonuria: the relationship between ingested cionamate and urinary hippurate in humans. Res Commun Chem Pathol Pharmtlcol 35:275-282. 56. Smith,I. 1994. TreabDent of phenylalanine hydroxylase deficiency. Aaa Paediat 407:60-65. 57. Cockbum,F., Clark,B.l., Caine,E.A.. Harvie,A., Farquharson,I., lamieson,E.C., Robinson,P., and Logan,R..W. 1996. Fany acids in the stability of neuronal membrane: Relevance 10 PKU. IntemJlt Pediatr Il:56 • 60. 160 58. Riva,E., Agostoni,C., 8iasucci,G., Trojan,S., Luotti,D., Fiori,L., and Giovannini,M. 1996. Early breastfeeding is tinked to higher intelligence • quotient scores in dietary treated phenylketonuric ChildreD. Acta Paediatr 85:56-58. 59. St.Clair,N.L. and Navia,M.A. 1992. Cross-linked enzyme crystals as robust enzyme catalysts. J Am Chem Soc 114:7314-7316. 60. Margolin,A.L. 1996. Novel crystalline catalysts. TlB Tech 14:223-230. • 161 • CL~STOOUGINALITY 1. Creation of a hybrid beteroallelic ENUl/2 (non-PKU HPA like) mouse strain, with descriptions and comparisoDS of control (BTBRlPas), mutant onbologues of human PKU and non-PKU HPA strains (ENU2, ENUI and ENUI/2) and the beterozygous counterpans. 2. Development of an amplification-ereated recognition site (ACRS) method for fast deteetion of the ENUI mutation. 3. Metabolic manipulation and measures of the rate of plasma phe clearance for the HPA mouse strains. Demonstration of an intermediate phenotype for the ENUl/2 animais, lying between severe ENU2 and mild ENUl phenotypes. The ENUl/2 mouse, more pliant to metabolic manipulation, displays an HPA phenotype tbat is suitable for experiments requiring bighly monitored plasma phe regulation. 4. Comparison of measured hepatic Pah enzyme activities of the various mouse strains, showing inverse correlation belWeen activity and the corresponding phe levels in plasma and brain and plasma phe clearance tîme. ENUI/2 anjmals display levels intermediate to those of the ENU2 and ENU1 mice. S. Variation in Pah protein stability is shown for the different HPA mouse models. Stability of the ENUl/2 mutant protein is intennediate 10 the ENUI (unstable mutant) and the ENU2 proteins. 6. Measures of the maternai HPA effect on offspring correlate direcdy with the • degree of maternaI HPA; abnormal phenotype observed ooly with the ENU2 162 mouse model. Measures of bebaviour demonstrate an abnormal pbenotype, • again observed only witb the ENU2 mouse (resembling buman data where low levels of HPA are associated with normal CNS function). 7. A NICI GCIMS method was developed for analyses of PFB ester derivatives of PAA, PPA and PLA, when formed in situ in brain bomogenates. A stable isotope dilution technique was used with PAAds and PLAdJ as internaI standards. 8. Unstable PPA in the homogenate was reduced by NaB1H4 to stable PLAdl, labeled with a single deuterium and discriminated from endogenous PLA in the mass spectrometer on tbis basis. 9. NICI mass spectra were obrained for the PFB esters of authentic PAA and PAAds and for the PFB esters of the trifluoroacetyl esters of unlabeUed and labeUed PLA and their a5S0Ciated ions were identified. 10. Concentrations of PLA, PAA and PPA in the brain tissue of wildtype, ENUI and ENU2 mice correlated direcdy with the corresponding plasma and brain levels of pbe. The bigbest levels of the Metabolites measured in the ENU2 brain tissue were lo-fold lower tban tbose 1inked with toxicity (as described in literature reports). PKU-related CNS dysfonction is thus associated witb elevated levels ofpbe itself. Il. Use of the ENU mouse onbologues to obtain praof of pbarmacological principle: Intraperitoneal injection of recombinant PAL acted in vivo to lower ambient blood pbe levels. The effect persisted for over 24 bourse • 163 12. Use of the ENU mouse orthologues 10 obtain proof of physiological principle: Two recombinant PAL formulations (proteeted against degradation • by intestinal digestion) were delivered ioto the intestinal lumen. Depletion of the endogenous pool (plasma phe) was demonstrated. 13. Development of a protoeol for long-term PAL administration. using a route that provides direct access 10 the duodenum. • 164 • APPENDIXA (Copyright co 2000 by Academie Press) (bttp://www.apnet.eom) Reprinted with the permission of the publisher • 165 MolecuJar GeDetù:s and MetaboliaJD _.188-194 (2000) • • doi:IO.lOO61rqme.2000.2974. available ooline a& bttp:lIwww.idealibI.lU.Y.c:om on .I.'a[ A HeteroaJlelic Mutant Mouse Model: A New Orthologue for Human HyperphenylaJaninemia Cbristineh N. Sarkissian,· Danielle M. Boulais,· J. David Mdlonald.t and Charles ft. Scriver*,l -Ckpal"t1Mnt 0(BÙJIDIlY. DrporllrWnt 0(HII/IItUI. GcMtiQ. and DrpGI'tnWlIl ofp~ McGül UniuusUy and lk"~ lAboratory. MeGill Uniucnity-Montnal Childnn" HOIIpiIal Raeard& /1UIit1lle.2300 TUP/MT Stlwt. A·TIT. Mon.mal. Qucbcc. H3H IP3, CtIIIGIÙJ; and tD.partmcnt ofB~Sciau%•• Wic/uto SIIJIe Uniwnity. 1845 FtJÜ'mounl. W"1C1aita. lCiJMtg 61260-0026 Rec:eived December 7, 1999 Pbenylketonuria CPKU) and related forma of non JbperpbeDylalaaia.... (JIPA) are ....deli•• PKU hyperpbenylalanjnemia (HPA> (OMIM diaoiden..-ItiqfroIa de8cieaein la the COII"' 261600) are human autoBomal reœ&Bive traits, char· "'of~I.I.pi..to ~TheYaà""ri&y are espIaiaed by a prbauy cIe8cieaey of...... ylal. acterized by elevated leveJs of phenylalanine (phe> aniae ~.... (PAIl) acdvity. The lDIÛority of in body f1uids. These Mendelian diaorders result aaenatecl palieD.. aperieace il iJapair- from deficiencies in phenylalaDine bydroxylase en .eatofcapitived...elo..._t.AI itiaoaeof zyme 1 To .bomconespaadeaœ sbould he addre:ued. Fu: (514)934. became available (1.8). Themiœ thus generated had 4329. E-mail: lDCTlhuaica..m.c:giII.ca. autosomaI rec:essive forma ofHPArepresenting both 188 lœ.1lD'OO 135.00 Cappilbt0 2000 by Ac:ad.aUc Pre. AU riIb&a or rwprodacs:ian ÙlllDY lima l'aeI'nd.. • 166 • HYPERPHENYLALANINEMIC MOUSE MODELS 189 locus and allelic heterogeneity; for example. the procedures described below wete reviewed and ap strain first identified (9), calIed hph-l. was mutated proved by the Animal Care Committee at McGill at the GTP-CH locus (10); GTP.cH catalyzes the University. first &tep in biosynthesis of tetrahydrobiopterin, a Metabolic manipulation of animal modela. cofactor essential for hydroxylase activity. Sub&e Plasma and brain phe levels were measured in all quently, other &trains aU mutated at the PaJ& locus. mice when fed on breeder moUBe cbow (Teklad 8626) but with varying degrees of phenotypic severitr (Madison, WIl. ENU2 mice were then made euphe (orthologues of human PKU and non-PKU HPA), nylalaninemic: br placing them, for 3 consecutive became available (3,8). Here we report a hybrid days. on 80lid diet devoid of phe (Teldad 97152) strain (paJaMalI'). produced by CJ'088ÏDg a homozy supplemented with waœr containing 30 mgIL L-phe, gous femaJe PaJ&MalIl nOD-PKU HPA mouse with a and then injeded with L-pbe (1.1 mglg body M, hete.rozygous male PohMdh PKU carrier. We de subeutaneously) tG produce a controUed predictable scribe the organismal phenotypes of the control HPA state. ENUl and ENU1J2 miœ do DOt show the (BTBRlPas) and mutant straiD8 CPahMalIl and Md/a HPA state on normal diet; a predic:table degree of Pah , the heteroalleüc PaJ&MalII stra.in, and tbeir HPA was produced in tbese strains bysubcutaneous carriercounterparts), their correspondiDg metabolic injection of L-phe Cl.1 mglg). panuneten, hepatic Pah enzyme activity, blood and brain phe leveJs, behavioral parameters and corrob Metabolic ~ TiJDe.depeadent plasma orate prior evidence of maternai HPA eff'ect on the clearance of phe was measured after subc:utaneous fetus. We aIso discu88 how this mouse model is being injection ofthe standard dose ofL-phe in the ENUl, used to measure the respDnse to an alternative ther ENUlfl, and euphenylalaninemic: ENU2 animais. apy for PKU by enzyme substitution with phenylal Plasma pbe was measured at baseline (zero h> and l, anine ammonia lyase