sign in sign up
<<
Home , Adenoncos, Aerangidinae, Aerangis biloba, Aerangis citrata, Aerangis ellisii, Aerangis fastuosa

MOLECULAR SYSTEMATICS AND ANATOMY OF (): THE EVOLUTION OF MONOPODIAL LEAFLESSNESS

By

BARBARA S. CARLSWARD

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2004 Copyright 2004

by

Barbara S. Carlsward ACKNOWLEDGMENTS

I would like to thank my advisor, William Louis Stern, for his invaluable guidance. He welcomed me into his lab at the beginning of my career and has continually nurtured my love of and their anatomy. I would also like to thank W. Mark Whitten, who has been a friend and mentor. Without his constant guidance, I would have failed miserably in the molecular laboratory.

During the course of my doctoral degree, Norris H. Williams has offered useful counsel, allowed me unlimited access to his laboratory, and given me office space to write my dissertation. From the beginning of my botany career, Walter

S. Judd has been instrumental in developing my love for plants and has always given helpful advice in the process of delimiting anatomical data for cladistic analysis. As a committee member, Robert J. Ferl provided insightful advice and guidance.

Robert L. Dressler was always willing to help me identify orchids and gave helpful advice on tricky taxonomic issues. James D. Ackerman was also extremely generous with his taxonomic advice, especially regarding

Dendrophylax. Gustavo Romero (AMES Herbarium, Harvard University,

Massachusetts) provided assistance in finding the taxonomic articles necessary for the nomenclatural transfers of . Alec M. Pridgeon has continually been willing to offer guidance and counsel, most notably with the interpretation of the vandaceous anatomy. Lars Jonsson was kind enough to donate his

iii monographic work on and give advice on leafless Vandeae. Gunnar

Seidenfaden, now deceased, graciously sent me his last copy of Opera Botanica

95 (“Orchid genera in XIV. Fifty-nine vandoid genera”). Eric A.

Christenson provided sage taxonomic advice and was always willing to identify specimens of .

I also thank Sherwin Carlquist and Edward L. Schneider for providing the seed of an idea for this project. I am gratefule to Jennifer A. Thorsch and Bruce

H. Tiffney for their friendship and mentorship during my brief graduate career at the University of California, Santa Barbara.

I would like to acknowledge the tremendous generosity of the following commercial and hobbyist orchid growers: Isobyl La Croix (Uzumara Orchids,

Gairloch, Scottland); Robert Fuchs (R. F. Orchids, Inc., Homestead, Florida);

Martin Motes (Motes Orchids, Homestead, Florida); Claude Hamilton (Hamlyn

Orchids, Kingston, Jamaica); Gaspar Silvera (Orquideas Tropicales, Panama

City, Panama); William A. (Andy) Phillips (Andy’s Orchids, Encinitas, California);

Jim Rose (Cal-Orchid, Santa Barbara, California); Erich Michel (Hoosier Orchid

Company, Indianapolis, Indiana); Rick Reese (Rick’s Tropica, New Port Richey,

Florida); Countryside Orchids (Corrales, New Mexico); Johan Hermans (Royal

Botanic Gardens, Kew, London, England); James D. Ackerman (University of

Puerto Rico, Puerto Rico); Germán Carnevali (Centro de Investigación Científica de Yucatán, Mexico); Paul Simon (private grower, Los Altos Hills, California); and

James Watts (private grower, Hollywood, Florida). Harry Luther, Bruce Holst, and Wesley Higgins of The Marie Selby Botanical Gardens were all extremely

iv generous with their resources and time. I also acknowledge the help of Paula J.

Rudall, Mark W. Chase, Edith Kapinos, and the late Timothy Lawrence at The

Royal Botanic Gardens, Kew, for their help in processing, vouchering, and shipping the anatomical and DNA specimens donated by Johan Hermans.

Benny Bytebier (University of Stellenbosch, South ) collected and vouchered most of my angraecoid specimens from Africa, for which I am thankful.

Assistance and use of equipment provided by the Electron Microscopy Core

Laboratory at the University of Florida (especially Karen L. Kelley) were essential to the success of my anatomical work. I would like to thank three of my fellow graduate students for their assistance in completing this project: Mario A. Blanco collected brenesii from Costa Rica, Kurt M. Neubig sequenced several of my last DNA specimens, and J. Michael Heaney lent me some of his

Polystachyinae slides for anatomical observation. I want to also thank the helpful staff of the Department of Botany and the University of Florida Herbarium.

This research was supported by the National Science Foundation (Doctoral

Dissertation Improvement Grant, DEB-0104566), the Lewis and Varina Vaughn

Fellowship in Orchid Biology, the American Orchid Society’s 11th World Orchid

Conference Fellowship, and the College of Liberal Arts and Sciences

Dissertation Fellowship. William Stern provided funds to complete much of the molecular and anatomical work, and Norris Williams freely allowed me to use the supplies and equipment in his molecular laboratory.

v I am grateful to my grandparents, Carl and Ellen Carlsward, who have supported and loved me unconditionally throughout my life. I would also like to thank my life-long partner and friend, J. Richard Abbott. His love, guidance, and infectious passion for plants have helped me grow throughout my botanical career.

vi TABLE OF CONTENTS Page

ACKNOWLEDGMENTS ...... iii

LIST OF TABLES...... ix

LIST OF FIGURES ...... x

ABSTRACT...... xvi

CHAPTER

1 INTRODUCTION...... 1

Systematics ...... 2 Leaflessness ...... 11 Anatomy ...... 13 Objectives...... 14 Methods...... 14

2 MOLECULAR PHYLOGENY OF VANDEAE...... 16

Introduction...... 16 Materials and Methods ...... 17 Material ...... 17 Extraction ...... 28 Amplification...... 30 Sequencing ...... 32 Data Analysis ...... 33 Results ...... 36 ITS Analyses of Vandeae...... 36 ITS and Analyses of and ...... 45 ITS matrix ...... 45 matK matrix ...... 46 trnL-F matrix ...... 51 Combined chloroplast matrix ...... 56 Combined ITS and chloroplast matrix...... 60 Discussion ...... 65

vii 3 VEGETATIVE ANATOMY OF VANDEAE ...... 78

Introduction...... 78 Material and Methods...... 87 Results ...... 113 Anatomy of Tribe Vandeae ...... 113 Anatomy of Subtribe Angraecinae ...... 118 Anatomy of Subtribe Aeridinae ...... 196 Anatomy of Tribe , Subtribe ...... 207 Phylogenetic Analyses of Vandeae...... 212 Discussion ...... 213 Comparative Anatomy...... 213 Cladistics...... 221

4 ANATOMICAL EVOLUTION WITHIN ANGRAECINAE...... 223

Introduction...... 223 Materials and Methods ...... 223 Results ...... 237 Structural Characters Mapped onto Molecular Topologies ...... 237 Structural Characters Traced along Combined Topologies...... 252 Discussion ...... 276

5 CONCLUSIONS ...... 281

APPENDIX: PARALOGY IN VANDEAE ...... 287

LIST OF REFERENCES...... 290

BIOGRAPHICAL SKETCH ...... 301

viii LIST OF TABLES

Table page

2-1 Taxa of Vandeae for molecular phylogenetic study...... 18

2-2 Representative sampling of genera of Vandeae...... 27

2-3 Primer sequences for polymerase chain reaction amplification...... 30

2-4 Components of polymerase chain reactions ...... 30

2-5 Thermocycler program for polymerase chain reactions...... 31

2-6 Thermocycler program for cycle sequencing...... 32

2-7 Components of cycle sequencing reactions...... 32

2-8 Comparison of tree statistics for each gene region and combinations of these gene regions for maximum parsimony analyses...... 45

3-1 Taxa of Vandeae examined for anatomical study...... 97

3-2 Anatomical and morphological characters used in cladistic analysis of Vandeae...... 105

3-3 Character states for taxa used in cladistic analyses of Vandeae...... 107

4-1 Taxa of Vandeae examined for combined molecular and anatomical study...... 225

4-2 Structural character states for taxa used in cladistic analyses of Angraecinae and Aerangidinae ...... 232

4-3 Comparison of tree statistics for each phylogenetic analysis ...... 237

ix LIST OF FIGURES

Figure page

1-1 parishii plants showing the deciduous type of monopodial leaflessness ...... 3

1-2 Monopodial leaflessness with scale ...... 3

2-1 One of 20,000+ most parsimonious trees for Vandeae using ITS...... 37

2-2 Aeridinae clade from one of 20,000+ most parsimonious trees ...... 39

2-3 Bootstrap consensus tree for large ITS data set of Vandeae...... 40

2-4 Aeridinae clade from bootstrap consensus tree of Vandeae using ITS sequence data...... 41

2-5 One of 126 most parsimonious trees for Angraecinae + Aerangidinae using ITS...... 47

2-6 Bootstrap consensus tree for ITS data set of Angraecinae + Aerangidinae...... 49

2-7 One of 20,000+ most parsimonious trees for Angraecinae + Aerangidinae using matK chloroplast region...... 52

2-8 Bootstrap consensus tree for matK data set of Angraecinae + Aerangidinae...... 54

2-9 One of 20,000+ most parsimonious trees for Angraecinae + Aerangidinae using trnL-F chloroplast region...... 57

2-10 Bootstrap consensus tree for trnL-F data set of Angraecinae + Aerangidinae...... 59

2-11 One of 20,000+ most parsimonious trees for Angraecinae + Aerangidinae using trnL-F and matK chloroplast regions combined ...... 61

2-12 Bootstrap consensus tree of combined trnL-F and matK data sets for Angraecinae + Aerangidinae...... 63

x 2-13 One of 2,688 most parsimonious trees for Angraecinae + Aerangidinae using trnL-F, matK, and ITS regions combined ...... 67

2-14 Bootstrap consensus tree of combined trnL-F, matK, and ITS data sets for Angraecinae + Aerangidinae...... 69

3-1 TS showing mesophyll above midrib...... 91

3-2 TS showing smooth endovelamen thickenings (arrowheads) in eburneum...... 92

3-3 Root TS showing ridged endovelamen thickenings (arrowheads) in arachnanth...... 93

3-4 Root TS showing exodermal proliferation (e) in praetermissa ...... 94

3-5 Water-storage idioblasts with various cell wall thickenings ...... 95

3-6 Glandular hairs of leaf ...... 114

3-7 Hypodermal cells in leaf ...... 115

3-8 Leaf sections showing mesophyll features of Vandeae...... 116

3-9 Root TS showing velamen cells ...... 119

3-10 Solenangis clavata root TS showing radially elongate epivelamen cells and cover cells (arrowheads) arranged above passage cells of ∩- thickened exodermal cells...... 120

3-11 Root TS of xanthopollinium...... 120

3-12 Root TS of maudiae showing shape, size, and distribution of cortical cells...... 121

3-13 Root TS showing aeration units ...... 122

3-14 Root TS of Rhipidoglossum subsimplex showing -thickened endodermal cell walls, pericycle, xylem clusters with wide tracheary elements, alternating phloem clusters, lignified embedding tissue, and round lignified pith cells ...... 123

3-15 Leaf TS showing features of the epidermis ...... 126

3-16 Leaf sections showing features of the epidermis...... 127

3-17 Leaf TS of pertusa showing heterogeneous mesophyll and scattered fibrous idioblasts (arrowheads)...... 128

xi 3-18 Leaf TS of coriacea showing darkly stained within thin-walled bundle sheath cells ...... 129

3-19 Root TS of grandidieriana showing isodiametric epivelamen cells and ∩-thickened exodermal cells...... 130

3-20 Root TS of Angraecum cultriforme showing algal cells (arrowheads) within the epivelamen...... 131

3-21 Root TS of Aerangis coriacea showing vascular cylinder with thick-walled cells encircling phloem clusters...... 132

3-22 Leaf TS of arachnites showing fiber bundle with encircling stegmata (arrowheads) ...... 134

3-23 Leaf TS of parviflora showing mucilage globules (arrowheads) in mesophyll cells ...... 137

3-24 Leaf TS of Angraecum spp. showing features of the mesophyl ...... 143

3-25 Root TS of macrostachya showing ∪-thickened exodermal cells...... 145

3-26 Leaf TS showing features of the mesophyll in Bolusiella spp...... 147

3-27 Root TS of lindenii showing pits formed by anastomosing epivelamen thickenings...... 160

3-28 Leaf TS of millarii showing papillose epidermal cells ...... 161

3-29 Root TS of Jumellea sagittata showing modified layer of cortical cells surrounding the endodermis...... 163

3-30 Root TS of Microcoelia macrantha showing grooves (arrowhead) in ∩- thickened exodermal cells...... 172

3-31 Leaf TS of Sphyrarhynchus schliebenii showing large raphide idioblast (arrowhead) forming raised area just below epidermis...... 189

3-32 Root TS of crassifolia showing tufts in epivelamen...... 194

3-33 Leaf TS of Ypsilopus viridiflorus showing twisted vascular bundles...... 196

3-34 Leaf TS of Chiloschista lunifera showing eglandular trichome ...... 200

3-35 Root TS of flabellata showing large, fibrous idioblasts of cortex ...... 202

xii 3-36 Leaf TS of longiscapa showing water-storage cells and the absence of stegmata associated with the vascular bundles...... 209

3-37 Root TS of Polystachya longiscapa showing webbed tilosomes...... 211

3-38 One of 20,000+ equally parsimonious trees using anatomical and morphological data...... 214

3-39 Bootstrap consensus tree of Vandeae ...... 216

3-40 Strict consensus of 20,000+ equally parsimonious trees ...... 217

4-1 Bootstrap consensus trees for the molecular (left) and anatomical (right) data sets...... 239

4-2 All structural characters mapped onto a representative molecular phylogeny...... 241

4-3 Tilosome presence mapped onto a representative molecular tree...... 242

4-4 Aeration complex presence mapped onto a representative molecular tree...... 243

4-5 Hypodermal distribution mapped onto a representative molecular tree...... 244

4-6 Stegmata presence mapped onto a representative molecular tree ...... 245

4-7 Mucilage loss mapped onto a representative molecular tree...... 246

4-8 Stem condition mapped onto a representative molecular tree ...... 247

4-9 Epivelamen cell shape mapped onto a representative molecular tree ...253

4-10 Epivelamen cell shape mapped onto a representative molecular tree using the ACCTRAN optimization algorithm ...... 254

4-11 Distinct thickenings of the inner endovelamen wall mapped onto a representative molecular tree...... 255

4-12 Velamen tuft presence mapped onto a representative molecular tree ...256

4-13 Exodermal thickening type mapped onto a representative molecular tree...... 257

4-14 Exodermal proliferations mapped onto a representative molecular tree...... 258

xiii 4-15 Water-storage cell wall ornamentation mapped onto a representative molecular tree ...... 259

4-16 ACCTRAN optimization of water-storage cell wall ornamentation mapped onto a representative molecular tree...... 260

4-17 Root fibers mapped onto a representative molecular tree...... 261

4-18 ACCTRAN optimization of foliar hairs mapped onto a representative molecular tree ...... 262

4-19 DELTRAN optimization of foliar hairs mapped onto a representative molecular tree ...... 263

4-20 Adaxial epidermal cell shape mapped onto a representative molecular tree...... 264

4-21 Abaxial epidermal cell shape mapped onto a representative molecular tree...... 265

4-22 Stomatal distribution mapped onto a representative molecular tree...... 266

4-23 Hypodermal composition mapped onto a representative molecular tree...... 267

4-24 ACCTRAN optimization of hypodermal composition mapped onto a representative molecular tree...... 268

4-25 Mesophyll differentiation mapped onto a representative molecular tree...... 269

4-26 Leaf water-storage cell wall ornamentation mapped onto a representative molecular tree...... 270

4-27 Mesophyll fiber idioblasts mapped onto a representative molecular tree...... 271

4-28 Leaf persistence mapped onto a representative molecular tree...... 272

4-29 Leaf morphology mapped onto a representative molecular tree ...... 273

4-30 Monopodial stem length mapped onto a representative molecular tree...... 274

4-31 ACCTRAN optimization of monopodial stem length mapped onto a representative molecular tree...... 275

4-32 Bootstrap consensus tree using structural and molecular data...... 277

xiv 4-33 All structural characters mapped onto a representative combined phylogeny...... 278

5-1 Strict consensus of 20,000+ most parsimonious trees from ITS sequence data ...... 282

A-1 Bootstrap consensus tree for ITS data set of all Vandeae ...... 288

xv Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

MOLECULAR SYSTEMATICS AND ANATOMY OF VANDEAE (ORCHIDACEAE): THE EVOLUTION OF MONOPODIAL LEAFLESSNESS

By

Barbara S. Carlsward

December 2004

Chair: William Louis Stern Major Department: Botany

Leafless members of tribe Vandeae (Orchidaceae) have undergone extreme reduction in habit and represent a novel adaptation to the canopy environment. Members of Vandeae form a large, pantropical, and poorly studied group of orchids traditionally divided into three subtribes: Aeridinae,

Aerangidinae, and Angraecinae. Leafless taxa occur throughout Vandeae and are geographically distributed in tropical Africa, , and America. The most widely accepted classification system is based solely on floral morphology, and no significant molecular or anatomical studies of Vandeae have been done. To study the evolution of leaflessness, molecular and structural evidence were used to generate phylogenetic hypotheses using Paup* 4.0 (Sinauer Associates,

Sunderland, Massachusetts). The structural portion of this study was performed using both macro- and microscopic leaf and root characters. Cladistic analyses based on parsimony of 169 taxa used 26 vegetative anatomical and

xvi morphological characters. These analyses supported a monophyletic Vandeae, with very little resolution among subtribes or genera. Molecular studies used sequences from ITS nrDNA, trnL-F cpDNA, and matK cpDNA. Separate and combined maximum parsimony analyses of these three gene regions each supported only two subtribes within Vandeae: Aeridinae and a combined

Angraecinae + Aerangidinae.

The DNA sequence data were also combined with structural data in cladistic analyses. These combined analyses resulted in trees with lower consistency indices, but gave fewer trees with more well-supported clades than either data set alone. Finally, two techniques of examining character evolution were compared: 1) mapping vegetative characters onto a molecular topology and 2) tracing vegetative characters onto a combined structural + molecular topology. In both cases, structural synapomorphies supporting Vandeae and clades within Vandeae were nearly identical. Not surprisingly, a change in leaf morphology (most commonly reduced to a nonphotosynthetic scale) seems to be the most important character in making the evolutionary transition to leaflessness. Other vegetative characters that were probably also important in the transition to leaflessness were loss of tilosomes, development of an aeration complex, and development of the monopodial plant habit.

xvii CHAPTER 1 INTRODUCTION

Orchidaceae are one of the largest families, with approximately 20,000 (Dressler, 1993) ranging from small, ephemeral, terrestrial herbs to large, perennial epiphytic succulents. They have a worldwide distribution and occur on every continent except Antarctica. Despite this wide distribution, few taxa are pantropical, which suggests that modes of dispersal have limited the biogeographic patterns within this large angiosperm family.

Orchids also comprise an extremely diverse group of organisms, showing wide ranges in vegetative structure, chemistry, chromosome number, and habit. Most orchids are epiphytic (Atwood, 1986), but plants may also be terrestrial, lithophytic, and/or mycoparasitic. One of the most extreme examples of reduction in the epiphytic Bauplan is found in the specialized tribe Vandeae, which contains reduced leafless epiphytes (Figs. 1-1, 1-2).

In these leafless orchids, photosynthetic leaves are reduced to small brown scales or caducous, vestigial leaves and contribute no net carbon gain to the plant (Benzing & Ott, 1981). Instead, the form the main body of the plant and have assumed the role of food-assimilation using a CAM-like system of recycling CO2 (Cockburn et al., 1985). The degree of reduction is so extreme that these leafless orchids have even been referred to as “shootless” and

“semishootless” by some workers (Benzing et al., 1983; Benzing & Ott, 1981).

Benzing and Ott (1981) hypothesize that these extreme epiphytes have

1 2 evolutionarily reduced their carbon investment in vegetative organs by limiting shoot formation, while increasing their potential fitness by allocating more resources for and fruit production.

Systematics

Vandeae were first circumscribed by Lindley during the early 1800s in his treatment of the orchid family (1830-1840). Members of Vandeae sensu Lindley were grouped based on the presence of distinct caudicles of the pollinarium. In addition to Vandeae sensu Dressler, 1993 (e.g., Vanda and Angraecum), a significant part (40%) of Lindley’s group are tropical American taxa that are now placed in Maxillarieae. However, after describing Vandeae as a new tribe,

Lindley admitted his circumscription of Vandeae could probably be even further subdivided into well defined groupings, given further study. After Lindley,

Bentham (1881) used the presence of one to two caudicles attached to a distinct gland () to group Vandeae, with many taxa now placed in Maxillarieae.

Bentham subdivided Vandeae into eight subtribes, including Sarcanthinae (his

“Sarcantheae”). As circumscribed by Bentham (1881), Sarcanthinae included three series (numbered one through three) based on the presence of a foot and spurred lip. Series one comprised New World Maxillarieae, while Series two and three comprised vandaceous taxa sensu Dressler, 1993.

The German taxonomist Pfitzer (1887) deviated from a strictly floral system of classification, instead using one that emphasized vegetative characteristics.

His group, Sarcantheae (Pfitzer’s “Sarcanthinae”), were placed in the

Monopodiales, allied to Dichaeae (Pfitzer’s “Dichaeinae”). Within 3

Figure 1-1. Chiloschista parishii plants showing the deciduous type of monopodial leaflessness. On the left is a plant with short-lived vestigial leaves, and on the right is a leafless plant of the same species.

Figure 1-2. Monopodial leaflessness with scale leaves. a) Solenangis aphylla with an elongate stem. b) Dendrophylax sallei with a very abbreviated stem (arrowhead). 4

Sarcantheae, Aeridinae (Pfitzer’s “Aerideae”) were distinct from Pachyphyllinae

(Pfitzer’s “Pachyphylleae”) in having a nonpetaloid clinandrium and primarily paleotropical distribution. Pfitzer basically agreed with Bentham’s classification of Sarcantheae (1881), minus the .

Schlechter (1926), one of the most prolific orchid taxonomists (Pridgeon et al., 1999), published his system of classification almost 40 years later. In it he used a combination of floral and vegetative characteristics. While Schlechter did not stress vegetative morphology to the extent of Pfitzer’s (1887) classification, he did group four subtribes based on their monopodial habit (subseries

Monopodiales): Dichaeinae, Pachyphyllinae, Pterostemmatinae, and

Sarcanthinae (Schlechter’s “Sarcantheae”). Schlechter further divided

Sarcanthinae into two greges: those with having a column foot

( group = “Sarcochilinae” and group = “Podanginae”) and those without a column foot (Vanda group = “Vandinae”, Angraecum group =

“Angraecinae”, group = “Saccolabiinae”, and Aerangis group =

“Aeranginae”). More than 10 years later, Mansfeld (1937) attempted to reorganize Schlechter’s (1926) classification of the monandrous subfamily. Tribe

Vandeae was reinstated, including mostly taxa of Maxillarieae and one subtribe of vandaceous taxa, Sarcanthinae.

More than a century after Lindley’s monumental treatment of Orchidaceae

(1830-1840), Dressler and Dodson (1960) presented the most comprehensive classification system at the time. In their discussion of Orchidaceae, Dressler and Dodson synthesized information presented by previous workers and then 5 presented their own system of classification, which was the first to consistently follow the International Code of Botanical Nomenclature. Dressler and Dodson placed subtribe Sarcanthinae within a large tribe Epidendreae. They also noted that while this monopodial subtribe may be difficult to distinguish from the tropical

American , they are probably not closely related (Dressler & Dodson,

1960).

At about the same time, Garay (1960; 1972a) published his systematic treatments of Orchidaceae. Garay’s 1972 publication provided a clear outline of his own classification, along with a comparison to those of previous workers

(including Dressler and Dodson). Garay reinstated tribe Vandeae based on the presence of an incumbent anther, porrect rostellum, and well-developed stipes.

Vandeae sensu Garay included tropical American subtribes Cyrtopodiinae,

Zygopetalinae, and Oncidiinae as well as Vandinae (Garay, 1972a). During the same year, Garay (1972b) also published the first paper in his series of monopodial orchid treatments in which he discussed only members of Vandinae.

Vermeulen’s (1966) classification was similar to Schlechter’s (1926) scheme but differed in ranks, so that Orchidaceae is shifted up to an order

(Orchidales) with three families: Apostasiaceae, Cypripediaceae, and

Orchidaceae. Vermeulen’s Orchidaceae are composed of two subfamilies,

Orchidoideae and . Vandeae are part of his “contribe”

Epidendranthae and are separated from Epidendreae by having stipes.

Twenty years after publishing his first taxonomic synopsis of Orchidaceae,

Dressler (1981) published an exceptional treatise on the natural history and 6 systematics of the orchid family in which he elevated units of the original tribe

Epidendreae delimited by Dressler and Dodson (Dressler & Dodson, 1960) to form two subfamilies: Epidendroideae and Vandoideae. While Vandoideae had long been recognized (at varying taxonomic levels) on the basis of floral morphology, there were very few consistent characters to delimit Vandoideae from Epidendroideae. Dressler admitted that the only clear character delimiting these two subfamilies was anther development. Several years later Dressler

(1989) reinstalled members of Vandoideae into a broad Epidendroideae, much like his original systematic treatment with Dodson (Dressler & Dodson, 1960). In either case, though, Vandeae formed a well-defined group of orchids split into three subtribes: Sarcanthinae, Angraecinae, and Aerangidinae.

The use of cladistics in orchid classification was not introduced until 1986, when Burns-Balogh and Funk (1986) published their phylogenetic analysis of

Orchidaceae. While they gave orchid systematics a more modern perspective, they were criticized for misinterpreting many of the morphological characters used in their analyses (Dressler, 1987). But, as part of Epidendroideae,

Vandeae remained relatively unchanged from Dressler’s (1981) classification system.

Dressler’s (1993) most recent work on orchid classification integrated modern cladistic approaches with the knowledge base that had accumulated since Lindley’s treatment of Orchidaceae (1830-1840). Even today, with the preeminent use of sequence data in phylogenetics, Dressler’s classification scheme based on morphology and biogeography is still the most widely used 7 system. Vandeae were essentially unchanged from his previous book (Dressler,

1981), except they were allied with and in a dendrobioid subclade of Epidendroideae.

Several years after Dressler published his comprehensive classification scheme (1993), Dariusz Szlachetko (1995) provided a much more subdivided classification system in which he split orchids into three families and subdivided

Orchidaceae sensu stricto into eight subfamilies, including Vandoideae.

Szlachetko’s system was primarily based on overall similarity in floral morphology, not on shared-derived characters; it has therefore been essentially disregarded by most taxonomists today (Pridgeon et al., 1999). In his organization of Vandeae (based primarily on rostellum morphology), Szlachetko created ten new subtribes to complement the three existing subtribes (Aeridinae,

Angraecinae, and Aerangidinae).

The most comprehensive morphological study of orchid systematics was carried out by Freudenstein and Rasmussen (1999). In their cladistic analyses,

Vandeae formed a monophyletic tribe based on several synapomorphies: isodiametric exodermal cell shape, monopodial growth habit, spherical stegmata, and seeds with laterally compressed walls. Aerangis and Angraecum were united by the reduction of four pollinia to two, and they were sister to a paraphyletic grade of Aeridinae ( and ). Their study also indicated a sister relationship with Polystachyinae (Polystachya and

Neobenthamia). 8

Existing molecular evidence for relationships among members of tribe

Vandeae is scarce. This tribe has often been referred to as the “black box” of

Orchidaceae (Dressler, personal communication). The chloroplast-encoded matK (Jarrell & Clegg, 1995) and rbcL (Cameron et al., 1999) gene regions show that the three traditional subtribes are monophyletic, but these two studies differed in relative placement of the subtribes. The rbcL tree gave greater support for Angraecinae and Aeridinae as sister taxa than for the traditional sister-grouping of Angraecinae and Aerangidinae supported by matK studies.

However, taxon sampling in these rbcL and matK studies was very limited (seven and 22 vandaceous genera, respectively). Cameron (2001) later added two chloroplast gene regions (atpB and psaB) to his rbcL data matrix and found that

Aerangidinae and Angraecinae formed a clade sister to Aeridinae. In this expanded study, Cameron also found Polystachya to be a well-supported sister group of Vandeae.

Shortly after Szlachetko published his morphological classification (1995),

Neyland and Urbatsch (1996) published their phylogenetic study of

Epidendroideae based on ndhF chloroplast sequences. Unfortunately, their sampling of Vandeae was much more limited than either of the other two molecular studies (Cameron et al., 1999; Jarrell & Clegg, 1995). Representative taxa of Vandeae were limited to two genera of Aeridinae and one of

Aerangidinae: (Aeridinae), Aerangis graminifolia

(Aerangidinae), and philippinensis (referred to as Angraecum philippinense and erroneously used as a representative of Angraecinae). In their 9 analyses, Vandeae were polyphyletic. Amesiella and Aerangis formed a well- supported clade (100 % bootstrap support) sister to Polystachya, while Vanda was embedded in a large polytomy of New and Old World epidendroids (< 50% bootstrap support).

The most recent systematic treatment of Orchidaceae (Chase et al., 2003), was an attempt to classify orchids based on a combination of several different molecular studies (Cameron, 2001; Cameron et al., 1999; Neyland & Urbatsch,

1996). In this new classification, Vandeae formed a monophyletic tribe within a large polytomy of advanced epidendroid groups ( and

Agrostophyllinae) and included the sympodial subtribe Polystachyinae. There is no discussion of why Polystachyinae were included within Vandeae. Presumably this portion of the cladogram is supported by Neyland and Urbatsch’s study of the Epidendroideae (1996) in which they found Polystachya to be sister to the

Amesiella + Aerangis clade. As mentioned previously, the Neyland and Urbatsch study was based on very limited sampling (within Vandeae, subtribe Angraecinae were not represented) and should probably not be relied on for subtribal relationships of Vandeae. While their attempt to modernize Dressler’s (1993) classification system was desperately needed, their treatment of Epidendroideae was probably premature. As in many of the molecular studies of Orchidaceae, sampling for Vandeae was limited (nine genera of Aeridinae, two genera of

Angraecinae, two genera of Aerangidinae, and two genera of Polystachyinae).

Lower-level phylogenetic studies of Vandeae are even more uncommon than higher-level studies of the tribe. As a preliminary step in teasing apart 10 lower-level relationships among members of Angraecinae, Carlsward et al.

(2003) performed more detailed studies of the New World genus Dendrophylax.

Using several African species of Angraecum as outgroups, their studies reduced the four previously described genera in tropical America to two sister genera:

Campylocentrum and Dendrophylax.

Most molecular phylogenetic studies support Dressler’s (1993) classification system of Vandeae, differing only in sister-group relationships. Therefore, for the purposes of my study, Dressler’s 1993 classification system was used as an initial hypothesis for subtribal relationships of Vandeae. Polystachyinae have been supported as a group closely related to Vandeae by molecular studies

(Cameron, 2001; Cameron et al., 1999; Neyland & Urbatsch, 1996), chromosome number (Arends & Van der Laan, 1986), and seed morphology

(Ziegler, 1981). Therefore, Polystachyinae were used for outgroup comparisons in both molecular and anatomical analyses of my study.

Vandeae sensu Dressler 1993 include approximately 158 genera with 1968 species of monopodial epiphytes. Within the primarily epiphytic subfamily

Epidendroideae, Vandeae are sister to members of subtribe Polystachyinae

(Chase et al., 2003). Distinguishing characters of Vandeae include velamen of the Vanda type (Porembski & Barthlott, 1988); monopodial habit; tegular stipe

(Rasmussen, 1986b); pollinia reduced from eight to four or two (Rasmussen,

1986b); pollinia superposed (Rasmussen, 1986b); and Vanda type seeds

(Ziegler, 1981). 11

Vandeae sensu Dressler (1993) included three subtribes and were divided based on floral morphology and biogeography. While the tribe as a whole shows a pantropical distribution pattern, most genera are restricted to the Old World.

Aeridinae make up the largest subtribe, with 103 genera (1253 species) primarily distributed throughout Asia, , and a few species in Africa [e.g., Acampe papillosa (Lindl.) Lindl. and coxii (Summerh.) Summerh.]. They are distinguished from members of the other two subtribes by having an entire rostellum, a relatively small spur formed by the lip, and four or two pollinia.

Several genera, such as Acampe and , may also possess a prominent column foot.

Aerangidinae contain 36 genera (307 species) occurring in tropical Africa and . Aerangoid species typically possess an elongate rostellum, elongate spur, and two pollinia. Their appearance closely resembles that of members of the smallest subtribe, Angraecinae, which contains 19 genera (408 species). Angraecoids are distributed throughout Madagascar, the Mascarene and Islands, and tropical Africa, with two genera (Campylocentrum and

Dendrophylax) in tropical America. Angraecoid orchids possess an apron-like rostellum, elongate spur, and two pollinia. The primary feature distinguishing

Angraecinae and Aerangidinae is the shape of the rostellum (elongate vs. apron- like).

Leaflessness

While leaflessness within angiosperms is common, the type of leaflessness found in Vandeae is unique to this specialized orchid tribe. Most leafless vascular plants are typically either succulent and xeric-adapted (e.g., Cactaceae, 12

Euphorbiaceae) or in some way parasitic on other plants or fungi (e.g.,

Orobanchaceae, Orchidaceae). In almost all cases, the shoot system of these leafless plants is well-developed and forms the main body. However, the shoot system of leafless Vandeae is extremely reduced, so that the roots form the main body of the plant. Even within Orchidaceae, there are examples of parasitic

() and succulent leafless plants that are typically deciduous

(). Vandeae differ in that they are epiphytes with a reduced shoot system and monopodial growth habit.

Monopodial leaflessness occurs taxonomically in all three subtribes of

Vandeae and geographically across the globe. Aeridinae contain the greatest diversity of leafless taxa, with four genera (165 species) found primarily throughout Asia and one (Taeniophyllum coxii) in Africa. Taeniophyllum is the largest exclusively leafless genus within Vandeae, with approximately 185 species that possess brown scale leaves. The remaining three Australasian genera (Chiloschista, Microtatorchis, and Phalaenopsis section Aphyllae) together contain approximately 45 species with caducous, vestigial leaves.

Traditionally, there are three genera within Aerangidinae containing leafless species. Microcoelia is an exclusively leafless genus with approximately 26 species found throughout tropical Africa and Madagascar. Chaulidion is a monotypic African genus that resembles Microcoelia (Jonsson, 1979).

Solenangis is mainly a leafy genus with two leafless members: S. aphylla and S. cornuta. Both Microcoelia and Solenangis have leaves reduced to small nonphotosynthetic scales. The main vegetative difference between these genera 13 is the length of their stems. Species of Microcoelia all possess abbreviated stems (less than 3 cm long) while S. aphylla and S. cornuta possess elongate stems (usually greater than 4 cm).

The primarily paleotropical Angraecinae contains two leafless genera restricted to the neotropics. Dendrophylax is an exclusively leafless genus with

13 species bearing brown scales along an abbreviated stem axis. The larger genus, Campylocentrum (35 species), is primarily leafy with approximately 12 leafless species, ranging from plants with abbreviated stems bearing nonphotosynthetic scales to one species (C. poeppigii) with elongate stems bearing minute, elongate, caducous leaves. By far though, the greatest diversity of leafless Vandeae occurs in the paleotropics, specifically Asia.

Anatomy

Much like the molecular phylogenetics of Vandeae, work published on the vegetative anatomy has been limited, especially for studies dealing exclusively with vandaceous genera. Most anatomical data published on Vandeae in the mid to late 20th century have been segments in surveys of ecological habitats and/or geographical regions. The most commonly used taxa were those of

Aeridinae (Chiang & Chou, 1971; Curtis, 1917; Das & Paria, 1992; Kaushik,

1983; Mohana Rao et al., 1989).

Numerous anatomical surveys of plant organs have included vandaceous taxa (Barthlott, 1981; Cheadle & Kosakai, 1982; Dycus & Knudson, 1957;

Engard, 1944; Leitgeb, 1864; Møller & Rasmussen, 1984; Mulay & Panikkar,

1956; Olatunji & Nengim, 1980; Oliveira & Sajo, 1999; Porembski & Barthlott,

1988; Pridgeon, 1987; Pridgeon et al., 1983; Sakharam Rao, 1953; Singh, 1986; 14

Williams, 1979). For Vandeae (and many other orchid subgroups), Solereder and Meyer’s (1930) vegetative anatomical survey of Orchidaceae is still the most comprehensive treatment.

Objectives

The leafless condition of Vandeae represents a unique series of modifications by which plants survive in canopy environments. The transition to this reduced habit resulted in important structural, physiological, and developmental changes in the plant body. Given the broad taxonomic and geographic distribution of these organisms, it is likely that leaflessness has evolved several times in the three traditional subtribes (Dressler, 1993). The principal goals of my research were to develop a hypothesis of evolution for leaflessness within Vandeae and to determine the structural changes that have taken place in the reduction to leaflessness. As a basis for answering these evolutionary questions, another significant objective was to develop a phylogenetic hypothesis of relationships among leafy and leafless taxa in the three traditional subtribes of Vandeae.

Methods

Sequence data from the nuclear ribosomal internal transcribed spacer regions 1 and 2 (collectively referred to as nr ITS) were used to form a hypothesis of relationships for all Vandeae (Aeridinae, Aerangidinae, and

Angraecinae). This general phylogeny provided an overview of the tribe and allowed me to answer questions about monopodial leafless evolution in all subtribes. 15

The primary focus of my research was the evolution of leaflessness outside

Australasia. Therefore, additional sequence data from chloroplast gene regions

(matK and trnL-F) were obtained for taxa of Aerangidinae and Angraecinae.

These additional molecular data from the chloroplast region are presumably independent of ITS gene genealogy and would allow for a more robust evolutionary hypothesis than ITS alone (Soltis et al., 1998).

Structural data were collected from roots of at least one species for all leafless genera in Vandeae. Detailed anatomical observations were also made for all representative leafy taxa of Aerangidinae and Angraecinae. Select leafy genera of Aeridinae (Acampe, Amesiella, Kingidium, , , and Vanda) were used for comparison. Vegetative morphological and anatomical characters were then used in phylogenetic analyses of the tribe, with an emphasis on Aerangidinae and Angraecinae.

To answer questions about the structural evolution of leaflessness, structural characters were mapped onto trees created using molecular data only.

Structural characters were also traced onto a combined molecular and morphological topology. These two methods were compared for their effectiveness and accuracy in describing evolutionary patterns of leaflessness. CHAPTER 2 MOLECULAR PHYLOGENY OF VANDEAE

Introduction

The concept of Vandeae has changed considerably since Lindley’s (1830-

1840) original circumscription of Orchidaceae in the early 19th century. The primary difference between today’s most-accepted classification scheme

(Dressler, 1993) and that of earlier orchid taxonomists (Bentham, 1881; Lindley,

1830-1840; Mansfeld, 1937; Pfitzer, 1887; Schlechter, 1926) is the inclusion of various monopodial American genera now thought to be part of Maxillarieae.

Many early workers relied on very few morphological characters to circumscribe major orchid groups. Two of the most important characters used to delimit members of Vandeae were a monopodial growth habit and well-developed stipes. More than a century after Lindley’s (1830-1840) original circumscription of Vandeae, Freudenstein and Rasmussen (1999) quantified Dressler’s (1993) hypotheses of vandaceous relationships using shared-derived morphological characters in a cladistic analysis.