CEC 4.3.1.5) to degrade exceas 2 and 3 h postcba11enge. We use tbia parameter as a dietary and endogenoua phenylalanine (18). measure of phe "nmout... Poh enzyme CISSCIY. Liver tissues were prepared MATER1AL8 AND METRODS and stored at -80°C until analysis. Protein conœn• ENU mïœ. W"Jld-type mice (BTBRlPas back tration was measured using the Bio-Rad protein ground) were treated with alkylating agent eN 8888y kit (HeRUles. CA). The 8888r (12-14), mea ethyl-N'-nitrœourea) and mutations mapping tG the suring the conversion oC [U-14C}-L-pbe to labeled ty mouse phenylalanine hydroxylase locus (PaA) were rosine, was modified 88 foUows. Homogenate (100 identified by hyperpbenylalaninemia, a metricaJ 1&1> and 0.4 mM 6-methyltetrahydropterine (6 metaholic trait (3.7). The original straiDs PahMalIl MPH4) (Scbircks Labs. Jona, Switzerland) were (phenotype name, ENU1) and PahMdta ŒNU2), added tG the reaction mixture (0.1 M potassium kincilr given tG us by W. Dove and A. Shedlovsky, phosphate butrer (pH 6.8), 1000 units catalase (Sigma-Aldrich, Oakville, Ontario, Canada>, 0.3 were bred in Madison, WiscoD.8În (3,1) and later 5 genotyped (11). The hybrid heteroal1e1ic: strain mM L-phe, 4 x 10 cpm [U_14C}phe (DuPont NEN. ta (Pall-z • ENUlfl) was bred in Montreal, Canada, Boaton, MN, and 10 mM dithiothreitol (lCN. Costa as describecl here. • Mesa, CA» (final reaction volume = 250 ,dl. The The homozygous mutant ENUI mouse is a coun samples were inc:ubated (with shaking) at 25°C for terpartofhuman DOn-PKU BPA(7.8); itexpresses a 1 ho then boiled for 5 ~ plac:ed on ice, and ana m.issenae mutation (c.364T - C, VI06A) in UDn 3 of lyzed aa:ording to Ledleyet al. (14). Preliminary the Pah gene (11). The bomozygous mutant ENU2 experiments established linearity ofactivity versus mouse is a counterpart of human PKU (3,8); it ex protein concentration and incubation tÏJDe. presses a mi888nse mutation (c:.835T - C, F2638) in Western blots. Liver was homogenized in buffer esDn 7 ofthe Pail gene (11). The ENUlfl strain was c:ontaining 50 mM Trizma (pH 8.0), 150 mM NaCl, t deve10peci brselective matiDgofENUl C2 x Pah-z + 1~ (vlv) NP-40, 0.3 #oLM aprotinin (Roc:he Molec:ular (ENU2I+)à. Genotypes at the Pail locus ofall breed BiocbemicaJs, Laval Quebec, Canada). and 1 mM ers and offspring were verified by DNA analysis. AlI Pefabloc: (Roche Molecular Biochemicals). Samples were eIectrophoresed on 1~ SDS-polyacrylamide 11 Z PaA-.l mice with an &PA pbeDotype were ioitially aamecl gel, transferred to Hybond-C extra nitrocellulose the Pah"'- st.nio; PaA-~ mice are the PKU eDUDterpart. (Amersham, Little Cbalfont, Buckinghamshire, En- • 167 • 190 SARKISSIAN ET AL. gland). and immunoblotted to detect mouse Pah pro ~ with 1 ~ml anti-mouse PH8 primaryantibody j (PbarMin~ Missisauga, Ontario. Canada) (15). detected with peroxidase-Iabeled anti-mouse anti body (1:1000 dilution) (Amersham). and developed with RPN 2109 ECL (Amersham). HWDan PAH wu used as a positive control. Effect ofparentalphenotype on(etal suruival. Fe males were introduced to their breeding partners immed.iately following sexual maturity. The foUow ing female homozygous and compound phenotypes FIG. 1. ~pbe values (JIJDOl. mean :!: SE, Il • 4): cootI'Dl were studied: wild-type BTBRlPas (Contron. ENUl, (BTBRIPas) mice. 91.2 :!: 6 ~I; ENOlI+. 58.5 :!: 7; ENt/21+, ENU1I2, ENU2. and heterozygous ENUlI+. &6.1:!: 1; ENUI. 93.4:!: 8; ENUJJ2.147.0:!: 29; ENU2.1697.4 :!: ENU2I+. Various male genotypes (and phenotypes) 175. The corntllpoDdiDc braiD pb.value- (1&IDOl. mean :!: SE ) are control. 76.9 :!: 6; ENUlI+, 120.3 :!: 10; ENU2I+. 112.5 :!: 5; were aJso studied for possible patemal affect. The ENVI. 123.6 ~ 1; ENU1J2. 1SO.7 :!: 42; ENU2. 876.4 ~ 30. efTect ofmaternai HPAon progeny was measured by counting the number oflitters and number of prog eny at birth and weaning. Blood phe was measured isoleucine was aclded as an internai standard; bD in the dam prior to breeding and at delivery and mogenate was then incubated for 15 min at room weaning. temperature followed by the addition of 1.590 (vlv) 5--sulfosalicylic acid dihydrate solutionand then vor Tests of behauior. The T-maze altemation test texed and centrifuged at 14.000g for 15 min. The was conducted as described by Nasir et al. (16). A supematant was extracted and frozen at -sooC un Win-5tay eight-arm ramai maze task was con til anaIysis. Blood was coUected hm the taiI into 1 WeR T ducted foUowing the completion of the beparinized tubes and plasma was obtained by cen maze tests. The latter task, modified as described by trifugation. Seamans and Phillips (11) and Nasir et al. (16). consista of a central octagooal platform with eight Amino acid analysis. AlDino acids were mea arms radiating hm the middle (35 x 9 x 12 cm); sured by HPLC on a Beckman 6300 automatic eight 6--W light bulbs mounted directlyabave food amino ac:id anaIyzer ~ DISCUSSION nG- 3. Pah enzyme acUvity YS pluma pbe values in control aad ENU pbeoocypes (mean :: SEM;Il :; 4). Enzymeactivity and plasma pb.e levels ofthe ENUVl auimala are iDtermectiate com Animal models assist the study ofdisease pheno pared to thoee ofENUl and ENU2 animals (P < 0.05). types and potential therapies (20). Mouse models • 169 • 192 SARKlSSIAN ET AL TABLE 1 Maternai Etreet GD N1IIII.....and SaofLitten aad Survival to WelllÜDC Average No. orlitten Averap No. o( Average No. o( Matema1 Average No. or surviving ID WIUUlincI pnpnyat progeny surviviDg genocype littenlmated remale mated (emaJe birtbllitter tG welUlingllitter Control 1.9 ~ 0.2 1.& ~ 0.1 8.0 ~ 0.7 7.1 ~ 0.8 ENUlI+ 2.0 ~ 0.3 1.& ~ 0.5 8.1 ~ 1.2 7.& ~ 1... ENU2I+ 3.1 ~ 0.4 1.9 ~ 0.3 &.& ~ 0.6 ".9 ~ 0.1 ENU1 2.1 ~ 0.2 1.9 ~ 0.2 &.2:: 0.5 5.0 ~ 0.5 ENU1f2 3.1 :: 1.3 2.1:: 0.4 6.0:: 0.8 5.3:: 0.8 ENU2 1.3 ~ 0.2 o~ 0" 1.3:: 0.9 0 ~ O· • ANOVA. P < 0.00014. • ANOVA. P < 0.0008. oirer the added advantage in tbat their genomes are Pah enzyme activities ofthe various models cor highly homologoua with the human genome (21). In relate inversely with the corresponding pbe levels addition the mouse and human phenylalanine hy in plasma and brain and with plasma phe clear droxylase genes have -87% conaervation ofthe nu ance time. ENU2 mice with undetectable enzyme cleotide sequence, with -10'lJ ofthe changes ment; activâty have -2o-fold elevated plasma and brain the corresponding proteins bave 95% conserved pbe levels and the slowest clearance rate, wbile amino acid sequences (14). Here we bave described ENUI and ENUlJ2 mice with -24 and 5% normal and compared phenotypes of control (BTBRlPas) enzyme activâty• respectively, bave neat normal m II2 and mutant strains (Pah- , Pah..u4/2, Pah.- , plasma and brain phe levels and more normal and their beterozygoua counterparts), the mutants clearance rates. The carrier counterparts. baving being orthologues of buman PKU and non PKU approximately hall the normal enzyme activity, HPA (Fig. 5). display normal plasma and brain phe levels. These The ENUl mouse, whic:h displays a mild pheno metrica1 traits are thase expected for an autoso type (non-PKU HPA), carries a mutation in exon 3 mal recessive phenotype (25). (11) affecting the N-tenninal region of the enzyme Pah protein shows different states of stability in distant Û'Om the catalytic residues of PAHIPah. re the dift'erent ENV phenotypes. The ENUl mutation cenUy identified by c:rystaliographic analysis ofthe results in protein iDstability, whereu the ENU2 buman enzyme (22,23). The ENU2 counterpart bas mutation bas ooly a minor eirect on this parameter. a mutation in Bon 7 whic:h includes the catalytic Stability in the ENU1J2 compound Î8 intermediate region; the site is predicted ta bave 11'-stacking in in comparison. teractions with the substrate (24). The resulting The bebavioral assessment of ENU2 miœ shows phenotype is PKU-like (11). The ENUW heteroal impaired simple discrimination in short-term mem lelic counterpart displays an intermediate pheno ory, reference memory, babit learning, and memory type. for a visual stimulus. The othergenotypes were cor- TABLE 2 8e11aYionl AaR "Dt.... ~ st:. " = 1) ReIlUliDiDg paotypes Significaaat Test ENU2 combiDed (P) T·mue alterDatioo test Increaae ÎIl averap time required ta reach food (a) 20.7 ~ 6.7 5.2-10.3 :: 0.4-2.1 <0.005 The W"m-Stay eigbt-anD radial maze tallit Reduction in the No.. oC eotries iDto iDiciaIIy lit arDIS 5.5 0.3 6.2-7.5 0.4-0.5 <0.03 Uu:reue in average tilDe nquired ta reach (ood (a) 58.3 15.5 5.~13.1 L3-L9 <4 x 10·· Increaae iD average time tG complete triaJa Cs) 290.0 36.0 71.8-138.& 6.4-13.4 <8 x 10-12 • 170 • HYPERPHENYLALANINEMIC MOUSE MODELS 193 .... , . , a' <- ~- -'- .-~, ._".~: .. ":-, ~ : t ~ ~- .;.. ~~.~." FIG. 5. CJauic moua lIIOdeJa or PKtT and non·PJCU HPA. induced by N..chyl·N'-nitraeouna (ENt1) mutagenesia: A. contrai BTBRlPaa; B, Pah-.l'· heterœyguuacarrier/Wild·type;C.PoA-m non-PKU HPAortboloKue; D. Pah-- be&uozygouscarrierlwild·type; E, PaI&-'~ PKU ortbolague; F. PuJa-.l'~ heteroalIelic ortbolaeue- respondîngly unaffected in clinical measurès. Tbese present studies demonstrate praofofprinciple. both observations coneur with earlier findings (26). phannacologicaJ and physiological. The present re The maternal et1"ect on offspring correlates di· port desc:ribes in detail the parameters available ta rectly with the degree ofHPA and is apparent only measure the short- and long-term responses to this with the ENU2 mothers; the effect is completely therapy and document the advantages of the independent of paternal genotype. These findings ENU1J2 strain for this work. resemble human data where maternai plasma phe levels below the 4OO-1LfD01 range are osuaUyassoc:i ACKNOWLEDGMENTS ated with nonnal fetaI outeome (1). The ENU1J2 mouse model has been particuJarly useful for measuring the response to an alternative This work \YU supported in part by the Medical Resea.n:h Council (Canada). the Canadïan Genecic Diseases Necwork therapy for PKU. namelyoral administration ofphe • 172 • APPENDIXB (Copyright @ 2000 by Academie Press) (http://www.apnet.com) Reprinted with the permission of the publisher • 173 AnalyticaJ Biochemiatry JBO. 242-249 (2000) l1D • doi:lO.l00&'abio.2000.4642. avaiJahJe oa1iae at http://www.idaalibnry.C01IlooIII..•1 Measurement of Phenyllactate, Phenylacetate, and Phenylpyruvate by Negative Ion Chemicallonization-Gas Chromatography/Mass Speetrometry in Brain of Mouse Genetic Models of Phenylketonuria and Non-Phenylketonuria Hyperphenylalaninemia Cbristineh N. Sark:issian.* Charles ft. Scriver.* and Orval A. Mamer1..1 ·1)qIartIMnu ofBid.otlY. Hrurum GcMtia, and Petliatrk•• McGUl Uniuenily. and Debelk 1AbtwatDry, McGUl Uniwnity Montrml Claildren·. HOIIpital ~ lnatiluU, 2300 Tupper Sttwt. A·717. MOIItnal. Quc6«. H3B IP3. CCIIICICIo; and tMeu.s Sped7'orMIJ'y Unit. llcOUI Uniwnity. 1130 PiM Awnue Wat. Jlonbeal. Qucbec. H3A lA3. CœuuIo nyl.'.-'ne 1DetebaIi GCIII8; dea&eri-.; M!Iected Phea~__ (J'KU) (OIIDI 281.-) i8 &he Int ioa .....torinI; ; --...... u_ ...... ID ba". _ Weatifted c....tcaI ca ofilapaind eopiti.edeveIopaIeat. 1'IIe.u- i8 paaied.QpupIIeDy'·-en'-'. (BPA) ..... eleYated leveJa of...... y'._.nln. -.&aboli.. (pIaeayI- PbenyDœtonuria iUeIf,..... ca ... 1 ~ ued: cl. SIdIbt ...... sua-titueiall by % atoma 01 ...... ~ I._t. ._.-...... dIIateriuIII ia &he moIecuIe; ENV. N-ethyl·N'·ai~ŒNUV1) ~ ..... PKU; .--PSU ..~l·..·in__'a; ~1IIOUe ...... &Ir humaD ....PKU byperpblmylalanine aùa; ŒNU2I2). ~ _ lIIGdel for hu.maa. PKU; BPA. ~ l'IIea7lMe1ate; ~JPlIt •••te; ... b,pupbiiiq'·lamnemi'· MB1'PA. N-~büli"ha=m. Nlet.upûYeiDadlemical jmizatian; PA.\. ~.ad; PFB. pea~1; pile. pbeoJfaJaa.iae; PIW. pfaeaylb&oDuria; PLA. 1 To ..... cun-spm...... shoWd be adcIreMed. Fu: (514) a. pbmlyDacâe aàd; PPA. pbeDyfpynme add; SOI. MIected ion 1DOIli 2488. E-mail: md82lflDu" mqpU ca. tDriDI;TPA. ~ OGœ-2W1JUO S35.00 Cap,rilht02000 by ~Pre. • AIl riII*ot~ÎA _,. fitna '-"'Id... 174 • SPECTROMETRIe MEASUREMENT OF PIfENYLALANlNE IN PHENYLKETONURlA 243 MATEIlIAU AND METHODS The method measures PMas the pentafluorobenzyl 100 seo 200 aso ~o l40 20000°1 1 ~. :::1 .- ....~ "- -',. 7(~ Jl~/S~_"'''''''' 1.80000 100 .so zoo ~ .. I.OOOGO FIG. L NlCI mua Ipec:tra obtaiDed for the PFB derivativea oC UD1abeJed PM and PAAd•. IDteDsities orÎou with ...... IJ'fttat tban 145 Da have beeD mulliplied b,.20.and apparDDt co be related co the IlUDple. The ÎIlteDae IODa at m/z 135 and 140 ClUTY Dearly the mtinty or the iDil c:urnDt prodau:ed and awnçond tG the carboxy late aniou formed by the (ou orthe peatdUOl'lllleuyI ndical &Dm the molecular 8IÙDDL WhiJe the moIeculu lIIlioIW upected al m/z 316 and 321. respllCtnely. an IlOt decected. very wnk ion eurnnta aoooo aUributabJe CO Jou or HF &om the molecuJar uUou (DOt abowD) conIirm &he aatun oC the derivativa. 100 lated to tyrosine and onIy a trivial fraction is transam inated to PPA onder normal conditions (4). PAR en 400000 zyme catalyzes the hydroxylation reaction; when its activity is absent or reduœd (as in PKU and to a lesser degree in DOD-PKU HPA>. the &ee phe poof expands. if aoooo dietary phe input is DOt reduced. At tbis stage, the degradative transamiDation pathway, involving con aooooo in version ofphe to PPA(the initial reaction this path I.IIOGOO way), becomes signüicant at a modal phe value of-0.5 mM (2-5). PPA is suhsequently converted to PLA and loaooO sa PAA and phenylacetylglutamine (1). Whether these lIOOCIG lia, metaboütes actually conbibute ta pathogenesis ofcog /' _0 nitive impairment has long been debated (3,5). lOO Orthologous mouse modela of PKU and Don-PKU FlG.2. NlCI maaa spectra obtained for the PFB derivacives ofthe HPAexist (6-8) which allow us to measure pheand its TFA esters ofunlabeled PLA. PLAdI• and PLAd,. lntenaiCies ofioM metaboütes in brain in various deg.rees of HPA. Here with lDUMlI greater than 270 bave been multiplied by 50 co show we describe a GCIMS method to measure phenylala tbat chey appearoœ CO be reIa&ed CD the sampje, as the lDaSIIeIS show no inc:remeDtiDc depeadeat lIpDIllabelîDg. The c:arbos:ylace aaiDM at nine metabolites based upon stable isotope dilution mJz 261.262, and:!&l fonned by the Jou orthe pentaftuorolJeDzyl techniques. coupled with negative ion chemical ioniza radical &am the molecWar anioDs (m/z 442, 443. and .us. Dot tion IIOGOOO 200000 1110000 1100000 400000 eoooo aoooo 40000 ~,... ~=- ~ O'"""'_...... - ...... -r-I.."""...... ,...... -iI"l o,...... e.• ..R a.a 10.0 ••• a.a 8.S 10.0 rn/a 161 m1z 262 uu 400000 soo 1iIIOO00 40000 3100000 400 lI8OO00 JlOOOO ~oo aoGODO &0000 1110000 200 100000 10000 lOO 80000 ol:;::;::;:::;=;::~;::::::::;;::;~ o...... ~...- ..~...... , o~"""""''''''''.....;..p:-~ ....., 10.0 10.5 10.0 lO.S 1&.0 10.0 lO.5 1&.0 l'Ic. S. SIM du'omaCOpalDs (or a calibratinlf mixtunt cootaining wdabe1ed PM (mJz 135). iDtemaJ ltaDdard PAAd. (mlz 1..0). and W1Jabe1ed PLA(mJz 261). [onaurenc. atmJz 262 (12.47., relatlVlttom/z 261) and 264(0.13.,) artdue too aatural abUDdanœ heavy iMtope iaduaioa iD the carboxyla&e anion rormecl !rom th. wüabe*l PLA derivatiYe. deuteride .000 -.. 10.0 10000 700 eaoo tICIOO 100 2000 100 o..,...-..,...... ---...... ~ O;-...... "'"T"'...... ,.....