With the relatively recent advent of DNA sequencing, molecular data have reshaped our ideas of relationships within Orchidaceae, which have been the focus of more published DNA phylogenetic analyses than on those of any other flowering plant family (Chase et al., 2003). However, few orchidologists have attempted to tease apart relationships among taxa of Vandeae (Jarrell & Clegg,

1995, 1996). Most molecular work with Vandeae has been done as part of a

16 17 larger phylogenetic study of Orchidaceae using chloroplast sequences (Cameron et al., 1999; Neyland & Urbatsch, 1994). The most recent molecular systematic work (Chase et al., 2003) was an attempt to modernize Dressler’s 1993 orchid classification by compiling previously published molecular data to create one large phylogenetic hypothesis of Orchidaceae. Chase and colleagues support a broader circumscription of Vandeae that includes Polystachyinae, Aeridinae,

Angraecinae, and Aerangidinae. While the sample size for representatives of

Vandeae was an improvement from previous studies, it was still extremely limited

(approximately 8% of the genera represented).

Materials and Methods

Plant Material

Specimens were obtained from cultivated material, herbarium specimens, and wild-collected plants (Table 2-1). When possible, the type species for each genus was obtained (Table 2-2). The ITS region for representatives of all subtribes was sequenced to obtain an overall hypothesis of relationships within

Vandeae. Polystachyinae were used as outgroup taxa, based on results of previous analyses (Cameron, 2001; Cameron et al., 1999; Chase et al., 2003;

Freudenstein & Rasmussen, 1999; Neyland & Urbatsch, 1996). Additional gene regions (chloroplast-encoded matK and trnL-F) were sequenced for all available

Aerangidinae and Angraecinae. Aeridinae and Polystachyinae were used as outgroups in these multigene analyses. Table 2-1. Taxa of Vandeae for molecular phylogenetic study. Specimen Gene Taxona Sourced Vouchere (locationf) numberb regionc Tribe Vandeae Lindl., Subtribe Aerangidinae Summerh. (Lindl.) Schltr. B 232 I, M, T FLMNH hort. Whitten (FLAS) A. citrata (Thouars) Schltr. B 109 I, M, T Countryside Orchids Whitten 1788 (FLAS) A. confusa J.L.Stewart B 310 I, M, T B. Bytebier, Africa Bytebier s.n. (EA) A. coriacea Summerh. B 272 I Hoosier Orchid Co. No voucher A. coriacea B 318 I, M, T B. Bytebier, Africa Bytebier 562 (EA) A. ellisii var. grandiflora J.L.Stewart B 260 I, M, T Hoosier Orchid Co. No voucher A. fastuosa (Rchb.f.) Schltr. B 268 I, M, T Countryside Orchids No voucher A. kirkii (Rchb.f.) Schltr. B 302 I, M, T B. Bytebier, Africa Bytebier 637 (EA) A. kotschyana (Rchb.f.) Schltr. B 316 I, M, T B. Bytebier, Africa Bytebier 671 (EA) A. luteoalba var. rhodosticta (Kraenzl.) J.L.Stewart B 308 I, M, T B. Bytebier, Africa Bytebier 691 (EA) A. macrocentra (Schltr.) Schltr. B 327 I, M, T J. Hermans hort. Kew 779 (K) A. modesta (Hook.f.) Schltr. B 136 I, M, T ABG hort. Carlsward 242 (FLAS) A. punctata J.L.Stewart B 227 I, M, T Hoosier Orchid Co. Carlsward 328 (FLAS) A. somalensis (Schltr.) Schltr. B 298 I, M, T B. Bytebier, Africa Bytebier 1549 (EA) A. thomsonii (Rolfe) Schltr. B 309 I, M, T B. Bytebier, Africa Kirika 968 (EA) A. ugandensis Summerh. B 303 I, M, T B. Bytebier, Africa Bytebier 681 (EA) A. verdickii (DeWild.) Schltr. B 267 I, M, T Countryside Orchids No voucher capitatus (Lindl.) Summerh. B 230 I, M, T Uzumara Orchids Carlsward 276 (FLAS) A. metteniae (Kraenzl.) Summerh. B 239 I, M, T Uzumara Orchids No voucher, ver. La Croix A. recurvus Finet B 248 I, M, T Uzumara Orchids No voucher, ver. La Croix A. straussii (Schltr.) Schltr. B 274 I, M, T Uzumara Orchids Photo (FLAS), ver. La Croix Angraecopsis amaniensis Summerh. B 252 I, M, T Uzumara Orchids No voucher, ver. La Croix A. breviloba Summerh. B 285 I, M, T B. Bytebier, Africa Bytebier 307 (EA) A. parviflora (Thouars) Schltr. B 251 I, M, T Uzumara Orchids Carlsward 291 (FLAS) A. parviflora B 339 I J. Hermans hort. Kew 4363 (K) Beclardia macrostachya (Thouars) A.Rich. B 249 I, M, T Uzumara Orchids Photo (FLAS), ver. La Croix B. macrostachya B 325 I J. Hermans hort. Kew 3536 (K) Bolusiella batesii (Rolfe) Schltr. B 78 I, T SEL hort. (1997-0173A) Carlsward 152 (FLAS) Nkongmeneck 2087 (SEL) B. iridifolia (Rolfe) Schltr. B 319 I, M, T B. Bytebier, Africa Bytebier 1113 (EA) B. maudiae (Bolus) Schltr. B 287 I, M, T B. Bytebier, Africa Bytebier 485 (EA) Table 2-1. Continued Specimen Gene Taxona Sourced Vouchere (locationf) numberb regionc Chamaeangis ichneumonea (Lindl.) Schltr. B 246 I, M, T Uzumara Orchids La Croix 1101 (?), Photo (FLAS) C. odoratissima (Rchb.f.) Schltr. B 247 I, M, T Uzumara Orchids No voucher, ver. La Croix C. sarcophylla Schltr. B 284 I, M, T B. Bytebier, Africa Bytebier 339 (EA) C. vesicata (Lindl.) Schltr. B 311 I, M, T B. Bytebier, Africa Bytebier 796 (EA) C. vesicata B 340 I J. Hermans hort. Kew 399 (K) Cribbia brachyceras (Summerh.) Senghas B 283 I, M, T B. Bytebier, Africa Bytebier 361 (EA) C. confusa P.J.Cribb B 332 I, M, T J. Hermans hort. Kew 3936 (K) Cyrtorchis arcuata (Lindl.) Schltr. B 300 I, M, T B. Bytebier, Africa Bytebier 676 (EA) C. chailluana (Hook.f.) Schltr. B 50 I, M, T SEL hort. (1996-0294) Carlsward 156 (SEL) C. praetermissa Summerh. B 271 I, M, T Countryside Orchids No voucher C. ringens (Rchb.f.) Summerh. B 98 I, M, T SEL hort. (1997-0154A) Carlsward 226 (FLAS) Nkongmeneck 1388 (SEL) Diaphananthe fragrantissima (Rchb.f.) Schltr. B 317 I, M, T B. Bytebier, Africa Kirika 536 (EA) D. lorifolia Summerh. B 301 I, M, T B. Bytebier, Africa Bytebier 346 (EA) D. millarii (Bolus) H.P.Linder B 270 I, M, T Countryside Orchids Carlsward 346 (FLAS) D. pellucida (Lindl.) Schltr. B 134 I, M, T ABG hort. Carlsward 241 (FLAS) galeandrae (Rchb.f.) Schltr. B 254 I, M, T Uzumara Orchids Carlsward 293 (FLAS) E. rothschildiana (O’Brien) Schltr. B 231 I, M, T Sunset Orchids Whitten (FLAS) Listrostachys pertusa (Lindl.) Rchb.f. B 241 I, M, T Uzumara Orchids No voucher, ver. La Croix Microcoelia bulbocalcarata L.Jonsson B 244 I, M, T Uzumara Orchids No voucher, ver. La Croix M. corallina Summerh. B 242 I, M, T Uzumara Orchids No voucher, ver. La Croix M. exilis Lindl. B 213 I, M, T Sunset Orchids Whitten M. exilis B 281 I B. Bytebier, Africa Bytebier 1255 (EA) M. gilpinae (Rchb.f. & S.Moore) Summerh. B 250 I, M, T Uzumara Orchids Carlsward 290 (FLAS) M. globulosa (Hochst.) L.Jonsson B 126 I, M, T Uzumara Orchids Carlsward 259 (FLAS) M. globulosa B 279 I B. Bytebier, Africa PCP 488 (EA) M. macrantha (H.Perrier) Summerh. B 326 I, M, T J. Hermans hort. Kew 5391 (K) M. megalorrhiza (Rchb.f.) Summerh. B 296 I, M, T B. Bytebier, Africa Bytebier 1250 (EA) M. obovata Summerh. B 289 I, M, T B. Bytebier, Africa Bytebier 1256 (EA) M. physophora (Rchb.f.) Summerh. B 299 I, M, T B. Bytebier, Africa Bytebier 629 (EA) M. smithii (Rolfe) Summerh. B 313 I, M, T B. Bytebier, Africa Bytebier 1248 (EA) M. stolzii (Schltr.) Summerh. B 243 I, M, T Uzumara Orchids Carlsward 287 (FLAS) Table 2-1. Continued Specimen Gene Taxona Sourced Vouchere (locationf) numberb regionc Microterangis hariotiana (Kraenzl.) Senghas B 43 I, M, T Andy’s Orchids Carlsward 227 (FLAS) M. hariotiana B 253 I Uzumara Orchids Carlsward 292 (FLAS) M. hildebrandtii (Rchb.f.) Senghas B 329 I, M, T J. Hermans hort. Kew 2616 (K) aliceae Bolus B 107 I, M, T Countryside Orchids Whitten 1787 (FLAS) M. braybonae Summerh. B 59 I, M, T Andy’s Orchids Carlsward 179 (FLAS) M. capense (L.f.) Schltr. B 108 I, M, T Countryside Orchids Whitten 1781 (FLAS) M. flanaganii (Bolus) Bolus B 338 I, M, T J. Hermans hort. Kew 5084 (K) Podangis dactyloceras (Rchb.f.) Schltr. B 330 I, M, T J. Hermans hort. Kew 4999 (K) amaniensis (Kraenzl.) Summerh. B 292 I, M, T B. Bytebier, Africa Bytebier & Kirika 26 (EA) R. muscicola (Rchb.f.) Summerh. B 44 I, M, T SEL hort. (1997-0177A) Carlsward 169 (SEL) R. muscicola B 256 I Countryside Orchids No voucher R. rhipsalisocia (Rchb.f.) Summerh. B 117 I, T SEL hort. (1997-0172D) Carlsward 235 (SEL) Rhipidoglossum kamerunense (Schltr.) Garay B 157 I, M, T SEL hort. (1997-0188A) Carlsward 248 (FLAS) Nkongmeneck 3030 (SEL) R. kamerunense B 237 I Uzumara Orchids No voucher, ver. La Croix R. rutilum (Rchb.f.) Schltr. B 245 I, M, T Uzumara Orchids Carlsward 288 (FLAS) R. subsimplex (Summerh.) Garay B 288 I, M, T B. Bytebier, Africa Bytebier 546 (EA) R. xanthopollinium (Rchb.f.) Schltr. B 238 I, M, T Uzumara Orchids Carlsward 384 (FLAS) Solenangis aphylla (Thouars) Summerh. B 1 I, M, T Andy’s Orchids Carlsward 341 (FLAS) S. aphylla B 323 I J. Hermans hort. Kew 2389 (K) S. clavata (Rolfe) Schltr. B 229 I, M, T Uzumara Orchids No voucher, ver. La Croix S. cornuta (Rchb.f.) Summerh. B 384 I, M, T Rick’s Tropica, Madagascar OICg 14302 (SEL) S. wakefieldii (Rolfe) P.J.Cribb & J.L.Stewart B 291 I, M, T B. Bytebier, Africa Bytebier 627 (EA) Sphyrarhynchus schliebenii Mansf. B 315 I, M, T B. Bytebier, Africa Bytebier 393 (EA) (Lindl.) Schltr. B 255 I Countryside Orchids No voucher T. bicaudata B 307 I, M, T B. Bytebier, Africa Bytebier 348 (EA) T. crassifolia Summerh. B 73 I, M, T SEL hort. (1997-0165A) Carlsward 174 (FLAS) Nkongmeneck 2076 (SEL) T. filifolia (Schltr.) Schltr. B 295 I, M, T B. Bytebier, Africa Bytebier 707 (EA) T. furcistipes Summerh. B 290 I, M, T B. Bytebier, Africa Bytebier 1731 (EA) T. scottellii (Rendle) Schltr. B 294 I, M, T B. Bytebier, Africa Bytebier 497 (EA) T. tanneri P.J.Cribb B 293 I, M, T B. Bytebier, Africa PCP 198 (EA) Ypsilopus longifolius (Kraenzl.) Summerh. B 282 I, M, T B. Bytebier, Africa Bytebier 609 (EA) Table 2-1. Continued Specimen Gene Taxona Sourced Vouchere (locationf) numberb regionc Ypsilopus viridiflorus P.J.Cribb & J.L.Stewart B 280 I, M B. Bytebier, Africa Bytebier 402 (EA) Tribe Vandeae Lindl., Subtribe Angraecinae Summerh. (Thouars) Lindl. B 13 I*, M, T Cal-Orchid Carlsward 198 (FLAS) Lindl. B 127 I*, M, T Cal-Orchid Carlsward 238 (FLAS) Angraecum calceolus Thouars B 24 M, T SEL hort. (1996-0480) No voucher A. chevalieri Summerh. B 19 I, M, T SEL hort. (1997-0160) Carlsward 208 (FLAS) A. conchiferum Lindl. B 305 I*, M, T B. Bytebier, Africa Bytebier 616 (EA) A. cultriforme Summerh. B 257 I, M, T Countryside Orchids Carlsward 298 (FLAS) A. distichum Lindl. B 4 I, M, T Cal-Orchid Carlsward 237 (FLAS) A. dives Rolfe B 314 I*, M, T B. Bytebier, Africa Marimoto 42 (EA) A. eburneum Bory B 221 I*, M, T FLMNH hort. Carlsward 335 (FLAS) A. eburneum B 91 I*, M, T FLMNH hort. Whitten (FLAS) A. eburnuem ssp. superbum (Thouars) H.Perrier B 28 M, T FLMNH hort. Carlsward 186 (FLAS) A. eburneum ssp. superbum B 228 I*, M, T W. L. Stern hort. Carlsward 282 (FLAS) A. eburneum ssp. superbum var. longicalcar B 263 I*, M, T Countryside Orchids No voucher Bosser A. eburneum ssp. xerophilum H.Perrier B 226 M, T W. L. Stern hort. Carlsward 275 (FLAS) A. eichlerianum Kraenzl. W 719 I, M, T FLMNH hort. Carlsward 284 (FLAS) A. elephantinum Schltr. B 41 I* Cal-Orchid Carlsward 187 (FLAS) A. elephantinum B 120 I*, M, T W. L. Stern hort. Carlsward 251 (FLAS) A. erectum Summerh. B 306 I, M, T B. Bytebier, Africa Bytebier 801 (EA) A. florulentum Rchb.f. B 266 I*, M, T Hoosier Orchid Co. No voucher A. germinyanum Hook.f. B 261 I*, M, T Santa Cruz Orchids No voucher A. leonis (Rchb.f) André B 38 I*, M, T Cal-Orchid Photo (FLAS) A. rutenbergianum Kraenzl. B 265 I*, M, T Santa Cruz Orchids Carlsward 300 (FLAS) A. teres Summerh. B 304 I*, M, T B. Bytebier, Africa Bytebier 675 (EA) Bonniera sp. B 2 I*, M, T Cal-Orchid Photo (FLAS) B. appendiculata (Frapp. ex Cordem.) Cordem. B 334 I*, M, T J. Hermans hort. Kew 4232 (K) christyanum (Rchb.f.) Summerh. B 22 I, M, T SEL hort. (1997-0239) Carlsward 194 (SEL) Campylocentrum brenesii Schltr. B 370 I M. Blanco, Costa Rica Blanco 2139 (USJ) C. fasciola (Lindl.) Cogn. B 37 I, M, T Hamlyn Orchids, Jamaica Carlsward 185 (FLAS) C. jamaicense (Rchb.f. & Wullschl.) Benth. ex W 712 I, M, T Jamaica Whitten 1934 (FLAS) Rolfe Table 2-1. Continued Specimen Gene Taxona Sourced Vouchere (locationf) numberb regionc Campylocentrum lansbergii (Rchb.f) Schltr. B 219 I, M, T Brazil Carlsward 272 (FLAS) C. micranthum (Lindl.) Rolfe B 60 I, M, T Cal-Orchid (Mexico) Carlsward 180 (FLAS) C. neglectum (Rchb.f. & Warm.) Cogn. B 144 I Herbarium specimen, Paraguay Zardini 14995 (MO) C. pachyrrhizum (Rchb.f.) Rolfe B 112 I, M, T J. Ackerman, Puerto Rico Ackerman s.n. (UPRRP) C. poeppigii (Rchb.f.) Rolfe B 15 I, M, T Mexico Carnevali 4507 (CICY, FLAS) C. robustum Cogn. B 149 I Herbarium specimen, Ecuador Hoeijer & Dalstroem 839 (MO) C. sullivanii Fawc. & Rendle B 276 I, M, T Hamlyn Orchids, Jamaica Carlsward 301 (FLAS) C. tyrridion Garay & Dunst. W 783 I, M, T Mexico Carnevali 5145 (CICY) C. ulei Cogn. B 151 I Herbarium specimen, Brazil Chagas & Silva 1333 (MO) elatus (Thouars) Lindl. B 236 I, M, T Uzumara Orchids No voucher, ver. La Croix C. paniculatus H.Perrier B 336 I, M, T J. Hermans hort. Kew 5392 (K) Dendrophylax alcoa Dod W 778 I Herbarium specimen, Ackerman 2773 (UPRRP) Dominican Republic D. barrettiae Fawc. & Rendle B 36 I, M, T Hamlyn Orchids, Jamaica Carlsward 199 (FLAS) D. fawcettii Rolfe W 715 I, M, T Grand Cayman Whitten 1939 (FLAS) D. filiformis (Sw.) Carlsward & Whitten W 917 I, M, T J. Ackerman, Puerto Rico Whitten 1842 (FLAS) D. funalis (Sw.) Benth. ex Rolfe B 233 I, M, T FLMNH hort., Jamaica Carlsward 302 (FLAS) D. lindenii (Lindl.) Benth. ex Rolfe W 716 I, M, T Hamlyn Orchids, Jamaica Photo (FLAS) D. porrectus (Rchb.f.) Carlsward & Whitten B 366 I, M, T Fish-eating Creek, Florida Carlsward 329 (FLAS) D. sallei (Rchb.f.) Benth. ex Rolfe B 360 I, M, T Dominican Republic Whitten 1945 (JBSD) D. varius (Gmel.) Urb. B 362 I, M, T Dominican Republic Whitten 1960 (JBSD) Jumellea confusa (Schltr.) Schltr. B 103 I*, M, T W. L. Stern hort. Carlsward 228 (FLAS) J. maxillarioides (Ridl.) Schltr. B 264 I*, M, T Hoosier Orchid Co. No voucher J. sagittata H.Perrier B 114 I*, M, T SEL hort. (1981-1182) Carlsward 232 (SEL) pallidiflora Bosser B 328 I, M, T J. Hermans hort. Kew 4958 (K) Lemurorchis madagascariensis Kraenzl. B 335 I*, M, T J. Hermans hort. Kew 5383 (K) Neobathiea grandidieriana (Rchb.f.) Garay B 240 I, M, T Uzumara Orchids Photo (FLAS), ver. La Croix rosea Ridl. B 102 I, M, T FLMNH hort. Whitten (FLAS) polystachys (Thouars) Schltr. B 66 I*, M, T Cal-Orchid Carlsward 221 (FLAS) humbertiana H.Perrier B 275 I*, M, T P. Simon hort. Carlsward 304 (FLAS) Table 2-1. Continued Specimen Gene Taxona Sourced Vouchere (locationf) numberb regionc Tribe Vandeae Lindl., Subtribe Aeridinae Pfitzer Acampe ochracea (Lindl.) Hochr. B 52 I, M, T SEL hort. (1983-0253) Carlsward 206 (SEL) Acampe papillosa (Lindl.) Lindl. B 25 I, M, T SEL hort. (1991-0066) Carlsward 191 (SEL) vesiculosa Carr B 130 I W. L. Stern hort. Carlsward 258 (FLAS) rosea Lodd. ex. Lindl. & Paxton B 123 I Unknown garden origin Carlsward 254 (FLAS) Amesiella philippinensis (Ames) Garay B 269 I, M, T Countryside Orchids Carlsward 295 (FLAS) Ascocentrum aurantiacum (J.J.Sm.) Schltr. B 86 I SEL hort. (1987-0134) Carlsward 217 (SEL) A. miniatum (Lindl.) Schltr. B 220 I SEL hort. (1985-0839) Carlsward 273 (SEL) Ascochilopsis myosurus (Ridl.) Carr B 135 I ABG hort. Carlsward 239 (FLAS) Ceratochilus biglandulosus Blume B 56 I Andy’s Orchids No voucher Chiloschista lunifera (Rchb.f.) J.J.Sm. B 343 I R. F. Orchids Carlsward 153, 305 (FLAS) C. lunifera B 17 I SEL hort. (s.n.) No voucher C. parishii Seidenf. B 94 I W. L. Stern hort. Carlsward 222 (FLAS) C. parishii B 119 I TropicOne Carlsward 250 (FLAS) C. parishii B 216 I Banjong Orchids Carlsward 267 (FLAS) C. pusilla (J.König) Schltr. B 278 I Camp-Lot-A-Noise Tropicals Carlsward 303 (FLAS) C. viridiflava Seidenf. B 350 I R. Ing hort. Carlsward 312 (FLAS) Christensonia vietnamica Haager B 320 I Mountain Orchids Carlsward 349 (FLAS) arietinum (Rchb.f.) Garay B 77 I SEL hort. (1995-0045) Carlsward 211 (SEL) C. chantaburiense Seidenf. B 18 I SEL hort. (1988-0303) Carlsward 155 (SEL) C. discolor Lindl. B 122 I W. L. Stern hort. Carlsward 253 (FLAS) C. racemiferum (Lindl.) Garay B 277 I SEL hort. (s.n.) Carlsward 299 (SEL) (Rchb.f.) Christenson B 121 I Gypsy Glen Orchids Carlsward 252 (FLAS) clarkei Rchb.f. B 23 I SEL hort. (1997-0233) Carlsward 189 (SEL) dasypogon (Sm.) Kuntze B 30 I R. F. Orchids Carlsward 183 (FLAS) Haraella odorata Kudô B 133 I ABG hort. Carlsward 240 (FLAS) trichorhiza (Hook.) Blume B 48 I SEL hort. (1986-0372) Carlsward 203 (SEL) ligulata (J.J.Sm.) J.J.Sm. B 128 I Andy’s Orchids Carlsward 246 (FLAS) pallida (Roxb.) Lindl. B 39 I Motes Orchids Carlsward 162 (FLAS) Microtatorchis sp. B 365 I J. Watts hort. Carlsward 387 (FLAS) Neofinetia falcata (Thunb.) Hu B 74 I, M, T SEL hort. (1993-0377) Carlsward 163 (SEL) teres (Roxb.) Schltr. B 371 I Motes Orchids Carlsward 332 (FLAS) Table 2-1. Continued Specimen Gene Taxona Sourced Vouchere (locationf) numberb regionc laycockii (M.R.Hend.) B 97 I SEL hort. (1993-0318) Carlsward 225 (SEL) A.D.Hawkes ctenoglossum Ridl. B 92 I Motes Orchids Carlsward 220 (FLAS) P. ctenoglossum B 138 I SEL hort. (871-1) Carlsward 244 (SEL) P. insectifera (Rchb.f.) Ridl. B 3 I SEL hort. (1986-0712) Carlsward 164 (SEL) (L.) Blume AY391535 I NCBIh KDAIS KC-329 P. amboinensis J.J.Sm. AF537006 I NCBI No voucher P. braceana (Hook.f.) Christenson AY228495 I NCBI No voucher P. chibae T.Yukawa AF536996 I NCBI No voucher P. cornu-cervi (Breda) Blume & Rchb.f. AF536994 I NCBI No voucher P. deliciosa Rchb.f. (syn. = Kingidium deliciosum) B 33 I, M, T SEL hort. (1997-0330) Carlsward 160 (SEL) P. deliciosa (syn. = Kingiella decumbens) B 225 I W. L. Stern hort. Carlsward 274 (FLAS) P. equestris (Schauer) Rchb.f. AF537012 I NCBI No voucher P. fuscata Rchb.f. AY228498 I NCBI No voucher P. hainanensis T.Tang & F.T.Wang B 101 I SBG hort. No voucher P. lobbii (Rchb.f.) H.R.Sweet B 214 I Andy’s Orchids Carlsward 261 (FLAS) P. lowii Rchb.f. AF537019 I NCBI No voucher P. parishii Rchb.f. AF537037 I NCBI No voucher P. pulcherrima (Lindl.) J.J.Sm. AF536993 I NCBI No voucher P. wilsonii Rolfe B 368 I Andy’s Orchids Carlsward 331 (FLAS) P. zebrina Teijsm. & Binn. AY390252 I NCBI KDAIS KC-231 spicata Breda B 82 I SEL hort. (1986-0172) Carlsward 214 (SEL) semiteretifolium H.A.Petersen B 129 I W. L. Stern hort. Carlsward 257 (FLAS) Rolfe B 344 I W. L. Stern hort. Carlsward 306 (FLAS) gigantea (Lindl.) Ridl. B 46 I SEL hort. (1981-1033) Carlsward 201 (SEL) cerina (Rchb.f.) Garay B 76 I SEL hort. (1990-0199) Carlsward 210 (SEL) R. spatulata (Blume) J.J.Sm. B 215 I W. L. Stern hort. Carlsward 262 (FLAS) F.Muell. B 106 I Andy’s Orchids Carlsward 231 (FLAS) comberi (J.J.Wood) J.J.Wood N 605 I Countryside Orchids Carlsward 296 (FLAS) crassifolium (Lindl. & Paxton) Garay B 118 I SEL hort. (1990-0552) Carlsward 236 (SEL) fragrans (C.S.P.Parish & Rchb.f.) B 57 I Andy’s Orchids Carlsward 249 (FLAS) Seidenf. & Smitinand S. juncifolia Reinw. ex Blume B 110 I Countryside Orchids Whitten 1783 (FLAS) Table 2-1. Continued Specimen Gene Taxona Sourced Vouchere (locationf) numberb regionc fasciatus (Rchb.f.) Ridl. B 95 I SEL hort. (1981-1550) Carlsward 223 (SEL) dalatensis (Guillaumin) Garay B 58 I Andy’s Orchids No voucher Taeniophyllum biocellatum J.J.Sm. B 352 I J. Watts hort. Carlsward 317 (FLAS) T. complanatum Fukuy B 383 I Rick’s Tropica, Thailand No voucher T. fasciola (G.Forst.) Seem. B 154 I Kores & Molvray, Fiji GOK 0652364 (?), VTM 7997130 (?) T. glandulosum Blume B 382 I Rick’s Tropica, Thailand No voucher T. smithii Kores & L.Jonsson B 155 I Kores & Molvray, Fiji VTM s.n. (?) elongatum Ames B 88 I SEL hort. (1985-1735) Carlsward 170 (SEL) Trichoglottis atropurpurea Rchb.f. B 6 I, M, T Motes Orchids Carlsward 173 (FLAS) T. geminata (Teijsm. & Binn.) J.J.Sm. B 31 I SEL hort. (1992-0404) Carlsward 197 (SEL) T. seidenfadenii Aver. B 83 I SEL hort. (1981-1413) Carlsward 172 (SEL) Trichoglottis tomentosa Seidenf. B 223 I W. L. Stern hort. Carlsward 270 (FLAS) brevirachis L.O.Williams & B 47 I SEL hort. (1987-0212) Carlsward 202 (SEL) J.J.Wood T. kotoense Yamam. B 51 I SEL hort. (1986-0724) Carlsward 205 (SEL) Vanda flabellata (Rolfe ex Downie) Christenson B 20 I, M, T SEL hort. (1996-0223) Carlsward 192 (SEL) V. luzonica Loher ex Rolfe B 139 I SEL hort. (1984-0565) Carlsward 245 (SEL) V. tessellata (Roxb.) Hook. ex G.Don. B 72 I SEL hort. (1985-0965) Carlsward 175 (SEL) lissochiloides (Gaudin) Pfitzer B 80 I SEL hort. (1983-0249) Carlsward 177 (SEL) Tribe Epidendreae Humb.Bonpl. & Kunth, Subtribe Polystachyinae Pfitzer gracilis Rolfe B 348 I, M, T Unknown garden origin Carlsward 311 (FLAS) (Jacq.) Garay & H.R.Sweet B 81 I, M, T SEL hort. (1996-0140) Carlsward 213 (SEL) P. longiscapa Summerh. B 65 I, M, T W. L. Stern hort. No voucher P. modesta Rchb.f. B 90 I, M, T SEL hort. (1994-0078) Carlsward 219 (SEL) Heaney 984 (FLAS) aTaxon names and authorities follow Kew’s Monocot Checklist (2003). Author abbreviations follow Brummitt and Powell (1992). bB numbers represent Barbara S. Carlsward’s DNA specimens, W numbers represent W. Mark Whitten’s DNA specimens, N numbers represent Norris H. Williams’ DNA specimens, and AY/AF numbers represent accession numbers from the National Center for Biotechnology Information database. cGene regions sequenced: I = ITS (sequences marked with asterisks were paralogous); M = matK; and T = trnL-F. dHort. specimens are cultivated plants from various individual and commercial orchid growers; FLMNH = Florida Museum of Natural History greenhouse collection; SEL = The Marie Selby Botanical Gardens (numbers represent their living plant accession numbers); ABG = Atlanta Botanical Garden; SBG = Singapore Botanic Gardens. e Specimens with “ver. La Croix” are those with no voucher or with only a photo voucher [denoted Photo (FLAS)] which have been identified by Isobyl La Croix; PCP = East African National Museum’s Plant Conservation Programme. fHerbarium abbreviations follow Holmgren et al. (1990). gOIC = Orchid Identification Center spirit collection at The Marie Selby Botanical Gardens. hNCBI = National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). 27

Table 2-2. Representative sampling of genera of Vandeae. Asterisks indicate when the type was sampled in my study. Genera sampled Spp. sampled / Type speciesb total spp.a Aerangidinae Aerangis 16 / 49 A. brachycarpa (A.Rich.) Durand&Schinz Ancistrorhynchus 4 / 17 *A. recurvus Angraecopsis 3 / 21 A. tenerrima Kraenzl. Beclardia 1 / 1 *B. macrostachya Bolusiella 3 / 6 *B. maudiae Chamaeangis 4 / 10 C. gracilis (Thouars) Schltr. Cribbia 2 / 4 *C. brachyceras Cyrtorchis 4 / 15 *C. arcuata Diaphananthe 4 / 24 *D. pellucida Eurychone 2 / 2 not designated Listrostachys 1 / 2 *L. pertusa Microcoelia 11 / 29 *M. exilis Microterangis 2 / 7 *M. hariotiana Mystacidium 4 / 10 *M. capense Podangis 1 / 1 *P. dactyloceras Rangaeris 3 / 7 *R. muscicola Rhipidoglossum 4 / 35 *R. xanthopollinium Solenangis 4 / 6 S. scandens (Schltr.) Schltr. Sphyrarhynchus 1 / 1 *S. schliebenii Tridactyle 6 / 43 *T. bicaudata Ypsilopus 2 / 5 *Y. longifolius Angraecinae Aeranthes 2 / 47 *A. grandiflora Angraecum 15 / 221 *A. eburneum Bonniera 2 / 2 not designated Calyptrochilum 1 / 2 C. emarginatum (Afzel. ex Sw.) Schltr. Campylocentrum 12 / 67 *C. micranthum Cryptopus 2 / 4 *C. elatus Dendrophylax 9 / 14 *D. varius Jumellea 3 / 58 J. recta (Thouars) Schltr. Lemurella 1 / 4 L. culicifera (Rchb.f.) H.Perrier Lemurorchis 1 / 1 *L. madagascariensis Neobathiea 1 / 5 N. perrieri (Schltr.) Schltr. Oeonia 1 / 5 O. volucris (Thouars) Spreng. Oeoniella 1 / 2 *O. polystachys Sobennikoffia 1 / 4 S. robusta (Schltr.) Schltr. Aeridinae Acampe 2 / 7 A. rigida (Buch.-Ham. ex Sm.) P.F.Hunt Adenoncos 1 / 16 A. virens Blume Aerides 1 / 25 A. odorata Lour. Amesiella 1 / 3 *A. philippinensis Ascocentrum 2 / 13 *A. miniatum Ascochilopsis 1 / 2 *A. myosurus Ceratochilus 1 / 1 *C. biglandulosus Chiloschista 4 / 20 C. usneoides (D.Don) Lindl. 28

Table 2-2. Continued Genera sampled Spp. sampled / Type speciesb total spp.a Christensonia 1 / 1 *C. vietnamica Cleisostoma 4 / 87 C. sagittatum Blume Dyakia 1 / 1 *D. hendersoniana Esmeralda 1 / 2 E. cathcartii (Lindl.) Rchb.f. Gastrochilus 1 / 55 G. calceolaris (Buch.-Ham. ex Sm.) D.Don Haraella 1 / 1 *H. odorata Luisia 1 / 39 L. tristis (G.Forst.) Hook.f. Malleola 1 / 29 M. sphingoides J.J.Sm. Micropera 1 / 18 *M. pallida Microtatorchis 1 / 50 M. perpusilla Schltr. Neofinetia 1 / 2 *N. falcata Papilionanthe 1 / 10 *P. teres Paraphalaenopsis 1 / 4 P. denevei (J.J.Sm.) A.D.Hawkes Pelatantheria 2 / 7 *P. ctenoglossum Phalaenopsis 15 / 62 *P. amabilis Pomatocalpa 1 / 32 *P. spicata Pteroceras 1 / 23 P. teres (Blume) Holttum Renanthera 1 / 18 R. coccinea Lour. Rhynchostylis 1 / 3 R. retusa (L.) Blume Robiquetia 2 / 39 R. ascendens Gaudich. Sarcochilus 1 / 25 S. falcatus R.Br. Sarcoglyphis 1 / 12 S. mirabilis (Rchb.f.) Garay Sarcophyton 1 / 3 S. crassifolium (Lindl.&Paxton) Garay Schoenorchis 2 / 26 *S. juncifolia Staurochilus 1 / 14 *S. fasciatus Stereochilus 1 / 7 S. hirtus Lindl. Taeniophyllum 5 / 185 T. obtusum Blume Thrixspermum 1 / 144 T. centipeda Lour. Trichoglottis 4 / 64 T. retusa Blume Tuberolabium 2 / 13 *T. kotoense Vanda 3 / 51 *V. tessellata Vandopsis 1 / 4 *V. lissochiloides aTotal species numbers are from Kew’s Monocot Checklist (2003). bType species are from Index Nominum Genericorum.

Extraction

DNA from fresh, silica gel dried, and herbarium dried material was extracted using a modified cetyl trimethylammonium bromide (CTAB) technique from Doyle and Doyle (1987), scaled down to a 1mL volume. Approximately 100 mg of fresh tissue or 10 mg of dried tissue were thoroughly ground using a mortar and pestle with 1.25 mL of CTAB 2X buffer and 8 µL of mercaptoethanol. The homogenized 29 mixture was then transferred to a 1.5 mL Eppendorf tube and incubated at 65oC for 20-60 minutes, vortexing every 5 minutes during incubation. Material from herbarium specimens usually yielded degraded DNA more susceptible to secondary compounds and therefore required a longer incubation period of 2-3 hours.

After incubation, a 500 µL mixture of chloroform and isoamyl alcohol (24:1) was added to the CTAB/DNA mixture and then vortexed for several seconds.

This milky chloroform solution was subsequently centrifuged at 10,000 rpm for 5 minutes. From the top aqueous layer, 750 µL were removed and placed into a clean Eppendorf tube. To this aqueous solution, 30 µL of 3 M sodium acetate and 510 µL of 100% isopropyl alcohol were added. The solution was then mixed by hand and placed in a –20oC freezer overnight to allow the DNA to precipitate out of solution.

After freezing, the solution was centrifuged for 20 minutes at 13,000 rpm to obtain a DNA pellet. The alcohol/sodium acetate solution was then carefully poured off (so as not to dislodge the pellet), and the pellet was washed with 1 mL of 70% ethyl alcohol several times. After cleaning the pellet, the tube was dried in a heated vacuum centrifuge at 60oC for approximately 15 minutes. The dried pellet was resuspended in 75 µL of Tris-EDTA buffer (TE, pH 8.0) by incubating at 65oC for 15 minutes and shaking occasionally. DNA extracted from herbarium specimens was subsequently cleaned using Qiagen QIAquick PCR purification columns to remove any inhibitory secondary compounds and resuspended in 60

µL of 10 mM Tris-Cl buffer (EB, pH 8.5). All DNA solutions were stored at –20oC. 30

Amplification

For DNA extracted from fresh or silica dried specimens, the entire ITS region was amplified using primers of Sun et al. (1994) designed for Sorghum

(17SE and 26SE, Table 2-3). Polymerase chain reactions (PCRs) were carried out in 50 µL volumes (Table 2-4) using an initial denaturation of 98oC for 6 minutes. The samples were then cooled to and held at 80oC while 0.2 µL of Taq polymerase was added to each tube. After adding Taq polymerase, 35 cycles of denaturation, primer annealing, and elongation (Table 2-5) were completed.

Table 2-3. Primer sequences for polymerase chain reaction amplification. Primer Primer sequence ITS 1 + 5.8S + ITS 2 17SE, forward ACGAATTCATGGTCCGGTGAAGTGTTCG 26SE, reverse TAGATTTCCCCGGTTCGCTCGCCGTTAC ITS 1 and ITS 2 ITS-A, forward GGAAGGAGAAGTCGTAACAAGG ITS-C, reverse GCAATTCACACCAAGTATCGC ITS-D, forward CTCTCGGCAACGGATATCTCG ITS-B, reverse CTTTTCCTCCGCTTATTGATATG matK 56F, forward ACTTCCTCTATCCGCTACTCCTT 1520R, reverse CGGATAATGTCCAAATACCAAATA trnL-F C, forward CGAAATCGGTAGACGCTACG F, reverse ATTTGAACTGGTGACACGAG

Table 2-4. Components of polymerase chain reactions. PCR components (µL) ITS ITS 1, 2 trnL-F matK H2O 22 31 32 35 Betaine (5 M) 13.4 0 0 0 10X Sigma buffer 4.5 5 5 5 MgCl2 (25 mM) 6.2 6 9 6 Forward primer (10 pmol/µL) 1.0 1.0 1.0 1.0 Reverse primer (10 pmol/µL) 1.0 1.0 1.0 1.0 dNTPs (10 mM) 1.0 1.0 1.0 1.0 Taq polymerase 0.2 0.2 0.2 0.2 DNA template 1.0 5 1.0 1.0 31

Table 2-5. Thermocycler program for polymerase chain reactions. Step # Temperature (oC) Time Notes ITS 1 + 5.8S + ITS 2 1 98 6 minutes 2 80 pause Add Taq 3 95 45 seconds 4 57 30 seconds 5 72 1 minute Cycle to step 2, 35 times 6 72 4 minutes ITS 1 and ITS 2 1 80 pause Add Taq polymerase 2 94 2 minutes 3 94 20 seconds 4 55 30 seconds 5 72 30 seconds Cycle to step 3, 43 times 6 72 7 minutes matK 1 80 pause Add Taq polymerase 2 94 3 minutes 3 94 45 seconds 4 55 45 seconds 5 72 2 minutes Cycle to step 3, 33 times 6 72 3 minutes trnL-F 1 80 pause Add Taq polymerase 2 94 3 minutes 3 94 1 minute 4 58 1 minute 5 72 80 seconds Cycle to step 3, 33 times 6 72 6 minutes

For degraded DNA extracted from herbarium specimens, ITS 1 and ITS 2 were amplified separately using primers of Blattner (1999) designed for general angiosperms (ITS 1: ITS-A + ITS-C and ITS 2: ITS-D + ITS-B, Table 2-3).