-,...... , 10.0 10.11 1'.0 so.o 10.11 Il.0 to.O 10.8 Il.0 nG.5. SIM c:htamacocnma obtaiaed (or plie metabolita in the brainofa aormal mOWl8. PM(mJz (35) ia cIearly pnsent. .biIe PLAaod PPA (mJz 261 aad 262) an Ilot deteded in the pnMUt aaIIIple. The àoa. c:unenc aC mlz 2st ia due CO the PLAd, Ùl&enul! staAdanl. Dess. The residue was taken up in a lo-ml aliquot of ofImown concentration. The final concentration ofthe 2JfzO and held at 6QDC for 1 h. This solution was cooled PLAd:l internai standard solution was 0.787 mM. to room temperature and NaB2Jf. (approximately 5 mg. CDN Isotopes) W88 added. The resulting solution Brain Sample Prr!paration W88 warmed to SODC for 10 min. cooled in an ice bath. and slowly acidified to pH < 2 with 2 N ReJ (caution: Brains were removed within 5 s foUowing decapita vigorous evolution ofhydrogen). The solution W88 sat tiOll ofENU2I2, ENUlIl. and control animaIs fed with urated with NaCl and extracted with three lo-ml vol standard rodent diet (Teldad No. 8604) (n = 61geno umes of dietbyl ether. The ether extracta were com type) and immediately homogeaized in minimal 20°C bined, made anhydrous by addition ofsolid anhydrous deionized water (1:1. wlv) ta wbich we added the la· NaaSO. (two successive l-g lots). and then evaporated beled intemalstandards (100 '"each ofthe PLAd;s and to dryness in a dry nitrogen stream. The product. PAAd, solutions). The total volume was made up to 1 PLAd:r. was obtaiDed (14 mg. 83% c:rude yield) in oïl ml. adiusted ta pH 10-12with dilute KOa NaBZU. (2 form. &ee of residual PPA 88 determined by GCIMS mg) was added immediately. and thetubes were placed analysis of the trimethylsilyl derivatives. Extensive in SO-C water for 10 min.. PFB derivatives were pre experience with reduc:tiona ofketo acids with NaBZU. pared in the manner previously reported <11) with the in this laboratory shows that these reductioDS are fonowing stocksolutions:A, methylenechloride(20 101) quantitative. The isotopie purity was determined ta he and pentaftuorobenzyl bromide (0.4 ml. Aldrich Chem· 97% as the triply deuterium-Iabeled isotopomer. Ap' ic:al Co.); B. potassium phosphate butTer (pH 7.4. 100 proximately 14 mg ofthe crude product was dissolved ml) and tetrabutylammonium hydrogen sulfate (3.4 g. in deionized water (lOO ml) ta he used as the internal Aldrich Chemical Co.) adjusted ta pH 7.4 with 2 N standard for PLA and PLAdI determinatioDS- The con KOH. Solutions A (0.25 ml) and B (0.25 ml) were com centrationofthis intemal standard was determined by bined in a separate tube. 0.25 ml oftissue homogenate a reverse stable isotope dilution aasay. measuring rel supematantwas added, the mixture was vortexed for2 ative ion intensities in a solution with wùabe1ed PIA minand then plaœd in an ultrasonie bath for 20 minat • 177 • 246 SARKISSlAN. SCRIVER. AND MAMER m/a J3S '7'7a nalz .... tllOOO I~OOO laooO ISO 0 SDDOO 400 eooo AOCI0 2000 o.,...... "'P"l-""""....,...."""-...... """""~ a.a a.a a ... tO.O mJzlQ 100 150 laD O~:::=:;::::::=;::::~~~:;::::; 0..,...... ,...... -...... o..p.-...... ~....~II'I'... 10.0 III.S ".0 10.0 10.a Il.0 10.0 10.lS Il.0 nG... SIM chromatop'alU of:JtaiaecI for pM metaholites in the brain oflUl ENU·llllOUlML PAA is praent atlevela Ml1Dewhat lower chan tbCIM in the normailDOllM. aad PLA aDd pp" are e1eYated aliehtly rela&ive tg the DOI'DUÙ IDOUM. Tb. nrcentioo timea MeD beN are alichtly difrereDr. fnnn FiC. 5 becaua iD the iDterim the aaalytical culUlDll wu nrplaced. room temperature. Huane (2 ml> W88 added. the mix GCIMS fitted with a 3O-m x O.2S-mm Lei. capillary ture wu vOTtesed for 1 min. the hexane layerW88 then column (J & W Scientific) coated with a 0.25-f&JD DB-l removed and dried by addition of anhydrous sodium film. The helium 80w rate was 2 mJImin; the injector sulfate (10 mg) with vortexing for 1 min. The huane and interface temperatures were 250°C. The column layer was nen dec:anted into a separate tube. N-meth was temperature programmed from l00·C after a yI-bis-triftuoroac:etamide (MB'l'FA. 50 ,.d. Pierce Cbem l-mïn hold to 120·C at 40°C/min and then at 10·Clmin iœl Co.) added was then vol'teXed and pJaced into a to 280·C. The column was baked out at 280°C for 5 min 50°C water bath for 10 min. AIN sodium bicarbonate at the compJetion of each sample analysis. Methane solution (2 ml) was added to the tube and the mixture was WIed 88 the moderator gas al an indicated source W88 vortexed for 1 min. The besane layer _as 6na1ly pressure of 0.6 mbar and the ion source temperature removed into a sepante tube, anhydrous sodium sul was 120°C. SeJected ion mode W88 WIed to measure the fate was added, and the mixture W88 vortexed for 1 intensities of negative ion fragments m/z 135, 140. min. An aliquot oftbis final hexane solution W88 t:raJ1s.. 261. 262. and 264 with dweU âmes of 50 ms each. ferred to an au~ec:torvial for GClMS analysis. These fragments arise by the 1088 of the penta1luoro ben.zyl radical from the molec:u1a.r anions of the PFB Blanit Scunpk derivatives of PAA and PAAds• and the PFBIl'FA de rivatives ofPLA. P1.Ad and PLAd:ao respectively. Blank samples were prepared with deionized water lt equal in volume to the brain tissue homogenate super natants. These samples were proc:essed and anaIyzed AmiIlO AJ:id Quantitation 88 described for the tissue samples. Whole blood was coUected from mouse tails into hep a.rinized tubes, plasma was separated by centrifuga OC/MS Analysis tion, and after deproteinization the amino acid content Aliquots (1 pl) of the derivati2ed mixtures were an was analyzed by HPLC on a Beckman &300 automatic alyzed in NICI mode with a Hewlett-Packard 5988A amino acid analyzer. • 178 • SPECTROMETRIe MEASUREMENT OF PHENYLALANINE IN PHENYLKETONURlA 247 m/1.f3S s7710 ml.,. 140 8000 _00 4000 11000 4000 2000 O..p..---...... ,...... ~.,...... """"...... ,""""'.o; o+-J IIIpIl ..... ••• e.a ••• 10.0 ••• •.a ••• 10.0 UIOOO a.·ua 7000 rn/z 26f 1000 I.c)QO .aeo 18000 5000 10000 4000 8000 3000 2000 4000 1000 aooo o~;::;::;:;:;:;;::;:;::;:::;~;:;:;::;::; o~...~....."""...... ~..."'\ o..,...-~.....IIQIp..".....~.., 10.0 10 •• 11.0 10.0 10•• 10.0 '0.• Is.O PlG.7. SIM chromatDp1UIIS obtamed for pb. me&aboücea ÎA the brainofan ENU·2 mouae. PM. PLA. and PPAare aIl cleulyelenced. The 1abe1ed internai staDdanI. Cm/z 140 aod 264) e1ute slicbtly earlier tIuUl tbeir unlabeled analopes. Tbe mention tiIDa ...n ben anr apin slichtly different fiom Fic. 5 because in the interiID Che aAalycicaI column wu ~placed. Whole brain amino acids were anaJyzed according to 1. The 14o.Da fragment in the spectrwn of PAAd5 the method described by Diomede et al (12). Brain confirma that an labeling Î8 intact iD the ion measured. tissue was removed within 5 s after dec:apitation and SIM anaJysis of PAAds shows that the unlabeled con· bomogenized (on ice) in 0.590 sodium dodecyl sulfate tent is 1.3~ relative to the labeled. This is taken into solution (1:4, ."Iv). Alloiaoleucine was added as an in account in the caJcu1ations of the endogenous concen terna! standard and the homogenate was then i.Dcu trations ofPM. bated for 15 min at room temperature. A 41ft solution of NlCI spectra for the PFB esters ofthe triftuoroacetyl 5-sulfoealicylic acid dibydrate solution (1;0.6, v/v) was esters ofunlabeled and labeled PLA are shown in Fig. added, and the mixture was centrifuged at JA,OOOg for 2. The most intense ions (m/z 261. 262, and 264) 15 min. The supematant was decanted and frozen at represent the earboxyl anions produced by the loss of -8O"C until analyzed by HPLC as ahove. the pentaftuorobenzyl radical &am the molecular an ions m/z 442, 443, and 445 (not detected) ofunlabeled authentic: PLA, PLAd. synthesized !rom PPA by redue IlESULTS AND DISCtTSSION tion with NaBZJ{... and synthesized PLAd:l (internaI NIC! mass spectra obtaiDed for the PF8 esters of standard>. respective1y. The PLAdl isotopomer corre authentic PAA and PAAd~ standards are shawn in Fig. sponds to PPA in the original bomogenate. It is essen 1. The must intense ions correspond to the carboxylate tial that the 2-hydroxyl group ofthe PLA isotopomers anions (m/z 135 and 140, respec:tively) produœd by the he derivatized because decomposition by dehydration 1088 ofthe pentafluorobenzyl radical (181 Da) !rom the atGe temperatures would leadtodeuterium labelloss. moleeular anions (m/z 316 and 321, respec:tive1y, Dot The PLAd:s synthesized and used as intemal standard detected>. Losa ofHF (20 Da> !rom the molecuJar an was found by SIM analysis tG he 91.17'11 PLA.d" 2.66% ions, which is commonlyobserved in derivatives ofthis PLAdz, 0.001% PLAdlt and 0.16% PLAdo. Reduction of nature, is detectable, although not apparent inthe Fig. authentic PPA by NaBzH.. yielded PLAdl that was • 179 • 248 