Polymerase chain reactions were carried out in a 50 µL volume (Table 2-4) using a hot start of 80oC and an initial denaturation of 94oC for 2 minutes (Table 2-5).

For DNA extracted from fresh or silica dried plant material, the chloroplast- encoded matK and trnL-F regions were also amplified using a hot start of 80oC and an initial denaturation at 94oC for 3 minutes (Table 2-5). Primers used to 32 amplify a portion of the matK region (Table 2-3) were designed for the orchid tribe Maxillarieae by Whitten et al. (2000), and primers for the trnL-F region (trnL intron + trnL 3’ exon + intergenic spacer separating trnL from trnF, Table 2-3) were designed by Taberlet et al. (1991).

Sequencing

PCR products were cleaned using Qiagen QIAquick PCR purification columns, eluted with 50 µL of 10 mM Tris-Cl buffer (EB, pH 8.5), and stored at

–20oC. Purified PCR products were then cycle sequenced (Table 2-6) using a mix of fluorescent Big Dye dideoxy terminators and a single primer, all scaled down to a 5 µL reaction (Table 2-7). For each gene region, both primers (forward and reverse) were sequenced to ensure data reliability. Resulting cycle sequencing products were placed into a clean Eppendorf tube along with 0.52 µL

3.0 M sodium acetate and 12.48 µL 95% ethyl alcohol. This solution was vortexed briefly and centrifuged at 13,000 rpm for 20 minutes. The supernatant was carefully poured off, and the DNA pellet was cleaned with 500 µL of 70% ethyl alcohol twice. The pellets were then dried in a heated vacuum centrifuge at

60oC for approximately 15 minutes, or until the tube was dry.

Table 2-6. Thermocycler program for cycle sequencing. Step # Temperature Time Notes (oC) 1 96 10 seconds 2 50 5 seconds 3 60 4 minutes Cycle to step 1, 25 times

Table 2-7. Components of cycle sequencing reactions. Components µL Primer (10 pmol/µL) 0.25 Big Dye terminator mix 2.0 DNA template 3.0 33

Cleaned cycle sequence products were directly sequenced on a polyacrylamide gel in a Perkin Elmer Applied Biosystems, Inc. (ABI) 373A or 377 automated sequencer at the Interdisciplinary Center for Biotechnology Research core sequencing facility at the University of Florida. Sequence data were edited using the ABI program Sequence Navigator™. Sequences from forward and reverse primers were assembled and compared using the ABI program

Autoassembler™. A consensus file of data from both primers was built and used as the alignable sequence data in phylogenetic analyses. When stuttering occurred, a sequence patch was made from closely related taxa and assembled with both primers. Missing sequence data, replaced by the patch, were then coded as “N” in the target sequence.

Data Analysis

Sequence data from the assembled forward and reverse primers were incorporated into a matrix using the phylogenetic program Paup*4.0b10

(Swofford, 1999). Data for each gene region were aligned manually within Paup and Se-Al v2.0a11 (Rambout, 1996). All characters were weighted equally, and indels were coded as missing data. No sequence data were excluded from ITS and matK gene regions. However, due to difficulties with alignment and multiple repeat regions within the trnL-F matrix, the analyses excluded 356 bp from the central region (preceding the trnL exon).

The ITS region is a multiple copy gene region, which normally undergoes concerted evolution that would produce orthologous copies of ITS1 and ITS2.

These orthologous copies can provide useful information in examining phylogenetic relationships among taxa. However, if the evolution of these ITS 34 regions is not concerted, it can result in paralogous copies in addition to the orthologous ones. When used within phylogenetic analyses of orthologous sequences, these paralogous sequences can lead to erroneous conclusions about phylogenetic relationships among taxa (Alvarez & Wendel, 2003). Within

Vandeae, paralogy was simple to detect during the alignment process due to a large deletion (approximately 40 bp long) at the beginning of the ITS2 region.

This was consistently found in most genera of Angraecinae, but has also been detected in Aeridinae by other workers (J. Schulman and A. Kocyan, personal communication). PCR products of Angraecum calceolus were initially cloned to separate orthologous and paralogous gene regions, but only one copy

(presumably the paralogous one) was ever detected. Taxa with putatively paralogous sequences were therefore excluded from all analyses and are indicated with an asterisk in the gene region column of Table 2-1.

The ITS region was sequenced for all three traditional subtribes of

Vandeae. Multiple individuals were sequenced for several species, as material was available. This large ITS matrix was used to examine relationships among all Vandeae. To more closely examine relationships among the African and

Malagasy subtribes of Vandeae, additional sequence data were collected from the chloroplast gene regions trnL-F and matK. Therefore, two sets of analyses were performed: 1) ITS analyses of all Vandeae using Polystachyinae as outgroups and 2) three gene analyses (ITS, matK, and trnL-F) of Angraecinae and Aerangidinae using seven Aeridinae and four Polystachyinae as outgroups. 35

Maximum parsimony analyses were run using a heuristic search strategy of branch-swapping by subtree pruning and regrafting (SPR) step-wise addition with

1000 random-addition replicates holding 10 trees at each step, saving multiple trees (MULTREES on). Due to limited computational resources (400Mhz G3 processor), the maximum number of trees saved for all analyses was limited to

20,000. The resulting shortest trees from this initial analysis were then swapped to completion. Levels of support were estimated with 1000 bootstrap replicates

(BS), using the SPR algorithm of branch swapping for 10 random-addition replicates per bootstrap replicate.

Parsimony analyses were run separately for each gene region (ITS, matK, and trnL-F). Bootstrap trees generated from each gene region were then manually compared for congruency, as described by Whitten et al. (2000).

Where there were no conflicting, well-supported clades (BS greater than 74%) between gene regions, data were combined. Data congruency was also tested using the partition homogeneity test (HTF) in Paup*4.0b10 (Swofford, 1999) as described by Johnson and Soltis (1998). Heuristic searches for the HTF tests were performed using 100 replicates and an SPR algorithm. Five random addition replicates were performed per HTF replicate. Probability values greater than 0.5 were used to identify data sets that were not significantly different from one another and could therefore be combined. Combined analyses were performed with the same heuristic search strategies as described for separate gene region analyses. 36

Results

In all analyses, Vandeae formed a strongly supported clade (greater than

90% BS) with members of Polystachyinae as outgroups Within Vandeae,

Aeridinae also formed a well-supported clade with greater than 90% bootstrap support in all analyses.

ITS Analyses of Vandeae

The large ITS matrix of all Vandeae included 207 individuals representing

189 species plus four outgroup species of Polystachyinae. Of the 777 aligned sequence positions, 394 were parsimony informative. Heuristic analysis produced 20,000+ trees (Figs. 2-1 and 2-2) of length (L) 3205, consistency index

(CI1) of 0.29, consistency index excluding uninformative characters (CI2) of 0.26, retention index (RI) of 0.76, and rescaled consistency index (RC) of 0.22. Eighty- two clades were supported with greater than 85% BS (Figs. 2-3 and 2-4).

Within Vandeae, Aeridinae were supported with 98% BS while Angraecinae

+ Aerangidinae formed a well-supported (92% BS) angraecoid clade (Fig. 2-3).

The angraecoid clade is almost completely unresolved along its backbone, but there are several supported groups within this polytomy (Fig. 2-4).

New World Angraecinae formed a clade including several species of African

Angraecum (96% BS), which was sister to A. eichlerianum (53% BS).

Dendrophylax and Campylocentrum were both supported as monophyletic genera with low to moderate bootstrap percentages (53 and 74, respectively).

Relationships within these genera supported results found by Carlsward et al.

(2003). Figure 2-1. One of 20,000+ most parsimonious trees for Vandeae using ITS. a) Traditional Aerangidinae taxa excluding Calyptrochilum christyanum, which is part of Angraecinae and indicated by a star symbol. b) New World Angraecinae sister to several Old World Angraecum species. c) Remaining Old World taxa of Angraecinae excluding Beclardia macrostachya, which is part of Aerangidinae and indicated by a star symbol. Arrowheads indicate collapsed branches in the strict consensus. 38

Neobenthamia gracilis Polystachya longiscapa Polystachya concreta Polystachya modesta clade b Angraecopsis amaniensis Angraecopsis breviloba Sphyrarhynchus schliebenii Mystacidium aliceae Mystacidium braybonae Mystacidium capense Mystacidium flanaganii Angraecopsis parviflora B251 Angraecopsis parviflora B339 Diaphananthe millarii Cribbia brachyceras Cribbia confusa Campylocentrum brenesii Rhipidoglossum kamerunense B157 Campylocentrum fasciola Rhipidoglossum kamerunense B237 Campylocentrum sullivanii Rhipidoglossum rutilum Campylocentrum tyrridion Rhipidoglossum xanthopollinium Campylocentrum pachyrrhizum Rhipidoglossum subsimplex Campylocentrum poeppigii clade c Campylocentrum micranthum Cyrtorchis arcuata Campylocentrum robustum Cyrtorchis chailluana Campylocentrum ulei Cyrtorchis ringens Campylocentrum neglectum Cyrtorchis praetermissa Campylocentrum jamaicense Listrostachys pertusa Campylocentrum lansbergii Tridactyle bicaudata B307 Dendrophylax alcoa Tridactyle bicaudata B255 Dendrophylax sallei Tridactyle filifolia Tridactyle crassifolia Dendrophylax varius Tridactyle scottellii Dendrophylax fawcettii Tridactyle furcistipes Dendrophylax funalis Ypsilopus longifolius Dendrophylax porrectus Rangaeris amaniensis Dendrophylax filiformis Tridactyle tanneri Dendrophylax barrettiae Ypsilopus viridiflorus Angraecum chevalieri Podangis dactyloceras Angraecum erectum Rangaeris rhipsalisocia Angraecum cultriforme Rangaeris muscicola B44 Angraecum eichlerianum Rangaeris muscicola B256 Chamaeangis ichneumonea Chamaeangis odoratissima b Diaphananthe fragrantissima Diaphananthe lorifolia Diaphananthe pellucida Chamaeangis sarcophylla Chamaeangis vesicata B311 Chamaeangis vesicata B340 Eurychone galeandrae Aerangis biloba Aerangis confusa Aerangis ugandensis Aerangis kirkii Aerangis kotschyana Aerangis thomsonii Aerangis macrocentra var. grandiflora Cryptopus elatus Aerangis punctata Oeonia rosea B102 Microterangis hariotiana B43 Oeonia rosea B321 Microterangis hariotiana B253 Cryptopus paniculatus Microterangis hildebrandtii Neobathiea grandidieriana B240 Aerangis coriacea B318 Neobathiea grandidieriana B322 Aerangis coriacea B272 Lemurella pallidiflora var. rhodosticta Beclardia macrostachya B249 Aerangis somalensis Beclardia macrostachya B325 Aerangis verdickii Ancistrorhynchus capitatus Ancistrorhynchus metteniae c Ancistrorhycnhus straussii Ancistrorhynchus recurvus Bolusiella batesii Bolusiella maudiae Bolusiella iridifolia Microcoelia bulbocalcarata Microcoelia megalorrhiza Microcoelia gilpinae Microcoelia macrantha Solenangis aphylla B1 Solenangis aphylla B323 Microcoelia corallina Microcoelia obovata Microcoelia globulosa B126 Microcoelia globulosa B279 5 changes Microcoelia stolzii B213 Microcoelia exilis B281 Microcoelia smithii Microcoelia physophora Solenangis cornuta Solenangis clavata Solenangis wakefieldii Calyptrochilum christyanum a Aeridinae 39

Neobenthamia gracilis Polystachya longiscapa Polystachya concreta Polystachya modesta Angraecinae + Aerangidinae Acampe ochracea Acampe papillosa Staurochilus fasciatus Gastrochilus dasypogon Haraella odorata Vanda flabellata Christensonia vietnamica Ascocentrum aurantiacum Neofinetia falcata Luisia trichorhiza Paraphalaenopsis laycockii Thrixspermum elongatum Ceratochilus biglandulosus Trichoglottis atropurpurea Trichoglottis seidenfadenii Trichoglottis tomentosa Trichoglottis geminata Esmeralda clarkei Renanthera imschootiana Adenoncos vesiculosa Pelatantheria ctenoglossum B92 Pelatantheria ctenoglossum B138 Pelatantheria insectifera Cleisostoma racemiferum Cleisostoma arietinum Cleisostoma chantaburiense Sarcophyton crassifolium Cleisostoma discolor Sarcoglyphis comberi Stereochilus dalatensis Malleola ligulata Robiquetia cerina Robiquetia spatulata Micropera pallida Schoenorchis juncifolia Schoenorchis fragrans Pomatocalpa spicata Amesiella philippinensis Tuberolabium kotoense Dyakia hendersoniana Tuberolabium brevirachis Chiloschista lunifera B343 Chiloschista lunifera B17 Chiloschista pusilla Chiloschista viridiflava Chiloschista parishii B94 Chiloschista parishii B119 Chiloschista parishii B216 Microtatorchis sp. Taeniophyllum glandulosum Taeniophyllum complanatum Taeniophyllum smithii Taeniophyllum fasciola Taeniophyllum biocellatum Sarcochilus fitzgeraldii (= Kingidium deliciosum) B33 Phalaenopsis deliciosa (= Kingiella decumbens) B225 Phalaenopsis hainanensis Phalaenopsis lowii Phalaenopsis wilsonii Phalaenopsis braceana Phalaenopsis chibae Phalaenopsis amabilis Phalaenopsis zebrina Phalaenopsis cornucervi Ascochilopsis myosurus 5 changes Pteroceras semiteretifolium Figure 2-2. Aeridinae clade from one of 20,000+ most parsimonious trees. Arrowheads indicate collapsed branches in the strict consensus. 40

98 Neobenthamia gracilis Polystachya longiscapa 98 Polystachya concreta Outgroup Polystachya modesta Campylocentrum brenesii 100 Beclardia macrostachya B249 100 Campylocentrum fasciola Beclardia macrostachya B325 Campylocentrum sullivanii 63 Aerangis biloba 60 Campylocentrum tyrridion Aerangis confusa 94 Campylocentrum pachyrrhizum 99 86 Aerangis ugandensis 100 Campylocentrum micranthum Aerangis kirkii 97 74 Campylocentrum robustum Aerangis kotschyana Campylocentrum ulei Aerangis thomsonii Campylocentrum poeppigii 89 Aerangis citrata 100 Campylocentrum neglectum Aerangis macrocentra 93 Campylocentrum jamaicense 98 Aerangis ellisii var. grandiflora Campylocentrum lansbergii 57 92 Aerangis fastuosa Dendrophylax alcoa 63 79 Aerangis modesta 54 Dendrophylax sallei 53 Aerangis punctata 96 99 Dendrophylax lindenii Microterangis hariotiana B43 Dendrophylax varius 100 66 54 Microterangis hariotiana B253 100 Dendrophylax fawcettii Microterangis hildebrandtii Dendrophylax funalis 82 53 100 Aerangis coriacea B318 Dendrophylax porrectus 59 Aerangis coriacea B272 53 94 Dendrophylax filiformis 79 Aerangis luteoalba var. rhodosticta Dendrophylax barrettiae 85 Aerangis somalensis 95 Angraecum chevalieri Aerangis verdickii 100 Angraecum erectum 95 Eurychone galeandrae Angraecum cultriforme Eurychone rothschildiana Angraecum eichlerianum 66 Ancistrorhynchus capitatus Angraecum distichum 93 Ancistrorhynchus metteniae Calyptrochilum christyanum 92 Ancistrorhycnhus straussii Cryptopus elatus Ancistrorhynchus recurvus 74 Cryptopus paniculatus 54 Bolusiella batesii 93 100 Oeonia rosea B102 100 Bolusiella maudiae Oeonia rosea B321 Bolusiella iridifolia 99 Neobathiea grandidieriana B240 Microcoelia bulbocalcarata 58 100 Neobathiea grandidieriana B322 51 Microcoelia gilpinae Lemurella pallidiflora Microcoelia megalorrhiza Microcoelia macrantha 100 Solenangis aphylla B1 Solenangis aphylla B323 Solenangis cornuta 100 79 Microcoelia corallina 96 Microcoelia obovata 63 Microcoelia globulosa B126 100 Microcoelia globulosa B279 95 Microcoelia stolzii 100 Microcoelia exilis B213 96 67 Microcoelia exilis B281 Microcoelia smithii Microcoelia physophora 99 Angraecopsis amaniensis 73 Angraecopsis breviloba 64 Sphyrarhynchus schliebenii Mystacidium aliceae 92 93 Mystacidium braybonae 73 Mystacidium capense Mystacidium flanaganii 100 Angraecopsis parviflora B251 Angraecopsis parviflora B339 100 Cribbia brachyceras 68 51 Cribbia confusa 98 Rhipidoglossum kamerunense B157 Rhipidoglossum kamerunense B237 Diaphananthe millarii 87 Rhipidoglossum rutilum Rhipidoglossum xanthopollinium Rhipidoglossum subsimplex 64 Chamaeangis ichneumonea 77 Chamaeangis odoratissima 99 Diaphananthe fragrantissima 97 Diaphananthe lorifolia Diaphananthe pellucida 99 Chamaeangis sarcophylla 97 Chamaeangis vesicata B311 100 Chamaeangis vesicata B340 Cyrtorchis arcuata 100 Cyrtorchis chailluana Cyrtorchis ringens Cyrtorchis praetermissa 51 95 Podangis dactyloceras Rangaeris rhipsalisocia 100 Rangaeris muscicola B44 Rangaeris muscicola B256 Listrostachys pertusa 98 Rangaeris amaniensis Aeridinae 100 Tridactyle bicaudata B307 Tridactyle bicaudata B255 Tridactyle crassifolia Tridactyle filifolia Tridactyle scottellii 100 Tridactyle furcistipes Ypsilopus longifolius 98 Tridactyle tanneri a b Ypsilopus viridiflorus 98 Solenangis clavata Solenangis wakefieldii Figure 2-3. Bootstrap consensus tree for large ITS data set of Vandeae. a) Traditional Angraecinae taxa and outgroup Polystachyinae. b) Traditional Aerangidinae taxa. Bootstrap percentages above branches are based on 1000 replicates. 41

98 Neobenthamia gracilis Polystachya longiscapa 98 Polystachya concreta Outgroup Polystachya modesta 92 Angraecinae + Aerangdinae 97 Acampe ochracea Acampe papillosa 79 Vanda flabellata 60 Christensonia vietnamica 90 Ascocentrum aurantiacum 100 Ascocentrum miniatum 55 Vanda tessellata Vanda luzonica 99 Neofinetia falcata 96 Luisia trichorhiza Papilionanthe teres Paraphalaenopsis laycockii 97 Amesiella philippinensis 99 Tuberolabium kotoense Dyakia hendersoniana Tuberolabium brevirachis 99 Phalaenopsis deliciosa B33 Phalaenopsis deliciosa B225 62 100 Phalaenopsis hainanensis 70 Phalaenopsis lowii 70 Phalaenopsis wilsonii 100 88 Phalaenopsis braceana 100 Phalaenopsis lobbii Phalaenopsis parishii Phalaenopsis chibae Phalaenopsis pulcherrima 93 76 Phalaenopsis amabilis 80 Phalaenopsis equestris 82 Phalaenopsis amboinensis 76 Phalaenopsis zebrina Phalaenopsis cornucervi Phalaenopsis fuscata Adenoncos vesiculosa Aerides rosea 98 Ascochilopsis myosurus Pteroceras semiteretifolium Ceratochilus biglandulosus 76 100 Trichoglottis atropurpurea 93 95 Trichoglottis seidenfadenii 98 Trichoglottis tomentosa Trichoglottis geminata 97 Pelatantheria ctenoglossum B92 89 Pelatantheria ctenoglossum B138 77 Pelatantheria insectifera 100 Cleisostoma racemiferum Cleisostoma arietinum Cleisostoma chantaburiense 79 Cleisostoma discolor 83 Sarcoglyphis comberi 69 Stereochilus dalatensis 86 Malleola ligulata Robiquetia cerina Micropera pallida Robiquetia spatulata Sarcophyton crassifolium 76 Schoenorchis juncifolia Schoenorchis fragrans Chiloschista lunifera B343 100 Chiloschista lunifera B17 Chiloschista parishii B94 84 63 Chiloschista parishii B119 Chiloschista parishii B216 Chiloschista pusilla Chiloschista viridiflava Esmeralda clarkei Gastrochilus dasypogon Haraella odorata 98 Microtatorchis sp. 61 Taeniophyllum glandulosum 87 Taeniophyllum complanatum 55 Taeniophyllum smithii 99 Taeniophyllum fasciola Taeniophyllum biocellatum Pomatocalpa spicata Renanthera imschootiana Rhynchostylis gigantea Sarcochilus fitzgeraldii Staurochilus fasciatus Thrixspermum elongatum Vandopsis lissochiloides Figure 2-4. Aeridinae clade from bootstrap consensus tree of Vandeae using ITS sequence data. Bootstrap percentages above branches are based on 1000 replicates. 42

The only other nonparalogous Angraecum species not sister to the New

World Angraecinae (A. distichum) formed a polytomy with the remaining angraecoids. Other unresolved species in this large angraecoid polytomy were

Calyptrochilum christyanum, Lemurella pallidiflora, Beclardia macrostachya,

Listrostachys pertusa, Rangaeris amaniensis, Tridactyle bicaudata, T. crassifolia,

T. filifolia, and T. scottellii.

Cryptopus elatus, C. paniculatus, and Oeonia rosea formed a clade (74%

BS) sister to Neobathiea grandidieriana (93% BS). This clade formed a major portion of the traditional Angraecinae from Madagascar.

The remaining supported clades were of traditional Aerangidinae. With the inclusion of Microterangis, Aerangis formed a strongly supported clade (98% BS) sister to a monophyletic Eurychone (95% BS). Ancistrorhynchus (92% BS),

Bolusiella (100% BS), and Microcoelia (100% BS, including Solenangis aphylla and S. cornuta) were monophyletic genera forming a weakly supported clade

(58% BS). Within Microcoelia, Solenangis aphylla, S. cornuta, and M. macrantha were the only unresolved species.

Angraecopsis and the monospecific Sphyrarhynchus formed a clade (99%

BS), which was sister to a well supported (93% BS) clade of Mystacidium species. Angraecopsis parviflora was moderately supported (73% BS) as sister to the Ancistrorhynchus/Mystacidium clade (64% BS). Both species of Cribbia formed a strongly supported clade (100% BS) sister to Rhipidoglossum kamerunense (51% BS). Rhipidoglossum rutilum + R. xanthopollinium (87% BS) 43 plus R. subsimplex and Diaphananthe millarii formed a weakly supported clade

(68% BS) with the Angraecopsis/Mystacidium clade.

Chamaeangis forms a strongly supported (97% BS) clade with the inclusion of Diaphananthe lorifolia, D. fragrantissima, and D. pellucida.

The four species of Cyrtorchis formed a well supported monophyletic group

(100% BS) with no internal resolution. Cyrtorchis, Podangis dactyloceras,

Rangaeris muscicola, and R. rhipsalisocia formed a weakly supported clade

(51% BS).

Both leafy species of Solenangis sampled formed a clade (98% BS) completely unrelated to the leafless species of Solenangis. Ypsilopus longifolius was sister to Tridactyle tanneri (98% BS) while Ypsilopus viridiflorus was sister to

Tridactyle furcistipes (100% BS). The remaining Tridactyle species were part of the large angraecoid polytomy.

The backbone of Aeridinae was also a large polytomy with several internally resolved clades. In this large polytomy were 12 unresolved taxa and two small clades (composed of two taxa): Acampe ochracea + A. papillosa (97% BS) and

Ascochilopsis myosurus + Pteroceras semiteretifolium (98% BS).

Of the larger clades, Vanda flabellata + Christensonia vietnamica formed a moderately supported group (79% BS) sister to two species of Ascocentrum

(60% BS). This Vanda flabellata/Ascocentrum clade, along with Vanda tessellata and V. luzonica, formed a well-supported clade (100% BS). Neofinetia falcata was sister to this entire Vanda clade with very weak support (55% BS). Luisia 44 trichorhiza + Papilionanthe teres (96% BS) formed a polytomy with

Paraphalaenopsis laycockii and the large Vanda/Neofinetia clade (99% BS).

Amesiella philippinensis was sister to Tuberolabium kotoense (97% BS) and this small group formed an unresolved clade with Dyakia hendersoniana and

Tuberolabium brevirachis (99% BS).

Phalaenopsis was a monophyletic genus with strong support (93% BS) and two primary clades: P. deliciosa/P. pulcherrima (88% BS) and P. amabilis/P. cornucervi (80% BS). Phalaenopsis fuscata formed a polytomy with these two large clades. The genus Trichoglottis was monophyletic (93% BS) and sister to

Ceratochilus biglandulosus (76% BS).

Pelatantheria was monophyletic (89% BS) and sister to Cleisostoma racemiferum + C. arietinum (77% BS). This clade, along with Sarcoglyphis,

Stereochilus, Malleola, Robiquetia, Micropera, Sarcophyton, Schoenorchis, and the remaining species of Cleisostoma, formed a large weakly supported clade

(69% BS). Cleisostoma discolor was sister to Sarcoglyphis comberi (79% BS), and this group formed a clade with Stereochilus dalatensis (83% BS). Malleola ligulata was sister to Robiquetia cerina (86% BS), and the only two species of

Schoenorchis sampled formed a moderately supported genus (76% BS).

Chiloschista was monophyletic (100% BS) with very little resolution and very short branch lengths among species. Microtatorchis and Taeniophyllum, the other two leafless genera of Aeridinae, formed a weakly supported clade (55%

BS). Microtatorchis sp. was sister to Taeniophyllum glandulosum + T. complanatum (98% BS). Taeniophyllum smithii was sister to the 45

Microtatorchis/Taeniophyllum complanatum clade (87% BS). The

Microtatorchis/Taeniophyllum smithii clade was sister to Taeniophyllum fasciola +

T. biocellatum clade (99% BS).

ITS and Chloroplast Analyses of Angraecinae and Aerangidinae

All cladistic analyses used four species of Polystachyinae for outgroup comparison. Ingroup taxon sampling focused on the African and Malagasy subtribes (Angraecinae and Aerangidinae), and sampling of Aeridinae was limited to seven species. Statistical comparisons of analyses for each gene region as well as combined gene regions are included in Table 2-8.

Table 2-8. Comparison of tree statistics for each gene region and combinations of these gene regions for maximum parsimony analyses. Combined chloroplast = matK + trnL-F and combined three gene = ITS + matK + trnL-F. Tree statistics ITS matK trnL-F Combined Combined chloroplast three gene L 1767 1235 1918 3173 5013 Informative characters 320 314 435 749 1069 Trees saved 126 20000+ 20000+ 20000+ 2688 CI1 0.38 0.54 0.55 0.54 0.48 CI2 0.34 0.44 0.43 0.43 0.39 RI 0.71 0.75 0.72 0.73 0.72 RC 0.27 0.40 0.40 0.40 0.34 Clades with >85% BS 46 37 42 71 77

ITS matrix

The ITS matrix included 116 species plus four outgroup taxa. Most

Angraecinae (Aeranthes, Jumellea, Sobennikoffia, Lemurorchis, Oeoniella,

Bonniera, and many species of Angraecum) possessed paralogous ITS sequences and were therefore excluded from phylogenetic analyses. Results of the Angraecinae + Aerangidinae ITS matrix (Figs. 2-5 and 2-6) were very similar to those of the larger Vandeae matrix. The primary differences related to weakly 46 supported clades. In the reduced ITS analysis, Campylocentrum + Dendrophylax formed a monophyletic group (52% BS) sister to Angraecum chevalieri/A. cultriforme. Angraecum eichlerianum was part of the large angraecoid polytomy.

Solenangis cornuta was basal to the Microcoelia + S. aphylla clade (51% BS).

Cribbia formed a polytomy with Rhipidoglossum, Diaphananthe, and the

Angraecopsis/Mystacidium clade. Diaphananthe pellucida was sister to the

Chamaeangis ichneumonea/Diaphananthe lorifolia clade (51% BS). Cyrtorchis formed part of the large angraecoid polytomy, along with Podangis dactyloceras

+ Rangaeris rhipsalisocia and Rangaeris muscicola. matK matrix

The matK matrix included 137 species (Bolusiella batesii and Rangaeris rhipsalisocia were excluded due to amplification difficulties) plus four outgroup taxa. A majority of the Old World Angraecinae formed a clade (82% BS) sister to the remaining polytomy of Angraecinae + Aerangidinae (Figs. 2-7 and 2-8).

There was very little resolution within this Old World Angraecinae clade.

Aeranthes arachnites + A. grandiflora were strongly supported with 100% BS.

Bonniera formed a weakly supported monophyletic group (64% BS). The clade comprising , A. conchiferum, and Bonniera was strongly supported with 95% BS. All of the subspecies, except A. eburneum ssp. xerophilum, formed a moderately supported clade (71%

BS). The only other supported clades were A. elephantinum + A. rutenbergianum (100% BS) and the genus Jumellea (97% BS) Sobennikoffia,

Oeoniella, Lemurorchis, and several species of Angraecum were unresolved within this Angraecinae clade. Figure 2-5. One of 126 most parsimonious trees for Angraecinae + Aerangidinae using ITS. a) Traditional Aerangidinae taxa excluding Calyptrochilum christyanum, which is part of Angraecinae and indicated by a star symbol. b) New World Angraecinae sister to several Old World Angraecum species. c) Remaining Old World taxa of Angraecinae excluding Beclardia macrostachya, which is part of Aerangidinae and indicated by a star symbol. Arrowheads indicate collapsed branches in the strict consensus. 48

Neobenthamia gracilis Polystachya longiscapa Polystachya concreta Polystachya modesta Acampe ochracea Acampe papillosa Trichoglottis atropurpurea Vanda flabellata Neofinetia falcata Amesiella philippinensis Phalaenopsis deliciosa clade b Angraecopsis amaniensis Angraecopsis breviloba Sphyrarhynchus schliebenii Campylocentrum fasciola Campylocentrum sullivanii Mystacidium aliciae Mystacidium braybonae Campylocentrum tyrridion Mystacidium capense Campylocentrum pachyrrhizum Mystacidium flanaganii Campylocentrum poeppigii Angraecopsis parviflora Campylocentrum micranthum Diaphananthe millarii Campylocentrum jamaicense Cribbia brachyceras Campylocentrum lansbergii Cribbia confusa Dendrophylax filiformis Rhipidoglossum kamerunense Dendrophylax barrettiae Rhipidoglossum rutilum Dendrophylax fawcettii Rhipidoglossum xanthopollinium Dendrophylax funalis Rhipidoglossum subsimplex Dendrophylax sallei Dendrophylax lindenii clade c Dendrophylax varius Aerangis biloba Dendrophylax porrecta Aerangis confusa Angraecum chevalieri Aerangis ugandensis Angraecum erectum Aerangis kirkii Angraecum cultriforme Aerangis kotschyana Angraecum eichlerianum Aerangis thomsoni Angraecum distichum Aerangis citrata Aerangis macrocentra Aerangis ellisii var. grandiflora Aerangis modesta b Aerangis fastuosa Aerangis punctata Microterangis hariotiana Microterangis hildebrandtii Aerangis coriacea Aerangis luteoalba var. rhodosticta Aerangis somalensis Aerangis verdickii Eurychone galeandrae Eurychone rothschildiana Ancistrorhynchus capitatus Cryptopus elatus Ancistrorhynchus metteniae Oeonia rosea Ancistrorhynchus straussii Cryptopus paniculatus Ancistrorhynchus recurvus Neobathiea grandidieriana Bolusiella batesii Lemurella pallidiflora Bolusiella maudiae Beclardia macrostachya Bolusiella iridifolia Microcoelia bulbocalcarata Microcoelia megalorrhiza Microcoelia gilpinae c Microcoelia corallina Microcoelia obovata Microcoelia globulosa Microcoelia stolzii Microcoelia exilis Microcoelia smithii Microcoelia physophora Microcoelia macrantha Solenangis aphylla Solenangis cornuta Cyrtorchis arcuata Cyrtorchis chailluana Cyrtorchis praetermissa Cyrtorchis ringens Rangaeris muscicola Podangis dactyloceras Rangaeris rhipsalisocia Tridactyle tanneri Ypsilopus viridiflorus 5 changes Rangaeris amaniensis Tridactyle furcistipes Ypsilopus longifolius Listrostachys pertusa Tridactyle bicaudata Tridactyle crassifolia Tridactyle filifolia Tridactyle scottellii Chamaeangis ichneumonea Chamaeangis odoratissima Diaphananthe fragrantissima Diaphananthe lorifolia Chamaeangis sarcophylla Chamaeangis vesicata a Diaphananthe pellucida Solenangis clavata Solenangis wakefieldii Calyptrochilum christyanum 49

98 Neobenthamia gracilis Polystachya longiscapa Polystachya concreta Outgroup 99 68 Aerangis biloba Polystachya modesta 99 Aerangis confusa 100 Acampe ochracea Aerangis kirkii 67 Acampe papillosa 87 Aerangis ugandensis Trichoglottis atropurpurea 97 Aerangis kotschyana 97 99 Vanda flabellata Aeridinae Aerangis thomsoni Neofinetia falcata 89 Aerangis citrata 60 Amesiella philippinensis Aerangis macrocentra Phalaenopsis deliciosa 98 Aerangis ellisii var. grandiflora 100 Campylocentrum fasciola 55 92 Aerangis fastuosa Campylocentrum sullivanii 62 Aerangis modesta 96 63 Campylocentrum tyrridion 54 Aerangis punctata Campylocentrum pachyrrhizum 53 99 Microterangis hariotiana 67 Campylocentrum micranthum 81 Microterangis hildebrandtii Campylocentrum poeppigii 57 Aerangis coriacea 100 Campylocentrum jamaicense 78 Aerangis luteoalba var. rhodosticta 52 Campylocentrum lansbergii 82 Aerangis somalensis 94 Dendrophylax filiformis Aerangis verdickii Dendrophylax barrettiae 97 Eurychone galeandrae 64 100 Dendrophylax fawcettii Eurychone rothschildiana Dendrophylax funalis 68 Ancistrorhynchus capitatus 93 73 76 Dendrophylax sallei 93 Ancistrorhynchus metteniae 100 Dendrophylax lindenii 95 Ancistrorhynchus straussii 59 Dendrophylax varius Ancistrorhynchus recurvus Dendrophylax porrecta 71 Bolusiella batesii 94 Angraecum chevalieri 100 Bolusiella maudiae 100 Angraecum erectum Bolusiella iridifolia Angraecum cultriforme Microcoelia bulbocalcarata Angraecum distichum 100 Microcoelia gilpinae Angraecum eichlerianum 62 Microcoelia megalorrhiza Calyptrochilum christyanum Microcoelia macrantha Cryptopus elatus Solenangis aphylla 83 Cryptopus paniculatus 87 51 82 Microcoelia corallina Oeonia rosea 97 Microcoelia obovata Neobathiea grandidieriana 63 Microcoelia globulosa Lemurella pallidiflora 100 95 Microcoelia stolzii 95 100 Microcoelia exilis 100 Microcoelia smithii Microcoelia physophora Solenangis cornuta Angraecopsis amaniensis 100 73 Angraecopsis breviloba 62 Sphyrarhynchus schliebenii Mystacidium aliciae Mystacidium braybonae 72 94 Mystacidium capense Mystacidium flanaganii Angraecopsis parviflora 100 Cribbia brachyceras 67 Cribbia confusa Rhipidoglossum kamerunense Diaphananthe millarii 89 87 Rhipidoglossum rutilum Rhipidoglossum xanthopollinium Rhipidoglossum subsimplex Beclardia macrostachya 63 Chamaeangis ichneumonea 74 Chamaeangis odoratissima 99 Diaphananthe fragrantissima 51 Diaphananthe lorifolia 98 Diaphananthe pellucida 100 Chamaeangis sarcophylla Chamaeangis vesicata Cyrtorchis arcuata 100 Cyrtorchis chailluana Cyrtorchis praetermissa Cyrtorchis ringens Listrostachys pertusa 97 Podangis dactyloceras Rangaeris rhipsalisocia Rangaeris amaniensis Rangaeris muscicola Tridactyle bicaudata Tridactyle crassifolia Tridactyle filifolia Tridactyle scottellii 100 Tridactyle furcistipes b Ypsilopus longifolius a 98 Tridactyle tanneri Ypsilopus viridiflorus 97 Solenangis clavata Solenangis wakefieldii Figure 2-6. Bootstrap consensus tree for ITS data set of Angraecinae + Aerangidinae. a) Traditional Angraecinae taxa with Aeridinae (open rectangle) and Polystachyinae (black rectangle). b) Traditional Aerangidinae taxa. Bootstrap percentages above branches are based on 1000 replicates.

Within the large angraecoid clade, the New World Angraecinae plus several

African species of Angraecum formed the largest supported clade (73% BS). 50

Campylocentrum (78% BS) and Dendrophylax (51% BS) formed a monophyletic

New World clade (76% BS). Relationships within Campylocentrum and

Dendrophylax agreed with previous work done on these genera (Carlsward et al.,

2003). Angraecum chevalieri/A. cultriforme formed a well supported clade (93%

BS) sister to the New World Angraecinae (85% BS). Angraecum eichlerianum was sister to this Campylocentrum + Dendrophylax + Angraecum clade (85%

BS). The remaining African Angraecinae (Angraecum distichum and

Calyptrochilum christyanum) formed part of the large angraecoid clade.

Several Malagasy taxa formed a small, weakly supported (50% BS) clade.

Cryptopus elatus + C. paniculatus formed a monophyletic group (56% BS) sister to Oeonia rosea (63% BS). The Cryptopus elatus/Oeonia rosea clade was sister to Neobathiea grandidieriana with moderate support (72% BS). Lemurella pallidiflora and Beclardia macrostachya (traditional Aerangidinae from

Madagascar) formed an unresolved monophyletic group with the

Cryptopus/Neobathiea clade (50% BS).

The genus Aerangis formed a large, unresolved clade (78% BS) that included both species of Microterangis. Species of Eurychone formed a paraphyletic grade sister to the Aerangis + Microterangis clade (88% BS). Within

Aerangis, the only clade conflicting with the ITS data was A. thomsonii + A. verdickii (90% BS).

Ancistrorhynchus (90% BS), Bolusiella (100%), Cyrtorchis (86% BS), and

Microcoelia (100% BS, including Solenangis aphylla and S. cornuta) were monophyletic genera in the large angraecoid polytomy. Within Microcoelia, M 51 bulbocalcarata/M. megalorrhiza (87% BS), M. corallina/M. globulosa (100% BS), and M. exilis + M. smithii (92% BS) formed a large clade (72% BS) which included both leafless species of Solenangis. Microcoelia physophora was sister to this large clade.

Angraecopsis breviloba and A. amaniensis formed a weakly-supported clade with Sphyrarhynchus schliebenii (57% BS). This Angraecopsis +

Sphyrarhynchus clade, along with Mystacidium (100% BS) and Angraecopsis parviflora, form an unresolved clade (55% BS). Cribbia brachyceras + C. confusa (99% BS) formed a well-resolved monophyletic group with all four species of Rhipidoglossum (74% BS).

Most species of Diaphananthe formed a well supported clade with

Chamaeangis (93% BS). Diaphananthe millarii, which was most closely related to Rhipidoglossum in the ITS analyses, formed part of the large angraecoid polytomy.

Tridactyle was split into two clades: Tridactyle bicaudata/Tridactyle filifolia

(93% BS) and Tridactyle furcistipes/Ypsilopus viridiflorus (57% BS). The first clade was exclusively composed of Tridactyle species with very little resolution.

In the second clade, Ypsilopus longifolius + T. furcistipes and T. tanneri + Y. viridiflorus were both well supported clades (93% and 97% BS, respectively). trnL-F matrix

The trnL-F matrix included 138 species (Ypsilopus viridiflorus was excluded due to amplification difficulties) plus four outgroup taxa. The data from the trnL-F gene region gave very similar results to those of the matK gene region; the primary difference was that trnL-F generally resulted in more resolution among Figure 2-7. One of 20,000+ most parsimonious trees for Angraecinae + Aerangidinae using matK chloroplast region. a) Traditional Aerangidinae taxa excluding Calyptrochilum christyanum and Angraecum distichum, which are part of Angraecinae and indicated by star symbols. b) New World Angraecinae sister to several Old World Angraecum species. c) Malagasy taxa of Angraecinae excluding Beclardia macrostachya, which is part of Aerangidinae and indicated by a star symbol. d) Remaining Old World Angraecinae. Arrowheads indicate collapsed branches in the strict consensus. 53

Neobenthamia gracilis Polystachya concreta Polystachya modesta Polystachya longiscapa Acampe ochracea Acampe papillosa Trichoglottis atropurpurea Vanda flabellata Neofinetia falcata Campylocentrum fasciola Amesiella philippinensis Campylocentrum sullivanii Phalaenopsis deliciosa Campylocentrum tyrridion Campylocentrum pachyrrhizum clade b Campylocentrum micranthum Campylocentrum poeppigii Angraecum distichum Campylocentrum jamaicense Aerangis biloba Campylocentrum lansbergii Aerangis confusa Dendrophylax filiformis Aerangis ugandensis Dendrophylax barrettiae Aerangis kirkii Dendrophylax fawcettii Aerangis kotschyana Dendrophylax funalis Aerangis luteoalba var. rhodosticta Dendrophylax sallei Aerangis thomsoni Dendrophylax lindenii Aerangis verdickii Dendrophylax varius Aerangis citrata Dendrophylax porrecta Aerangis macrocentra Angraecum chevalieri Aerangis ellisii var. grandiflora Angraecum erectum Aerangis modesta Angraecum cultriforme Aerangis fastuosa Angraecum eichlerianum Microterangis hariotiana Microterangis hildebrandtii Aerangis punctata Aerangis somalensis Aerangis coriacea b Eurychone galeandrae Eurychone rothschildiana Bolusiella maudiae Bolusiella iridifolia Microcoelia bulbocalcarata Microcoelia gilpinae Microcoelia megalorrhiza Microcoelia corallina Cryptopus elatus Microcoelia obovata Cryptopus paniculatus Microcoelia globulosa Oeonia rosea Microcoelia stolzii Neobathiea grandidieriana Microcoelia exilis Beclardia macrostachya Microcoelia smithii Lemurella pallidiflora Microcoelia macrantha Solenangis aphylla Solenangis cornuta Microcoelia physophora Ancistrorhynchus capitatus c Ancistrorhynchus metteniae Ancistrorhynchus straussii Ancistrorhynchus recurvus Calyptrochilum christyanum Angraecopsis amaniensis Angraecopsis breviloba Sphyrarhynchus schliebenii Mystacidium aliciae Mystacidium braybonae Aeranthes arachnitis Mystacidium capense Aeranthes grandiflora Mystacidium flanaganii Angraecum germinyanum Angraecopsis parviflora Angraecum conchiferum Cribbia brachyceras Bonniera sp. Cribbia confusa Bonniera appendiculata Rhipidoglossum kamerunense Angraecum eburneum Rhipidoglossum rutilum Angraecum eburneum ssp. superbum Rhipidoglossum xanthopollinium Angraecum eburneum ssp. superbum var. longicalcar Rhipidoglossum subsimplex Angraecum dives Diaphananthe millarii Angraecum florulentum Rangaeris muscicola Angraecum eburneum ssp. xerophilum Solenangis clavata Oeoniella polystachys Solenangis wakefieldii Angraecum calceolus Cyrtorchis arcuata Angraecum teres Cyrtorchis chailluana Angraecum rutenbergianum Cyrtorchis praetermissa Angraecum elephantinum Cyrtorchis ringens Listrostachys pertusa Sobennikoffia humbertiana Tridactyle furcistipes Jumellea confusa Ypsilopus longifolius Jumellea maxillarioides Tridactyle tanneri Jumellea sagittata Ypsilopus viridiflorus Lemurorchis madagascariensis Podangis dactyloceras Rangaeris amaniensis Tridactyle bicaudata Tridactyle crassifolia Tridactyle scottellii d Tridactyle filifolia Chamaeangis ichneumonea Chamaeangis odoratissima Chamaeangis sarcophylla Diaphananthe fragrantissima 5 changes Chamaeangis vesicata Diaphananthe pellucida Diaphananthe lorifolia a clade c clade d 54

71 Neobenthamia gracilis 99 Polystachya concreta Polystachya modesta Outgroup Polystachya longiscapa Acampe ochracea Angraecum distichum 100 Calyptrochilum christyanum 97 Acampe papillosa Aerangis biloba 52 Trichoglottis atropurpurea Aeridinae 64 Aerangis confusa 86 Vanda flabellata 87 100 Neofinetia falcata Aerangis ugandensis Amesiella philippinensis Aerangis kirkii Aerangis kotschyana Phalaenopsis deliciosa Aerangis thomsoni 100 Campylocentrum fasciola 90 67 Campylocentrum sullivanii Aerangis verdickii 81 Aerangis citrata 74 Campylocentrum tyrridion Campylocentrum pachyrrhizum Aerangis macrocentra 78 Aerangis ellisii var. grandiflora 78 75 Campylocentrum micranthum Campylocentrum poeppigii 58 Aerangis fastuosa Campylocentrum jamaicense 95 Microterangis hariotiana 98 Microterangis hildebrandtii Campylocentrum lansbergii 76 Aerangis modesta Dendrophylax filiformis 88 Dendrophylax barrettiae Aerangis punctata 51 Dendrophylax fawcettii Aerangis coriacea 99 Aerangis somalensis Dendrophylax funalis 85 Aerangis luteoalba var. rhodosticta 52 64 Dendrophylax sallei 86 Dendrophylax lindenii Eurychone galeandrae Dendrophylax varius Eurychone rothschildiana Dendrophylax porrecta 64 Ancistrorhynchus capitatus 73 89 Ancistrorhynchus metteniae Angraecum chevalieri 93 90 Ancistrorhynchus straussii 86 Angraecum erectum Angraecum cultriforme Ancistrorhynchus recurvus Angraecum eichlerianum 100 Bolusiella maudiae Bolusiella iridifolia 56 Cryptopus elatus Angraecopsis amaniensis 63 Cryptopus paniculatus 57 100 72 99 Angraecopsis breviloba Oeonia rosea Sphyrarhynchus schliebenii 50 Neobathiea grandidieriana Mystacidium aliciae 55 Lemurella pallidiflora 78 Mystacidium braybonae Beclardia macrostachya 100 Mystacidium capense Mystacidium flanaganii Angraecopsis parviflora 50 99 Cribbia brachyceras 84 Cribbia confusa 56 Rhipidoglossum kamerunense 74 Rhipidoglossum rutilum Rhipidoglossum xanthopollinium 67 Rhipidoglossum subsimplex Diaphananthe millarii 64 Cyrtorchis arcuata 86 Cyrtorchis chailluana Cyrtorchis praetermissa Cyrtorchis ringens Listrostachys pertusa Podangis dactyloceras Rangaeris amaniensis Rangaeris muscicola Tridactyle bicaudata 93 64 Tridactyle crassifolia Tridactyle scottellii Tridactyle filifolia Tridactyle furcistipes 100 93 57 Ypsilopus longifolius 97 Tridactyle tanneri 100 Aeranthes arachnitis Ypsilopus viridiflorus Aeranthes grandiflora 78 Microcoelia bulbocalcarata Angraecum germinyanum 87 Microcoelia gilpinae 95 Angraecum conchiferum Microcoelia megalorrhiza 64 Bonniera sp. Microcoelia macrantha Bonniera appendiculata Solenangis aphylla Angraecum eburneum 72 Solenangis cornuta 71 Angraecum eburneum ssp. superbum Microcoelia corallina Angraecum eburneum ssp. superbum var. longicalcar 100 Microcoelia obovata Angraecum eburneum ssp. xerophilum Microcoelia globulosa 100 Angraecum calceolus Microcoelia stolzii 82 Angraecum dives 92 Microcoelia exilis 100 Angraecum rutenbergianum Microcoelia smithii Angraecum elephantinum Microcoelia physophora Angraecum florulentum 98 Solenangis clavata Angraecum leonis Solenangis wakefieldii Angraecum teres Chamaeangis ichneumonea 97 Jumellea confusa Chamaeangis odoratissima 64 Jumellea maxillarioides 70 Diaphananthe fragrantissima Jumellea sagittata 52 Chamaeangis sarcophylla a Lemurorchis madagascariensis b 93 Chamaeangis vesicata Oeoniella polystachys Diaphananthe pellucida Sobennikoffia humbertiana Diaphananthe lorifolia Figure 2-8. Bootstrap consensus tree for matK data set of Angraecinae + Aerangidinae. a) Traditional Angraecinae taxa excluding Beclardia macrostachya (star symbol) plus Aeridinae (open rectangle) and Polystachyinae (black rectangle). b) Traditional Aerangidinae taxa excluding Angraecum distichum and Calyptrochilum christyanum (star symbols). Bootstrap percentages above branches are based on 1000 replicates. 55 taxa. Differences between the two data sets will be emphasized in the following results.

Most of the Old World Angraecinae formed a grade, branching basally with respect to the remaining angraecoids (Figs. 2-9 and 2-10), whereas they formed a moderately supported clade (82% BS) with the matK data. Within this Old

World Angraecinae grade, Aeranthes (100% BS) and Jumellea (88% BS) were monophyletic genera, and all subspecies of Angraecum eburneum formed a monophyletic group (100% BS). Sobennikoffia, Lemurorchis, Oeoniella, and

Bonniera were intercalated among species of Angraecum in the large

Angraecinae grade.

Cryptopus/Beclardia formed a clade sister to a large, poorly resolved angraecoid clade (60% BS). Within the angraecoid clade, there were four main subclades: 1) Campylocentrum + Dendrophylax + African Angraecum species

(71% BS); 2) Angraecum distichum + Calyptrochilum christyanum +

Aerangidinae (55% BS); and 3) Chamaeangis + Diaphananthe (96% BS).

Bootstrap support for Campylocentrum (98% BS), Dendrophylax (93% BS), and the New World Angraecinae clade (97% BS) was much higher using trnL-F data (99% BS) than with matK data. However, there was much less resolution among species of Dendrophylax using the trnL-F region.

Of the remaining Angraecinae, Angraecum distichum and Calyptrochilum christyanum were part of the large, poorly resolved angraecoid clade. Aerangis

(including Microterangis) was well-supported as a genus (100% BS) and sister to a monophyletic Eurychone (100% BS). Cribbia formed a clade with all species of 56

Rhipidoglossum except R. xanthopollinium, which was part of the large angraecoid clade. Species of Cyrtorchis no longer formed a monophyletic genus

(as was seen with the matK data), but instead were part of a poorly resolved clade (57% BS) with Listrostachys/Ypsilopus longifolius, Podangis/Rangaeris rhipsalisocia, Rangaeris amaniensis/R. muscicola, Tridactyle bicaudata/T. scottellii, and T. tanneri. Microcoelia was a monophyletic genus (87% BS) in which the leafless species of Solenangis and M. macrantha formed a clade (50%

BS). The leafy species of Solenangis formed a well-supported subclade (93%

BS) of the large angraecoid clade.

Combined chloroplast matrix

The combined chloroplast matrix included 139 ingroup species and four outgroup species. There were no conflicting, well-supported clades between the matK and trnL-F gene region topologies, but results from the partition homogeneity test found the two chloroplast data sets to be significantly different from one another (p-value = 0.18). This discrepancy was probably due to sensitivity flaws in the partition homogeneity test rather than real heterogeneity between the data sets (Graham et al., 1998). The topologies of the combined chloroplast trees (Figs. 2-11 and 2-12) were very similar to both the matK and trnL-F topologies and in most cases were more resolved with better support than either gene region separately (Table 2-8).

The topology of Old World Angraecinae matched the topology from the matK gene region, but with more resolution and generally higher BS support.

These Old World Angraecinae were sister to a more resolved angraecoid clade in which the Cryptopus elatus/Beclardia macrostachya clade was sister to the Figure 2-9. One of 20,000+ most parsimonious trees for Angraecinae + Aerangidinae using trnL-F chloroplast region. a) Traditional Aerangidinae taxa excluding Calyptrochilum christyanum and Angraecum distichum, which are part of Angraecinae and indicated by star symbols. b) New World Angraecinae sister to several Old World Angraecum species. c) Malagasy taxa of Angraecinae excluding Beclardia macrostachya, which is part of Aerangidinae and indicated by a star symbol. d) Remaining Old World Angraecinae. Arrowheads indicate collapsed branches in the strict consensus. 58

Neobenthamia gracilis Polystachya concreta Polystachya modesta Polystachya longiscapa Acampe ochracea Acampe papillosa Campylocentrum fasciola Trichoglottis atropurpurea Campylocentrum sullivanii Vanda flabellata Campylocentrum tyrridion Neofinetia falcata Campylocentrum pachyrrhizum Amesiella philippinensis Campylocentrum micranthum Phalaenopsis deliciosa Campylocentrum poeppigii Campylocentrum jamaicense clade b Campylocentrum lansbergii Dendrophylax filiformis Angraecum distichum Dendrophylax barrettiae Angraecopsis amaniensis Dendrophylax fawcettii Angraecopsis breviloba Dendrophylax funalis Sphyrarhynchus schliebenii Dendrophylax sallei Mystacidium aliciae Dendrophylax varius Mystacidium braybonae Dendrophylax lindenii Mystacidium capense Dendrophylax porrecta Mystacidium flanaganii Angraecum chevalieri Angraecopsis parviflora Angraecum erectum Cribbia brachyceras Angraecum cultriforme Cribbia confusa Angraecum eichlerianum Rhipidoglossum kamerunense Rhipidoglossum rutilum Rhipidoglossum subsimplex Diaphananthe millarii Rhipidoglossum xanthopollinium b Calyptrochilum christyanum Ancistrorhynchus capitatus Ancistrorhynchus metteniae Ancistrorhynchus straussii Ancistrorhynchus recurvus Cyrtorchis arcuata Cyrtorchis chailluana Cyrtorchis praetermissa Cyrtorchis ringens Rangaeris amaniensis Rangaeris muscicola Tridactyle tanneri Listrostachys pertusa Tridactyle furcistipes Ypsilopus longifolius Cryptopus elatus Cryptopus paniculatus Podangis dactyloceras Rangaeris rhipsalisocia Oeonia rosea Tridactyle bicaudata Neobathiea grandidieriana Tridactyle crassifolia Lemurella pallidiflora Tridactyle filifolia Beclardia macrostachya Tridactyle scottellii Aerangis biloba Aerangis confusa Aerangis ugandensis c Aerangis kirkii Aerangis kotschyana Aerangis thomsoni Aerangis verdickii Aerangis luteoalba var. rhodosticta Aerangis somalensis Aerangis coriacea Aerangis punctata Microterangis hariotiana Microterangis hildebrandtii Aeranthes arachnitis Aerangis citrata Aeranthes grandiflora Aerangis macrocentra Angraecum rutenbergianum Aerangis ellisii var. grandiflora Angraecum elephantinum Aerangis fastuosa Lemurorchis madagascariensis Aerangis modesta Angraecum germinyanum Eurychone galeandrae Angraecum conchiferum Eurychone rothschildiana Bonniera sp. Microcoelia bulbocalcarata Bonniera appendiculata Microcoelia megalorrhiza Angraecum eburneum Microcoelia gilpinae Angraecum eburneum ssp. superbum Microcoelia corallina Angraecum eburneum ssp. superbum var. longicalcar Microcoelia obovata Angraecum eburneum ssp. xerophilum Microcoelia globulosa Angraecum dives Microcoelia stolzii Angraecum calceolus Microcoelia exilis Angraecum florulentum Microcoelia smithii Angraecum teres Microcoelia macrantha Oeoniella polystachys Microcoelia physophora Angraecum leonis Solenangis aphylla Sobennikoffia humbertiana Solenangis cornuta Jumellea confusa Solenangis clavata Jumellea maxillarioides Solenangis wakefieldii Jumellea sagittata Bolusiella batesii Bolusiella maudiae Bolusiella iridifolia Chamaeangis ichneumonea d Chamaeangis vesicata Chamaeangis odoratissima Diaphananthe fragrantissima Chamaeangis sarcophylla 5 changes Diaphananthe lorifolia Diaphananthe pellucida a clade c clade d 59

69 Neobenthamia gracilis 100 Polystachya concreta Polystachya modesta Outgroup Polystachya longiscapa Acampe ochracea 81 Acampe papillosa 78 Trichoglottis atropurpurea Angraecum distichum 56 99 Vanda flabellata Aeridinae Calyptrochilum christyanum 100 Neofinetia falcata Aerangis biloba Phalaenopsis deliciosa 98 100 Aerangis confusa Amesiella philippinensis 100 Aerangis ugandensis Campylocentrum fasciola 100 Aerangis kirkii 84 Campylocentrum sullivanii Aerangis kotschyana 68 Campylocentrum tyrridion 91 54 Aerangis thomsoni Campylocentrum pachyrrhizum Aerangis verdickii 81 Campylocentrum micranthum Aerangis citrata 98 Campylocentrum poeppigii 92 Aerangis macrocentra Campylocentrum jamaicense 100 74 Aerangis ellisii var. grandiflora Campylocentrum lansbergii 80 97 Aerangis fastuosa Dendrophylax filiformis Aerangis modesta Dendrophylax barrettiae Aerangis punctata Dendrophylax fawcettii 60 99 100 Microterangis hariotiana 93 Dendrophylax funalis 51 Microterangis hildebrandtii 78 Dendrophylax sallei 69 Aerangis coriacea Dendrophylax lindenii Aerangis somalensis Dendrophylax varius Aerangis luteoalba var. rhodosticta Dendrophylax porrecta 71 100 Eurychone galeandrae 100 Angraecum chevalieri Eurychone rothschildiana Angraecum erectum 100 Ancistrorhynchus capitatus Angraecum cultriforme Ancistrorhynchus metteniae Angraecum eichlerianum 97 56 Ancistrorhynchus straussii Ancistrorhynchus recurvus 78 Bolusiella batesii 95 Bolusiella maudiae Bolusiella iridifolia Angraecopsis amaniensis 64 100 Angraecopsis breviloba 60 Sphyrarhynchus schliebenii Mystacidium aliciae 53 99 Mystacidium braybonae Mystacidium capense Mystacidium flanaganii 55 Angraecopsis parviflora 99 Cribbia brachyceras 64 Cribbia confusa 80 Rhipidoglossum kamerunense 98 Rhipidoglossum rutilum Rhipidoglossum subsimplex Diaphananthe millarii 100 Rhipidoglossum xanthopollinium 96 Cyrtorchis arcuata Cyrtorchis chailluana Cyrtorchis praetermissa Cyrtorchis ringens 60 Listrostachys pertusa 99 Tridactyle furcistipes 63 Ypsilopus longifolius 57 91 Podangis dactyloceras 73 Cryptopus elatus Rangaeris rhipsalisocia 100 Cryptopus paniculatus 66 Rangaeris amaniensis 89 Oeonia rosea Rangaeris muscicola 75 Neobathiea grandidieriana Tridactyle bicaudata 66 Lemurella pallidiflora 76 Tridactyle crassifolia Beclardia macrostachya Tridactyle filifolia 100 Aeranthes arachnitis Tridactyle scottellii Aeranthes grandiflora Tridactyle tanneri Angraecum germinyanum Microcoelia bulbocalcarata 63 74 Microcoelia gilpinae 86 Angraecum conchiferum 99 Bonniera sp. Microcoelia megalorrhiza Bonniera appendiculata Microcoelia macrantha 50 72 Angraecum eburneum Solenangis aphylla 69 Angraecum eburneum ssp. superbum Solenangis cornuta 100 Angraecum eburneum ssp. superbum var. longicalcar 87 97 Microcoelia corallina Microcoelia obovata Angraecum eburneum ssp. xerophilum 99 70 Angraecum calceolus Microcoelia globulosa Angraecum dives 69 Microcoelia stolzii 94 Angraecum rutenbergianum 74 Microcoelia exilis Angraecum elephantinum Microcoelia smithii Angraecum florulentum Microcoelia physophora 51 Angraecum teres 93 Solenangis clavata Oeoniella polystachys Solenangis wakefieldii Angraecum leonis 60 Chamaeangis ichneumonea Jumellea confusa Chamaeangis vesicata 88 Jumellea maxillarioides 98 Chamaeangis odoratissima Jumellea sagittata 55 68 Diaphananthe fragrantissima a Lemurorchis madagascariensis b 96 Chamaeangis sarcophylla Sobennikoffia humbertiana Diaphananthe pellucida Diaphananthe lorifolia Figure 2-10. Bootstrap consensus tree for trnL-F data set of Angraecinae + Aerangidinae. a) Traditional Angraecinae taxa excluding Beclardia macrostachya (star symbol) plus Aeridinae (open rectangle) and Polystachyinae (black rectangle). b) Traditional Aerangidinae taxa excluding Angraecum distichum and Calyptrochilum christyanum (star symbols). Bootstrap percentages above branches are based on 1000 replicates. remaining Aerangidinae + Angraecinae (90% BS). Within this Aerangidinae +

Angraecinae clade, Chamaeangis ichneumonea/Diaphananthe lorifolia was sister 60 to the remaining angraecoids (56% BS). The New World Angraecinae + several species of Angraecum formed a clade (98% BS) sister to the remaining poorly resolved clade of angraecoids (82% BS). The remaining angraecoid clade was composed primarily of Aerangidinae, with the exception of Angraecum distichum and Calyptrochilum christyanum (the positions of which were unresolved within the angraecoid clade).

Aerangis formed a monophyletic genus that included Microterangis (98%

BS) and was sister to a monophyletic Eurychone (100% BS). Ancistrorhynchus

(100% BS), Bolusiella (100% BS), leafy Solenangis (100% BS), and Microcoelia

(100% BS, including leafless Solenangis) were all monophyletic genera that were part of the angraecoid clade. Within Microcoelia, Solenangis aphylla and S. cornuta formed a clade with M. macrantha (76% BS) sister to most of the other species of Microcoelia. Angraecopsis amaniensis/Sphyrarhynchus was sister to

Mystacidium + Angraecopsis parviflora (92% BS), and this clade was sister to the

Cribbia + Rhipidoglossum + Diaphananthe millarii clade (87% BS).

The topology of the Cyrtorchis arcuata/Tridactyle filifolia clade (88% BS) was primarily unresolved, as seen in the trnL-F data set. However, Cyrtorchis formed a monophyletic genus (88% BS) and Rangaeris amaniensis formed a weakly supported group with Tridactyle tanneri + Ypsilopus viridiflorus (52% BS).

Combined ITS and chloroplast matrix

There were only three instances in which the ITS data conflicted with the chloroplast data (Figs. 2-6 and 2-12). The clade of Angraecum erectum + A. chevalieri (94% BS) was sister to A. cultriforme (100% BS) using ITS data while the A. erectum + A. cultriforme clade (100% BS) was sister to A. chevalieri Figure 2-11. One of 20,000+ most parsimonious trees for Angraecinae + Aerangidinae using trnL-F and matK chloroplast regions combined. a) Traditional Aerangidinae taxa excluding Calyptrochilum christyanum and Angraecum distichum, which are part of Angraecinae and indicated by star symbols. b) New World Angraecinae sister to several Old World Angraecum species. c) Malagasy taxa of Angraecinae excluding Beclardia macrostachya, which is part of Aerangidinae and indicated by a star symbol. d) Remaining Old World Angraecinae. Arrowheads indicate collapsed branches in the strict consensus. 62

Neobenthamia gracilis Polystachya concreta Polystachya modesta Polystachya longiscapa Acampe ochracea Acampe papillosa Trichoglottis atropurpurea Vanda flabellata Neofinetia falcata Amesiella philippinensis Phalaenopsis deliciosa Campylocentrum fasciola clade b Campylocentrum sullivanii Angraecum distichum Campylocentrum tyrridion Aerangis biloba Campylocentrum pachyrrhizum Aerangis confusa Campylocentrum micranthum Aerangis ugandensis Campylocentrum poeppigii Aerangis kirkii Campylocentrum jamaicense Aerangis kotschyana Campylocentrum lansbergii Aerangis coriacea Dendrophylax filiformis Aerangis somalensis Dendrophylax barrettiae Aerangis thomsoni Dendrophylax fawcettii Aerangis verdickii Dendrophylax funalis Aerangis luteoalba var. rhodosticta Dendrophylax sallei Aerangis citrata Dendrophylax lindenii Aerangis macrocentra Dendrophylax varius Aerangis ellisii var. grandiflora Dendrophylax porrecta Aerangis fastuosa Angraecum chevalieri Aerangis modesta Angraecum erectum Aerangis punctata Angraecum cultriforme Microterangis hariotiana Angraecum eichlerianum Microterangis hildebrandtii Eurychone galeandrae Eurychone rothschildiana Calyptrochilum christyanum b Angraecopsis amaniensis Angraecopsis breviloba Sphyrarhynchus schliebenii Mystacidium aliciae Mystacidium braybonae Mystacidium capense Mystacidium flanaganii Angraecopsis parviflora Cribbia brachyceras Cryptopus elatus Cribbia confusa Cryptopus paniculatus Rhipidoglossum kamerunense Oeonia rosea Rhipidoglossum rutilum Neobathiea grandidieriana Rhipidoglossum subsimplex Lemurella pallidiflora Rhipidoglossum xanthopollinium Beclardia macrostachya Diaphananthe millarii Ancistrorhynchus capitatus Ancistrorhynchus metteniae Ancistrorhynchus straussii c Ancistrorhynchus recurvus Bolusiella batesii Bolusiella maudiae Bolusiella iridifolia Cyrtorchis arcuata Cyrtorchis chailluana Cyrtorchis praetermissa Aeranthes arachnitis Cyrtorchis ringens Aeranthes grandiflora Rangaeris amaniensis Angraecum rutenbergianum Tridactyle tanneri Angraecum elephantinum Ypsilopus viridiflorus Jumellea confusa Listrostachys pertusa Jumellea maxillarioides Tridactyle furcistipes Jumellea sagittata Ypsilopus longifolius Lemurorchis madagascariensis Rangaeris muscicola Angraecum germinyanum Tridactyle bicaudata Angraecum conchiferum Tridactyle crassifolia Bonniera sp. Tridactyle scottellii Bonniera appendiculata Tridactyle filifolia Angraecum eburneum Podangis dactyloceras Angraecum eburneum ssp. superbum Rangaeris rhipsalisocia Angraecum eburneum ssp. superbum var. longicalcar Microcoelia bulbocalcarata Angraecum eburneum ssp. xerophilum Microcoelia gilpinae Angraecum calceolus Microcoelia megalorrhiza Angraecum florulentum Microcoelia corallina Angraecum teres Microcoelia obovata Oeoniella polystachys Microcoelia globulosa Angraecum dives Microcoelia stolzii Angraecum leonis Microcoelia exilis Sobennikoffia humbertiana Microcoelia smithii Microcoelia macrantha Solenangis aphylla Solenangis cornuta d Microcoelia physophora Solenangis clavata Solenangis wakefieldii Chamaeangis ichneumonea Chamaeangis odoratissima Diaphananthe fragrantissima Chamaeangis sarcophylla Chamaeangis vesicata Diaphananthe pellucida Diaphananthe lorifolia 10 changes a clade c clade d 63

83 Neobenthamia gracilis 100 Polystachya concreta Polystachya modesta Outgroup Polystachya longiscapa 97 Acampe ochracea 99 Acampe papillosa 85 Trichoglottis atropurpurea 100 Vanda flabellata Aeridinae 100 Neofinetia falcata Amesiella philippinensis Phalaenopsis deliciosa 100 Campylocentrum fasciola 92 Campylocentrum sullivanii 98 Aerangis biloba 73 Aerangis confusa Campylocentrum tyrridion 100 100 95 Campylocentrum pachyrrhizum Aerangis ugandensis Aerangis kirkii 100 90 Campylocentrum micranthum Campylocentrum poeppigii Aerangis kotschyana 100 Campylocentrum jamaicense 85 Aerangis thomsoni Campylocentrum lansbergii 56 Aerangis verdickii 99 Dendrophylax filiformis Aerangis luteoalba var. rhodosticta Dendrophylax barrettiae 99 Aerangis citrata 100 Dendrophylax fawcettii 98 58 Aerangis macrocentra 97 Dendrophylax funalis 51 Aerangis ellisii var. grandiflora 100 75 Dendrophylax sallei 87 Aerangis fastuosa 97 Dendrophylax lindenii Aerangis modesta Dendrophylax varius Aerangis punctata 97 69 98 Dendrophylax porrecta 100 Microterangis hariotiana 100 Angraecum chevalieri Microterangis hildebrandtii 100 Angraecum erectum Aerangis coriacea Angraecum cultriforme Aerangis somalensis Angraecum eichlerianum 100 Eurychone galeandrae Angraecum distichum Eurychone rothschildiana Calyptrochilum christyanum Ancistrorhynchus capitatus 95 Ancistrorhynchus metteniae 56 100 Ancistrorhynchus straussii Ancistrorhynchus recurvus 72 Bolusiella batesii 100 Bolusiella maudiae Bolusiella iridifolia 88 Angraecopsis amaniensis 82 100 Angraecopsis breviloba Sphyrarhynchus schliebenii 92 Mystacidium aliciae 81 Mystacidium braybonae 100 Mystacidium capense 65 Mystacidium flanaganii Angraecopsis parviflora 79 100 Cribbia brachyceras 91 Cribbia confusa 94 Rhipidoglossum kamerunense 75 98 Rhipidoglossum rutilum Rhipidoglossum subsimplex 87 Rhipidoglossum xanthopollinium 90 Diaphananthe millarii Chamaeangis ichneumonea 98 Cyrtorchis arcuata Chamaeangis odoratissima 58 Cyrtorchis chailluana 100 52 Diaphananthe fragrantissima 88 Cyrtorchis praetermissa 71 Chamaeangis sarcophylla Cyrtorchis ringens 100 Chamaeangis vesicata 62 Listrostachys pertusa Diaphananthe pellucida 100 Tridactyle furcistipes Diaphananthe lorifolia Ypsilopus longifolius 100 83 Cryptopus elatus 93 Podangis dactyloceras 95 99 Cryptopus paniculatus 88 Rangaeris rhipsalisocia 97 Oeonia rosea 52 Rangaeris amaniensis 80 Neobathiea grandidieriana 98 Tridactyle tanneri 93 Lemurella pallidiflora Ypsilopus viridiflorus Beclardia macrostachya Rangaeris muscicola 100 Aeranthes arachnitis Tridactyle bicaudata Aeranthes grandiflora 100 68 Tridactyle crassifolia Angraecum germinyanum Tridactyle scottellii 98 Tridactyle filifolia 92 Angraecum conchiferum 100 Bonniera sp. 73 Microcoelia bulbocalcarata 100 99 Bonniera appendiculata Microcoelia gilpinae 74 Angraecum eburneum Microcoelia megalorrhiza 93 Angraecum eburneum ssp. superbum 75 100 Microcoelia corallina 51 100 Microcoelia obovata Angraecum eburneum ssp. superbum var. longicalcar 99 74 Angraecum eburneum ssp. xerophilum Microcoelia globulosa 96 Microcoelia stolzii Angraecum calceolus 84 90 Angraecum dives 98 Microcoelia exilis 69 Microcoelia smithii 54 Angraecum florulentum Angraecum teres 100 78 Microcoelia macrantha 52 76 Oeoniella polystachys Solenangis aphylla Angraecum leonis Solenangis cornuta Sobennikoffia humbertiana Microcoelia physophora 100 Angraecum rutenbergianum 100 Solenangis clavata Angraecum elephantinum Solenangis wakefieldii 100 Jumellea confusa a 68 Jumellea maxillarioides b Jumellea sagittata Lemurorchis madagascariensis Figure 2-12. Bootstrap consensus tree of combined trnL-F and matK data sets for Angraecinae + Aerangidinae. a) Traditional Angraecinae taxa excluding Beclardia macrostachya and the Chamaeangis/Diaphananthe clade (star symbols), plus Aeridinae (open rectangle) and Polystachyinae (black rectangle). b) Traditional Aerangidinae taxa. Bootstrap percentages above branches are based on 1000 replicates. 64

(100% BS) using chloroplast data. Within Aerangidinae, Rhipidoglossum rutilum was sister to R. xanthopollinium (87% BS) using ITS data while R. rutilum was sister to R. subsimplex (98% BS) using chloroplast data. However, the support for the ITS relationship was only moderately high (87% BS), whereas the support for the chloroplast data set was 98% BS.

Aerangis thomsonii was sister to the A. biloba/A. kotschyana clade (97%

BS) and A. verdickii was sister to A. coriacea/A. somalensis clade (82% BS) using ITS data. Using chloroplast data, A. thomsonii and A. verdickii are sister species with moderate support (85% BS).

To eliminate the possibility of taxon sampling incongruency, reduced chloroplast analyses were performed in which taxa with paralogous ITS sequences were removed from the matrix. Topologies and BS support for the conflicting taxon groupings were the same in the reduced and complete chloroplast analyses.

Probability values from the partition homogeneity tests between trnL-F/ITS

(p-value = 0.01) and matK/ITS (p-value = 0.01) showed significant heterogeneity between both chloroplast data sets and the ITS data set. However, given the oversensitivy of this statistical test seen in my study with the chloroplast data sets as well as in other studies (Graham et al., 1998), it seems likely that the partition homogeneity test would be at least as overly sensitive comparing nuclear and chloroplast data sets as is was in comparing chloroplast data sets. Also, given the infrequency of topology conflicts between the chloroplast and ITS data sets and the minor position of these topologies within the overall tree, it is more likely 65 that these incongruencies are due to technical issues such as taxon sampling or phylogenetic signal and homoplasy (Wendel & Doyle, 1998) than they are to real gene genealogy differences. Therefore, the data sets were combined to give a more robust phylogeny of all Aerangidinae and Angraecinae than would otherwise be attainable with individual data sets (Soltis et al., 1998).

The combined three gene matrix included 138 ingroup species and four outgroup species. Topology of the combined matrix was more similar to the chloroplast data set than the nuclear (ITS) data set (Figs. 2-13 and 2-14).

Resolution within the combined data tree was generally more resolved with better support for fewer trees than any of the other data sets alone (Table 2-8).

For example, Angraecum distichum was part of a large angraecoid polytomy using all three data sets separately, but formed part of the Angraecopsis amaniensis/Diaphananthe millarii clade in the combined analysis (57% BS).

Ancistrorhynchus and Bolusiella were sister genera forming a clade most closely related to Microcoelia (including leafless Solenangis), a grouping not seen in any separate analysis. However, the large angraecoid clade was less resolved in the three gene analysis than in the chloroplast analysis alone, probably due to the homoplasy of the ITS data set. Cryptopus/Beclardia and Chamaeangis +

Diaphananthe were both part of the large poorly resolved angraecoid clade.

Discussion

The two African and Malagasy subtribes of Vandeae, Angraecinae and

Aerangidinae, were originally circumscribed by Summerhayes (1966) based on rostellum shape and chromosome number. These differences, however, seem to be phylogenetically misleading. Chromosome counts from several sources 66

(Arends et al., 1980; Arends & Van der Laan, 1983, 1986; Charard, 1963; Jones,

1967; Jonsson, 1981) support a general trend of x = 25 for Aerangidinae and x =

19 for Angraecinae, as indicated by Summerhayes (1966), but within each subtribe there is tremendous variation. This chromosomal variation is most prominent in large genera such as Angraecum (x = 19, 20, 21, 23, 24, 25) and

Aerangis (x = 21, 23, 25, 27).

Morphologically, members of these two subtribes appear very similar in their vegetative and floral features, so it is not surprising that molecular data do not support the monophyly of either Angraecinae or Aerangidinae. It is interesting to note that Angraecum distichum, which is sister to the Aerangidinae

Angraecopsis amaniensis/Diaphananthe millarii clade in the combined three gene analysis of my study, has a chromosome number of x = 25. Several other

African species of Angraecum not included in my study (A. bancoense, A. podochiloides, and A. subulatum) also have been reported as having x = 25

(Arends et al., 1980). The chromosome number common to many Aerangidinae is x = 25, which suggests affinities between Aerangidinae (which is primarily

African) and the African species of Angraecum.