SARKISSIAN. SCRIVER. AND MAMER TABLE 1 Relationship becween Brain Phe Metabolites with Plasma Phe 1..t!ve1s in Three Phenotypes (normal, ENUI. and ENU2) (n = 61genotype. X ~ SE) Pluma pbenylalaoine PPA PM PLA Mouse mode1s concentration (~ (omaJlg braiD) (IUDOJlC bnm) (omoJlr braiDJ Control <100 1.2 =0.1 2.7 =0.3 0.2 = 0.1 ENU-1 150-100 1.2 =0.1 2.2 =0.5 0.9 = 0.3 ENU·2 1400-3000 2.2 =0.3 7.4 =1.6 59.3 =21.8 O.2K unlabeled.. a measureorthe isotopie purity ofthe mal or near normal (physiologicaJ) phe levels the lot of NaB~. which W88 WIed for the entire study. transamination pathway contributes insignificantly to SIM chromatograms obtained for one ofthe calibrat the brain metabolic: pbenotype in the variant HPA mg mixtures containing PM, PAAd,. and unlabeled. state. PLA are shawn in Fig. 3. The PAA isotopomers are The ENU-2 • 181 • APPENDIXC (Copyright C 1999 Proc. Nad. Acad. Sei. USA) Reprinted with the permission of the publisher • 182 Proc. NarJ. J'kad. Sa. USA Vol 96. pp. 2339-2344. MardI 1999 • MedicaJ SCiences A different approach to treatlllent ofphenylketonuria: Pheny1aJauine degradation with recombiDant phenylalaDine ammonia lyase CHJusnNEH N. SAIUtlSSIAN·. bONGOI SHAot. FRANÇOISE BLAINt. ROSALlE PEEvERSt. HONGSHENG Sut. ROBEllT tlEFTt. THOMAS M. S. CHANo*. AND CHARLEs R. SauvER-§ 0DcparuIIcaD of BioIrv. HUJUIl Gml:lica. and PedilItrics, McGill Uaivemly. and Ddlcllc Uborarory. McGiJI Unjycrllly·MoatreaJ CbaIdrca'~ HO$pilal RescarclI lnalihlbl. 2300 Tuppcr Stm:t, A-717. Moaucal. oc. fllH lPJ. ~ 'IBEX TeduIoIo&Ja. lac.. S4aS rIM! Pari. Monrn:aJ. oc. H4P lP7. ûaada; ôIIId 'NtUICW CdII and Orpaa RaardI ~n~. McGiJI Uajycnity. Montn:aI, oc. H3G 1Y6, CôIIIada CDIIIIIU41IKtUftl by Amo G. MotubJcy. Uniwnily 0/ Walwrgto... Seauk. WA. lNcmtbD 7. 1998 (~elll«l lM rmew Octobu 5. 1998) AIIS1"RACl PkeJlbtoallria (PKV). wilh iu auadakd lifestyle. dictary Ucatmeot is difficuJt. Moreover. dietary ther· • , ...... , (HPA) ...... la • apy cao bc associated with dcficicncies ofSCVCralllUtricDlS (1)• dauk pMIic ad lM fini .. _ft .. idntilled some ofwhich may bcdctrimcntatto brain devclopmcnt (6. 7). c...... Q , c.lÙllft..e Tra 1 Morcoycr. mast low phenylalanine matment prodUClS bave ,.,. bkIJa widI ....,...... , die organoleptic propcrties sutfaaenùy unsatisfaetory that com .... c 1tYe pIIeIIaIJpe .., .-lion'" HPA is püaDce with thc trcatment is compromised (8, 9). Sud\ coo ne as _ 01 die lintdfecIift l''''''''U01. pMIic cems have greater relcvance now rbat bctter and longcr diaeue. Rawenr. c..pI_ce ••11I diehrJ arnuaer.1 is dif- compliance with therapy of PIeU and non·PKU-HPA in all ..... ad il • rer .1Ie. as ... ne...... , .. pcrsoas at rislt has been recommended (10, 11). ÙI...... IieuJJJ MC of~. pnMbIy uraJbIk. A combination of oral enzyme thenpy with pbcnylalanine lIeniII .. dacriIIe aper'-u _ ...... u'" ammooia Iyase (PAL; EC 4.3.1.5) and controUed low protein 811G111er .,'01'1,...1oIPItUc_paliMewidt better diet might replace depcndence on thc scmisynlhctic dier. for ca.plw.ce aciIJIarJ ....,...... -- .,.. trcatmcnt of PKU alter infancy (10. 12). PAL is a robust (PAL. EC oU.J.!) .. ..,...... ,...... die ...... autocatalytic enzyme thar. uoIike PAH. docs not rcquin: a ••trialt la PJaJ; i lnae.na. PAL KIl as a IUINIIhIk cofador (13). PAL converts phenylalaninc to metabolica11y .... die ~,.., _ ...... ,.....(Ee L14.1'-l). insignific:anr amouolS of ammonia and trans-cinnamic acid. a .1Iidlù"""ti. PIW. PAL.. nIMut..,...... bannless dlctabolitc; thelatteris c:onverted tobenzoic acid and rw. c~. c .,upM.,...... traIII-CùIauIk..... rapidly acretcd in urinc as bippurate (14). A preliminary ...... _ IL We dacribe (i) .. dIIdeM nc..-.. report indic:ates tbar HPA is anenuated by oral administration ...1 PALeIIZJ'" (li) ...... ~ PAL la of mic:rocnc:apsuJatcd PAL in the rar wilb c:hcmicaJJy induœd ....1.11. N-edtJI-N'·IIiI~ (ENV) --. -- HPA (15) and also. in preliminary studies. in naturally occur "nia..dt HPA. (Ui) pnoIs of...... (PAL ...... ring HPA in a lIlOU5C dlodel (16-18). Prdiminary srudics in HPA)-1Iadt oJGIic (widt • clar---.... eI- buman PKU paticnts sbowcd anaIogous responses alter the lm ... HPA PAL iIIjcctiN) ~(...... administration of PAL in enteric-coated gelatin capsules (19) ..1enI PAL ia sipiIIcutIJe&cthe HPA). 1'IIaeftIMIiap or during use of an extracorporeaJ enzyme reactor (20). Thc ...... ,1.lKiUtaCe....18n1eldU dauicanetic buman and evcn the animal stUdies _cre not continued ..... bccausc PAL wu not availablc in sufficicnt amoUDlS at rcasooable cost. Pbenylketonuria (PIW) (1) is the protorypical buman Men (1) Wc uscd a coustruet of the PAL &Cne from RJrodDspo delian disease (OMIM 2616(0) demoastrating benefirs from ridilIm roruIoUln (21) undcr the cootrol of a bigh-e:xpression tteatmenl (2). PIeU and a rdaled fonu of 'css barmlul promotcr and expresscd it in a main of E.scJamchùl coli ID bypcrpbenylaJanincmia (HP~ lCrmed noo-PKU-HPA) rcsuJl obtain large amouots of PAL (22). (ü) Wc used existing (23) from impaircd activily of pbenylaJanine bydtoxylasc (PAIl; and ncw st:ra.ins (CN.s.. J. D. McOonald. and c.R.S. at EC 1.14.16.1). the enzyme calalyzing conversion of the csscn bttp://www.mcgil1.ca/pahdblPah Mousc/Mousc Pah Homo tia1 amiaoacid Dulrienl pbenylaJaniDe to tyrosine.Theenzyme logues) of the mulant N-ethyl-,v··nittosourea (ENU}-ucaled is respoosible for disposai (by œidativc c:alabolism) of the mouse as orthologous modcfs of buman PKU and HPA to majorilyofnulrieot phenylalanine intde. The untrcated PIeU study enzyme substitution Ibcnpy witb PAL (üi) Wc showcd patient with persisleDt postnatal HPA is 1ikc1y to experience lhat Lp. PAL injection lowen plasma phenylalaninc in the irrcYersiblc impaïrmeot ofcognitive de Ori FIG. 3. [ujcctioD i..p. ofrecombinant PALenzyme redur:c:s plasma FIG. 1. PAL genc fmm yeast R. toruloIdn was cloned IR the phenylalaniDe ÎD tlle ENU2/2 mouse (y iUÙS IS Iogaritbmic scaIc:) avcr expression ~r plBX-7 wben: traoseription is cODuollcd by me time ~ u.is) (P < 0-05). Reduction of plasma pbenylaJanine by PAL 5UOngiDducible tlU: promocer and terminalcd by tbe rRNA rranscrip shows a dosc-respoase reJationship (: uis). Data an: 1I0rma!izl:d ID tionlCrmiDalor scqueuces rmBT1 and rrnBT2.lAcJ'f rqKl:SSeS me tlU: me CODItoI (sbam-UQtcd) values for C3Ch animal al cxh poinL Data. promolcr. and hcncc l$OpfOpyl ~~tbiopJactosidc is rcquitcd 10 dcpieted an: !he average of 6Ye paircd series. The raDse of CODItoI relcasc il from the promolcr. The ltanamyaD resislana: gcne (KanA) (1~) values wu 390-2,013 1UDOi/liier for animals rccc1'Ying 2 unil5 is induded iD Ibc CODSUUCI 10 ailow scJc:etion of cdJs contaming lhe of PAL. ffi-1.48S J&IIlOI/liler for animais rca::iving ZO units, and • pJasmjel S04-1•.J74 j.UJloi/litcr for animais rco:iving 100 units.. 185 • 2342 Medical Sciences: Sarltissian t!l al. Pme. Nal/. Acad. Sci. USA 96 (1999) % plasma phenylalanine Jevels 1 i i i il' i i 1 o 50 100 ohr (:...... ---•...-- Sham 24 hr ·1---4.----- Ohr ··•....•·· .. • .. ·· ..·t-...~ PAl o 2 3 4 24hr + . rune Ihrsl Flo. Plasma phenylalanine Jevds in ENU2/2 lIlicc arter oral Fla. 4. A sut&fe i.p. injcdion of recombinant PAL enzyme (100 s. admlnisttalion (25 unilS pel' mousc) of iaduced recombinanl E.. coli units al zero limc). reduccs plasma phcoylaluùac levcl in ENUI/I ecUs aprc:sain& PAL: 31'" reducrion witbin 1 br (P < 0.04) and 4415 miœ by 959ft Olt 24 br(P < O.al) reJalive 10sbam·ueatedconerols. Dala redUClion in 2 br (P < 0.(04). Data an: norlDllÜZC:d to control vaJues for païred series (mean LSO) are aormaLizcd 10 pain:d control me = (mean 150)... Sham; .. PAL eDdoIcd in E. coli. l'he raille of values 10 accommodale inler- and intrainCÜYiduahariatioa. T'be = ranac conerol values (100CJ&) wu 42S-8OO ,amol/lilcr, eYery mUlw sbowcd of control values (1009rt al zero lime) wu 41-528 l'DIol/lirer. eYery ôI rcsponse ra PAL mimai sbowed ;a rc:sponsc: 10 PAL and intra-individuaJ variation. AçcordingJy. we controUed for This formuJation resists inaetÎvation by chymotrypsio and the laner by adopting the prolocols desaibcd above. mouse inrestinal fJuid in "ÎITO (data not shown). Oral gavage of Proofofpluum4co/ogicalprincipk. A siagle i.p. injection of na.ked PAL (200 wùrs) l:ombined with aprotinin (protease PAL enzyme significandy lowered plasma pbenylalanine in inhibitor) lowered plasma phenylalanine in ENU2/2 miee: by PKU mice (ENU2/2; P < 0.05) and showed il dosc·respoosc SO'K7 in 1 br (P < 0.017) and 54% in 2 br (P < 0.023) (Fig. 6). effcer (Fig. 3); alcach point.dalaMe normalized ID mecontrol (sbam-trcaled) values for cach animal to ilCCommodare inler DISCUSSION and intra-individuaJ variation. The non-PKU-HPA mice (ENUl/l) and the beleroallelie: "PA nain (ENUl/2) aIso We dcscribe a method to producc recombinant PAL (Fig. 1) responded to PAL uearment (dala not shawn). The effeet of mat may enable the use of Ibis enzyme ta degrade excess a single i.p. PAL injection in ENUl/1 mouse model persisled phenylaJauine in PKU where the normal pathway Cor its Cor 24 br (P < 0.02; Fig. 4); ENUl/2 and ENU2/2 micc both disposai is impaired. Wbywould dùs aJlernalive be usetW if. as bad similar 24-hr rcsponses (data not shawn). is gcnetally assumed. carly treatmeO( of PKU by a semisyn. l'roofofphysi%ricalprincipk. Ta demoDStralc the effce:t of tbetie: low pbcnylalanine dict is one of the suc:cess stories of orally adminislered PAL on plasma pbenylalaniac levels re medic:aJ geactic:s (1. 2)1 The answen lie in the incidence of quired protease-resistant PAL formuJations. Recombinant PICU. our expec:tations Cor its treatmcnt. and the anticipated PAL enzyme activity -..s protected againat inaetinoon by ··prevaJencett of patient rreaunent ycars. gastrie: acidity and intestinal digestive enzymes by retaining Tbc combined incidence of PIeU and non·PKU-HPA is on and shieJding it in the E. coü ccJIs wbere itWU synthesizcd. Wc the arder of 10-' live birtbs in populations of European used these œUs in the absence of a different (orm oC PAL desœnL Cunent cvidcnc:e reveaJs simiIar rares in Asian protection. Oriental and Arabie: popuJations (1). New gujdelines (l0. Il) Recombinant PAL enzyme protce:tcd by the ecu wall and for the trealment of HPA bave appeared 50 that residuaJ membrane of E. coü resists inactivation by proteolytie: intes in (1) c:an tinal enzymes in vitro; odlerwise activity of nalted enzyme is imperCections outc:ome be overcome and apec:ta tioos met; the guidelines advise treabDent to rcstore bJood abolished (data not shown). PAL encloscd in E. coli c:eIJs WiIS shawn 10 reduce pbenylalanine content ofthe in lIil70 solution pbenylalanine leveJs as near normal as possible. OIS carly as (Table 1). Whcn given by oral gavage. reeombiDant PAL (25 poa.Iole. and Cor as loog as possible. perhaps (or a liCetime. In units) expressed in an E. coli straiD isolated from Sprague this con~ the "prevaJenc:e" (or patient ttcatment years tùcs Dawley rat lowercd plasma phenylalanine in ENU2/2 micc by on new meaning wbcn it involvcs the diffic:uJt existing modes 31'K7 in 1 br (P < 0.04) and 44,*, in 2 br (P < 0.00(4) (Fig. 5). oftreatmcot. The predided "pn:valcnc:e" in patient treatment Other experiments in vivo. cooduacd with aprotinin (pro years Cor a population of l()ll persons. assuming 50 ycars of lea3e inbibitor) and recombinant PAL enzyme purified from treabDcot per patient. wouJd bc 500,000 patient treabDent E. coli (yl091). gave furtber proof of pbysiologic:a1 principlc. years in b:ùf a century. Table L Change in pbcnytaJaninc conlent in "UI'O solutioas undcr various tte:ltmeJ1ts Experimental cooditioos Tre;atment Control N'onrecombiDant E.. coli ceJJs o CbymotrypsiD o mlatiaal fiuid o PAL In iDduced rccombinaDt E. coli a:& 16 In iaduœd recombinant E. coli cdIs + cbymoU)'pSiD in medium 71. In iDduccd recombiDaDt E.. coli c:dJs + illtestiDa1 fiuid in medium 66 '"Trcatmcnts wen: for l h [oUowed by mcasuremcut of L·pbcnyJalaniuc CODICDt. • tInïtial CODœDttatiOa. 4 mM of L-pbenylalanine. 186 • Medical Sciences: Sarltissian f!!1 aL P~. NalL Acad. Sei. USA 96 (1999) 2343 PKU is a multiCaaorial discase; mutation in LIte PAH genc the induced mutant (ENU) mouse ortbologuc:s ofhuman PKU and dietary aposure to thc esscntial nutrient amino ac:id and non-PKU-HPA (23). Wc fllSt demonstrated praof of L-pbenylalanine are equally nec:essary causes of the mutant pharmacologie principal: given by injection. PAL acts in vivo phenotype (1). Treatment of HPA is feasible because the [0 lower ambient blood phenylalanine levels (fig. 3). We then dietary expericnc:c cao be purposefuJly moditied. and the low demoDStrated prao! of physiologie princ:ipal; PAL plaeed in pbenylalanine diet bas been ilS mainstay. the intestinaJ lumen aets in ..00 [0 suppre:s.s HPA (Fig$. 5 and Untreated PKU is a discase at tbree pbenotypic: levels. At 6). The latter is a signific:ant finding tbat capitalizes on three tbe proximal (enzyme) level. many different mutations in the prior concepts and observations: (i) Amino ac:ids are in PAR gene impair PAH intc:grity and func:tion (32). Bccause equilibrium between various compartments ofbody nwds (37. PAH enzyme is the principal detcrminant of phenylalanine 38) and ultimatc:ly in equilibrium witb the: intestinal lumen homeostasis in vivo (1 >. its impairmcnt Ic:ads to HPA. wbic:b is (39), 50 that treabDent of intestinal lumen pbenylalanine will the intermediate (metabolic:) level of the variant phenotype. affect ail body pools. (ü) PAL placcd in the intestinal lumen lmpaired cognitive development and neuropbysiological func will modify pbenylalanine content ofbody fluids in the wbole tion is the distal (clinical phenotype); phenylalanine is the animal (15.18). (üi) PAL plac:cd in the intestinal lumen will ICt neurotoxic: molec:ule (1), and hence the rationale to rcstore on both the dictary phenylalanine and the endogenous run out euphenylalaninemia. of free pbenylalanine from its bound pools (40). Accordingly. Three modalities for treatment exist in theory or in praetic:c: [he appropriale dosage and scbeduJe (10 avoid under- or gene therapy. enzyme therapy. and dict therapy. The 6rst bas overtrc:abnent) of oral PAL. perhaps in c:ombination with a Îts appeal but is ooly at the aperimental stilge (33) (also C. controlJed and modestly low protein diee. sbould control the Harding, personaJ communication) and unlikely to be put into pbenylalanine pool size witbout need of the drastic restriction practic:c unless tbe alternatives fail. The tbird method (low of cüetary phenylalanine as now practiced and requiring phenylalanine dict thcrapy) was inaugurated in the 19SOs (~S) arti6ciaJ diets. AncilJary treatment of PKU with PAL and and has acbieved its primary goal: it bas prevented mental prudent protcin intakc would bccome anaIogous to treattnent retardation in che adcquately treated patient (l, 34). However, of diabetes tnCUirus witb insulin. with an additional feature dietary tteatment of PKU and HPA is difficult; it involves the enterai route would avoid problcms with immune recog rigarous compliaoœ. a major alteration in lifestyle, and use of nition of PAL. treatment produClS that have unusual organoleptic qualities. Untîlllow. the castofPALhas prohibited any consideration Moreover. measurements of cognitive and neurophysiologie of thcrapy; even animal studies were cunailed. The recombi outcomes show subtJe de6cits (la scores are 05 SO below nant enzyme wc describe herein may avoid tbis constrainl and normal), and there are lacunae in neuropsyc:hological and bas eoabled OUI' investigations. The relatively low specific neurophysiological performance. Ac:cordingly, there is grow aetiviry of the: recombinant PAL product and relative ineffi ing interestin the second fonn oftreatment (enzyme tberapy). cieocy at pH 7.0 (R.H.. unpublisbed data) may bc offset by the Enzyme tberapy could be donc by replacement (of PAH long contact lime belWecn enzyme and substratc during enzyme) or by substitution (with another enzyme to degrade passage tbrough smal1 and large intestine. The formulation c:xcess phenylalanine). Replacement of PAH rcquires the c:unently under development is focuscd on completely pro intactmultienzymecomplafor c:ataJytic: hydroxylating activily tec:tiog the PAL enzyme against a protease envitonmenL ( 1); il could bc donc bc:at pcrbaps ooly by bepatic: transp1aJl. We Ihank Or. Ac:bim R.cckIcawlIId ra.