Unlike Angraecinae and Aerangidinae s.s., Aeridinae are a well-supported subtribe with a consistent chromosome number of x = 19 (Arends & Van der

Laan, 1983; Charard, 1963; Jones, 1967; Kamemoto, 1965; Sagawa, 1962;

Shindo & Kamemoto, 1963; Storey, 1952; Storey et al., 1963; Tara & Kamemoto,

1970; Woodard, 1951). Therefore, sequence data from my Figure 2-13. One of 2,688 most parsimonious trees for Angraecinae + Aerangidinae using trnL-F, matK, and ITS regions combined. a) Traditional Aerangidinae taxa excluding Calyptrochilum christyanum and Angraecum distichum, which part of the traditional Angraecinae and indicated by star symbols. b) New World Angraecinae sister to several Old World Angraecum species. c) Malagasy taxa of Angraecinae excluding Beclardia macrostachya, which is part of the traditional Aerangidinae and indicated by a star symbol. d) Remaining Old World Angraecinae. Arrowheads indicate collapsed branches in the strict consensus. 68

Neobenthamia gracilis Polystachya longiscapa Polystachya concreta Polystachya modesta Acampe ochracea Campylocentrum fasciola Acampe papillosa Campylocentrum sullivanii Trichoglottis atropurpurea Campylocentrum tyrridion Vanda flabellata Campylocentrum pachyrrhizum Neofinetia falcata Campylocentrum micranthum Amesiella philippinensis Campylocentrum poeppigii Phalaenopsis deliciosa Campylocentrum jamaicense Campylocentrum lansbergii clade b Dendrophylax filiformis Angraecum distichum Dendrophylax barrettiae Angraecopsis amaniensis Dendrophylax fawcettii Angraecopsis breviloba Dendrophylax funalis Sphyrarhynchus schliebenii Dendrophylax sallei Mystacidium aliciae Dendrophylax lindenii Mystacidium braybonae Dendrophylax varius Mystacidium capense Dendrophylax porrecta Mystacidium flanaganii Angraecum chevalieri Angraecopsis parviflora Angraecum erectum Cribbia brachyceras Angraecum cultriforme Cribbia confusa Angraecum eichlerianum Rhipidoglossum kamerunense Rhipidoglossum rutilum Rhipidoglossum subsimplex Rhipidoglossum xanthopollinium b Diaphananthe millarii Calyptrochilum christyanum Solenangis clavata Solenangis wakefieldii Ancistrorhynchus capitatus Ancistrorhynchus metteniae Ancistrorhynchus straussii Ancistrorhynchus recurvus Bolusiella batesii Bolusiella maudiae Bolusiella iridifolia Microcoelia bulbocalcarata Microcoelia gilpinae Microcoelia megalorrhiza Cryptopus elatus Microcoelia macrantha Cryptopus paniculatus Solenangis aphylla Oeonia rosea Solenangis cornuta Neobathiea grandidieriana Microcoelia corallina Lemurella pallidiflora Microcoelia obovata Beclardia macrostachya Microcoelia globulosa Microcoelia stolzii Microcoelia exilis Microcoelia smithii Microcoelia physophora c Cyrtorchis arcuata Cyrtorchis chailluana Cyrtorchis praetermissa Cyrtorchis ringens Podangis dactyloceras Rangaeris rhipsalisocia Rangaeris muscicola Listrostachys pertusa Rangaeris amaniensis Tridactyle tanneri Ypsilopus viridiflorus Aeranthes arachnitis Tridactyle furcistipes Aeranthes grandiflora Ypsilopus longifolius Angraecum rutenbergianum Tridactyle bicaudata Angraecum elephantinum Tridactyle filifolia Jumellea confusa Tridactyle crassifolia Jumellea maxillarioides Tridactyle scottellii Jumellea sagittata Aerangis biloba Lemurorchis madagascariensis Aerangis confusa Angraecum germinyanum Aerangis ugandensis Angraecum conchiferum Aerangis kirkii Bonniera sp. Aerangis kotschyana Bonniera appendiculata Aerangis thomsoni Angraecum eburneum Aerangis verdickii Angraecum eburneum ssp. superbum Aerangis coriacea Angraecum eburneum ssp. superbum var. longicalcar Aerangis somalensis Angraecum eburneum ssp. xerophilum Aerangis luteoalba var. rhodosticta Angraecum calceolus Aerangis citrata Angraecum florulentum Aerangis macrocentra Angraecum teres Aerangis ellisii var. grandiflora Oeoniella polystachys Aerangis fastuosa Angraecum dives Aerangis modesta Angraecum leonis Aerangis punctata Sobennikoffia humbertiana Microterangis hariotiana Microterangis hildebrandtii Eurychone galeandrae Eurychone rothschildiana d 10 changes Chamaeangis ichneumonea Chamaeangis odoratissima Diaphananthe fragrantissima Chamaeangis sarcophylla Chamaeangis vesicata Diaphananthe pellucida a Diaphananthe lorifolia clade c clade d 69

74 Neobenthamia gracilis Polystachya longiscapa Outgroup 100 Polystachya concreta Angraecum distichum Polystachya modesta Angraecopsis amaniensis 100 Acampe ochracea 100 98 100 Angraecopsis breviloba Acampe papillosa Sphyrarhynchus schliebenii 66 Trichoglottis atropurpurea 57 100 Mystacidium aliciae 100 Vanda flabellata Aeridinae 86 100 100 61 Mystacidium braybonae Neofinetia falcata Mystacidium capense 53 71 Amesiella philippinensis Mystacidium flanaganii Phalaenopsis deliciosa Angraecopsis parviflora 100 Campylocentrum fasciola 99 100 Cribbia brachyceras 80 Campylocentrum sullivanii 97 83 Cribbia confusa Campylocentrum tyrridion 81 Rhipidoglossum kamerunense 100 Campylocentrum pachyrrhizum 95 Rhipidoglossum rutilum 87 Campylocentrum micranthum 83 100 87 Rhipidoglossum subsimplex Campylocentrum poeppigii Rhipidoglossum xanthopollinium 100 Campylocentrum jamaicense Diaphananthe millarii Campylocentrum lansbergii Aerangis biloba 99 Dendrophylax filiformis 99 95 Aerangis confusa 100 96 Dendrophylax barrettiae Aerangis ugandensis Dendrophylax fawcettii 100 93 Aerangis kirkii 100 Dendrophylax funalis 77 Aerangis kotschyana 100 Dendrophylax sallei 75 Aerangis thomsoni 100 Dendrophylax lindenii 63 93 Aerangis verdickii Dendrophylax varius Aerangis citrata Dendrophylax porrecta 100 97 Aerangis macrocentra Angraecum chevalieri 100 Aerangis ellisii var. grandiflora Angraecum erectum 100 65 92 99 Aerangis fastuosa Angraecum cultriforme Aerangis modesta Angraecum eichlerianum 57 Aerangis punctata Calyptrochilum christyanum Microterangis hariotiana Cryptopus elatus 100 65 100 Microterangis hildebrandtii 99 Cryptopus paniculatus 99 70 Aerangis coriacea Oeonia rosea 81 Aerangis somalensis 86 Neobathiea grandidieriana 95 Aerangis luteoalba var. rhodosticta Lemurella pallidiflora Eurychone galeandrae Beclardia macrostachya 100 Eurychone rothschildiana 73 Ancistrorhynchus capitatus 99 Ancistrorhynchus metteniae 100 Ancistrorhynchus straussii 68 Ancistrorhynchus recurvus 81 Bolusiella batesii 100 Bolusiella maudiae Bolusiella iridifolia Microcoelia bulbocalcarata 93 72 100 Microcoelia gilpinae Microcoelia megalorrhiza 86 Microcoelia macrantha 71 Solenangis aphylla 100 Solenangis cornuta Microcoelia corallina 100 Microcoelia obovata 99 Microcoelia globulosa 100 100 Microcoelia stolzii 66 100 Microcoelia exilis Microcoelia smithii Microcoelia physophora 82 Chamaeangis ichneumonea 80 Chamaeangis odoratissima 100 Aeranthes arachnitis 93 Diaphananthe fragrantissima 100 Aeranthes grandiflora 61 100 Chamaeangis sarcophylla Angraecum germinyanum 98 100 Chamaeangis vesicata 93 Angraecum conchiferum Diaphananthe lorifolia 100 Bonniera sp. Diaphananthe pellucida Bonniera appendiculata 97 Cyrtorchis arcuata 74 Angraecum eburneum 59 Cyrtorchis chailluana 92 Angraecum eburneum ssp. superbum 100 53 100 Cyrtorchis praetermissa Angraecum eburneum ssp. superbum var. longicalcar Cyrtorchis ringens Angraecum eburneum ssp. xerophilum Listrostachys pertusa Angraecum calceolus 100 Podangis dactyloceras 91 Angraecum dives 69 Rangaeris rhipsalisocia Angraecum florulentum 56 66 Rangaeris amaniensis 53 Angraecum teres 97 100 Tridactyle tanneri Oeoniella polystachys Ypsilopus viridiflorus Angraecum leonis Rangaeris muscicola Sobennikoffia humbertiana Tridactyle bicaudata 100 Angraecum rutenbergianum 100 59 Tridactyle crassifolia Angraecum elephantinum Tridactyle scottellii 100 Jumellea confusa Tridactyle filifolia 67 Jumellea maxillarioides 100 Tridactyle furcistipes a Jumellea sagittata b Ypsilopus longifolius Lemurorchis madagascariensis 100 Solenangis clavata Solenangis wakefieldii Figure 2-14. Bootstrap consensus tree of combined trnL-F, matK, and ITS data sets for Angraecinae + Aerangidinae. a) Traditional Angraecinae taxa excluding Beclardia macrostachya (bold text) plus Aeridinae (open rectangle) and Polystachyinae (black rectangle). b) Traditional Aerangidinae taxa excluding Angraecum distichum (bold text). Bootstrap percentages above branches are based on 1000 replicates. study indicate only two subtribes of Vandeae: 1) the Australasian Aeridinae and

2) the large African and Malagasy Aerangidinae + Angraecinae. Members of the 70 second subtribe are often referred to as “angraecoid” orchids and should be grouped into a single subtribe, Angraecinae (see name transfer in Chapter 5).

Paralogy in the ITS gene region has been reported by other workers in

Aeridinae (J. Schulman, personal communication) and was a concern for my study. However, cloning experiments with Angraecum calceolus as well as chloroplast data comparisons seem to indicate no paralogy in Angraecinae.

For the majority of Aeridinae in my study, only data from the ITS gene region were gathered and very few species were collected for each genus, so taxonomic conclusions are speculative. Based on my sampling, Acampe,

Phalaenopsis, Trichoglottis, Pelatantheria, Chiloschista, and Taeniophyllum

(including Microtatorchis) are monophyletic. Cleisostoma, Robiquetia, and

Vanda (as currently circumscribed) are not monophyletic. In the strict consensus, Chiloschista and Taeniophyllum are part of one large clade.

Taeniophyllum is sister to the leafy genus Sarcochilus, and Chiloschista is sister to a leafy clade of Amesiella, Tuberolabium, and Dyakia. This would suggest that leaflessness probably evolved at least three times within Aeridinae (in each of the leafy ancestors of Taeniophyllum, Chiloschista, and Phalaenopsis).

Within Phalaenopsis, two main clades exist: 1) subgenus Phalaenopsis including sections Deliciosae, Aphyllae, Proboscidioides, Parishianae, and

Esmeralda; and 2) subgenus Phalaenopsis, including sections Phalaenopsis and

Stauroglottis as well as subgenus Polychilos including sections Amboinensis,

Zebrinae, and Polychilos. Section Aphyllae is monophyletic (72% BS) if P. lowii

(section Proboscidioides) is included. Phalaenopsis lowii is morphologically 71 similar to section Aphyllae (Christenson, 2001), which would support its inclusion within section Aphyllae. The monophyly of section Deliciosae is questionable because P. deliciosa is more closely related to section Aphyllae (65% BS) than to

P. chibae. Subgenus Polychilos is weakly supported as monophyletic (78% BS), excluding P. fuscata, which is unresolved in a clade with P. deliciosa/P. pulcherrima and P. amabilis/P. cornucervi.

Gussonea was originally circumscribed by Richard (1828) for Angraecum aphyllum Thouars. The genus was adopted by Schlechter (1918) and Perrier de la Bâthie (1941) to include all leafless African and Malagasy angraecoids.

Schlechter (1918) divided Gussonea into subgenus Eu-Gussonea with elongate stems and loosely spaced roots (i.e., Solenangis aphylla) and subgenus

Taeniophylloides with shortened stems and densely tufted roots (i.e., Microcoelia spp.). As noted by Summerhayes (1943), Gussonea A. Rich. is actually a later homonym of the Euphorbiaceae genus Gussonia (now a synonym of Sebastiana) previously described by Sprengel. In his treatment of the leafless angraecoids,

Summerhayes (1943) split Gussonea into two genera, which are comparable to

Schlechter’s subgenera (1918), based on floral morphology and overall habit: the long-stemmed Solenangis and the short-stemmed Microcoelia. Currently,

Solenangis includes two leafless species [S. aphylla and S. cornuta (Rchb.f.)

Summerh.], one intermediate species with reduced leaves [S. conica (Schltr.)

L.Jonsson], and three species with well-developed leaves [S. clavata, S. scandens (Schltr.) Schltr., and S. wakefieldii]. Based on sequence data, the leafless S. aphylla and S. cornuta seem to be more closely related to other 72 species of Microcoelia than to the leafy species of Solenangis (S. clavata and S. wakefieldii). In the strict consensus of the combined analyses, S. clavata + S. wakefieldii are sister to Microcoelia + leafless Solenangis. While there is no support for this relationship, it is interesting to note the affinities between these two genera. Solenangis aphylla was originally transferred from Gussonea into the genus Microcoelia by Summerhayes (1936), and the results of my molecular phylogenetic analyses support the transfer of S. aphylla back to M. aphylla

(Thouars) Summerh. However, Solenangis cornuta was a new combination of

Summerhayes’ (1942), transferred from Gussonea cornuta Ridley. The results of my molecular phylogenetic analyses support the transfer of S. cornuta to M. cornuta. The type species of Solenangis, S. scandens, possesses well- developed photosynthetic leaves. Further sampling of S. scandens (the type species) and S. conica (an intermediate species with small, deciduous, conical leaves) would be needed before conclusions about the monophyly of the leafy species of Solenangis can be made.

Two other African leafless genera that have been recognized as segregates of Microcoelia are Chaulidion Summerh. and Encheiridion Summerh.

Summerhayes transferred Microcoelia macrorrhynchia (Schltr.) Summerh. to

Encheiridion macrorrhynchium (Schltr.) Summerh. based on the trilobed lip and horizontally elongate rostellum (Summerhayes, 1943). In Jonsson’s revision of

Microcoelia (1981), he found several intermediate species [namely M. leptostele

(Summerh.) L.Johnsson, M. nyungwensis L.Jonsson, and M. sanfordii

L.Jonsson] that formed a continuum in lip morphology with Encheiridion 73 macrorrhynchium. Given this floral evidence, Jonsson logically transferred

Encheiridion back into Microcoelia (Jonsson, 1981).

In the same publication on leafless angraecoids that Summerhayes (1943) introduced Encheiridion, he also created a new genus and species, Chaulidion buntingii Summerh., based on callus morphology in the lip. Summerhayes mentioned the resemblance of this species to Microcoelia, especially in vegetative habit and pollinarium structure (Summerhayes, 1943). During his monographic work on Microcoelia, Jonsson transferred Summerhayes’

Chaulidion buntingii (Summerhayes, 1943) to Chaulidion deflexicalcaratum

(DeWild.) L.Jonsson. Chaulidion deflexicalcaratum was originally described by

De Wildeman (1916) as Angraecum deflexicalcaratum and then was later transferred to the short-stemmed section of Gussonea by Schlechter (1918).

Interestingly, Summerhayes transferred Gussonea deflexicalcarata (DeWilde.)

Schltr. to Microcoelia deflexicalcarata (DeWilde.) Summerh. in the same publication in which he described the new genus Chaulidion. Jonsson (1979) contributed Summerhayes’ confusion to not having access to De Wildeman’s original material of Angraecum deflexicalcaratum. In examining type material for both M. deflexicalcarata and Chaulidion buntingii, Jonsson felt that these species were conspecific and should be lumped together under the older name of C. deflexicalcarata. Although Chaulidion and Encheiridion were not sampled in my study, their vegetative and floral similarity to Microcoelia is a strong indication that they should be included in Microcoelia. 74

The only remaining leafless Old World member of Aerangidinae is

Taeniorrhiza Summerh., a monotypic genus native to Africa. In his description of the genus, Summerhayes (1942) separated Taeniorrhiza from the remaining leafless Aerangidinae by its flattened roots, single-flowered inflorescences, winged column, and -like lip. Unfortunately, Taeniorrhiza was not sampled in my study and because it is so morphologically distinct, conclusions of its phylogenetic position cannot be made.

Rhipidoglossum has traditionally been segregated from Diaphananthe by two key features: a column foot and a distinct conical projection or “tooth-like” callus at the opening of the spur (Garay, 1972b; Senghas, 1986; Summerhayes,

1960). However, Summerhayes (1960) and Cribb (1989) observed a complete continuum in these floral character states within Diaphananthe and

Rhipidoglossum. Sequence data support the inclusion of Rhipidoglossum with

Cribbia and Diaphananthe millarii, while most species of Diaphananthe in my study are most closely related to Chamaeangis. It is clear from these preliminary analyses that Rhipidoglossum and Diaphananthe do not form a monophyletic group, exclusive of other Aerangidinae. However, given the relatively small percentage of Diaphananthe and Rhipidoglossum species sampled in my study

(Table 2-2), no nomenclatural changes are made.

In all molecular analyses, species of Aerangis form a monophyletic group with the inclusion of Microterangis hariotiana (the type species) and M. hildebrandtii. Before Senghas erected the genus Microterangis (1985), most of its members were included in Chamaeangis section Microterangis (Schlechter, 75

1918). Morphologically, flowers of Microterangis look more similar to

Chamaeangis than to Aerangis; but molecular data clearly indicate this to be convergence rather than homology. The type species (M. hariotiana) and M. hildebrandtii are both transferred to Aerangis (see Chapter 5). However, the remaining five species of Microterangis will need further study to determine their taxonomic positions.

It is interesting to note that the sister taxa of the New World Angraecinae are African, suggesting an African ancestor of Campylocentrum and

Dendrophylax. Paralogous ITS sequences were never found in New World

Angraecinae or their African Angraecum relatives, but paralogy was very common in the Malagasy Angraecinae (especially Aeranthes, Angraecum,

Oeoniella, Sobennikoffia, Jumellea, and Lemurorchis). Cryptopus, Oeonia,

Neobathiea, and Lemurella (also Malagasy Angraecinae containing orthologous

ITS sequences) are most closely related to Beclardia (Malagasy Aerangidinae), and this clade is embedded in a large, poorly resolved angraecoid clade. The topology of the combined three gene tree suggests that duplication events creating paralogy probably originated in Madagascar and spread to closely allied

Angraecinae in Africa (e.g., Angraecum conchiferum, A. dives, and A. teres).

Angraecum is clearly polyphyletic in all analyses. With over 200 species

(15 of which were included in my study) and alliances to America

(Campylocentrum and Dendrophylax) as well as Madagascar and Africa

(Aeranthes, Jumellea, Lemurorchis, and Aerangidinae) its polyphyletic nature is not surprising. Bonniera, Oeoniella, and Sobennikoffia are embedded within a 76 clade composed primarily of species of Angraecum. Jumellea and Aeranthes each seem to be monophyletic. However, without more extensive taxon sampling (especially of the genus Angraecum), taxonomic decisions about most traditional Angraecinae are premature.

The large polytomy of Cyrtorchis, Listrostachys, Podangis, Rangaeris,

Tridactyle, and Ypsilopus showed that generic circumscriptions of these genera may need to be reconsidered. Cyrtorchis is clearly monophyletic while

Listrostachys and Podangis may also be distinct genera (only one of the two species of Listrostachys was sampled and Podangis is monotypic). Some species of Rangaeris are more closely related to other genera (Podangis and

Tridactyle) than they are to one another, but no clear pattern of relationships was found. The two species of Ypsilopus sampled are more closely related to

Tridactyle than they are to one another, so Ypsilopus should probably be transferred to Tridactyle. However, more taxon sampling within Tridactyle (only six of the 43 species were sampled), would be needed to make any taxonomic conclusions about the generic concepts of Tridactyle.

Mystacidium forms a monophyletic group in the combined bootstrap analysis, but Angraecopsis parviflora is weakly supported (55% BS) as a sister species. The remaining Angraecopsis species are more closely related to

Sphyrarhynchus than to Mystacidium. However, support for the position of A. parviflora is extremely weak and with further taxon sampling, Angraecopsis and

Mystacidium may be prove to be monophyletic genera. 77

While there are problems with the monophyly of several genera mentioned above, many angraecoid genera are monophyletic in the combined bootstrap consensus. The New World Campylocentrum and Dendrophylax, as redefined by Carlsward et al. (2003) form well-supported clades. Old World angraecoid genera that also form monophyletic groups are: Cryptopus, Aeranthes,

Jumellea, Eurychone, Ancistrorhynchus, Bolusiella, and Cyrtorchis. Oeonia,

Neobathiea, Lemurella, Beclardia, Lemurorchis are all very small genera with only one species sampled from each, and they are likely monophyletic as well. CHAPTER 3 VEGETATIVE ANATOMY OF VANDEAE

Introduction

Vandeae comprise a large group of epiphytic monopodial taxa. These exhibit a wide variety of habits from plants with elongate stems and well- developed photosynthetic leaves, to plants with abbreviated stems and caducous leaves, to plants with abbreviated stems and small nonphotosynthetic scale leaves. This range of variation can be seen in both subtribes: Aeridinae and

Angraecinae (including Aerangidinae, sensu Dressler, 1993). The focus of my anatomical studies concerns the African and Malagasy subtribe, Angraecinae.

Taxa of Aeridinae examined were primarily leafless and served for sister group comparisons with Angraecinae. More distantly related outgroups, Polystachya and Neobenthamia (Polystachyinae, Epidendreae), were examined and compared with members of tribe Vandeae.

Although several regional or familial anatomical surveys have included miscellaneous vandaceous taxa (Barthlott, 1981; Cheadle & Kosakai, 1982;

Chiang & Chou, 1971; Curtis, 1917; Das & Paria, 1992; Dycus & Knudson, 1957;

Engard, 1944; Kaushik, 1983; Mohana Rao et al., 1989; Møller & Rasmussen,

1984; Mulay & Panikkar, 1956; Olatunji & Nengim, 1980; Oliveira & Sajo, 1999;

Porembski & Barthlott, 1988; Pridgeon et al., 1983; Rasmussen, 1986a; Sanford

& Adanlawo, 1973; Singh, 1986; Williams, 1979), very little anatomical work has been done specifically with taxa of Vandeae. One of the most comprehensive

78 79 studies of a group of leafless Vandeae was that by Jonsson (1981), in his monograph of Microcoelia. The anatomy and morphology Chiloschista lunifera were briefly examined by Jeyamurthy et al. (1990). Clements and Claypole

(1982, unpublished data) performed an ontogenetic investigation of

Taeniophyllum glandulosum and were particularly interested in how roots are converted into shoots during vegetative propagation via plantlet formation.

To clarify taxonomic issues, Arends and Stewart (1989) and Sulistiarini

(1986) examined leaf anatomy of Luisia latipetala and Aerangis gracillima

(respectively) and compared their results with other members of the same genus.

In their study of the leaf anatomy of Ossiculum aurantiacum, Gasson and Cribb

(1986) also surveyed leaf anatomical characters for many other angraecoid taxa to make systematic comparisons with O. aurantiacum. Nseya and Arends (1995) examined the vegetative anatomy and chromosome number of 10 species in the

African genus Cyrtorchis. In the leaves they found: abaxial, paracytic stomata; generally no hypodermis; mesophyll homogeneous to heterogeneous only above the midrib to heterogeneous throughout; and mechanical cells (sclerites) present in several species of the genus. Most of their observations for roots were quantified, and they recorded the following range of variation for Cyrtorchis: velamen 0.12 to 1.89 mm; exodermis 0.07 to 0.20 mm; cortical parenchyma 2.1 to 7.4 mm; and central cylinder 0.39 to 2.28 mm wide.

Members of Aeridinae are by far the most common vandaceous taxa included in orchid anatomical surveys. The anatomy of Luisia filiformis was examined during a survey of the ecological anatomy of several Sikkim Himalayan 80 orchids (Mohana Rao et al., 1989). They found L. filiformis possessed paracytic stomatal complexes, no absorbing trichomes, no hypodermis, an undifferentiated mesophyll, leaf idioblasts with “multispiral cellulosic thickenings,” and in roots a

∪-thickened endodermis and no mycorrhizae.

Kaushik (1983) published an extensive survey of the vegetative anatomy for

Himalayan Orchidaceae, in which he included the following taxa of Aeridinae

(Sarcanthinae): , A. odorata, A. vandarum, Camarotis obtusa,

C. purpurea, , Luisia trichorhiza, Kingidium taenialis,

Rhynchostylis retusa, Cleisostoma micranthum, C. gemmatum, , and Vandopsis undulata. Kaushik was able to define Aeridinae as plants without pseudobulbs; with adventitious roots formed along the entire length of the stem; and with distichous, nonplicate leaves. He broke the subtribe into the following groups, based on water-storage idioblasts in leaves, roots, and stems : A)

Kingidium + Camarotis, idioblasts absent; B) Vandopsis + Gastrochilus, idioblasts large with smooth cell walls; C) Cleisostoma + Aerides + Rhynchostylis

+ Vanda, + Luisia, idioblasts club- or barrel-shaped with various banded cell wall thickenings.

In a survey of developmental root anatomy for 10 Taiwanese orchid species, Chiang (1971) examined the following vandaceous taxa: Haraella odorata, Phalaenopsis amabilis, Sarcanthus fuscomaculatus, Saccolabium formosana, and Thrixspermum saruwatarii. Roots possessed two to four velamen layers with endophytic fungi and algae in all specimens examined. 81

Singh (1986) examined the root anatomy of four species of Aeridinae:

Rhynchostylis retusa, Vanda cristata, V. roxburghii, and Aerides odoratum.

Velamen layers ranged from two to eight; the exodermal walls were either ∪- or

O-thickened; the endodermal cells were either thin-walled or O-thickened; and the number of vascular groups (xylem + phloem) ranged from 11 to 46.

In their survey of leaf anatomy in nine epiphytic orchids, Oliveira and Sajo

(1999) examined and found lignified cells in the mesophyll as well as in the subepidermal layer and no water-storage tissue.

In his monograph of aerial orchid roots, Leitgeb (1864) examined several genera of Vandeae, mainly of the subtribe Aeridinae. In this extensive treatment,

Leitgeb was first to describe “Deckzellen,” or cover cells, in the velamen of many vandaceous genera. Cover cells form a tiered mantle, or covering, of two to four wedge-shaped cells that develop from the inner velamen above the passage

(short) cells of the exodermis. Cover cells may be associated with tilosomes in other orchid tribes, and several other anatomists mention their occurrence within

Vandeae (Mulay & Panikkar, 1956; Solereder & Meyer, 1930). Although Curtis

(1917) did not observe cover cells (his “pyramidal cells”) in Sarcochilus adversus

(his representative of Vandeae), he does mention these structures in

Dendrobium cunninghamii (which lacks tilosomes).

Areas of the velamen that remain dry after wetting were first observed by

Leitgeb (1864) and subsequently termed “pneumathodes” by Jost (1887).

Haberlandt (1914) also described the structure of pneumathodes in

Taeniophyllum zollingeri. According to Haberlandt (1914), the pneumathode was 82 composed of three parts: a wedge-shaped area of air-filled velamen cells; one

(usually) to several thin-walled exodermal cells; and several specialized cortical cells he called “complementary cells” (a term typically used for lenticel tissue in the bark of trees). Dycus and Knudson (1957), in their study of the role of the velamen in aerial roots, described pneumathode cells as more heavily lignified than surrounding velamen cells, but they did not detect any specialized cortical complexes below these specialized velamen areas. In a scanning electron microscope (SEM) survey of plant epidermal surfaces, Barthlott (1981) described the “spotted” appearance of the root surface for Taeniophyllum sp. While

Barthlott does not describe them as such, these spots probably correspond to pneumathodes in the velamen, which are able to retain air when wetted with water and are thus different from surrounding areas.

Jonsson (1981) observed pneumathodes in the velamen of Microcoelia exilis using transmission electron microscopy (TEM). He found that velamen cells of the pneumathode possessed pores covered by a thin membrane, which would explain the “spotted” appearance of the velamen as viewed with an SEM

(Barthlott, 1981). Benzing et al. (1983) later examined pneumathodes in several leafless and leafy vandaceous taxa and compared them to nonvandaceous taxa

( tampensis and radicans). Their definition of pneumathode was more restrictive than Haberlandt’s (1914) and only included the air-filled cells of the velamen, while the adjacent cortical layers (exodermal cell + cells of the assimilatory cortical region) were defined as “aeration units.” These aeration units potentially act as cortical stomatal complexes, regulating gas exchange 83 between the photosynthetic cortex and air-filled velamen cells, a function of pneumathodes that had been hypothesized by Schimper in 1888 (Pridgeon,

1987).

Pridgeon et al. (1983) examined tilosomes (rod-bodies or Stabkörper) and speculated on their systematic occurrence in Orchidaceae and created a classification scheme of tilosome types. Of the 31 vandaceous genera examined, only one unidentified species of Saccolabium (SEL77-2791) possessed broadly lamellate tilosomes. In their extensive study of velamen types in Orchidaceae, Porembski and Barthlott (1988) did not find any tilosomes in Vandeae.

The root multiple epidermis itself has been characterized in an extensive survey of velamen micromorphology assembled by Porembski and Barthlott

(1988). They found a consistent and unique type of velamen, the “Vanda type,” for the 46 vandaceous genera surveyed. Velamina consisted of two to five cell layers with a distinct epivelamen, the cells of which are typically thinner-walled than those of the endovelamen. Cell wall thickenings were large, helical, and anastomosing; unthickened walls may show small pores. Sanford and Adanlawo

(1973) previously examined the velamen and exodermis of several West African epiphytic taxa and related these characteristics to habitat tolerance. They found that velamina with more cell layers were typically found in taxa that grew in drier, harsher habitats than those with fewer cell layers. They also classified the velamen into three categories based on its wall striations: type I with broad parallel unbranched and uncrossing striations; type II with broad branched and 84 occasionally crossing striations; and type III with very fine striations that usually crossed one another. Vandeae generally possessed two velamen layers with type I or type II thickenings (Sanford & Adanlawo, 1973).

Olatunji and Nengim (1980) examined the occurrence and distribution of

“tracheoidal” idioblasts among Orchidaceae. They speculated on the function of these cortical idioblasts and concluded that they most likely provide mechanical support to surrounding thin-walled parenchyma via their wall thickenings.

Solereder and Meyer (1930) described these idioblasts as water-storage cells with various thickenings (spiral, reticulate, ring, or ridge-like). The term

“tracheoidal idioblast” was originally coined by Adriance Foster (1956) to describe idioblasts resembling tracheids because of their wall thickenings.

Although these idioblasts may serve in water storage and/or mechanical support, their function is in no way associated with water or mineral conduction (as the term “tracheoidal” might suggest). Burr and Barthlott (1991) further confused the issue by collectively calling these tracheoidal cells a “pseudovelamen” because their thickenings were similar to those of velamen cells. The development of these cortical cells is independent of the velamen’s development.

Olatunji and Nengim (1980) conducted the most extensive survey of

Vandeae; they examined roots, stems, and leaves for 44 West African species of

Angraecinae and Aerangidinae (sensu Dressler, 1993). They found two general types of idioblasts in roots, stems, and leaves: the Cyrtorchis type with broad, widely spaced thickenings and the type with thinner, closer thickenings. The most common type of idioblast in all taxa, excluding 85

Bulbophyllum Thou., was the Cyrtorchis type. Idioblasts occurred in all organs of

Vandeae, but were most commonly found in roots and leaves (Olatunji &

Nengim, 1980). Perhaps because of the term pseudovelamen, Porembski and

Barthlott (1988) included the presence of tracheoidal idioblasts in their survey of the velamen radicum in Orchidaceae. Among the 46 vandaceous taxa examined, they found idioblasts in the roots of: Aerides multiflorum, siamense, quasipinifolium, micrantha, and

Calyptrochilum christyanum.

Cheadle and Kosakai (1982) surveyed the occurrence of vessels in roots, stems, inflorescence axes, and leaves of Orchidaceae and included Angraecum conchiferum Lindl., Cyrtorchis arcuata, C. praetermissa, Diaphananthe xanthopollinia (= Rhipidoglossum xanthopollinium), Mystacidium capense,

Phalaenopsis sp., Renanthera matutina, , Tridactyle bicaudata, and Vanda tricolor. They found vessels with scalariform perforation plates in the roots, stems, inflorescence axes, and leaves of Vandeae sensu

Dressler (1993). Tracheids were restricted to stems, inflorescence axes, and leaves.

The most comprehensive surveys of stegmata in Orchidaceae were completed by Møller and Rasmussen (1984) and more recently by Prychid et al.

(2003). The three conditions that exist among Orchidaceae are: stegmata present with conical silica bodies, stegmata present with spherical silica bodies, and stegmata absent. Spherical silica bodies were consistently found in

Vandeae as well as in the genera Apostasia, , and Dendrobium. According 86 to Rasmussen (1986a), conical silica bodies are probably the ancestral condition for the family, with spherical silica bodies secondarily derived from either the conical or the absent condition. Prychid et al. (2003) provided alternatives to this hypothesis and suggested that the presence of both conical and spherical silica bodies may be ancestral or that both independently originated in Apostasia and the epidendroid groups.

Studies of leaf anatomy that include Vandeae are less common than those of the root. Williams (1979) examined subsidiary cell development and distribution in several groups of Orchidaceae. Although the emphasis of this study was on Oncidieae, 24 species of Vandeae were included. Most Vandeae possessed stomata distributed along the abaxial surface only; Doritis pulcherrima, Saccolabium hendersonianum, Vanda tricolor, and Chamaeangis orientalis exhibited an amphistomatal pattern of distribution. Subsidiary cells ranged from two to less commonly four, and their cell wall divisions were consistently oblique. There was no attempt to derive systematic implications for

Vandeae.

Das and Paria (1992) also examined the stomatal structure of several

Vandeae in their survey of Orchidaceae from . Most taxa were hypostomatic, except for Aerides multiflorum, Rhynchostylis retusa, and Vanda tessellata which were amphistomatic. They found three categories of stomata: type I consisted of four very similar subsidiary cells forming a circle around the guard cells; type II consisted of two elongate and parallel + two short and perpendicular subsidiary cells surrounding the guard cells; type III consisted of 87 undifferentiated subsidiary cells. Among the seven species of Aeridinae studied, type I stomatal complexes were most common, type II stomatal complexes were less common, and type III stomatal complexes were absent in Vandeae.

Material and Methods

Fresh and dry plant materials in my study were obtained from various botanical gardens, commercial and private horticultural collections, herbarium specimens, and wild-collected plants. When possible, vouchers for these materials were deposited at FLAS and/or SEL (Table 3-1). Prepared slides on loan from the Royal Botanic Gardens, Kew, were also used. Fresh plant materials were preserved in FAA (9 parts 40% formalin, 0.5 parts 70% ethanol, and 0.5 parts glacial acetic acid) for at least 48 hours and stored in 70% ethanol before sectioning. Materials obtained from herbarium specimens were rehydrated in concentrated ammonia for at least 24 hours, washed thoroughly in tap water, and stored in 70% ethanol (Toscano de Brito, 1996).

Stems were unavailable for most specimens primarily because the monopodial nature of vandaceous orchids usually necessitates destroying the entire plant in order to collect stems. Preliminary observations of stem anatomy for the few available specimens showed very little variation among taxa, as noted in previous studies (Kaushik, 1983; Withner et al., 1974). Therefore, stem anatomy was omitted from anatomical descriptions and phylogenetic analyses.

Transverse (TS) and longitudinal (LS) sections of unembedded leaves and roots were made with a sliding microtome at a thickness of 50 to 90 µm. Root and leaf specimens that could not be cut with the sliding microtome were embedded in paraffin (melting point = 55oC) using a graduated tertiary butyl 88 alcohol/ethyl alcohol series and sectioned with a rotary microtome at a thickness of 10 µm. All sections for light microscopy were stained with Heidenhain’s iron- alum hematoxylin and safranin (Carlsward et al., 1997). Differentiation and dehydration of stained sections were carried out in a graduated ethanol series followed by clearing in limonene (CitriSolv, Fisher Scientific Company). Sections were then mounted on microscope slides with Canada balsam and photographed with an Olympus BH-2 Epifluorescent microscope attached to a Pixera 120C digital camera using Studio Pro software.

To examine tilosomes and velamen wall thickenings, 90 to 120 µm root cross sections for scanning electron microscopy were dehydrated in a graded ethanol series and dried in a critical point dryer using liquid CO2. Dried sections were then mounted on clean aluminum stubs with double-sided adhesive graphite tabs. Mounted sections were coated with gold-palladium for approximately 60s in an argon vacuum. Sections were photographed digitally using an Hitachi S-4000 scanning electron microscope attached to a computer utilizing Spectrum Mono software. Descriptions of tilosomes follow Pridgeon et al. (1983).

Slides prepared at Kew were usually stained with safranin and alcian blue

(or fast green), a combination which frequently makes cellular organelles undetectable. When possible, only nonKew specimens were used to report the presence of organelles within tissues such as chlorenchyma.

The terms “small” and “large” are used in reference to cell or space sizes relative to the size of surrounding cells of the plant organ. Where root hairs are 89 present, the velamen and exodermis are thinner-walled than when hairs are absent. Therefore, for the sake of consistency, data for phylogenetic analyses of the velamen and exodermis have been recorded from areas lacking root hairs when possible.

Mesophyll and epidermal cells above the midrib are usually different from surrounding cells. The categories used to describe the degree of modification in

Vandeae are: (1) unmodified, cells above midrib not differentiable from surrounding cells (Fig. 3-1a); (2) slightly modified, cells anticlinally elongate to isodiametric and ± differentiable from surrounding cells (Fig. 3-1b); and (3) distinctly modified, cells anticlinally elongate and clearly differentiable from surrounding tissue (Fig. 3-1c).

Distinctly dense inner tangential wall thickenings of the endovelamen were found over both long and short cells of the exodermis and superficially resembled tilosomes. These structures differed from regular velamen wall thickenings primarily because of their thickness and morphology. The differentiation between these pronounced endovelamen thickenings and true tilosomes was not usually clear using just light microscopy and often required SEM observations. The two types of endovelamen thickenings observed in Vandeae were smooth (Fig. 3-2) and ridged (Fig. 3-3).

In many taxa studied, large areas of thin-walled, empty, lignified and/or suberized cells can be found localized along the periphery of the root cortex (Fig.

3-4) or root periphery when the velamen has been sloughed off of the root. 90

These areas seem to be derived from the exodermis and are therefore referred to as exodermal proliferations.

The wall structure of water-storage cells in leaves and roots formed a complete continuum between unthickened and smooth to secondarily thickened and banded. Birefringence of these water-storage cells refers to the refractive quality, or isotropy, of the cell walls as viewed with polarized light. Anisotropic walls (which may be primary and/or secondary in nature) are referred to as birefringent. Thickenings of the anisotropic cell walls varied across a complete continuum: spiral thickenings, evenly banded thickenings, wide bands anastomosing to form pits, and edge-thickened (Fig. 3-5). Edge-thickened cells are water-storage cells with secondary thickenings along the cell’s ridges, as viewed in thick sections three-dimensionally (described on p. 42 of Solereder and

Meyer, 1930).

Owing to the use of ferric ammonium sulfate mordant, raphides and other calcium oxalate crystals were difficult to observe in leaf and root specimens stained with Heidenhain’s iron-alum hematoxylin, and their absence in leaves and roots could not be reliably determined in my study. Raphides are found throughout Orchidaceae (Solereder & Meyer, 1930) and are not generally of value in phylogenetic analyses of orchid subgroups (Holtzmeier et al., 1998;

Stern & Judd, 2000, 2001, 2002). 91

Figure 3-1. Leaf TS showing mesophyll above midrib. a) Cribbia brachyceras with mesophyll unmodified. b) Rhipidoglossum kamerunense with mesophyll slightly modified. c) Angraecum dives showing distinctly modified mesophyll. Scale bars = 100 µm. 92

Figure 3-2. Root TS showing smooth endovelamen thickenings (arrowheads) in Angraecum eburneum. a) Light micrograph with scale bar = 50 µm. b) Scanning electron micrograph with scale bar = 12 µm. 93

Figure 3-3. Root TS showing ridged endovelamen thickenings (arrowheads) in Jumellea arachnantha. a) Light micrograph with scale bar = 50 µm. b) Scanning electron micrograph with scale bar = 8.75 µm. 94

Figure 3-4. Root TS showing exodermal proliferation (e) in Cyrtorchis praetermissa. Scale bar = 100 µm.

For all specimens examined there were anatomical constants similar to those discussed by Stern and Judd (2002) in their treatment of Cymbidieae and in Stern and Carlsward (Stern & Carlsward, 2004). These constants are described in a general anatomical treatment of Vandeae below. Subsequent descriptions of genera within subtribes Angraecinae (including Aerangidinae, sensu Dressler, 1993) and Aeridinae primarily include patterns of variation from the general orchidaceous anatomy. 95

Figure 3-5. Water-storage idioblasts with various cell wall thickenings. a) Polarized leaf TS of Cryptopus paniculatus with spiral thickenings. b) Root TS of Calyptrochilum christyanum with evenly banded thickenings. c) Root TS of Jumellea filicornoides with pitted wall (pits indicated with arrowheads). d) Root TS of Dendrophylax porrectus with edge-thickened wall. Scale bars = 50 µm.

Twenty-six features of vegetative anatomy and morphology (Table 3-2) were used to construct a character matrix in the computer program MacClade

4.0.6 for Mac OS X. These characters were then employed in maximum parsimony cladistic analyses of Angraecinae (including Aerangidinae, sensu

Dressler, 1993) (Table 3-3). Quantitative characters were used only when discrete states could be delimited by gaps in the range of variation. Species of

Aeridinae were employed as sister group comparisons, and species of 96

Polystachyinae (Polystachya and Neobenthamia) were used as more distantly related outgroups on the basis of molecular analyses (Cameron et al., 1999;

Chase et al., 2003) as well as morphological studies of Orchidaceae

(Freudenstein & Rasmussen, 1999). When multiple specimens of a species were available, the characters were scored as a composite of all specimens for that species. For leafless species, states for leaf characters were coded as missing data (?) in the data matrix. The computer program Paup* 4.0b10

(Swofford, 1999) was used to perform parsimony analyses in which all characters were unordered. Heuristic searches were performed with 1000 random-addition sequence replicates, saving 10 trees per replicate. For branch-swapping, the subtree pruning and regrafting (SPR) algorithm was used, saving multiple trees

(MULTREES on). Due to limited computational resources (400Mhz G3 processor), the maximum number of trees saved for all analyses was limited to

20,000. All resulting trees were then swapped to completion. Bootstrap analyses utilized 1000 replicates, with 10 random-addition replicates (SPR swapping) per bootstrap replicate.