- prqlIUlUioa of the cuzytDe. tation and tbis approacb bas Dot bcen pursued BUI iftbc PAL P:ImcIa o...aper and Or. KiD& Lee who pt: iawluable aIIisraPc:e enzyme c:ould bc administered by mouth to the PIeU patient. durias tbc carly Slap of tbâs projecf. lIId Maqarct Fuller and BevaIy it wouJd have a c:crtain appcal; tberapywith enzymesprotectcd Akmnan Cor ce:dJnjcaJ bcJp and ~ We abo lICknowIedF the from inactivation is feasible for the treatment of metilbotie acMa: of tbc flCICCPlM: n:vic:wers of dUs maauacnpt. This work wa conditions (35. 36).Wc propose: that PAL will '·substitutc" for supponcd in put by tbc Medical Raarcb Council (Canada), the defic:ienl bepatic: PAH aetiviry and degrade phenylalanine in Canadian GcaiI:œ Discases NelWOdc (CGDN) (Nctworb of Cearas of tbe PAH-deficicnt organism. To test tbis bypotbcsis. wc used EJœIJa:oœ). and a caatna (or mÙI"CMocr of t!lc nùa: (rom IBEX via COON. SIudcoISbip awards "CR supponed br !he McGiIJ UniYenity MontrealChiIdrcD's HœpuaI Racan:b Iasntutc.!he Garmd AsaociatioD (Caoada). and The: AIDilWy (Montreal CliIdtal's Hospital). 1. SCrivcr. C. R.. Kaufman. Eisc:nsmilh. R. C. A Woo. S. L C. c: s.. o (199S) in 1'1w MdIIboIic andMoI«Ultv84JG ofInhcrlnlIJi.xrl#. !! cds. Sc:nvcr. c. R.. Bc:audc:r. A. L.. SIy. W. s. ~ VaDe, O. ë (Mc:Gnw-HâIl New York), 7th Ed., pp. 1015-1075. 3 a'ê 2- Semer. C. R. (1967) in hocntIùrp oflM 71Iinl (nJenrIUUHUII oë COftI'Uf ofl1umtm GcMticr, eds. Crow.l. F. ok Neet. J. V. (The o 0 JobDs Hopkias Pra&. Baltimore. MD). pp. 45-56. c u ~# 3. BickcJ. K, Cic:rrard. J. ok Hi~ E. M. (1953) Lœu:er 0. -Ii - 812-813. 3- 4. Woolf. L L. Griffidq. R. ok Moacrcdf, A. (1955) Br. "'~d. J. 1. c: o 57-64. .c: CL. S. Armsuong. rd. ~ Tyler. F. K (1955)1. ClUr.. 11lIIat.. lot. 56S-5SO. 6. Codbum. F.. CJart. B. J.• Caine. E. A.. Harvie. A.. Farqubarsoa. J.• JamiCSOo. E. c.. RoblDSOlL, P. ok Logan. R. W. (1996) bu. a 2 3 4 hdiGr. II. 56 -60. rmelhrsl 7. Riva. E.. AgosIom. c.. Biasw:ci. G.• Trojan. 5.• Luotti. D.• Fion. L ok GiovaDnùù. M. (1996) Acta PanJimr. as,56-S8. FIG. 6. Plasma phenylalanine lads iD ENU2/2 mice airer com 8. Semer. C. R. (1971) NUIT. &!V. :J.155-158. binc:doral administrationor nated PALcazyme (200Wlitspee mousc) 9. Buisc. N. R. rd.. Prince. A P.. Huntington. K. L. Ttaen:k. J. M. md prolease inhibitor (aprotinin): SO"J(, reductian within 1 br (P < & Wagoner. O. D. (1994) Acta PacrJi4tr. Suppl. -Mr7.7S-n. 0.017) and 54"i iD 2 br (P <: 0.023). Data an: aormaüzcd ro control tO. Medical Rcscarcb Council WortiDg Party 011 Phenylkctonuria values (1I1CUl :: 1 SD)... Sbam; .. UDproteeted PAL plus aprotinÙL (1993) Br: ."'cd. J. JM, U5-119. The range ofcODtrol values (11JO"O) wu 458-1,051 JUl1OlIlitcr; cvcry 11. Medical Rcscan:b Council WorkiDg Party on Phenylktonuria • animal showcd a n:spoasc: ta PAL (1993) Atdr- Dis. CJriJJ. II. 426-127. 187 • Medical Sciences: Sarkissian ~t al Proc. Nad. AcaJ. Sei. USA 96 (1999J 12. Saiver, C R.. Kallfmaa. s. le Woo, S. L C (1989) in T1rI 26. Futuhata. N.• YosIùno. s.. Yamamoto, K., Se, T.. Sone, S., Md4boIic &uU ofInJtmrœ ~, eds. Semer. C R., Beauder. Nabjima, Y., Suzuki. M. '" MùigucJù. N. (1988) Europ8lf A. 1-. say, w. s. '" Valle. O. (Mc:Oraw·HilI, New York). 6th Ed.. PrIJDrJ App6elJ/ÙNl 0260 919. pp. 495-546- 27. Rasmuaeu. O. F. '" Orum. H. (1991) DNA Seq. 1. 207-211- 13. fIodPns. O. (1971) J. Biol Chem. Z4I. 2977-2985. 28. Mullis. K.. FaJooaa. F.. Scbarf. 5.• Saiki. R.. Horn. G.• Erlich. 14. Hoskias.J. A.. HoUiday, S. B. &: Grcenway, A. M. (1984) BiomaL K (1986) Cold Sprrng Hrubor Symp. Quant. Bw/. 51. 263-269. MGR Sp«tn1m. Il.296-300. 29. Su, H.. Blain. F.• Musil. R. A. Zimmermann. J. J. E. Gu. K. IS. Bowpr. L &: Chang. T. Mo S. (1986) Biodrim. BiDpIrys. Acta Ill. 432-438. " Scnnette, O. C (1996) '''ppl. &won. MicroblOi. I.Z. 272J 2734. 16. SlUkisaian., C. N.• Lee. K. C, Danqher, p.. Lcun.. R., FuJler, M. A. '" Sc:rivu, C. R. (1996)Am..I. Hum. Gad. Suppl. 5',1183 30. McDonaJd. J. D., Bode, V. C, Dove, W. F. " Sbedlovsky, A. (abere.). (1990) l'roc. NatL AcuJ. SeL USA 17. 1965-1967. 11. Sarltiuian. C. N.• Sbao, z.. Blain. F., Peevers. R., Su. K, FuUer, 31. McOoaaId.J. O. '" Charlton. C. K. (1997) GmDmIaJ'. 402-405. M. A. &: Scrivu. C. R. (1997) Am. J. Hum. Gm4 Suppl il. 182 32. Wlltets. P.I., Pamiak.M. A.. Nowacki. P. " Scriver. C. R. (1998) (abslr.). Hum. MII/IIL U. 14-17. 18. Saros. S. '" CbaD& T. Mo S. (199S) Artif. Ce/b B1IJod SubsIiL 33. FIJ1& B., EiseIlSDlith. R. c.. Li. x. H. C. F"megold. M. J. IlftIftObil. BiIJt«JmoL %J.681-692- Shedlovsty, A. DoYe. W. le Woo. S. 1.. C. (1994) GeM TIw: ., 19. Hœkias. J. A.. Jack. G., Peitia. R. J. D., Stan. D. J. T., Wade. 247-254. K E.. wnpr. E. C. Stem. 1. (1980) lArrul l, 392-394. 34. MacCready. R. A (1974) J. p~ 15. 3S3-385. 20. Ambrus. C M., Antboae. 5., Horvath. c.. lCaJabatlÎ. IC.. [,de. 35. ChaD..T. Mo S••PDZIllWSity, Mo J. (1968) NtUIII'r (London) n.. A. S.. Eapca. G.• Ambrus. 1. 1-. Ryan. A.J. '" Li. P. (1981).ANL 243-245. /1tlD7L Med. 1"531-531. J6. Prakasb. S. A ChaD.. T. M. S. (1996) NtJL Med. 1. 883-887. 21. GUbcrt. KJ., Carte, J. N.• GibeoD. R. SrcpbcnsoD. J. R. " K.. 37. Colla. R. Palmieri. M. J. '" McNaawa. P. D. (1980) in Tully, M. (1985) J. &amol. .'.,314-320. Mo. PrincIpiD ofMft4bolic CultllOl in M~SpceJD. eds. Her 22. Onam. R '" Rasmussen. F. (1992) Appl. MiaobùJL Biof«JutoL Ji. 745-748. lDaD. R. H.. Coba. R. M. A McNaIIlaR. P. O. (Plenum. New 23. Sbedlovsky, A.. McDonaJd. J. 0 .. SymuJa. O. '" Oove. W. (1993) York), p. 63. GtMâa lJ4, 1205-1210. lB. Christcasea. H. N. (1982) ~ fœtI. Q, 1193-1233. 24. Gilbert. KJ. '" TuDy. M. (1992) J. &lcWiDI. .se. 1147-1154. 39. Christcmcn..L N.• Feldawl. B. H. '" Hastinp. A. 8. (1963) 25. Ausubcl. F. M., Breat. R.. KiDplon. E., Moon:. O. D.. ScJdman. AnLl ~ _. 2S~260. J. G., Smith. J. A et S~ K. (1997) in Cunuu Profocoll III 40. Chan..T. M. s., BoUlFr. L '" ÜSler. C. (I99S)Artlf. Cdü B/ood MoI«uItv BiDlorY (WiJey, New Yort). Chapter 13. SuMtU. ImmobrL BiDt«JutoL 15. 1-23. • 188 • APPENDIXD • 119 • PAH MoœcSite - PaIl HllIIIOIopcs The Mous. Genette Pah Homoloau. Page. Prepared by: C.SaOOssian. and PAHdb Curators. Authors: CoN. Sarkission. J.O. McDonalcl C.R. Scrivc:r. MoUR eazy..c ud ceDe for plae.y.....iae .ydrosylase The mouse phenylalanine hydroxylasc genc (symbol Pah) was mapped to chromosome lOin 1988 [l] (Reviewed in 8); the cDNA was cloncd and sequenccd in the same 100 ~ (GcnBank UID: X51942. (EC 1.14.16.1». The cDNA is 1978 bp and bcgins ilS coding sequence al position 48. followed by an open reading frame ( (359 bp) and a 17-rcsiduc poly A signal (beginning al position c: 1965). Mouse and human gc:nes bave-87% conservation ofsequence. with -1()oAt of the changes silent (in the third codon position). No similaritics are obscrved in tbcir UDtranslatcd rcgiODS ffi]. The murinc Pab enzyme bas 453 n:sidues (molc:cuJar weight. 