Organization of the anatomical descriptions and structure for all remaining phylogenetic analyses will follow the two main taxonomic conclusions made in

Chapter 2, the most important of which was the inclusion of Aerangidinae (sensu

Dressler, 1993) within Angraecinae. The leafless species of Solenangis

(including S. aphylla) were transferred back to the entirely leafless genus

Microcoelia, which will also be reflected henceforth. Table 3-1. Taxa of Vandeae examined for anatomical study. Specimen Organs Taxona Sourcec Voucherd (location)e numberb studiedf Tribe Vandeae Lindl., Subtribe Angraecinae Summerh. Aerangis biloba (Lindl.) Schltr. BSC 4 SEL hort. (1994-0052A) No voucher L, R A. biloba BSC 285 FLMNH hort. Whitten (FLAS) L, R A. confusa J.L.Stewart BSC 256 B. Bytebier, Africa Bytebier s.n. (EA) L, R A. confusa K 345-81-03740 Kew hort. Cribb s.n. (K) L, R A. coriacea Summerh. BSC 212 Hoosier Orchid Co. No voucher L, R A. coriacea BSC 269 B. Bytebier, Africa Bytebier 562 (EA) L, R A. kirkii (Rchb.f.) Schltr. BSC 253 B. Bytebier, Africa Bytebier 637 (EA) L, R A. kotschyana (Rchb.f.) Schltr. BSC 270 B. Bytebier, Africa Bytebier 671 (EA) L, R A. luteoalba var. rhodosticta (Kraenzl.) BSC 252 B. Bytebier, Africa Bytebier 691 (EA) L, R J.L.Stewart A. macrocentra (Schltr.) Schltr. BSC 226 J. Hermans hort. Kew 779 (K) L, R A. somalensis (Schltr.) Schltr. BSC 263 B. Bytebier, Africa Bytebier 1549 (EA) L, R A. thomsonii (Rolfe) Schltr. BSC 266 B. Bytebier, Africa Kirika 968 (EA) L, R A. ugandensis Summerh. BSC 238 B. Bytebier, Africa Bytebier 681 (EA) L, R A. ugandensis K 45064 Kew hort. No voucher L, R A. ugandensis WLS 1004 Kew hort. (1990-1559) No voucher L, R A. verdickii (DeWild.) Schltr. BSC 204 Countryside Orchids No voucher L, R Aeranthes arachnites (Thouars) Lindl. BSC 129 Cal-Orchid Carlsward 198 (FLAS) L A. arachnites WLS 1081 Kew hort. (1987-2133) No voucher L, R A. caudata Rolfe WLS 1032 Kew hort. (1975-2575) No voucher L, R A. grandiflora Lindl. BSC 128 Cal-Orchid Carlsward 238 (FLAS) R A. grandiflora K 559-69-04918 Kew hort. Stewart 1120 (K) L, R A. peyrotii Bosser WLS 1038 Kew hort. (1981-2685) No voucher L, R A. ramosa Rolfe BSC 215 J. Hermans hort. Kew 113 (K) L, R Ancistrorhynchus clandestinus (Lindl.) Schltr. K 53517 Kew hort. Summerhayes s.n. (K) L A. metteniae (Kraenzl.) Summerh. BSC 192 Uzumara Orchids No voucher, ver. La Croix L, R A. refractus (Kraenzl.) Summerh. K 424-70-04125 Kew hort. Stewart 1231 (K) R A. refractus WLS 1026 Kew hort. (201-80-01961) No voucher L, R Angraecopsis amaniensis Summerh. K 082-82-00606 Kew hort. Gassner & Cribb 193 (K) R A. breviloba Summerh. BSC 255 B. Bytebier, Africa Bytebier 307 (EA) L, R A. parviflora (Thouars) Schltr. BSC 220 J. Hermans hort. Kew 4363 (K) L, R A. parviflora K 366-80-03819 Kew hort. La Croix 49 (K) L, R Table 3-1. Continued Specimen Organs Taxona Sourcec Voucherd (location)e numberb studiedf Angraecum birrimense Rolfe BSC 198 WLS hort. Carlsward 278 (FLAS) L, R A. calceolus Thouars BSC 11 SEL hort. (1996-0480A) No voucher L, R A. chevalieri Summerh. BSC 13 SEL hort. (1997-0160) Carlsward 208 (SEL) L, R A. conchiferum Lindl. BSC 241 B. Bytebier, Africa Bytebier 616 (EA) L, R A. conchiferum K 120-82-01054 Kew hort. Brummitt 15966 (K) L, R A. cultriforme Summerh. BSC 210 Countryside Orchids Carlsward 298 (FLAS) L, R A. distichum Lindl. BSC 12 SEL hort. (1985-0821A) Carlsward 224 (SEL) L, R A. dives Rolfe BSC 268 B. Bytebier, Africa Marimoto 42 (EA) L, R A. eburneum Bory BSC 186 FLMNH hort. Carlsward 335 (FLAS) R A. eburneum ssp. giryamae (Rendle) Senghas K 424-70-04185 Kew hort. Stewart 292 (K) L, R & P.J.Cribb A. eburneum ssp. superbum (Thouars) BSC 141 FLMNH hort. Carlsward 182 (FLAS) L, R H.Perrier A. eburneum ssp. superbum BSC 154 FLMNH hort. Carlsward 186 (FLAS) L, R A. eburneum ssp. superbum var. longicalcar BSC 206 Countryside Orchids No voucher L, R Bosser A. eburneum ssp. xerophilum H.Perrier BSC 187 WLS hort. Carlsward 275 (FLAS) L, R A. eichlerianum Kraenzl. BSC 140 FLMNH hort. Carlsward 284 (FLAS) L, R A. erectum Summerh. BSC 274 B. Bytebier, Africa Bytebier 801 (EA) L, R A. gabonense Summerh. WLS 1046 Kew hort. (352-87-02561) No voucher L, R A. germinyanum Hook.f. BSC 207 Santa Cruz Orchids No voucher L, R A. multinominatum Rendle WLS 169 E. Ayensu Sanford 442/64 (IFE) L, R A. pungens Schltr. WLS 178 E. Ayensu Sanford 400/64 (IFE) L, R A. rutenbergianum Kraenzl. BSC 234 Santa Cruz Orchids Carlsward 300 (FLAS) L, R A. sacciferum Lindl. BSC 258 B. Bytebier, Africa Bytebier 1134 (EA) L, R A. sesquipedale Thouars K 231-65-23101 Kew hort. Mason 30 (K) L, R A. subulatum Lindl. WLS 18 E. Ayensu Sanford 7150 L, R A. teres Summerh. BSC 272 B. Bytebier, Africa Bytebier 675 (EA) L, R Beclardia macrostachya (Thouars.) A.Rich BSC 217 J. Hermans hort. Kew 3536 (K) L, R Bolusiella batesii (Rolfe) Schltr. BSC 19 SEL hort. (1997-0173A) Carlsward 152 (FLAS), L, R Nkongmeneck 2087 (SEL) B. iridifolia (Rolfe) Schltr. BSC 250 B. Bytebier, Africa Bytebier 1113 (EA) L, R B. maudiae (Bolus) Schltr. BSC 259 B. Bytebier, Africa Bytebier 485 (EA) L, R Table 3-1. Continued Specimen Organs Taxona Sourcec Voucherd (location)e numberb studiedf Bonniera appendiculata (Frapp. ex Cordem.) BSC 228 J. Hermans hort. Kew 4232 (K) L, R Cordem. Calyptrochilum christyanum (Rchb.f.) BSC 20 SEL hort. (1997-0165B) No voucher L, R Summerh. C. christyanum BSC 137 Andy’s Orchids No voucher L, R C. christyanum BSC 148 SEL hort. (1997-0239A) Carlsward 194 (SEL) L, R C. emarginatum (Sw.) Schltr. K 57248 Kew hort. Calleus s.n. (K) L, R C. emarginatum WLS 3 E. Ayensu Sanford 463/64 L, R Campylocentrum fasciola (Lindl.) Cogn. BSC 153 Hamlyn Orchids, Jamaica Carlsward 185 (FLAS) R C. micranthum (Lindl.) Rolfe BSC 143 J. Ackerman, Puerto Rico Ackerman 3341 (UPRRP) L, R C. pachyrrhizum (Rchb.f.) Rolfe BSC 157 Fakahatchee State Preserve, No voucher R Florida C. poeppigii (Rchb.f.) Rolfe BSC 144 H. Carnevali, Mexico Carnevali 4507 (CICY) R C. sullivanii Fawc. & Rendle BSC 280 Hamlyn Orchids, Jamaica Carlsward 301 (FLAS) R Chamaeangis lanceolata Summerh. WLS 1 E. Ayensu Sanford 459/65 L, R C. odoratissima (Rchb.f.) Schltr. WLS 13 E. Ayensu Sanford 659/66 (IFE) L, R C. sarcophylla Schltr. BSC 239 B. Bytebier, Africa Bytebier 339 (EA) L, R C. vesicata (Lindl.) Schltr. BSC 219 J. Hermans hort. Kew 399 (K) L, R C. vesicata BSC 267 B. Bytebier, Africa Bytebier 796 (EA) L, R C. vesicata K 084-81-01305 Kew hort. Bailes 363 (K) L Cribbia brachyceras (Summerh.) Senghas BSC 236 B. Bytebier, Africa Bytebier 361 (EA) L, R C. brachyceras K 084-81-01175 Kew hort. Bailes 258 (K) L, R C. brachyceras WLS 1057 Kew hort. (1981-3763) No voucher L, R C. confusa P.J.Cribb BSC 214 J. Hermans hort. Kew 3936 (K) L, R Cryptopus elatus (Thouars.) Lindl. BSC 189 Uzumara Orchids No voucher, ver. La Croix L, R C. paniculatus H.Perrier BSC 117 Andy’s Orchids Carlsward 294 (FLAS) L, R C. paniculatus BSC 223 J. Hermans hort. Kew 5392 (K) L, R Cyrtorchis arcuata (Lindl.) Schltr. BSC 249 B. Bytebier, Africa Bytebier 676 (EA) L, R C. arcuata ssp. whytei (Rolfe) Summerh. BSC 31 SEL hort. (1997-0087A) No voucher L, R C. aschersonii (Kraenzl.) Schltr. WLS 75 Datsun s.n. USNM L, R C. chailluana (Hook.f.) Schltr. BSC 29 SEL hort. (1996-0294) Carlsward 156 (SEL) L, R C. praetermissa Summerh. BSC 203 Countryside Orchids No voucher L, R C. praetermissa WLS 1213 SEL hort. (1978-531) No voucher R Table 3-1. Continued Specimen Organs Taxona Sourcec Voucherd (location)e numberb studiedf Cyrtorchis ringens (Rchb.f.) Summerh. BSC 30 SEL hort. (1997-0154A) Carlsward 226 (FLAS), L, R Nkongmeneck 1388 (SEL) Dendrophylax alcoa Dod BSC 169 UPRRP, rehydrated material Ackerman 2773 (UPRRP) R D. barrettiae Fawc. & Rendle BSC 152 Hamlyn Orchids, Jamaica Carlsward 199 (FLAS) R D. filiformis (Sw.) Carlsward & Whitten BSC 185 J. Ackerman, Puerto Rico Whitten 1842 (FLAS) R D. funalis (Sw.) Benth. ex Rolfe BSC 32 Andy’s Orchids Photo (FLAS) R D. funalis K 18265 Kew hort. No voucher R D. gracilis (Cogn.) Garay BSC 167 UPRRP, rehydrated material Ackerman 3118 (UPRRP) R D. lindenii (Lindl.) Benth. ex Rolfe BSC 71 Unknown garden origin No voucher R D. lindenii BSC 156 Fakahatchee State Preserve, No voucher R Florida D. porrectus (Rchb.f.) Carlsward & Whitten BSC 142 J. Ackerman, Puerto Rico Ackerman 3340 (UPRRP) R D. porrectus BSC 145 G. Carnevali, Mexico Carnevali 5907 (CICY) R D. porrectus BSC 158 Fakahatchee State Preserve, No voucher R Florida D. porrectus BSC 184 Hamlyn Orchids, Jamaica Carlsward 184 (FLAS) R D. varius (Gmel.) Urb. BSC 168 UPRRP, rehydrated material Ackerman 2727 (UPRRP) R Diaphananthe bidens (Sw.) Schltr. BSC 33 SEL hort. (1997-0167A) Nkongmeneck 2079 (SEL) L, R D. bidens K 431-81-05022 Kew hort. Smith 597 (K) L, R D. fragrantissima (Rchb.f.) Schltr. BSC 240 B. Bytebier, Africa Kirika 536 (EA) L, R D. lorifolia Summerh. BSC 248 B. Bytebier, Africa Bytebier 346 (EA) L, R D. millarii (Bolus) H.P.Linder BSC 205 Countryside Orchids Carlsward 346 (FLAS) L, R Eggelingia ligulifolia Summerh. K 62063 Kew hort. No voucher L Eurychone rothschildiana (O’Brien) Schltr. BSC 288 Sunset Orchids Whitten (FLAS) L, R Jumellea arachnantha (Rchb.f.) Schltr. BSC 42 SEL hort. (1978-0422A) No voucher L, R J. arborescens H.Perrier WLS 1053 Kew hort. (1981-2756) No voucher L, R J. confusa (Schltr.) Schltr. BSC 211 Countryside Orchids No voucher L, R J. filicornoides (DeWild.) Schltr. BSC 246 B. Bytebier, Africa Bytebier 1266 (EA) L, R J. filicornoides K 143-81-02077 Kew hort. La Croix 158 (K) R J. flavescens H.Perrier K 5765 Kew hort. No voucher L, R J. phalaenophora (Rchb.f.) Schltr. WLS 983 Kew hort. (1975-2607) No voucher L, R J. sagittata H.Perrier BSC 43 SEL hort. (1981-1182A) Carlsward 232 (SEL) L, R J. sagittata BSC 229 J. Hermans hort. Kew 1150 (K) L, R Table 3-1. Continued Specimen Organs Taxona Sourcec Voucherd (location)e numberb studiedf Lemurella pallidiflora Bosser BSC 218 J. Hermans hort. Kew 4958 (K) L, R Lemurorchis madagascariensis Kraenzl. BSC 231 J. Hermans hort. Kew 5383 (K) L, R Listrostachys pertusa (Lindl.) Rchb.f. BSC 194 Uzumara Orchids No voucher, ver. La Croix L, R L. pertusa WLS 2 E. Ayensu Sanford 675/66 (IFE) L, R Microcoelia aphylla (Thouars) Summerh. BSC 174 Andy’s Orchids Carlsward 341 (FLAS) R M. aphylla BSC 225 J. Hermans hort. Kew 2389 (K) R M. bulbocalcarata L.Jonsson BSC 197 Uzumara Orchids No voucher, ver. La Croix R M. caespitosa (Rolfe) Summerh. S 1465 E. Ayensu Sanford 14/65 (IFE) R M. corallina Summerh. BSC 195 Uzumara Orchids No voucher, ver. La Croix R M. exilis Lindl. BSC 175 BNBG, spirit collection 87-0103 (BR) R M. exilis BSC 184 Sunset Orchids Whitten (FLAS) R M. exilis BSC 275 B. Bytebier, Africa Bytebier 1255 (EA) R M. globulosa (Hochst.) L.Jonsson BSC 177 BNBG, spirit collection 91-0194-71 (BR) R M. globulosa BSC 243 B. Bytebier, Africa PCP 488 (EA) R Microcoelia macrantha (H.Perrier) Summerh. BSC 176 BNBG, spirit collection 90-0043 (BR) R M. macrantha BSC 232 J. Hermans hort. Kew 5391 (K) R M. macrorrhynchia (Schltr.) Summerh. BSC 178 BNBG, spirit collection 86-0086 (BR) R M. macrorrhynchia WLS 80 Unknown garden origin No voucher R M. megalorrhiza (Rchb.f.) Summerh. BSC 247 B. Bytebier, Africa Bytebier 1250 (EA) R M. obovata Summerh. BSC 254 B. Bytebier, Africa Bytebier 1256 (EA) R M. perrieri (Finet) Summerh. BSC 47 SEL hort. (1984-0109A) Photo (FLAS), R verified by L. Jonsson M. physophora (Rchb.f.) Summerh. BSC 244 B. Bytebier, Africa Bytebier 629 (EA) R M. smithii (Rolfe) Summerh. BSC 251 B. Bytebier, Africa Bytebier 1248 (EA) R M. stolzii (Schltr.) Summerh. BSC 196 Uzumara Orchids Carlsward 287 (FLAS) R M. stolzii WLS 981 Kew hort. (224-84-01954) No voucher R Microterangis hildebrandtii (Rchb.f.) Senghas BSC 222 J. Hermans hort. Kew 2616 (K) L, R Mystacidium braybonae Summerh. BSC 134, 135 Andy’s Orchids Carlsward 179 (FLAS) L, R M. capense (L.f.) Schltr. K 261-83-03283 Kew hort. Stewart s.n. L, R M. flanaganii (Bolus) Bolus BSC 224 J. Hermans hort. Kew 5084 (K) L, R Neobathiea grandidieriana (Rchb.f.) Garay BSC 193 Uzumara Orchids No voucher, ver. La Croix L, R N. grandidieriana BSC 216 J. Hermans hort. Kew 3450 (K) L, R Table 3-1. Continued Specimen Organs Taxona Sourcec Voucherd (location)e numberb studiedf Oeonia rosea Ridl. BSC 166 FLMNH hort. Whitten (FLAS) R O. rosea BSC 221 J. Hermans hort. Kew 3222 (K) L, R Oeoniella polystachys (Thouars) Schltr. BSC 123 Cal-Orchid Carlsward 221 (FLAS) L, R O. polystachys BSC 213 J. Hermans hort. Kew 2194 (K) L, R O. polystachys K 433-75-04420 Kew hort. Mason 1073 (K) L, R Ossiculum aurantiacum P.J.Cribb & Laan K 473 Kew hort. Laan 718 (K) L caudatus (Lindl.) Summerh. BSC 69 SEL hort. (1997-0179A) Nkongmeneck 3018 (SEL) L, R P. caudatus K 391-83-04788 Kew hort. No voucher L, R P. caudatus WLS 624 Kew hort. (391-83-04788) No voucher L, R Podangis dactyloceras (Rchb.f.) Schltr. BSC 70 SEL hort. (1996-0293A) No voucher L, R P. dactyloceras BSC 227 J. Hermans hort. Kew 4999 (K) L, R P. dactyloceras K 16654 Kew hort. No voucher L, R Rangaeris amaniensis (Kraenzl.) Summerh. BSC 265 B. Bytebier, Africa Bytebier & Kirika 26 (EA) L, R R. amaniensis K 084-81-01290 Kew hort. Bailes 348 (K) L, R R. amaniensis WLS 975 Kew hort. (084-81-01176) No voucher L, R R. longicaudata (Rolfe) Summerh. WLS 173 E. Ayensu Sanford 1732/65 (IFE) L, R R. muscicola (Rchb.f.) Summerh. BSC 86 SEL hort. (1997-0177A) Carlsward 169 (FLAS) L, R R. muscicola BSC 209 Countryside Orchids No voucher L, R R. muscicola K 181164 Kew hort. No voucher L, R R. schliebenii (Mansf.) P.J.Cribb K 105-79-00999 Kew hort. Cribb 11087 (K) L, R Rhipidoglossum bilobatum (Summerh.) Szlach. WLS 203 Kew hort. (052-77-00251) Meyer 18 (K) L, R & Olszewski. R. curvatum (Rolfe) Garay WLS 171 E. Ayensu Sanford 1819/65 L, R R. kamerunense (Schltr.) Garay BSC 190 Uzumara Orchids No voucher, ver. La Croix L, R R. obanense (Rendle) Summerh. BSC 35 SEL hort. (1997-0193A) Nkongmeneck 3025 (SEL) L, R R. pulchellum (Summerh.) Garay K 151167 Kew hort. No voucher L, R R. rutilum (Rchb.f.) Schltr. BSC 37 SEL hort. (1997-0186A) Carlsward 157 (FLAS), L, R Nkongmeneck 3027 (SEL) R. subsimplex (Summerh.) Garay BSC 264 B. Bytebier, Africa Bytebier 546 (EA) L, R R. xanthopollinium (Rchb.f.) Schltr. BSC 191 Uzumara Orchids No voucher, ver. La Croix L, R R. xanthopollinium K 396-82-04315 Kew hort. La Croix 346 (K) L, R Sobennikoffia humbertiana H.Perrier BSC 230 J. Hermans hort. Kew 3044 (K) L, R S. humbertiana WLS 103 Unknown garden origin Millot s.n. L, R Table 3-1. Continued Specimen Organs Taxona Sourcec Voucherd (location)e numberb studiedf Sobennikoffia robusta (Schltr.) Schltr. BSC 138 Andy’s Orchids No voucher L, R S. robusta WLS 977 Kew hort. (471-89-03289) No voucher L, R Solenangis clavata (Rolfe) Schltr. K 431-81-05035 Kew hort. No voucher L, R S. clavata WLS 182 E. Ayensu Sanford 1724/65 (IFE) L, R S. clavata WLS 593 Kew hort. (431-81-05035) No voucher L, R S. wakefieldii (Rolfe) P.J.Cribb & J.L.Stewart BSC 245 B. Bytebier, Africa Bytebier 627 (EA) L, R Sphyrarhynchus schliebenii Mansf. BSC 261 B. Bytebier, Africa Bytebier 393 (EA) L, R S. schliebenii K 356-81-03860 Kew hort. Protzen s.n. L, R Summerhayesia zambesiaca P.J.Cribb K 081-82-00558 Kew hort. La Croix 278 (K) L, R Tridactyle bicaudata (Lindl.) Schltr. BSC 208 Countryside Orchids No voucher L, R T. bicaudata BSC 262 B. Bytebier, Africa Bytebier 348 (EA) L, R T. bicaudata K 366-80-03811 Kew hort. La Croix 41 (K) L, R T. crassifolia Summerh. BSC 95 SEL hort. (1997-0165A) Carlsward 174 (FLAS), L, R Nkongmeneck 2076 (SEL) T. filifolia (Schltr.) Schltr. BSC 242 B. Bytebier, Africa Bytebier 707 (EA) L, R T. furcistipes Summerh. BSC 237 B. Bytebier, Africa Bytebier 1731 (EA) L, R T. scottellii (Rendle) Schltr. BSC 260 B. Bytebier, Africa Bytebier 497 (EA) L, R T. tanneri P.J.Cribb BSC 271 B. Bytebier, Africa PCP 198 (EA) L, R T. tanneri K 097-76-00664 Kew hort. Cribb 10038 (K) L, R T. tridactylites (Rolfe) Schltr. BSC 96 SEL hort. (1997-0187A) Nkongmeneck 3029 (SEL) L, R T. tridactylites K 25166 Kew hort. Gregory 302-48 (K) L, R T. tridentata (Harv.) Schltr. K 214-82-01989 Kew hort. Gilbert 4 (K) L, R Ypsilopus longifolius (Kraenzl.) Summerh. BSC 273 B. Bytebier, Africa Bytebier 609 (EA) L, R Y. longifolius K 224-84-01904 Kew hort. No voucher L, R Y. longifolius WLS 625 Kew hort. (224-84-01904) No voucher L, R Y. viridiflorus P.J.Cribb & J.L.Stewart BSC 257 B. Bytebier, Africa Bytebier 402 (EA) L, R Tribe Vandeae Lindl., Subtribe Aeridinae Pfitzer Acampe papillosa (Lindl.) Lindl. BSC 147 SEL hort. (1991-0066A,B) Carlsward 191 (SEL) L, R A. papillosa K 23465 Kew hort. Cumberlerge 234-65 (K) R Amesiella philippinensis (Ames) Garay BSC 8 SEL hort. (1987-0157A) No voucher, L, R verified by R. Dressler Chiloschista lunifera (Rchb.f.) J.J.Sm. BSC 149 Selby hort. No voucher L, R C. lunifera BSC 179 BNBG, spirit collection 96-0291-19 (BR) R Table 3-1. Continued Specimen Organs Taxona Sourcec Voucherd (location)e numberb studiedf Chiloschista parishii Seidenf. BSC 22 Tropic 1 Orchids, Inc. Carlsward 154 (FLAS) L, R C. parishii BSC 163 WLS hort. Carlsward 222 (FLAS) R C. pusilla (J.König) Schltr. BSC 235 Camp-Lot-A-Noise Tropicals Carlsward 303 (FLAS) R C. usneoides (D.Don) Lindl. K 1952 Kew hort. No voucher R Microtatorchis iboetii J.J.Sm. BSC 172 NHN, spirit collection 3415 (L) R Neofinetia falcata (Thunb.) Hu BSC 53 SEL hort. (1993-0377A) Carlsward 163 (SEL) L, R N. falcata K 13660 Kew hort. No voucher L, R Phalaenopsis deliciosa Rchb.f. BSC 45 SEL hort. (1987-0330A) Carlsward 160 (SEL) L, R P. hainanensis T.Tang & F.T.Wang BSC 165 SBG hort. (SING) R P. wilsonii Rolfe BSC 173 Andy’s Orchids Carlsward 331 (FLAS) R Taeniophyllum sp. BSC 170 NHN, spirit collection 8132 (L) R T. sp. BSC 171 NHN, spirit collection 10615 (L) R T. biocellatum J.J.Sm. BSC 281 J. Watts hort. Carlsward 317 (FLAS) R T. fasciola (G.Forst.) Seem. BSC 180 Kores & Molvray, Fiji GOK 0652364 (?), R VTM 7997130 (?) T. smithii Kores & L.Jonsson BSC 181 Kores & Molvray, Fiji VTM s.n. (?) R T. smithii BSC 182 Kores & Molvray, Fiji VTM s.n. (?) R Trichoglottis atropurpurea Rchb.f. BSC 90 SEL hort. (1974-0023-602A) Carlsward 171 (SEL) L, R Vanda flabellata (Rolfe ex Downie) BSC 6 SEL hort. (1996-0223C,D) Carlsward 192 (SEL) L, R Christenson Tribe Epidendreae Humb.Bonpl. & Kunth, Subtribe Polystachyinae Pfitzer Neobenthamia gracilis Rolfe JMH 1005 Unknown garden origin Carlsward 311 (FLAS) L, R Polystachya concreta (Jacq.) Garay & JMH 986 SEL hort. (1996-0140A) Carlsward 213 (SEL) L, R H.R.Sweet P. longiscapa Summerh. WLS 1559 WLS hort., No voucher L, R P. modesta Rchb.f. BSC 202 SEL hort. (1994-0078A) Carlsward 219 (SEL) L, R JMHeaney 984 (FLAS) aTaxon names and authorities follow Kew’s Monocot Checklist (2003). Author abbreviations follow Brummitt and Powell (1992). bBSC numbers represent Barbara S. Carlsward’s anatomical specimens; JMH numbers represent J. Michael Heaney’s anatomical specimens; WLS numbers represent William L. Stern’s anatomical specimens; K numbers represent slides made at the Royal Botanic Gardens, Kew; S numbers represent slides made by E. Ayensu. cFLMNH hort. are cultivated specimens from Florida Museum of Natural History greenhouse collection; Kew hort. represent live specimens grown at the Royal Botanic Gardens, Kew (numbers are their living plant accession numbers); SEL hort. are cultivated specimens from The Marie Selby Botanical Gardens (numbers represent their living plant accession numbers); SBG hort. are cultivated specimens from the Singapore Botanic Gardens; BNBG spirit collection are alcoholized collections from Belgium National Botanic Garden; NHN spirit collection are alcoholized collections from the National Herbarium Netherlands; and WLS hort. represent live plants from William L. Stern’s personal collection. dSpecimens with “ver. La Croix” are those with no voucher or with only a photo voucher which have been identified by Isobyl La Croix; PCP = East African National Museum’s Plant Conservation Programme. eHerbarium abbreviations follow Holmgren et al. (1990). fL, leaf; R, root.