51,786 Da). Thcre is -8% divcrgcncc betwcen buman and mousc sequences; the majority ofditrcrcnccs are in the N-tmninaI rcgïon (thougbt to he involvcd in rcguIaaory or binding function ratbcr than catalytic activity). In addition. thcœ an: rcciprocal substitutions ofcysteioc rcsiducs in mousc and human cnzym~ prcscrving the numbcr ofcysteincs but altcring their relative positions. DitTcn:ntial stcady-state concentrations orthe two enzymes in the ccII. potential topologicaJ changes. ~may alter sttucture and fimction. possible ditrcreoecs in the rates oftnmscription, traoslation, stability, activation or intrinsic caIa1ytic activity are aJJ possible conttibulors ta the still uncxplaincd ditrcrcnce in mousc and human PAH activitics; mouse enzyme bas an order ofmagnitude greatcr specifie activity tban bwDan enzyme 00. Natural (genetie) mousc modcls for PKU and non-PKU Hypcrphcnylalaninemia (HPA) now cxist. Inbrcd BTBR males wcrc treatcd with N-ethyl-N-nitrosourca (1), mated to normal BTBR fcmalcs. and the potentially bcterozygous progcny from this cross were mated and thcir progcny screcoed for HPA. Thrcc mutant pbenotypes wcn: identificd; Pah(enuJ), Pah(emt2) and Pah(e1lll3). The bomozygous Pah(enuJ) mousc was reported in 1990 [2]. On the basis ofils retarded clearance ofan injectcd phenylalanine load. it was classificd as a non-PKU HPA counlerpalt. Pah(enul) micc have a c.J64T>C transition CV I06A) in exon Jill • 190 PAH ,..,.Site - PaIl HClIIIlIIopes lliJ. Note: StructurelfunctiOD studies (rat Pab) show tbat the region in which this • mutation falls (the N-terminal regulatory domain) cao he cleaved by chymotryptic digestion with the enzyme still retaining its catalytic activity [1]. Crystallograpbic analysis ofthe human enzyme reveals that this mutation is distant from the calalytic residues ofPAHlPah [b~. This factor in conjunction with the conservative nature of the pm:Iicted Val 10 AJa substitution may explain the mild phenotype ofthe Pah(enu/) animais [ll). These animais display normal plasma phenylalanine levels. normal coJouration and no abnormal hebaviour on regular met creklad. #8626). Tbere is no apparent effec:t ofmaternai phenotype on the ferus; and progcny show normal survival and growth rate. Pah enzyme activity is -5-24% normal [lQ,1lI. Under conditions of elevated Phe in die~ reduced growth is observed l2J.1l. P"h(enu2) and Pah(enuJ) strains weœ reported in 1993 ill]. 80th strains are classified as PKU counterpans. The Pah(enu2) mutation is a c.83ST>C transition (F263S) in exon 1 W lliJ. Nole: This mutation affec:ts a residue shown (by the crystal structure anaIysis orthe human PAH eata1ytic and lell'amerization domaios) 10 he in the active site. This residuc is implicated in plerin binding with predieted 1t -sracking interactions with the substrate QA]. The region is bighly conscrved. ~. The presence ofmutation in the criticaJ region in coojunctioo with the non-conservative phe to ser substitution may explain the sever phenotype observed in Pah(enuJ) animais. The Pah(enuJ) mouse mutation remains 10 he identified, bowever. il bas becn localized 10 a 301 bp portion of the coding sequence, spanning part ofaon 11 and ail ofaoos 12 and 13 U> Ull. Neilber Pah(enu2) or Pah(enuJ) have measurable hc:patic enzyme activity; 00 normal diets. they bath display a 10-20 fold elevated senun phenylalanine level and elevated phenylketones in urine. These animais have retarded pre- and postnatal gro~ smaller hcads. hebavioraJ abnonnalities and. like their bwnan PKU coWl~show pronounced hypopigmentation. 80th strains have a severe maternai effec:t on the relUS. resulting in the loss oflitters within severaJ hows orbinh l!bil]. We bave bled a variant ofthe Pah(enu) mouse using Pah(enuJ) (femaJe) x Pah(enu2) (maie) crosses. Melabolic profiling. fol1owing L-pbenyJalaoioe cba1Ieng~ rcvea1s a HPA phenotype inlCllDcdiale between Pah(enul) and Pah(enu2). On regular mouse cllow. this Pah(enuJn) heteroallelic strain bas near normal plasma plie levels and DOnnai coloration. Pah enzyme aetivity is -5% DOnnai. This strain bas DO abnormal bebavior. a low matemal eifecton the fetus and is pliant ta metabolic manipulation [ll). FoulDoles: J (t)N-dhyl-N-nilrwauna. an alkyllJling eJgenr. indw:u nrulatiom al ~ /(r fr"fIMUICJI puloc:as. in Spurrtlllogoma/ slem ails. (t) MOlISe Pah cDNA Iras Mltn seqMUlCed bulnot tIw completll gmll. tMnfO#'e. U1dt lftJIlation Itœ bun a:ssig1Wd to a specifie uon(s) iIy ,q;onalJwmology bfttwllm lJtOUSe tmd/ramlUf gcna.. up [oC df..,,,,.,.,,,.,. ra=:1c."l!f/!f:m1•.wp.... !! ... A. Gcaeral Rdereaces: • 191 1. CoRon ROH. HoweUs OW. 5alceba JA. Dianzani 1. Smooker PM and Jcnnings IG: Srrucrure function SlUdies oflite phenylalanine hydroxyJasc a&:tive site and a summary ofsErw:ruraJ feanues. Cbemisay and • 8iology ofPteridincs and Foiales. Plenum Press. New York. 1993. pp. 55-57. 2. Erlandsen H., Fusetti F. Martinez A. Hough E. F1aImark T and SIcVens. RC: Cryslal structure ofdle eualytic: domain ofhuman phenylalanine hydroxyfasc reveaJs die 5trUçtural basis for phenylketonuria. J Biol Chcm 273: 1696~ 1998. J. ErJandsen H. and SlcVens RC: The stnK:twaJ basis ofphenylkeronuria. Malet: Genet Metab 68: 103. 1999. 4. Flabnark T: StruauraJ insigJn iota the aromalic amino a&:id hydroxylases and thcir discase-n:Jarcd murant forms. Cbcm Rev 99: 2137. 1999. S. Fuserti F. Erland5en H. ~A. FJarmark T and Stevens. RC: SttueIUte oflCtr.UDcric: human phenylaJanine hydroX"jh1se and irs implications for phcnylkcronuria. J Biol Chan 273: 16962. 1998. 6. Lcdlcy FD. Greneu HE. Dunbar as. Woo SLC: Mouse phenylalanine hydrollYlase. homology and divergence hm human phenyJaJanine hydrollYJase. Biochcm J 267:399, 1990. 7. LedIcy FD. Lcdbcacr SA. Ledbetter OH. Woo SLe: 1.ol:aIization ofmousc phenylalanine hydroxylase lœus on chromosome 10. Cytogcnet Ccli Genet 47: 125. 1988. 1. Scriver CR.. s Kautman. Eiscnsmilh RC and StC Woo. The hyperpbenylalaninemias. ln The Merabolic: and MolccuJar Bases ofInbcrited Oiscasc. 7rh cd. cds. Scrivcr CR.. Beaudct AL. Sfy WS and Valle O. Mç(jraw-HiIIlnc. New York, 1995. pp. 1015-1075. UR 10..,.,.,. ! t""'" B. Specilk aerenDces: 9. McDonaId JO. Bode VC. Dove WF lIIId SbcdIoYSky A: PtJh(hplû): A mousc IOUlant dctic:icnl in phenylalanine hydroxylase.. Proc Nad Ac:ad Sei USA 87: 1965. 1990. 10. McDonald JO, Bode VC. Dove WF and 5bcdloYSky A; The use of N-ethy~N·niIrosoUIQtu produce IIIOUSC IDOCItls for bWDllD pbcnylkeronuria lad hypcrphcnyJalanincmia. MUlalion and rbe Enviroamcnt, Wilcy-Liss. New York. 1990. PlIne. pp. 407-413. II. McDonaId JO. Charlton Cf(; Cllaraclèriarion ofmutations al the mousc phenylalanine hydroxyluc locus. Gcuomics 39:402. 1997. 12. Sarkissian CN. Boulais DM, McDoaald JO and Scrivcr CR. A HereroaUelic Murant Mouse Mode.: A New OrIbologue for HUIDlIII Hypcrphcnylalaniacmia. Mol Genet Mefab 69: 181-194, 2000. 13. SbcdIovsky A. Mc:Oonald JO. Symula 0 and Dove WF: Mouse IDOdcls ofhuman phcnylkeronuria. Gcoerics 134:1205. 1993. • UR ro Mw",m-.",.".,'«...... § W...,. uproGtMfç",_M.." ....'·...... ",eetlUt•."....,..... 1tIouHHome 1!!A!!!!!ll ForfuflheriIrfotrutIan .-ut"'lasileMdif:s eon--.,....c:OIItKtJ.D.IlcOouid 01'C.N.Satf!lssIap• • 192 • APPENDIXE • 193 Protocol for Lonl-Term PAL Administration Providing Direct Access • to the Duodenum Animais are injected with Tnbrissen 24brs prior to, the day of and the day following surgery. On the day of the surgery, they are injected (i.p.) with Pentobarbital, foUowed by an injection of Atropine sulfate (s.c.). The mouse is sbaved around the abdominal area and the back (between the scapulae) and disinfected with isopropyl-alcohol, Htbitane and Iodovet. An incision is made on the back and abdominal area. A piece of silicone tubing is insened tbrougb the back incision and directed (s.e.) towards the abdominal incision. The end, which appears at the posterior opening, is sealed with a sterile-removable plug (this cao he accessed for administration of the enzyme). The peritoneal membrane is incised, and the duodenum located. Theo a circular suturing is introduced and an incision made in the middle where the silicone tubing is insened. FoUoWÎDg insenion, the suture material is tightened around the tubing and Vetbond used to reinforce the seal. The abdominal cavity and skin is closed by suturing. The animais receive Buprenorphine (SC) prior to waking up and for the following 3 days. One week following the surgery, the PAL formulation can he tested by injecting the solution, tbrougb the catheter, direcdy into the intestine. Efficacy of the enzyme cao he measured by reduction in plasma pbenylalanine levels over a period ofa week. • 194