Table 3-2. Anatomical and morphological characters used in cladistic analysis of Vandeae. Plesiomorphic states are listed first (0), followed by unordered apomorphic states (1, 2, 3). No. Anatomical or morphological character 1. EPIVELAMEN CELL SHAPE: isodiametric to flattened (0), radially elongate (1). 2. TILOSOMES: present (0), absent (1). 3. STRUCTURE OF ENDOVELAMEN THICKENINGS: thin (0), thick and smooth (1), thick and ridged (2). 4. VELAMEN TUFTS: absent (0), present (1). 5. EXODERMAL CELL WALLS: -thickened (0), ∩-thickened (1), ∪-thickened (2) 6. AERATION COMPLEX: absent (0), present (1). 7. EXODERMAL PROLIFERATION: absent (0), present (1). 8. ROOT WATER-STORAGE CELL WALL ORNAMENTATION: smooth to pitted (0), banded thickenings (1), edge thickenings (2) 9. ROOT FIBERS: absent (0), present (1). 10. FOLIAR HAIRS: absent (0), present and glandular (1), present and eglandular (2). 11. ADAXIAL EPIDERMAL CELL SHAPE: isodiametric to rectangular (0), conical (1), papillose (2). 12. ABAXIAL EPIDERMAL CELL SHAPE: isodiametric to rectangular (0), conical (1), papillose (2). Table 3-2. Continued No. Anatomical or morphological character 13. STOMATAL DISTRIBUTION: hypostomatal (0), amphistomatal (1). 14. HYPODERMAL DISTRIBUTION: adaxial (0), abaxial (1), adaxial & abaxial (2), absent (3). 15. HYPODERMAL COMPOSITION: cells thin-walled (0), cells fibrous (1). 16. MESOPHYLL: homogeneous (0), heterogeneous (1). 17. FIBER BUNDLES: absent (0), present (1). 18. STEGMATA: absent (0), present (1). 19. LEAF WATER-STORAGE CELL WALL ORNAMENTATION: smooth to pitted (0), banded thickenings (1), edge thickenings (2). 20. MESOPHYLL FIBER IDIOBLASTS: absent (0), present (1). 21. MUCILAGE: present (0), absent (1). 22. STEM: sympodial with pseudobulbs (0), monopodial (i.e., without pseudobulbs) (1) 23. MONOPODIAL STEM: elongate and greater than 8 cm (0), abbreviated and less than 8 cm (1). 24. LEAF PERSISTENCE: persistent and evergreen (0), deciduous (1). 25. DECIDUOUSNESS: leaves present throughout most of growing season (0), leaves caducous (1). 26. LEAF MORPHOLOGY: well-developed, main photosynthetic organ (0), Chiloschista-type, secondary photosynthetic organ (1), scale-like, nonphotosynthetic organ (2). Table 3-3. Character states for taxa used in cladistic analyses of Vandeae. A = 0/1, B = 0/2, C = 1/2, D = 0/1/2. Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 Tribe Vandeae, Subtribe Angraecinae Aerangis biloba 1 1 0 0 A 1 0 0 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 1 A. confusa A 1 0 0 1 0 A 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 A A. coriacea 1 1 0 0 1 0 0 A 0 1 0 0 0 3 ? 0 0 1 B 0 1 1 0 0 ? 0 1 A. kirkii A 1 0 0 1 1 0 0 0 1 0 0 0 3 ? 0 0 1 1 0 1 1 1 0 ? 0 A A. kotschyana 0 1 0 0 0 0 0 1 0 0 0 0 0 3 ? 0 0 1 1 0 1 1 0 0 ? 0 0 A. luteoalba var. rhodosticta 0 1 0 0 1 0 1 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 0 A. macrocentra 0 1 0 0 1 0 0 0 0 0 0 0 0 3 ? 0 0 1 1 0 1 1 0 0 ? 0 0 A. somalensis 1 1 0 0 1 1 0 1 0 0 0 0 1 3 ? 0 0 1 1 0 1 1 1 0 ? 0 1 A. thomsonii 0 1 0 0 1 1 0 1 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 0 A. ugandensis 0 1 0 0 0 A A 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 0 A. verdickii 1 1 0 0 0 0 0 1 0 0 0 0 1 3 ? 1 0 1 0 0 1 1 1 0 ? 0 1 Aeranthes arachnites 1 1 2 0 1 1 0 0 0 1 0 A 0 0 0 0 0 1 0 0 1 1 1 0 ? 0 1 A. caudata 1 1 2 0 1 1 1 0 0 1 0 0 0 0 0 0 0 1 0 0 1 1 1 0 ? 0 1 A. grandiflora A 1 0 0 1 1 A 0 0 1 0 0 0 0 0 0 0 1 0 0 1 1 1 0 ? 0 A A. peyrotii A 1 0 0 1 0 1 0 0 1 0 1 0 0 0 1 0 1 0 0 1 1 1 0 ? 0 A A. ramosa 1 1 2 0 1 ? 1 ? ? 1 0 0 0 0 0 1 0 1 1 0 1 1 1 0 ? 0 1 Ancistrorhynchus clandestinus ? ? ? ? ? ? ? ? ? 0 1 1 0 2 1 1 0 1 1 1 1 1 1 0 ? 0 ? A. metteniae 1 1 0 1 1 1 1 A 0 1 0 0 0 2 1 1 0 1 0 0 1 1 1 0 ? 0 1 A. refractus A 1 0 0 A A A A 0 ? ? ? ? 2 ? ? ? ? ? ? 1 1 1 0 ? 0 A Angraecopsis amaniensis A 1 0 0 0 1 0 2 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 1 0 0 A A. breviloba 0 1 0 0 0 1 0 2 0 1 0 1 1 3 ? 0 0 1 0 0 1 1 1 1 0 0 0 A. parviflora 0 1 0 0 0 A 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 A 1 1 0 ? 0 0 Angraecum birrimense 0 1 0 0 0 0 0 1 0 0 0 0 0 2 1 0 0 1 A 0 1 1 0 0 ? 0 0 A. calceolus 1 1 0 0 1 1 1 0 0 1 0 0 0 B 0 1 0 1 0 0 1 1 1 0 ? 0 1 A. chevalieri 1 1 0 0 0 0 0 1 0 1 1 1 0 2 1 0 0 1 0 0 1 1 0 0 ? 0 1 A. conchiferum 1 1 0 0 A ? A 0 0 1 A A 0 0 0 1 0 1 0 0 1 1 0 0 ? 0 1 A. cultriforme 1 1 0 0 0 1 0 1 0 1 0 1 0 2 1 0 0 1 1 0 1 1 0 0 ? 0 1 A. distichum 0 1 2 0 0 0 1 0 0 1 0 1 0 3 ? 1 1 1 0 0 1 1 0 0 ? 0 0 Table 3-3. Continued Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 Angraecum dives 1 1 0 0 0 0 0 1 0 1 1 1 0 3 ? 1 0 1 1 0 1 1 1 0 ? 0 1 A. eburneum 1 1 1 0 0 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 0 0 ? 0 1 A. eburneum ssp. giryamae 1 1 1 0 0 0 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 1 A. eburneum ssp. superbum 1 1 1 0 0 A A 0 0 1 A 0 0 B 0 1 0 1 0 0 1 1 0 0 ? 0 1 A. eburneum ssp. superbum var. 1 1 1 0 0 0 0 0 0 1 0 0 0 3 ? 1 0 1 0 0 1 1 0 0 ? 0 1 longicalcar A. eburneum ssp. xerophilum 1 1 1 0 1 1 0 1 0 1 2 1 0 2 0 1 0 1 0 0 1 1 0 0 ? 0 1 A. eichlerianum 0 1 0 0 0 1 0 1 0 0 0 0 0 2 1 0 0 1 A 0 1 1 0 0 ? 0 0 A. erectum 1 1 0 0 0 1 0 1 0 1 0 1 0 2 1 1 0 1 C 0 1 1 0 0 ? 0 1 A. gabonense 0 1 0 0 0 0 1 0 0 1 0 1 0 0 0 1 0 1 0 1 1 1 0 0 ? 0 0 A. germinyanum 0 1 0 0 1 1 1 0 0 1 0 0 0 0 0 1 0 1 0 0 1 1 0 0 ? 0 0 A. multinominatum 1 1 0 0 0 0 0 A 0 1 0 0 0 2 1 0 0 1 0 0 1 1 0 0 ? 0 1 A. pungens ? ? ? ? ? ? ? ? ? 1 0 1 0 2 0 1 0 1 0 1 1 1 0 0 ? 0 ? A. rutenbergianum 0 1 0 0 0 0 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 0 0 A. sacciferum ? 1 0 ? 0 ? 1 1 0 1 0 0 0 0 0 0 0 1 0 0 1 1 1 0 ? 0 ? A. sesquipedale 1 1 1 0 1 0 1 1 0 1 0 0 0 2 1 1 1 1 0 0 1 1 0 0 ? 0 1 A. subulatum 1 1 ? 0 0 0 0 0 0 1 0 1 0 2 0 1 0 1 0 1 1 1 0 0 ? 0 1 A. teres 0 1 0 0 1 1 1 1 0 1 0 1 0 3 ? 1 0 1 0 0 1 1 1 0 ? 0 0 Beclardia macrostachya A 1 0 0 2 1 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 A Bolusiella batesii 0 1 0 0 0 0 1 0 0 0 ? 0 0 1 1 0 0 1 0 0 1 1 1 0 ? 0 0 B. iridifolia 1 1 0 0 0 1 0 0 0 0 0 0 1 2 1 0 0 1 0 0 1 1 1 0 ? 0 1 B. maudiae 1 1 0 0 0 0 0 0 0 0 ? 0 0 3 ? 0 0 1 0 1 1 1 1 0 ? 0 1 Bonniera appendiculata 1 1 0 0 0 1 1 0 0 1 0 0 0 0 0 1 0 1 0 0 1 1 0 0 ? 0 1 Calyptrochilum christyanum 1 1 0 0 2 A A 1 0 A 0 A 0 3 ? 1 0 1 1 0 1 1 0 0 ? 0 1 C. emarginatum 1 1 0 0 0 1 A 1 0 0 0 0 0 3 ? 0 0 1 1 0 1 1 0 0 ? 0 1 Campylocentrum fasciola 0 1 0 0 1 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 C. micranthum 0 1 0 0 A 1 0 1 0 0 0 1 0 2 1 1 0 1 0 0 1 1 0 0 ? 0 0 C. pachyrrhizum 0 1 0 0 1 1 1 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 C. poeppigii 0 1 0 0 1 1 1 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 0 0 ? 2 0 Table 3-3. Continued Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 Campylocentrum sullivanii 0 1 0 0 1 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 Chamaeangis lanceolata 0 1 2 0 1 0 0 0 0 0 0 0 1 3 ? 0 0 1 1 0 1 1 1 0 ? 0 0 C. odoratissima 0 1 2 0 1 ? 1 0 0 0 0 0 1 3 ? 0 0 1 1 0 1 1 0 0 ? 0 0 C. sarcophylla 0 1 2 0 1 1 0 0 0 1 0 0 1 3 ? 1 0 1 1 0 1 1 1 0 ? 0 0 C. vesicata 0 1 2 0 1 1 0 A 0 0 0 0 1 3 ? 0 0 1 1 0 1 1 1 0 ? 0 0 Cribbia brachyceras 0 1 0 0 A A A 0 0 A 0 0 0 B 0 0 0 1 0 0 1 1 0 0 ? 0 0 C. confusa 0 1 0 0 0 1 1 0 0 1 0 0 0 B 0 0 0 1 0 0 1 1 1 0 ? 0 0 Cryptopus elatus 0 1 0 0 A 1 0 0 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 0 C. paniculatus 0 1 0 0 A A 0 0 0 1 0 0 0 3 ? 0 0 1 1 0 1 1 0 0 ? 0 0 Cyrtorchis arcuata 1 1 0 0 0 1 0 1 0 1 1 1 0 3 ? 0 0 1 0 0 0 1 0 0 ? 0 1 C. arcuata ssp. whytei 1 1 0 0 0 0 0 1 0 1 0 0 0 3 ? 0 0 1 0 0 0 1 0 0 ? 0 1 C. aschersonii 1 1 0 0 0 0 1 0 0 1 1 1 0 3 ? 1 0 1 0 1 1 1 0 0 ? 0 1 C. chailluana 1 1 0 0 0 1 0 0 0 0 0 0 0 3 ? 0 0 1 0 0 0 1 0 0 ? 0 1 C. praetermissa A 1 2 0 0 A A 1 0 1 1 1 0 0 1 1 0 1 0 1 1 1 0 0 ? 0 A C. ringens 1 1 2 0 0 0 0 1 0 1 1 0 0 0 1 1 0 1 0 1 1 1 0 0 ? 0 1 Dendrophylax alcoa A 1 0 0 1 1 0 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 A D. barrettiae 0 1 0 0 1 1 0 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 D. filiformis 1 1 0 0 1 1 0 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 1 D. funalis 1 1 0 0 1 1 A 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 1 D. gracilis A 1 0 0 0 1 1 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 A D. lindenii A 1 0 0 1 1 1 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 A D. porrectus 0 1 0 0 1 1 A C 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 D. varius A 1 0 0 1 1 1 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 A Diaphananthe bidens A 1 0 0 A 0 0 1 0 1 0 0 A 3 ? 0 0 1 0 0 1 1 0 0 ? 0 A D. fragrantissima 1 1 2 0 1 0 0 1 0 0 0 0 1 3 ? 0 0 1 1 0 1 1 0 0 ? 0 1 D. lorifolia 0 1 0 0 1 1 1 1 0 1 0 0 1 3 ? 0 0 1 1 0 1 1 0 0 ? 0 0 D. millarii 1 1 0 0 1 1 0 0 0 1 2 2 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 1 Eggelingia ligulifolia ? ? ? ? ? ? ? ? ? 1 1 1 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 ? Eurychone rothschildiana 0 1 0 0 1 1 1 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 0 Table 3-3. Continued Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 Jumellea arachnantha 1 1 2 0 0 1 1 0 0 1 0 0 0 2 1 0 0 1 0 1 1 1 1 0 ? 0 1 J. arborescens 0 1 2 0 0 1 0 1 0 1 0 0 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 0 J. confusa 1 1 2 0 1 1 1 1 0 0 0 0 0 2 1 1 0 1 0 0 1 1 0 0 ? 0 1 J. filicornoides 1 1 2 0 0 1 0 0 0 1 0 0 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 1 J. flavescens 1 1 2 0 0 0 1 1 0 1 0 0 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 1 J. phalaenophora 0 1 2 0 0 1 0 0 0 1 0 0 0 2 1 0 0 1 0 1 1 1 1 0 ? 0 0 J. sagittata A 1 2 0 0 1 1 0 0 1 0 0 0 2 1 0 0 1 0 1 1 1 1 0 ? 0 A Lemurella pallidiflora 0 1 0 0 1 1 0 0 0 1 2 0 0 3 ? 1 0 1 0 0 1 1 0 0 ? 0 0 Lemurorchis madagascariensis 0 1 2 ? 0 0 1 0 0 1 0 0 0 3 ? 1 0 1 1 0 1 1 1 0 ? 0 0 Listrostachys pertusa A 1 0 0 0 1 1 0 0 1 0 0 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 A Microcoelia aphylla 1 1 0 0 1 1 A 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 0 0 ? 2 1 M. bulbocalcarata 0 1 0 0 1 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 M. caespitosa 0 1 0 0 1 1 0 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 M. corallina 0 1 0 0 1 1 0 2 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 M. exilis 0 1 0 0 1 1 A B 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 M. globulosa A 1 0 0 1 1 A B 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 A M. macrantha 0 1 0 0 1 1 A 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 M. macrorrhynchia 1 1 0 0 1 1 0 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 1 M. megalorrhiza 0 1 0 0 1 1 0 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 M. obovata 1 1 0 0 1 1 0 C 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 1 M. perrieri 0 1 0 0 1 1 0 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 M. physophora 1 1 0 0 1 1 0 C 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 1 M. smithii 0 1 0 0 1 1 0 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 M. stolzii 1 1 0 0 1 1 0 D 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 1 Microterangis hildebrandtii 1 1 0 0 1 1 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 1 Mystacidium braybonae 1 1 0 0 0 1 0 2 0 1 0 0 0 3 ? 1 0 1 0 0 1 1 1 0 ? 0 1 M. capense 1 1 0 0 0 1 1 2 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 1 M. flanaganii 1 1 0 0 0 1 0 2 0 1 0 0 1 3 ? 0 0 1 0 0 1 1 1 0 ? 0 1 Neobathiea grandidieriana 0 1 0 0 1 1 0 0 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 0 Table 3-3. Continued Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 Oeonia rosea 1 1 0 0 0 1 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 1 Oeoniella polystachys 1 1 0 0 A 1 A 1 0 1 A 1 0 3 ? 0 0 1 A 0 1 1 0 0 ? 0 1 Ossiculum aurantiacum ? ? ? ? ? ? ? ? ? 0 0 0 0 3 ? 0 1 1 1 0 1 1 0 0 ? 0 ? Plectrelminthus caudatus 1 1 0 0 A A 0 1 0 A 0 0 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 1 Podangis dactyloceras 1 1 0 0 0 A 0 0 0 A ? A 0 1 1 1 0 1 0 0 1 1 1 0 ? 0 1 Rangaeris amaniensis 1 1 0 0 0 A A 1 0 A 0 1 0 2 1 0 0 1 0 1 1 1 0 0 ? 0 1 R. longicaudata 1 1 0 0 0 0 1 1 0 1 0 0 0 0 1 1 0 1 0 0 0 1 0 0 ? 0 1 R. muscicola 1 1 0 0 0 1 0 1 0 1 A 1 1 2 1 0 0 1 0 1 1 1 1 0 ? 0 1 R. schliebenii 1 1 0 0 0 0 0 1 0 1 0 0 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 1 Rhipidoglossum bilobatum 1 1 0 0 0 1 1 0 0 1 0 0 0 3 ? 1 0 1 0 0 1 1 0 0 ? 0 1 R. curvatum 0 1 0 0 0 0 1 0 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 0 R. kamerunense 0 1 0 0 1 1 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 0 R. obanense 1 1 2 0 1 1 0 0 0 0 0 0 1 3 ? 0 0 1 1 0 1 1 0 0 ? 0 1 R. pulchellum 1 1 0 0 0 0 1 0 0 1 0 0 0 3 ? 1 0 1 0 0 1 1 1 0 ? 0 1 R. rutilum 1 1 0 0 0 0 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 1 R. subsimplex 1 1 0 0 0 1 1 0 0 1 A 1 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 1 R. xanthopollinium 1 1 0 0 A A 0 0 0 1 A A 0 3 ? A 0 1 0 0 1 1 0 0 ? 0 1 Sobennikoffia humbertiana 1 1 1 0 0 1 0 1 0 1 2 2 0 3 ? 1 0 1 1 0 1 1 0 0 ? 0 1 S. robusta A 1 1 0 0 1 0 1 0 1 2 C 0 3 ? 1 0 1 1 0 1 1 0 0 ? 0 A Solenangis clavata A 1 0 0 1 1 A 0 0 A A 0 0 2 1 0 0 1 0 0 1 1 0 0 ? 0 A S. wakefieldii 0 1 0 0 2 1 0 0 0 0 1 1 0 2 1 0 0 1 0 0 1 1 0 0 ? 0 0 Sphyrarhynchus schliebenii 0 1 0 0 0 1 0 2 0 1 0 1 1 3 ? 0 0 1 0 0 1 1 1 0 ? 0 0 Summerhayesia zambesiaca 0 1 0 0 0 0 0 1 0 0 0 1 0 2 1 1 0 1 0 1 1 1 1 0 ? 0 0 Tridactyle bicaudata 1 1 0 A 0 1 0 D 0 1 A D 0 2 1 A 0 1 0 1 1 1 0 0 ? 0 1 T. crassifolia 1 1 0 1 0 0 0 1 0 1 0 2 0 2 1 1 0 1 0 0 1 1 0 0 ? 0 1 T. filifolia ? 1 ? ? 0 ? 1 1 0 1 0 0 1 2 1 1 0 1 0 1 1 1 0 0 ? 0 ? T. furcistipes 1 1 0 1 0 1 0 1 0 1 0 0 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 1 T. scottellii 1 1 0 0 0 1 1 1 0 1 1 2 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 1 T. tanneri A 1 0 ? 0 A A 1 0 A 0 0 0 2 1 1 0 1 1 1 1 1 1 0 ? 0 A Table 3-3. Continued Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 Tridactyle tridactylites 1 1 0 0 0 A A 1 0 1 0 0 0 2 1 0 0 1 0 1 1 1 0 0 ? 0 1 T. tridentata 1 1 0 0 0 0 0 1 0 1 0 1 1 2 1 1 0 1 0 1 1 1 0 0 ? 0 1 Ypsilopus longifolius A 1 0 0 2 A 0 0 0 0 0 A 0 2 1 A 0 1 0 1 1 1 1 0 ? 0 A Y. viridiflorus 0 1 0 0 0 1 1 1 0 1 0 0 0 1 1 0 0 1 0 1 1 1 1 0 ? 0 0 Tribe Vandeae, Subtribe Aeridinae Acampe papillosa A 1 0 0 0 0 A 1 0 1 0 0 A 3 ? 0 0 1 1 0 1 1 0 0 ? 0 A Amesiella philippinensis 1 1 0 0 0 1 1 1 0 1 0 0 1 3 ? 1 0 0 1 0 1 1 1 0 ? 0 1 Chiloschista lunifera A 1 0 0 0 1 1 0 0 2 0 0 1 3 ? 0 0 0 0 0 1 1 1 1 1 1 A C. parishii A 1 0 0 0 1 A 0 0 2 0 0 1 3 ? 0 0 0 0 0 1 1 1 1 1 1 A C. pusilla 1 1 0 0 0 1 0 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 1 1 1 1 C. usneoides 1 1 0 ? 0 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 1 1 1 1 Microtatorchis iboetii 0 1 0 0 0 0 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 0 0 Neofinetia falcata 1 1 2 0 0 0 1 1 1 0 A 1 0 2 1 0 0 1 0 1 1 1 1 0 ? 0 1 Phalaenopsis deliciosa 0 1 0 0 1 1 1 0 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 0 P. hainanensis 0 1 0 0 1 1 0 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 1 1 1 0 P. wilsonii A 1 0 0 1 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 1 1 1 A Taeniophyllum sp. BSC 170 0 1 0 0 1 ? 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 T. sp. BSC 171 0 1 0 0 0 1 0 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 T. biocellatum 0 1 2 0 0 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 T. fasciola 0 1 2 0 1 1 0 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 T. smithii 0 1 0 0 1 1 0 A 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 0 Trichoglottis atropurpurea 1 1 0 0 0 1 0 1 0 1 0 0 1 3 ? 0 0 1 1 0 1 1 0 0 ? 0 1 Vanda flabellata 1 1 0 0 0 1 0 0 1 0 A 1 0 2 1 0 0 1 0 1 1 1 0 0 ? 0 1 Tribe Epidendreae, Subtribe Polystachyinae Neobenthamia gracilis 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ? 0 ? 0 0 Polystachya concreta 0 0 0 0 1 0 0 B 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ? 0 ? 0 0 P. longiscapa 0 0 0 0 0 0 0 A 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ? 1 0 0 0 P. modesta 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ? 0 ? 0 0 113

Results

Anatomy of Tribe Vandeae

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells. HAIRS glandular, multicellular with a small basal cell sunken into the epidermis. Surrounding epidermal cells form a crypt around the hair base (Fig.

3-6). STOMATA superficial, restricted to the abaxial surface. Outer ledges thin, inner ledges thick. Cuticular horns large, prominent. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. Cell walls evenly thin-walled to differentially thickened along the outer tangential wall. Abaxial cells smaller than adaxial cells. HYPODERMIS usually absent, when present composed of thin-walled water-storage cells (Fig.

3-7a) or thick-walled fibrous idioblasts (Fig. 3-7b). Fibrous idioblasts dead, empty cells elongate in LS (Fig. 3-7c) and rounded to angular in TS. FIBER

BUNDLES absent. MESOPHYLL homogeneous, composed of thin-walled chlorenchyma. Water-storage cell walls birefringent and smooth to pitted.

Nonbirefringent water-storage cell walls always smooth to pitted. “Pits” of water- storage cells represent small slits of the primary wall. Raphide idioblasts thin- walled, rounded in TS, and elongate in LS (Fig. 3-8a). Mesophyll and epidermal cells above the midrib variously modified from surrounding cells. VASCULAR

BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles, thicker-walled and more well-developed near phloem. Bundle sheath distinct, composed of thin-walled chlorenchyma cells. STEGMATA contain spherical, rough-surfaced silica bodies (Fig. 3-8b) found in association with sclerenchyma of phloem and xylem poles (Fig. 3-8c). 114

Figure 3-6. Glandular hairs of leaf. a) TS of Angraecum multinominatum showing hair within epidermal crypt. b) Scraping of Eggelingia ligulifolia showing multicellular nature of hairs in surface view. Scale bars = 50 µm. 115

Figure 3-7. Hypodermal cells in leaf. a) TS showing hypodermis composed of water-storage cells in Angraecum conchiferum and b) thick-walled fibers in Jumellea filicornoides. c) Scraping of Tridactyle tridactylites showing elongate fibers of thick-walled hypodermis. Scale bars = 100 µm. 116

Figure 3-8. Leaf sections showing mesophyll features of Vandeae. a) LS of Plectrelminthus caudatus with elongate, rounded raphide idioblast (scale bar = 50 µm), b) LS of Plectrelminthus caudatus showing spherical silica bodies (arrowheads) within stegmata (scale bar = 50 µm), and c) TS of Neofinetia falcata showing stegmata (arrowheads) associated with phloem and xylem pole sclerenchyma of vascular bundles (scale bar = 100 µm). 117

Root. VELAMEN two to three cells wide. Epivelamen cells radially elongate, ∪-thickened in TS with fine anastomosing radial wall thickenings (Fig.

3-9). Endovelamen cells angular with undulate to straight-sided radial walls and isodiametric to radially elongate. Tangential cell walls evenly thickened to unevenly thickened (Fig. 3-9a). Distinct inner tangential wall thickenings of the endovelamen absent. Cover cells present over short cells of the exodermis (Fig.

3-10). Hairs single-celled and thin-walled. Where root hairs present, cells of the velamen and exodermis thinner-walled than where hairs are absent (Fig. 3-11).

EXODERMAL CELLS radially elongate to isodiametric. Most commonly, long cells are radially elongate while short (passage) cells range from radially elongate to isodiametric. Walls of long cells O-thickened to moderately ∩- thickened. Short cells thin-walled to slightly ∩-thickened with densely stained protoplast (Figs. 3-2a and 3-10). Exodermal proliferations present. TILOSOMES absent. CORTICAL CELLS thin-walled, primarily chlorenchymatous, and isodiametric to radially elongate. Chloroplasts most abundant in outer cortical region, closest to the exodermis. The two to three outermost and innermost cortical layers (nearest the exodermis and endodermis, respectively) composed of small isodiametric cells with few intercellular spaces (Fig. 3-12). Water- storage cell walls birefringent and smooth-walled to pitted. Nonbirefringent water-storage cells always smooth-walled to pitted. Aeration units present, composed of one (or rarely two) exodermal cell with a thin inner-tangential wall and usually two differentially thickened cortical cells below (Fig. 3-13).

ENDODERMIS uniseriate and -thickened with thin-walled to slightly - 118 thickened passage cells found opposite xylem arms. Cells isodiametric to radially elongate (Fig. 3-14). PERICYCLE uniseriate with thin-walled cells opposite xylem and thick-walled cells opposite phloem (Fig. 3-14). VASCULAR

CYLINDER composed of alternating clusters of primary xylem and phloem cells.

Xylem rays possess one to several large, distinct metaxylem elements. Phloem cells arranged in clusters that vary from rounded to elliptical in TS. Vascular tissue embedded in sclerenchyma (Figs. 3-12 and 3-14). PITH sclerenchymatous. Cells circular in TS, with small to large intercellular spaces

(Figs. 3-12 and 3-14).

Anatomy of Subtribe Angraecinae

Aerangis

Leaf. CUTICLE generally smooth to slightly ridged along the contours of the epidermal cells, papillose (Fig. 3-15a, illustrated by Rhipidoglossum xanthopollinium) on both surfaces in A. verdickii, and infrequently papillose abaxially in A. luteoalba var. rhodosticta. Adaxial cuticle 1.25 to 7.5 µm thick; abaxial cuticle 1.25 to 5.0 µm thick. HAIRS glandular and multicellular; rare to infrequent and often only sunken epidermal areas present in A. confusa, A. coriacea, A. kirkii, A. luteoalba var. rhodosticta, and A. ugandensis (Fig. 3-15b); absent in A. biloba, A. kotschyana, A. macrocentra, A. somalensis, A. thomsonii, and A. verdickii. Hairs supported by a raised buttress of several epidermal cells in A. coriacea (BSC 212) and A. ugandensis (Figs. 3-16a, b). STOMATA abaxial; ad- and abaxial in A. coriacea, A. somalensis, and A. verdickii. Outer ledges thin to thick; inner ledges moderate to thick. Substomatal chambers 119

Figure 3-9. Root TS showing velamen cells. a) Angraecum dives with ∪- thickened epivelamen, fine anastomosing lateral wall thickenings (arrowhead), and unevenly thickened endovelamen cells. Scale bar = 100 µm. b) Rangaeris amaniensis epivelamen cells with fine undulate thickenings. Scale bar = 50 µm. 120

Figure 3-10. Solenangis clavata root TS showing radially elongate epivelamen cells and cover cells (arrowheads) arranged above passage cells of ∩-thickened exodermal cells. Scale bar = 100 µm.

Figure 3-11. Root TS of Rhipidoglossum xanthopollinium showing a) thin-walled velamen cells below hairs and b) thicker-walled velamen cells opposite hairs. Scale bars = 100 µm. Figure 3-12. Root TS of Bolusiella maudiae showing shape, size, and distribution of cortical cells. Stele with alternating xylem (red) and phloem (dark blue) clusters embedded in sclerenchyma; rounded lignified pith cells. Scale bar = 100 µm. Figure 3-13. Root TS showing aeration units in a) Campylocentrum fasciola and b) Chamaeangis sarcophylla. a = aeration cell; c = modified cortical cell; g = cortical region of gas exchange. Scale bars = 50 µm. Figure 3-14. Root TS of Rhipidoglossum subsimplex showing -thickened endodermal cell walls, pericycle, xylem clusters with wide tracheary elements, alternating phloem clusters, lignified embedding tissue, and round lignified pith cells. Scale bar = 100 µm. 124 small, irregularly shaped; large in A. biloba, A. confusa (BSC 265), and A. kirkii.

EPIDERMAL CELLS periclinally oriented to isodiametric; isodiametric to conical in A. thomsonii (Fig. 3-16c, illustrated by Tridactyle scottellii). HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL homogeneous, 12 to 20 cells thick. Heterogeneous with columnar anticlinal adaxial cells and isodiametric abaxial cells in A. verdickii (Fig. 3-17, illustrated by Listrostachys pertusa).

Water-storage cells with birefringent bands (Fig. 3-5a) in A. kirkii, A. kotschyana,

A. macrocentra, and A. somalensis ; edges secondarily thickened (Fig. 3-5d) in

A. coriacea (BSC 269); all other species with smooth to pitted walls. Cells above midrib slightly modified in A. biloba, A. confusa, A. kirkii, A. somalensis, A. ugandensis (BSC 238), and A. verdickii; distinctly modified in A. coriacea, A. kotschyana, A. macrocentra, A. luteoalba var. rhodosticta, A. thomsonii, and A. ugandensis (WLS 1004, K 45064); unmodified in all other species examined.

VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both phloem and xylem poles, surrounded by ± distinct bundle sheaths with large and very darkly stained chloroplasts in A. biloba, A. coriacea, A. luteoalba var. rhodosticta, and A. verdickii (Fig. 3-18). STEGMATA contain spherical, rough- surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to six cells wide. Epivelamen cells isodiametric (Fig.

3-19, illustrated by Neobathiea grandidieriana) in A. confusa (K 345-81-03740),

A. kotschyana, A. macrocentra, A. luteoalba var. rhodosticta, A. thomsonii, and

A. ugandensis; radially elongate to isodiametric in A. kirkii; only radially elongate in all other species. Endovelamen cells angular, isodiametric to radially elongate. 125

Inner endovelamen cells thin-walled with undulate radial walls and angular tangential walls. Distinct endovelamen wall thickenings absent. Cover cells present over short cells of the exodermis. Hairs present in A. biloba, A. confusa,

A. kirkii, A. macrocentra, and A. luteoalba var. rhodosticta. Hyphae present in A. biloba, A. kirkii, and A. luteoalba var. rhodosticta. Algal cells (Fig. 3-20, illustrated by Angraecum cultriforme) present A. ugandensis (WLS 1004, K

45064). EXODERMAL CELLS radially elongate to isodiametric. Long cell walls

∩-thickened in A. confusa, A. coriacea, A. kirkii, A. macrocentra, A. luteoalba var. rhodosticta, A. somalensis, A. thomsonii (Fig. 3-19); ∩- to -thickened in A. biloba; primarily -thickened in all other specimens examined. Proliferations present in A. confusa (K 345-81-03740), A. luteoalba var. rhodosticta, and A. ugandensis (BSC 238, K 45064). CORTEX 13 to 30 cells wide. Starch grains present in A. luteoalba var. rhodosticta and A. ugandensis. Hyphae present in

A. kirkii and A. luteoalba var. rhodosticta. Birefringent bands in water-storage cells of A. coriacea (BSC 269), A. kotschyana, A. somalensis, and A. thomsonii; absent in A. biloba, A. coriacea (BSC 212), and A. luteoalba var. rhodosticta; all other species with smooth to pitted birefringent walls. Aeration units present in

A. biloba, A. kirkii, and A. ugandensis (BSC 238). ENDODERMAL CELLS primarily -thickened to infrequently ∪-thickened in A. biloba and A. ugandensis

(WLS 1004). PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem, all cells thin-walled in A. confusa (K 345-81-03740).

VASCULAR CYLINDER 7- to 24-arch. Vascular tissue embedded in sclerenchyma only in most specimens examined; embedded in thin- and thick- 126 walled sclerenchyma in A. confusa (BSC 256) and A. coriacea where thick- walled cells surround phloem clusters and thin-walled cells surround xylem clusters (Fig. 3-21). PITH usually sclerenchymatous, parenchymatous in A. confusa (K 345-81-03740), A. ugandensis (WLS 1004), and A. verdickii. Cells circular in TS.

Figure 3-15. Leaf TS showing features of the epidermis. a) Rhipidoglossum xanthopollinium with papillose cuticle. b) Aerangis coriacea with hairless sunken region of epidermis. Scale bar = 100 µm. 127

Figure 3-16. Leaf sections showing features of the epidermis. a) Aerangis ugandensis TS showing trichome (arrowhead) associated with raised buttress of epidermal cells. b) Epidermal scraping of Aerangis ugandensis showing hair (arrowhead) in surface view. c) Leaf TS of Tridactyle scottellii showing conical epidermal cell shape. Scale bars = 50 µm. 128

Figure 3-17. Leaf TS of Listrostachys pertusa showing heterogeneous mesophyll and scattered fibrous idioblasts (arrowheads). Scale bar = 100 µm. 129

Figure 3-18. Leaf TS of Aerangis coriacea showing darkly stained chloroplasts within thin-walled bundle sheath cells. Scale bar = 100 µm. Figure 3-19. Root TS of Neobathiea grandidieriana showing isodiametric epivelamen cells and ∩-thickened exodermal cells. Scale bar = 100 µm. 131

Figure 3-20. Root TS of Angraecum cultriforme showing algal cells (arrowheads) within the epivelamen. a) Light micrograph. Scale bar = 100 µm. b) Scanning electron micrograph. Scale bar = 20 µm. 132

Figure 3-21. Root TS of Aerangis coriacea showing vascular cylinder with thick- walled cells encircling phloem clusters. Scale bar = 100 µm.

Aeranthes

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 2.5 to 23.7 µm thick; abaxial cuticle 2.5 to 16.25 µm thick. HAIRS multicellular, glandular. STOMATA abaxial. Outer ledges thin to thick; inner ledges thin to thick in A. arachnites. Cuticular ledges small in A. arachnites, A. caudata, and A. grandiflora. Substomatal chambers small, irregularly shaped.

EPIDERMAL CELLS periclinally oriented to isodiametric; conical abaxially in A. arachnites (WLS 1081) and A. peyrotii. HYPODERMIS adaxial, composed of one or two rows of large, thin-walled, birefringent, usually pleated water-storage 133 cells. FIBER BUNDLES distributed in a single row along the abaxial mesophyll, composed of several thick-walled lignified cells surrounding one to three small thin-walled cells (Fig. 3-22). Bundles absent only in A. arachnites (BSC 129); this leaf appears to be immature with much less lignification than all other specimens examined. MESOPHYLL 13 to 19 cells wide; heterogeneous with columnar adaxial cells and smaller isodiametric abaxial cells in A. ramosa; isobilateral in A. peyrotii, composed of isodiametric cells near ad- and abaxial surfaces and anticlinally oriented cells in the central mesophyll; homogeneous in all other specimens examined. Water-storage cells with birefringent bands in A. caudata and A. ramosa; restricted to hypodermis in A. arachnites (WLS 1081).

Cells above midrib distinctly modified in A. arachnites (WLS 1081), A. caudata,

A. grandiflora, A. peyrotii, and A. ramosa; slightly modified in A. arachnites (BSC

129). VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma. Stegmata surround the entire surface of fiber bundles (Fig.

3-22), except in A. arachnites (BSC 129) where fiber bundles are absent.

Root. VELAMEN one to two cells wide; often sloughed off in A. peyrotii.

Epivelamen cells radially elongate to isodiametric in A. grandiflora and A. peyrotii; only radially elongate in all other species examined. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings ridged in A. arachnites, A. caudata, and A. ramosa. Cover cells present over short cells of exodermis. Hairs present in A. arachnites, A. caudata, A. 134 grandiflora, and A. peyrotii. Algal cells present in A. peyrotii and A. ramosa.

EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩- thickened. Proliferations present in all specimens examined except A. grandiflora (K 559-69-04918). CORTEX 8 to 15 cells wide. Starch grains present in A. arachnites (WLS 1081) and A. peyrotii. Hyphae present in A. caudata and A. peyrotii. Water-storage cell walls birefringent and smooth to pitted. Single modified cortical layer of thin- to thick-walled cells surrounding the endodermis in A. ramosa. Aeration units present in A. arachnites, A. caudata, A. grandiflora. ENDODERMAL CELLS -thickened. PERICYCLIC CELLS thin- walled opposite xylem and thick-walled opposite phloem. VASCULAR

CYLINDER 6- to 16-arch. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Figure 3-22. Leaf TS of Aeranthes arachnites showing fiber bundle with encircling stegmata (arrowheads). Scale bar = 50 µm. 135

Ancistrorhynchus

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 2.5 to 8.75 µm thick; abaxial cuticle 1.25 to 8.75 µm thick. HAIRS glandular and multicellular in A. metteniae and A. refractus, absent in A. clandestinus. STOMATA abaxial in A. clandestinus and A. metteniae; ad- and abaxial in A. refractus. Outer ledges thick, cuticular horns small in A. metteniae.

Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric in A. metteniae; isodiametric and conical in A. clandestinus and A. refractus. HYPODERMIS ad- and abaxial, composed of a single row of fibrous idioblasts scattered among thin-walled chlorenchyma cells.

FIBER BUNDLES absent. MESOPHYLL 9 to 14 cells thick. Mesophyll heterogeneous with columnar anticlinal adaxial cells and isodiametric abaxial cells in A. metteniae; isobilateral in A. clandestinus and A. refractus with columnar anticlinal cells situated on either side of a central row of isodiametric cells. Water-storage cells with spirally thickened birefringent bands in A. clandestinus and A. refractus, smooth to pitted in A. metteniae. Cells above the midrib slightly modified. VASCULAR BUNDLES collateral, in one row.

Sclerenchyma associated with both xylem and phloem poles. Bundle sheath indistinct in A. clandestinus and A. refractus, distinct in all other species examined. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to seven cells wide. Epivelamen cells isodiametric in

A. metteniae and A. refractus (WLS 1026), radially elongate in A. refractus (K 136

424-70-04125). Endovelamen cells angular and isodiametric to radially elongate.

Distinct endovelamen wall thickenings absent. Cover cells present over short cells of exodermis. Hairs present. Hyphae abundant in A. refractus.

EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩- thickened in A. metteniae and A. refractus (K 424-70-04125); ∩- to -thickened in A. refractus (WLS 1026); primarily -thickened in all other specimens examined. Proliferations present in A. metteniae and A. refractus (K 424-70-

04125). CORTEX 15 to 20 cells wide. Starch grains abundant throughout in A. refractus. Water-storage cells with birefringent bands in A. refractus (WLS

1026); pitted to banded in A. metteniae; smooth to pitted in A. refractus (K 424-

70-04125). Aeration units present in A. metteniae and A. refractus (WLS 1026).

ENDODERMAL CELLS -thickened to infrequently ∪-thickened in A. metteniae.

PERICYCLE thin-walled opposite xylem and thick-walled opposite phloem.

VASCULAR CYLINDER 12- to 18-arch. Vascular tissue embedded in sclerenchyma, cell walls of embedding tissue in A. metteniae thickest around phloem clusters. PITH sclerenchymatous. Cells circular in TS.

Angraecopsis

Leaf. CUTICLE papillose along the adaxial surface in A. parviflora (BSC

220); smooth to ridged along the contours of the epidermal cells in all other specimens examined. Adaxial cuticle 1.25 to 6.25 µm; abaxial cuticle 1.25 to 2.5

µm. HAIRS multicellular, glandular. STOMATA abaxial in A. parviflora; ad- and abaxial in A. breviloba. Outer ledges thick in A. breviloba and A. parviflora (BSC

220). Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS 137 isodiametric to periclinally oriented in A. parviflora; isodiametric and conical abaxially in A. breviloba. HYPODERMIS absent. FIBER BUNDLES absent.

MESOPHYLL homogeneous, 10 to 13 cells wide. Birefringent walls absent in water-storage cells of A. breviloba, present and smooth to pitted in A. parviflora.

Mucilage globules present throughout mesophyll of A. parviflora (Fig. 3-23).

Cells above midrib distinctly modified in A. breviloba, only slightly modified in A. parviflora. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct.

STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Figure 3-23. Leaf TS of Angraecopsis parviflora showing mucilage globules (arrowheads) in mesophyll cells. Scale bar = 100 µm. 138

Root. VELAMEN two to three cells wide. Epivelamen cells isodiametric.

Endovelamen cells angular and isodiametric to radially elongate. Distinct endovelamen wall thickenings absent. Cover cells present over short cells of exodermis in A. amaniensis and A. parviflora, absent in A. breviloba. Hairs present in A. breviloba and A. parviflora. Hyphae present in A. breviloba.

EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily

-thickened. Proliferations absent. CORTEX 10 to 13 cells wide. Mucilage abundant throughout in A. parviflora. Water-storage cell walls birefringent and smooth to pitted in A. amaniensis and A. parviflora, edge-thickened in A. breviloba. Aeration units present in A. amaniensis, A. breviloba, and A. parviflora

(BSC 220). ENDODERMAL CELLS thin-walled in A. parviflora (K 366-80-

03819), -thickened in all other specimens examined. PERICYCLE thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 6- to

10-arch. Xylem clusters without distinct metaxylem elements in A. breviloba.

Vascular tissue embedded in sclerenchyma, cell walls of embedding sclerenchyma thickest around phloem clusters in A. breviloba. PITH sclerenchymatous. Cells circular in TS.

Angraecum

Leaf. Angraecum distichum, A. subulatum, and A. teres possess semi- terete leaves with an adaxial groove. In A. teres the adaxial groove is reduced to a sulcus of six or seven cells, so the leaf superficially appears terete. All other species examined possess flattened, bilateral leaves. CUTICLE smooth to ridged along the contours of the epidermal cells, papillose in A. eburneum ssp. 139 superbum var. longicalcar and A. eburneum ssp. xerophilum. Adaxial cuticle

1.25 to 18.75 µm thick; abaxial cuticle 1.25 to 30.0 µm thick. HAIRS multicellular, glandular; absent in A. birrimense and A. eichlerianum. STOMATA abaxial; slightly sunken in A. chevalieri. Outer ledges thin to thick, inner ledges thick; cuticular horns small in A. calceolus, A. cultriforme, A. eichlerianum, and A. sacciferum. Substomatal chamber small, irregularly shaped; large in A. conchiferum. EPIDERMAL CELLS periclinally oriented to isodiametric.; conical adaxially in A. chevalieri, A. conchiferum, A. cultriforme, A. dives, A. eburneum ssp. superbum (BSC 141); papillose adaxially in A. eburneum ssp. xerophilum; conical abaxially in A. chevalieri, A. conchiferum, A. cultriforme, A. distichum, A. dives, A. eburneum ssp. xerophilum, A. erectum, A. gabonense, A. pungens, A. subulatum, and A. teres. HYPODERMIS ad- and abaxial, forming a single row of cells and composed of fibrous idioblasts in groups of one to several cells interrupted by chlorenchyma in A. birrimense, A. chevalieri, A. cultriforme, A. eichlerianum, A. erectum, and A. multinominatum; very ∩-thickened fibers forming an uninterrupted row in A. sesquipedale. Hypodermis only adaxial and composed of one to several rows of smooth to pleated water-storage cells with birefringent walls in A. conchiferum, A. eburneum ssp. superbum (BSC 141), A. gabonense, A. germinyanum, and A. sacciferum; along the ad- and abaxial surfaces in A. calceolus, A. eburneum ssp. superbum (BSC 154), A. eburneum ssp. xerophilum, A. pungens, and A. subulatum. FIBER BUNDLES present in a single abaxial peripheral row and scattered among vascular bundles in A. teres

(Fig. 3-24a); alternating with vascular bundles in a single abaxial row in A. 140 subulatum; solitary bundles present only at leaf margins in A. distichum and A. sesquipedale; bundles absent in all other species examined. Bundles composed of only thick-walled sclerenchyma in A. distichum, A. sesquipedale, and A. teres

(Fig. 3-24a); composed of abaxially thick-walled cells and adaxially thinner- walled cells in A. subulatum (Fig. 3-24b). MESOPHYLL 8 to 50 cells wide; heterogeneous with columnar adaxial cells and isodiametric abaxial cells in A. conchiferum, A. distichum, A. dives, A. eburneum ssp. superbum, A. eburneum ssp. superbum var. longicalcar, A. eburneum ssp. xerophilum, A. gabonense, A. germinyanum, A. pungens, A. sesquipedale, A. subulatum, and A. teres; heterogeneous with large, empty adaxial cells and small, assimilatory abaxial cells in A. calceolus and A. erectum (Fig. 3-24c); homogeneous in all other specimens examined. Water-storage cells with smooth to pitted birefringent walls in most specimens; birefringent walls banded in A. birrimense, A. cultriforme, A. dives, A. eichlerianum, and A. erectum; birefringent walls thickened along the edges in A. erectum; water-storage cells with birefringent walls absent in A. eburneum ssp. superbum var. longicalcar, A. eburneum ssp. xerophilum, A. gabonense, A. germinyanum, and A. sesquipedale. Fibrous idioblasts scattered throughout mesophyll in A. gabonense and A. subulatum.

Cells above midrib distinctly modified in all specimens examined except A. calceolus, A. cultriforme, A. distichum, and A. teres, where they are only slightly modified. VASCULAR BUNDLES collateral; in two rows in A. teres (one central ring of large bundles surrounded by a ring of smaller bundles interspersed with fiber bundles); in one row in all other species examined. Sclerenchyma usually 141 associated with xylem and phloem poles; not associated with xylem poles in A. eichlerianum and A. gabonense. Bundle sheath distinct. STEGMATA of vascular bundles associated with only phloem pole sclerenchyma in A. eichlerianum, A. gabonense, A. pungens, and A. subulatum; associated with both xylem and phloem sclerenchyma in all other specimens examined. Stegmata encircling fiber bundles in A. distichum, A. sesquipedale, and A. teres (Fig. 3-

24a); only found on the abaxial surface of fiber bundles in A. subulatum (Fig. 3-

24b).

Root. VELAMEN two to four cells wide, completely sloughed off in A. conchiferum (BSC 241). Epivelamen cells isodiametric in A. birrimense, A. distichum, A. eichlerianum, A. gabonense, A. germinyanum, A. rutenbergianum, and A. teres; radially elongate in all other specimens examined. Endovelamen cells angular, isodiametric to radially elongate; outer layers usually thicker-walled than those of inner layers. Distinct endovelamen thickenings ridged in A. distichum; smooth in A. eburneum, A. eburneum ssp. giryamae, A. eburneum ssp. superbum, A. eburneum ssp. superbum var. longicalcar, A. eburneum ssp. xerophilum, and A. sesquipedale; absent in all other species examined. Cover cells absent in A. distichum, A. gabonense, A. sacciferum, and A. subulatum; present over short cells of exodermis in all other species examined. Hairs present in A. calceolus, A. erectum, A. gabonense, A. rutenbergianum, A. sacciferum, and A. subulatum. Algal cells present in A. conchiferum (BSC 241),

A. eburneum ssp. superbum (BSC 141), A. eichlerianum, and A. teres. Hyphae present in A. eburneum ssp. xerophilum and A. teres. EXODERMAL CELLS 142 radially elongate to isodiametric. Long cell walls ∩-thickened in A. calceolus, A. conchiferum (K 120-82-01054), A. eburneum ssp. xerophilum, A. germinyanum,

A. sesquipedale, and A. teres; primarily -thickened in all other specimens examined. Proliferations present in A. calceolus, A. conchiferum (BSC 241), A. distichum, A. eburneum, A. gabonense, A. germinyanum, A. pungens, A. rutenbergianum, A. sacciferum, A. sesquipedale, and A. teres. CORTEX 8 to 26 cells wide. Hyphae present in A. chevalieri, A. rutenbergianum, A. sacciferum, and A. subulatum. Water-storage cell walls usually birefringent and smooth to pitted; with birefringent bands in A. birrimense, A. chevalieri, A. cultriforme, A. dives, A. eburneum ssp. xerophilum, A. eichlerianum, A. erectum, A. multinominatum, A. sacciferum, A. sesquipedale, and A. teres; cells with birefringent walls absent in A. distichum. Single modified cortical layer of thin- to thick-walled cells surrounding the endodermis in A. distichum and A. subulatum.

Aeration units present in A. calceolus, A. conchiferum, A. cultriforme, A. eburneum, A. eburneum ssp. superbum (BSC 141), A. eburneum ssp. xerophilum, A. eichlerianum, A. erectum, A. germinyanum, A. pungens, A. sacciferum, and A. teres. ENDODERMAL CELLS primarily -thickened to infrequently ∪-thickened in A. eburneum, A. eburneum ssp. superbum (BSC

141), and A. multinominatum. PERICYCLIC CELLS usually thin-walled opposite xylem and thick-walled opposite phloem; all cells completely lignified in A. subulatum. VASCULAR CYLINDER 7- to 28-arch. Xylem clusters without distinct metaxylem elements in A. distichum, A. gabonense, and A. teres.

Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous with 143 scattered thin-walled parenchyma cells in A. germinyanum. Cells primarily circular in TS, but isodiametric and slightly angular in A. multinominatum.

Figure 3-24. Leaf TS of Angraecum spp. showing features of the mesophyll. a) A. teres showing arrangement of fiber bundles with encircling stegmata (arrowheads). Scale bar = 100 µm. b) A. subulatum showing fiber bundle composed of thin- and thick-walled cells and stegmata (arrowhead) restricted to the abaxial (thick-walled) surface. Scale bar = 50 µm. c) A. calceolus showing heterogeneous mesophyll composed of larger, empty adaxial cells and smaller, protoplast-rich abaxial cells. Scale bar = 100 µm. 144

Beclardia

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 2.5 µm thick; abaxial cuticle 1.25 µm thick. HAIRS multicellular, glandular. STOMATA primarily abaxial, rarely adaxial. Outer ledges moderate.

Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL homogeneous, 14 cells wide. Adaxial cells generally larger with fewer chloroplasts than cells closest to the abaxial surface. Water- storage cells with birefringent walls infrequent, smooth-walled, usually found within adaxial mesophyll. Cells above midrib distinctly modified. VASCULAR

BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough- surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells mainly isodiametric. Endovelamen cells angular, isodiametric to radially elongate.

Distinct endovelamen wall thickenings absent. Cover cells present over short cells of the exodermis. Hairs and hyphae present. EXODERMAL CELLS often radially elongate to isodiametric. Long cell walls ∪-thickened (Fig. 3-25).

Proliferations absent. CORTEX 10 cells wide. Water-storage cells large, radially elongate, birefringent, and edge-thickened. Aeration units present.

ENDODERMAL CELLS strongly -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 6- arch. Vascular tissue embedded in sclerenchyma, cell walls of embedding 145 sclerenchyma thickest around phloem clusters. PITH sclerenchymatous. Cells circular in TS.

Figure 3-25. Root TS of Beclardia macrostachya showing ∪-thickened exodermal cells. Scale bar = 100 µm.

Bolusiella

Leaf. Bolusiella batesii and B. maudiae possess terete leaves with no discernible adaxial epidermis. Leaves of B. iridifolia are deeply sulcate with the adaxial epidermis restricted to the sulcus. CUTICLE smooth to ridged along the contours of the epidermal cells. Adaxial cuticle 6.25 µm thick in sulcate leaves of

B. iridifolia; 3.75 to 15.0 µm thick abaxially. HAIRS absent. STOMATA ad- and abaxial in dorsiventral leaves of B. iridifolia. Outer ledges moderate in B. batesii 146 and thin to moderate in B. iridifolia; inner ledges moderate to thick in B. iridifolia.

Substomatal chamber forming a distinct gap between hypodermal fibers in B. batesii. EPIDERMAL CELLS isodiametric, infrequently conical in B. iridifolia.

HYPODERMIS composed of a single row of fibrous idioblasts in B. batesii and B. iridifolia; absent in B. maudiae. Idioblasts very thick-walled and tightly packed in

B. batesii, thin-walled and interspersed amongst thin-walled chlorenchyma cells in B. iridifolia. FIBER BUNDLES absent. MESOPHYLL homogeneous, 25 to 41 cells wide. Central suture of flattened cells in B. batesii and B. maudiae (Fig. 3-

26a). One to three very thick-walled fibrous idioblasts present near the adaxial pole in B. maudiae (Fig. 3-26b). Cells above midrib in B. iridifolia slightly modified, leaves in all other species terete. VASCULAR BUNDLES arranged in a ∪-shaped arc. Sclerenchyma associated with xylem and phloem poles relatively thin-walled. Bundle sheath indistinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to four cells wide. Epivelamen cells radially elongate in B. iridifolia and B. maudiae; isodiametric and very ∪-thickened in B. batesii.

Endovelamen cells angular, isodiametric to radially elongate; strongly thick- walled in B. batesii.. Distinct endovelamen wall thickenings absent. Cover cells absent in B. batesii and B. maudiae; present over short cells of exodermis in B. iridifolia. Hairs present in B. batesii and B. maudiae. Hyphae abundant in B. batesii. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily -thickened to infrequently ∩-thickened in B. iridifolia. Proliferations 147 present in B. batesii. CORTEX five to nine cells wide. Cells isodiametric to tangentially elongate in B. batesii and B. iridifolia.

Figure 3-26. Leaf TS showing features of the mesophyll in Bolusiella spp. a) B. batesii showing flattened mesophyll cells between paired vascular bundles forming a central suture. Scale bar = 200 µm. b) B. maudiae showing two solitary, thick-walled fibers (arrowheads) near the adaxial pole. Scale bar = 100 µm. 148

Water-storage cell walls birefringent and smooth to pitted. Aeration units present in B. iridifolia. ENDODERMAL CELLS heavily -thickened in B. batesii and B. iridifolia. PERICYCLIC CELLS all thick-walled in B. batesii and B. iridifolia; mainly thin-walled in B. maudiae. VASCULAR CYLINDER 7- to 12- arch. Xylem arms without distinct metaxylem elements in B. maudiae. Vascular tissue embedded in sclerenchyma, thick-walled in B. batesii and B. iridifolia.

PITH sclerenchymatous, thick-walled in B. batesii. Cells circular in TS.

Bonniera

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 5.0 µm thick; abaxial cuticle 2.5 µm thick. HAIRS multicellular, glandular. STOMATA abaxial. Outer ledges thin, inner ledges thick.

Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS adaxial, one row of large frequently birefringent water-storage cells. FIBER BUNDLES absent.

MESOPHYLL 11 cells wide, heterogeneous with columnar adaxial cells and isodiametric abaxial cells. Birefringent water-storage cells smooth to pitted.

Cells above midrib slightly modified. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells radially elongate. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells present over short cells of 149 exodermis. Abundant algal cells present, especially in epivelamen.

EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily

-thickened. Proliferations present. CORTEX 11 cells wide. Water-storage cell walls birefringent and smooth to pitted. Aeration units present. ENDODERMAL

CELLS strongly -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 14-arch. Vascular tissue embedded in thick-walled sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Calyptrochilum

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 12.5 to 22.5 µm thick; abaxial cuticle 5.0 to 7.5 µm thick. HAIRS multicellular, glandular; absent in C. emarginatum. STOMATA abaxial. Outer ledges thin, inner ledges thick. Substomatal chambers small, irregularly shaped.

EPIDERMAL CELLS periclinally oriented to isodiametric; often conical abaxially in C. christyanum (BSC 137, BSC 148). HYPODERMIS absent. FIBER

BUNDLES absent. MESOPHYLL 13 to 23 cells wide; homogeneous in C. emarginatum; heterogeneous with columnar adaxial cells and isodiametric abaxial cells in C. christyanum. Water-storage cells slightly lignified, birefringent bands present. Cells above midrib slightly modified in C. christyanum, distinctly modified in C. emarginatum. VASCULAR BUNDLES collateral, in one row.

Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma. 150

Root. VELAMEN three to seven cells wide. Epivelamen cells radially elongate. Endovelamen cells angular, isodiametric to radially elongate; outer layers possess thicker-walled cells than those of inner layers. Distinct endovelamen thickenings absent. Cover cells present over short cells of exodermis. Hairs present in C. christyanum (BSC 20). Algal cells present in C. christyanum (BSC 137) and C. emarginatum (WLS 3). EXODERMAL CELLS radially elongate to isodiametric. Long cell walls -thickened in C. emarginatum,

∪-thickened in C. christyanum. Proliferations present in C. christyanum (BSC

137) and C. emarginatum (WLS 3). CORTEX 12 to 21 cells wide. Hyphae present in C. emarginatum (WLS 3). Water-storage cells with birefringent bands often slightly lignified. Single modified cortical layer of thin- to thick-walled cells surrounding the endodermis in C. christyanum (BSC 20) and C. emarginatum where lignification is most pronounced. Aeration units present in C. christyanum

(BSC 137) and C. emarginatum (K 57248). ENDODERMAL CELLS - thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 13- to 35-arch. Xylem clusters without distinct metaxylem elements in C. christyanum (BSC 137). Vascular tissue embedded in sclerenchyma; sclerenchyma forming caps of very thick- walled cells over phloem clusters in C. emarginatum. PITH sclerenchymatous.

Cells circular in TS.

Campylocentrum

Leaf. Campylocentrum micranthum was the only species examined with well-developed photosynthetic leaves. All other species examined possessed 151 brown, scale leaves along the stem. The following description applies to the only leafy species examined, C. micranthum. CUTICLE smooth to ridged along the contours of the epidermal cells. Adaxial cuticle 7.5 µm thick; abaxial cuticle 6.25

µm thick. HAIRS absent. STOMATA abaxial. Outer ledges thin, inner ledges thick. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric adaxially; conical abaxially. HYPODERMIS ad- and abaxial, composed of one row of fibrous idioblasts scattered among mesophyll chlorenchyma cells. FIBER BUNDLES absent. MESOPHYLL 15 cells wide, heterogeneous with several rows of ad- and abaxial columnar cells surrounding central isodiametric cells. Water-storage cells with birefringent walls absent. Cells above midrib slightly modified. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles.

Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN one to three cells wide. Epivelamen cells isodiametric to tangentially flattened. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells present over short cells of exodermis, absent in C. fasciola. Hairs present in C. pachyrrhizum.

Algal cells present in C. fasciola, C. poeppigii, and C. sullivanii. Hyphae present in C. micranthum. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩-thickened in C. fasciola, C. pachyrrhizum, C. poeppigii, and C. sullivanii; ∩- to -thickened in C. micranthum. Proliferations present in C. fasciola, C. pachyrrhizum, C. poeppigii, and C. sullivanii. CORTEX 8 to 14 cells 152 wide. Starch grains abundant in C. poeppigii and C. sullivanii. Hyphae present in C. micranthum. Water-storage cell walls birefringent and smooth to pitted in C. fasciola and C. sullivanii; with birefringent bands in C. micranthum, C. pachyrrhizum, and C. poeppigii. Aeration units present in all species examined.

ENDODERMAL CELLS -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 6- to 9-arch.

Xylem clusters without distinct metaxylem elements in C. micranthum, C. pachyrrhizum, and C. poeppigii. Vascular tissue embedded in sclerenchyma.

PITH sclerenchymatous. Cells circular in TS.

Chamaeangis

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Ad- and abaxial cuticle 6.25 to 15.0 µm thick. HAIRS absent. STOMATA ad- and abaxial. Inner ledges moderate to thick, cuticular horns exceptionally large in C. lanceolata and C. odoratissima. Substomatal chamber large and radially elongate in C. sarcophylla. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL homogeneous, 15 to 33 cells thick; isobilateral in C. sarcophylla with several peripheral rows of columnar anticlinal cells surrounding a central core of isodiametric cells. Water-storage cells with birefringent bands, cell walls often slightly lignified. Cells above midrib distinctly modified in C. sarcophylla, slightly modified in C. lanceolata, C. odoratissima, and C. vesicata. VASCULAR

BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and 153 phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough- surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells primarily isodiametric. Endovelamen cells angular, isodiametric to radially elongate.

Distinct endovelamen thickenings ridged. Cover cells present over short cells of exodermis. Hairs present in C. vesicata (BSC 219, BSC 267). EXODERMAL

CELLS radially elongate to isodiametric. Long cell walls very ∩-thickened.

Proliferations present in C. odoratissima. CORTEX 8 to 22 cells wide. Water- storage cells with birefringent smooth to pitted walls in C. lanceolata, C. odoratissima, C. sarcophylla, and C. vesicata (BSC 219); with variously formed birefringent bands in C. vesicata (BSC 267). Aeration units present in C. sarcophylla and C. vesicata. ENDODERMAL CELLS heavily -thickened in C. sarcophylla and C. vesicata (BSC 219). PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 9- to

28-arch. Xylem clusters without distinct metaxylem elements in C. odoratissima and C. vesicata (BSC 219). Vascular tissue embedded in sclerenchyma, cell walls of embedding tissue thickest around phloem groups in C. sarcophylla.

PITH sclerenchymatous. Cells circular in TS.

Cribbia

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 1.25 to 8.75 µm thick ; abaxial cuticle 1.25 to 6.25 µm thick.

HAIRS multicellular, glandular; rare in C. brachyceras (K 084-81-01175, WLS

1057) and C. confusa, basal cell sunken into a buttress of raised epidermal cells. 154

STOMATA abaxial. Outer ledges thin to thick in C. brachyceras, moderate in C. confusa. Inner ledges thin to thick in C. brachyceras. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric, occasionally conical along abaxial surface in C. confusa.

HYPODERMIS most prominent on the adaxial surface with one to two complete rows of smooth to pleated water-storage cells, less prominent abaxially with scattered water-storage cells interspersed within mesophyll chlorenchyma.

FIBER BUNDLES absent. MESOPHYLL homogeneous, 11 to 13 cells wide.

Water-storage cell walls birefringent and smooth to pitted. Cells above midrib slightly modified in C. brachyceras (K 084-81-01175, WLS 1057) and C. confusa, unmodified in C. brachyceras (BSC 236). VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells isodiametric and thin-walled to slightly ∪-thickened. Endovelamen cells angular, isodiametric to radially elongate, and thin-walled. Distinct endovelamen thickenings absent.

Cover cells present over exodermal short cells in C. brachyceras, absent in C. confusa. Hairs present in C. brachyceras (BSC 236, WLS 1057) and C. confusa.

Hyphae present in C. brachyceras (BSC 236) and C. confusa. Algal cells present in C. brachyceras (WLS 1057). EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily -thickened. Proliferations present in

C. brachyceras (WLS 1057) and C. confusa. CORTEX 8 to 12 cells wide. 155

Abundant starch grains in C. confusa. Hyphae present in C. brachyceras (BSC

236). Water-storage cell walls birefringent and smooth to pitted. Aeration units present in C. brachyceras (BSC 236, WLS 1057) and C. confusa.

ENDODERMAL CELLS strongly -thickened in C. brachyceras (BSC 236, WLS

1057) and C. confusa, occasionally ∩-thickened in C. brachyceras (K 084-81-

01175). PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 7- to 11-arch. Xylem clusters without distinct metaxylem elements in C. brachyceras. Vascular tissue embedded in sclerenchyma, cells very thick-walled in C. confusa. PITH sclerenchymatous.

Cells circular in TS.

Cryptopus

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Ad- and abaxial cuticle 1.25 µm thick. HAIRS multicellular, glandular; rare with only sunken base of hair present in C. paniculatus (Fig. 3-15b); absent in C. elatus. STOMATA abaxial. Outer ledges thin, inner ledges thick; cuticular horns small. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. Small globules of a brown ergastic substance (probably tannins) present in scattered ad- and abaxial cells in C. paniculatus. HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL homogeneous, 10 to 11 cells wide. Water-storage cells with birefringent bands.

Cells above midrib slightly modified. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle 156 sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells isodiametric to tangentially flattened. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells present over short cells of exodermis. Hairs present in C. paniculatus (BSC 117).

EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩- to - thickened. Proliferations absent. CORTEX 8 to 13 cells wide. Water-storage cell walls birefringent and smooth to pitted in C. elatus and C. paniculatus (BSC

117); with birefringent bands in C. paniculatus (BSC 223). Aeration units present in C. elatus and C. paniculatus (BSC 117). ENDODERMAL CELLS primarily - thickened to infrequently ∪-thickened in C. paniculatus (BSC 117). PERICYCLIC

CELLS thin-walled opposite xylem and thick-walled opposite phloem.

VASCULAR CYLINDER 7- to 13-arch. Xylem rays without distinct metaxylem elements in C. elatus and C. paniculatus (BSC 117). Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Cyrtorchis

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 2.5 to 11.25 µm thick; abaxial cuticle 1.25 to 8.75 µm thick.

HAIRS multicellular, glandular; absent in C. chailluana. STOMATA abaxial.

Outer ledges very thin to thick. Substomatal chambers small, irregularly shaped.

EPIDERMAL CELLS isodiametric and conical in C. arcuata, C. aschersonii, and

C. praetermissa; conical cells restricted to the adaxial surface in C. ringens. 157

HYPODERMIS absent; adaxial in C. praetermissa and C. ringens. Fibrous idioblasts arranged in a single row and interspersed among mesophyll chlorenchyma cells. FIBER BUNDLES absent. MESOPHYLL 15 to 25 cells wide; homogeneous in C. arcuata and C. arcuata ssp. whytei; heterogeneous with columnar adaxial cells and isodiametric abaxial cells in C. aschersonii, C. praetermissa, and C. ringens. Water-storage cells without birefringent walls in C. arcuata ssp. whytei; birefringent walls present and smooth to pitted in all other specimens examined. Fibrous idioblasts scattered throughout mesophyll in C. aschersonii, C. praetermissa, and C. ringens. Cells above midrib distinctly modified in C. arcuata ssp. whytei, C. chailluana, C. praetermissa, and C. ringens, slightly modified in C. arcuata and C. aschersonii. VASCULAR

BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough- surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to four cells wide. Epivelamen cells isodiametric in

C. praetermissa (BSC 203); radially elongate in all other specimens examined.

Endovelamen cells angular, isodiametric to radially elongate; walls of outer layers thicker than those of inner layers. Distinct endovelamen thickenings ridged in C. praetermissa and C. ringens. Cover cells present over short cells of the exodermis. Hairs present in C. aschersonii. Algal cells present in C. chailluana and C. praetermissa (BSC 203). EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily -thickened. Proliferations present in C. aschersonii and C. praetermissa (BSC 203). CORTEX 15 to 26 cells wide. 158

Water-storage cells with birefringent smooth to pitted walls in C. aschersonii and

C. chailluana; with variously formed birefringent bands in C. arcuata, C. arcuata ssp. whytei, C. praetermissa, and C. ringens. Mucilage present in cells of C. arcuata, C. arcuata ssp. whytei, and C. chailluana. Aeration units present in C. arcuata, C. chailluana, and C. praetermissa (BSC 203). ENDODERMAL CELLS primarily -thickened to rarely ∪-thickened in C. praetermissa. PERICYCLIC

CELLS thin-walled opposite xylem and thick-walled opposite phloem.

VASCULAR CYLINDER 17- to 34-arch. Xylem rays without distinct metaxylem elements in C. aschersonii, C. ringens, and C. praetermissa (WLS 1213).

Vascular tissue embedded in sclerenchyma, cell walls of embedding sclerenchyma thickest around phloem clusters in C. arcuata ssp. whytei and C. praetermissa. PITH sclerenchymatous. Cells circular in TS.

Dendrophylax

Leaf. All species of Dendrophylax are leafless and only possess brown, nonphotosynthetic scales along the stem.

Root. VELAMEN one to four cells wide. Epivelamen cells isodiametric in

D. barrettiae and D. porrectus; isodiametric to radially elongate in D. alcoa, D. gracilis, D. lindenii (BSC 156), and D. varius; radially elongate in all other specimens examined. Anastomosing thickenings of radial walls often fused to form what appear to be pits in D. alcoa, D. funalis (BSC 32), D. gracilis, and D. lindenii (Fig. 3-27). Endovelamen cells angular, isodiametric to radially elongate; outer layer with thicker cell walls than inner layers. Distinct endovelamen thickenings absent. Cover cells present over short cells of exodermis, absent in 159

D. barrettiae and D. varius. Hairs present in D. funalis (BSC 32), D. gracilis, D. lindenii, D. porrectus, and D. varius. Hyphae present in D. barrettiae, D. funalis

(BSC 32), D. porrectus (BSC 151), and D. varius. Algal cells present in D. barrettiae, D. funalis (BSC 32), D. gracilis, D. lindenii (BSC 71), D. porrectus

(BSC 151), and D. varius. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩-thickened in all specimens except D. gracilis, where the walls are primarily -thickened. Proliferations present in D. funalis, D. gracilis, D. lindenii, D. porrectus (all specimens except BSC 142), and D. varius.

CORTEX 5 to 20 cells wide. Cells irregularly shaped and chloroplasts absent in rehydrated specimens (D. gracilis and D. varius). Hyphae present in D. barrettiae, D. gracilis, D. porrectus, and D. varius. Water-storage cells with birefringent bands. In addition to the banded wall ornamentation, water-storage cells of D. porrectus are also thickened along the wall edges. Aeration units present in all species examined. ENDODERMAL CELLS -thickened.

PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 4- to 13-arch. Xylem arms without distinct metaxylem elements in D. alcoa, D. barrettiae, D. lindenii (BSC 156), D. porrectus, and D. varius. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS or isodiametric and often ± angular in D. alcoa and D. lindenii (BSC 71).

Diaphananthe

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells, occasionally papillose in D. millarii. Ad- and abaxial cuticle less than 1.25 µm to 160

Figure 3-27. Root TS of Dendrophylax lindenii showing pits formed by anastomosing epivelamen thickenings. a) Light micrograph. Scale bar = 50 µm. b) Scanning electron micrograph. Scale bar = 37.5 µm.

10.0 µm thick. HAIRS multicellular and glandular, absent in D. fragrantissima.

STOMATA abaxial and rarely adaxial in D. bidens and D. lorifolia; frequently ad- and abaxial in D. fragrantissima. Outer ledges thin to moderate, inner ledges moderate to thick. Substomatal chamber large and irregular in D. fragrantissima and D. lorifolia. EPIDERMAL CELLS periclinally oriented to isodiametric, papillose in D. millarii (Fig. 3-28). HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL homogeneous, 11 to 23 cells thick. Water-storage cells with variously formed birefringent bands in D. fragrantissima and D. lorifolia; smooth to pitted in all other specimens examined. Cells above midrib unmodified in D. fragrantissima; slightly modified in D. bidens, D. lorifolia, and D. millarii.

VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain 161 spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma, rare in D. millarii.

Figure 3-28. Leaf TS of Diaphananthe millarii showing papillose epidermal cells. Scale bar = 50 µm.

Root. VELAMEN two to four cells wide. Epivelamen cells isodiametric in

D. bidens (K 431-81-05022) and D. lorifolia; radially elongate in all other specimens examined. Endovelamen cells angular, isodiametric to radially elongate; outermost layers of cells thicker-walled than inner layers. Distinct endovelamen thickenings ridged in D. fragrantissima. Cover cells absent in D. fragrantissima, present over short cells of exodermis in all other specimens examined. Hairs present in D. fragrantissima. Algal cells present in D. 162 fragrantissima and D. lorifolia. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩-thickened in D. bidens (K 431-81-05022), D. fragrantissima, D. lorifolia, and D. millarii; primarily -thickened in D. bidens

(BSC 33). Proliferations present in D. lorifolia. CORTEX 16 to 22 cells wide.

Water-storage cells with variously banded birefringent cell walls in D. bidens, D. fragrantissima, and D. lorifolia; with smooth to pitted walls in D. millarii. Single modified cortical layer of thin- to thick-walled cells surrounding the endodermis

(Fig. 3-29) in D. bidens and D. lorifolia. Aeration units present in D. lorifolia and

D. millarii. ENDODERMAL CELLS primarily -thickened; strongly -thickened in D. lorifolia; rarely ∪-thickened in D. bidens (BSC 33). PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR

CYLINDER 16- to 27-arch. Xylem clusters without distinct metaxylem elements in D. millarii. Vascular tissue embedded in sclerenchyma, cell walls of embedding sclerenchyma thickest around phloem clusters in D. fragrantissima.

PITH usually sclerenchymatous, but parenchymatous in D. bidens (BSC 33).

Cells circular in TS.

Eggelingia

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells. Adaxial cuticle 13.75 µm thick; abaxial cuticle 11.25 µm thick. HAIRS multicellular, glandular. STOMATA abaxial. Outer ledges thin, inner ledges thick. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS isodiametric and often conical. HYPODERMIS ad- and abaxial. Fibrous idioblasts in one discontinuous row scattered amongst mesophyll chlorenchyma 163 cells. FIBER BUNDLES absent. MESOPHYLL 14 cells wide, heterogeneous.

Adaxial mesophyll cells columnar, abaxial cells isodiametric. Birefringent water- storage cells smooth to pitted. Solitary fibrous idioblasts scattered throughout.

Figure 3-29. Root TS of Jumellea sagittata showing modified layer of cortical cells surrounding the endodermis. Scale bar = 100 µm.

Cells above midrib slightly modified. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. Roots not available. 164

Eurychone

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Ad- and abaxial cuticle 1.25 µm thick. HAIRS multicellular, glandular.

STOMATA abaxial. Outer ledges thin, inner ledges thick. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL homogeneous, 15 cells wide. Birefringent water-storage cells smooth to pitted.

Cells above midrib distinctly modified. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells isodiametric.

Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells infrequent over short cells of the exodermis. Hairs and hyphae present. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily -thickened. Proliferations present.

CORTEX 15 cells wide. Water-storage cells birefringent and smooth to pitted.

Aeration units present. ENDODERMAL CELLS -thickened. PERICYCLIC

CELLS thin-walled opposite xylem and thick-walled opposite phloem.

VASCULAR CYLINDER 11-arch. Vascular tissue embedded in sclerenchyma.

PITH sclerenchymatous. Cells circular in TS. 165

Jumellea

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 2.5 to 8.75 µm thick; abaxial cuticle 1.25 to 7.5 µm thick. HAIRS multicellular, glandular; absent in J. confusa. STOMATA abaxial. Outer ledges thin, inner ledges thin to thick in J. sagittata (BSC 43). Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS ad- and abaxial, composed of fibrous idioblasts in a single incomplete row scattered among chlorenchyma cells. FIBER BUNDLES absent. MESOPHYLL 11 to 17 cells wide; heterogeneous with columnar adaxial cells and isodiametric abaxial cells in J. arborescens, J. confusa, and J. flavescens; homogeneous in J. arachnantha, J. phalaenophora, and J. sagittata; isobilateral with columnar cells surrounding a central region of isodiametric cells in J. filicornoides. Water-storage cells with birefringent walls smooth to pitted in

J. filicornoides and J. flavescens; absent in J. arachnantha, J. arborescens, J. confusa, J. phalaenophora, and J. sagittata. Fibrous idioblasts scattered throughout in J. arachnantha, J. arborescens, J. filicornoides, J. flavescens, J. phalaenophora, and J. sagittata. Cells above midrib distinctly modified in J. arachnantha, J. arborescens, J. confusa, J. flavescens, J. phalaenophora, and J. sagittata; slightly modified in J. filicornoides. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheaths cells distinct, walls occasionally slightly lignified in J. arachnantha, J. flavescens, J. phalaenophora, and J. sagittata. STEGMATA contain spherical, 166 rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells isodiametric in

J. arborescens and J. phalaenophora; isodiametric to radially elongate in J. sagittata (BSC 229); radially elongate in all other specimens examined.

Endovelamen cells angular, isodiametric to radially elongate; cells of the outer layers often thicker-walled than those of the inner layers. Distinct endovelamen thickenings ridged. Cover cells present over short cells of exodermis. Hairs present in J. arachnantha, J. arborescens, J. phalaenophora, and J. sagittata

(BSC 229). Hyphae present in J. confusa, J. flavescens, J. phalaenophora, and

J. sagittata. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩-thickened in J. confusa; -thickened in all other species examined.

Proliferations present in J. arachnantha, J. confusa, J. flavescens, and J. sagittata. CORTEX 8 to 27 cells wide. Hyphae present in J. confusa and J. sagittata (BSC 229). Water-storage cell walls birefringent and smooth to pitted in

J. arachnantha, J. confusa, J. filicornoides, and J. flavescens; with birefringent bands in J. arborescens, J. confusa, and J. flavescens. Single modified cortical layer of thin- to thick-walled cells surrounding the endodermis in J. arachnantha,

J. arborescens, J. phalaenophora, and J. sagittata. Aeration units present in all species examined except J. flavescens. ENDODERMAL CELLS usually - thickened to infrequently ∪-thickened in J. confusa. PERICYCLIC CELLS thin- walled opposite xylem and thick-walled opposite phloem. VASCULAR

CYLINDER 13- to 38-arch. Vascular tissue embedded in sclerenchyma; cell 167 walls of embedding tissue thickest over phloem groups in J. confusa, J. flavescens, J. phalaenophora, and J. sagittata (BSC 229). PITH sclerenchymatous. Cells circular in TS.

Lemurella

Leaf. CUTICLE papillose to less frequently ridged. Adaxial cuticle 11.25

µm thick; abaxial 6.25 µm thick. HAIRS rare, multicellular, glandular. STOMATA abaxial; superficial to slightly raised. Outer ledges thin, inner ledges thick; cuticular horns small. Substomatal chambers small, irregularly shaped.

EPIDERMAL CELLS papillose adaxially; frequently conical abaxially.

HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL 14 cells wide, heterogeneous with columnar adaxial cells and isodiametric abaxial cells.

Birefringent water-storage cells smooth to pitted. Cells above midrib slightly modified. Red ergastic substance (possibly tannins) scattered in epidermal cells and present in mesophyll cells adjacent to the epidermises. VASCULAR

BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough- surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two cells wide. Epivelamen cells tangentially elongate and scalloped. Endovelamen cells angular, isodiametric to radially elongate.

Distinct endovelamen thickenings absent. Cover cells present over short cells of exodermis. Hairs and hyphae present. EXODERMAL CELLS radially elongate to isodiametric, ∩-thickened. Proliferations present. CORTEX 13 cells wide.

Water-storage cell walls birefringent and smooth to pitted. Aeration units 168 present. ENDODERMAL CELLS strongly -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR

CYLINDER 8-arch. Vascular tissue embedded in thick-walled sclerenchyma.

PITH sclerenchymatous. Cells thick-walled and circular in TS.

Lemurorchis

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Ad- and abaxial cuticle 2.5 µm thick. HAIRS multicellular, glandular. STOMATA abaxial. Outer ledges thick, inner ledges thick; cuticular horns small.

Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL 11 cells wide, heterogeneous with greater numbers of large adaxial water-storage cells and fewer small abaxial assimilatory cells.

Water-storage cells with birefringent bands. Cells above midrib distinctly modified. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct.

STEGMATA contain spherical, rough-surfaced silica bodies primarily associated with phloem sclerenchyma, rarely associated with xylem sclerenchyma.

Root. VELAMEN frequently absent or two cells wide. Epivelamen cells isodiametric. Endovelamen cells angular, isodiametric to radially elongate.

Distinct endovelamen thickenings ridged. Cover cells present over short cells of exodermis. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls -thickened. Proliferations present. CORTEX 8 cells wide. Water-storage cell walls birefringent and smooth to pitted. Aeration units absent. 169

ENDODERMAL CELLS ∪- to -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 18- arch. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous.

Cells circular in TS.

Listrostachys

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Ad- and abaxial cuticle 6.25 to 12.5 µm thick. HAIRS multicellular, glandular.

STOMATA abaxial. Outer ledges thin, inner ledges thick. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS ad- and abaxial. Fibrous idioblasts occurring singly or in groups of two to three, forming a single row with interspersed chlorenchyma. FIBER BUNDLES absent. MESOPHYLL 12 to 15 cells wide, heterogeneous with columnar adaxial cells and isodiametric abaxial cells. Water- storage cells with birefringent walls absent in WLS 2 and rare in BSC 194.

Solitary fibrous idioblasts concentrated in abaxial mesophyll, generally thinner- walled than hypodermal idioblasts. Cells above midrib slightly modified.

VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN three to four cells wide. Epivelamen cells primarily isodiametric to infrequently radially elongate in WLS 2. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings 170 absent. Cover cells absent. Hairs and hyphae present. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily -thickened.

Proliferations present. CORTEX 12 cells wide. Hyphae present in BSC 194.

Water-storage cell walls birefringent and smooth-walled to pitted. Aerations units present. ENDODERMAL CELLS strongly -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR

CYLINDER 7- to 17-arch. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Microcoelia (including Solenangis aphylla = Microcoelia aphylla)

Leaf. All species of Microcoelia are leafless and stems only possess brown, nonphotosynthetic scales.

Root. VELAMEN two to three cells wide. Epivelamen cells isodiametric in

M. bulbocalcarata, M. caespitosa, M. corallina, M. exilis, M. globulosa (BSC 177),

M. macrantha, M. megalorrhiza, M. perrieri, and M. smithii; radially elongate in all other specimens examined. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells present over short cells of the exodermis in all species except M. aphylla. Hairs present in M. aphylla (BSC 174), M. caespitosa, M. corallina, M. exilis (BSC 175), and M. macrorrhynchia (WLS 80). Hyphae present in M. globulosa (BSC 243). Algal cells present in M. aphylla, M. exilis (BSC 175), M. globulosa (BSC 177) and M. macrorrhynchia. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩-thickened. Microcoelia aphylla, M. caespitosa, M. exilis (BSC 275), and M. megalorrhiza possess radial wall swellings (Fig. 3-10, illustrated by 171

Solenangis clavata); M. macrantha, M. obovata, and M. physophora possess radial wall grooves (Fig. 3-30). Proliferations present in M. aphylla (BSC 174), M. bulbocalcarata, M. exilis (BSC 175), M. globulosa (BSC 177), and M. macrantha

(BSC 232). CORTEX 6 to 16 cells wide. Chloroplasts absent in M. globulosa

(BSC 177). Starch grains abundant in M. aphylla (BSC 174). Hyphae present in

M. globulosa (BSC 243) and M. macrantha (BSC 232). Water-storage cells with birefringent bands in M. aphylla, M. megalorrhiza, M. obovata, M. physophora, and M. stolzii (WLS 981); with edge thickenings in M. corallina, M. exilis, M. globulosa (BSC 243), M. obovata, M. physophora, and M. stolzii (WLS 981); smooth-walled to pitted in M. caespitosa, M. globulosa (BSC 177), M. macrantha,

M. macrorrhynchia, M. perrieri, and M. smithii; cell walls not birefringent in M. bulbocalcarata and M. stolzii (BSC 196). Single layer of thin- to thick-walled cells surrounding the endodermis in M. exilis (BSC 184, BSC 275), M. obovata, M. perrieri, and M. smithii. Aeration units present in all species examined.

ENDODERMAL CELLS primarily -thickened; strongly -thickened in M. aphylla; thin-walled only in M. bulbocalcarata, M. corallina, and M. stolzii.

PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 3- to 15-arch. Xylem clusters without distinct metaxylem elements in M. aphylla (BSC 174), M. corallina, M. perrieri, and M. stolzii (BSC 196). Vascular tissue embedded in sclerenchyma, cell walls of embedding sclerenchyma thickest around phloem clusters in M. globulosa (BSC

177) and M. stolzii (WLS 981). PITH usually sclerenchymatous, but parenchymatous in M. corallina. Cells circular in TS. 172

Figure 3-30. Root TS of Microcoelia macrantha showing grooves (arrowhead) in ∩-thickened exodermal cells. Scale bar = 50 µm.

Microterangis

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Ad- and abaxial cuticle 2.5 µm thick. HAIRS rare, multicellular, glandular.

STOMATA abaxial. Outer ledges thin to moderate, inner ledges thick.

Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL homogeneous, 14 cells wide. Birefringent water-storage cells smooth to pitted. Cells above midrib distinctly modified. VASCULAR

BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and 173 phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough- surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells radially elongate. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells present over short cells of the exodermis. Algal cells present. EXODERMAL CELLS radially elongate. Long cell walls ∩- to infrequently ∩+∪-thickened. Proliferations absent. CORTEX 6 cells wide. Starch grains abundant throughout. Water-storage cells with birefringent bands. Aeration units present. ENDODERMAL CELLS strongly - thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 6-arch. Xylem rays without distinct metaxylem elements. Vascular tissue embedded in thick-walled sclerenchyma.

PITH sclerenchymatous. Cells circular in TS.

Mystacidium

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Ad- and abaxial cuticle 1.25 to 3.75 µm thick. HAIRS multicellular, glandular.

STOMATA abaxial in M. braybonae and M. capense; ad- and abaxial in M. flanaganii. Outer ledges thin to moderate, inner ledges thick. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL

12 to 15 cells wide; homogeneous in M. capense and M. flanaganii; heterogeneous with columnar adaxial cells and isodiametric abaxial cells in M. braybonae. Water-storage cell walls not birefringent in M. capense and M. 174 flanaganii; birefringent and smooth to pitted in M. braybonae. Cells above midrib slightly modified in M. braybonae and M. capense, unmodified in M. flanaganii.

VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to four cells wide. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent.

Cover cells present over short cells of the exodermis. Hairs present in M. braybonae (BSC 134) and M. flanaganii. Algal cells present in M. braybonae

(BSC 134). EXODERMAL CELLS radially elongate to isodiametric. Long cell walls -thickened to infrequently ∩-thickened in M. braybonae (BSC 135).

Proliferations present in M. capense. CORTEX 11 to 14 cells wide. Water- storage cell walls birefringent and smooth to pitted with edge thickenings.

Aeration units present. ENDODERMAL CELLS -thickened. PERICYCLIC

CELLS thin-walled opposite xylem and thick-walled opposite phloem.

VASCULAR CYLINDER 8- to 10-arch. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Neobathiea

Leaf. CUTICLE smooth to papillose. Ad- and abaxial cuticle 3.75 to 5.0

µm thick. HAIRS absent. STOMATA abaxial. Outer ledges thin to thick, inner ledges thick; cuticular horns small. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. 175

HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL homogeneous,

11 to 13 cells wide. Birefringent water-storage cells smooth to pitted. Cells above midrib slightly modified. VASCULAR BUNDLES collateral, in one row.

Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies associated most frequently with phloem sclerenchyma in BSC 216; only associated with phloem sclerenchyma in BSC 193.

Root. VELAMEN two cells wide. Epivelamen cells isodiametric.

Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells present over short cells of exodermis. Hairs present. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩-thickened. Proliferations absent. CORTEX 10 to

16 cells wide. Starch abundant in BSC 216. Hyphae abundant in BSC 193.

Water-storage cell walls birefringent and smooth to pitted. Aeration units present. ENDODERMAL CELLS -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 5- to

8-arch. Xylem arms without distinct metaxylem elements in BSC 193. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in

TS.

Oeonia

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 5.0 µm thick; abaxial cuticle 3.75 µm thick. HAIRS rare, multicellular, glandular. STOMATA abaxial. Outer ledges thin, inner ledges 176 thick; cuticular horns small. Substomatal chambers small, irregularly shaped.

EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS absent.

FIBER BUNDLES absent. MESOPHYLL homogeneous, 12 cells wide.

Birefringent water-storage cells smooth to pitted. Cells above midrib slightly modified. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct.

STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two cells wide. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells present over short cells of exodermis. Algal cells present in BSC 166.

EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily

-thickened. Proliferations absent. CORTEX 9 to 11 cells wide. Cells isodiametric to tangentially elongate in BSC 166. Water-storage cell walls birefringent and smooth to pitted. Aeration units present. ENDODERMAL

CELLS -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick- walled opposite phloem. VASCULAR CYLINDER 7-arch. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Oeoniella

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 6.25 µm thick; abaxial cuticle 1.25 to 5.0 µm thick. HAIRS multicellular, glandular. STOMATA abaxial. Outer ledges thin to thick, inner ledges thick. Substomatal chambers small, irregularly shaped. EPIDERMAL 177

CELLS periclinally oriented to isodiametric and infrequently conical adaxially in

BSC 123; conical abaxially in all specimens examined. HYPODERMIS absent.

FIBER BUNDLES absent. MESOPHYLL homogeneous, 13 to 18 cells wide.

Water-storage cells with birefringent bands in BSC 213 and K 433-75-04420; birefringent walls absent in BSC 123. Cells above midrib slightly modified in BSC

123 and K 433-75-04420; distinctly modified in BSC 213. VASCULAR

BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough- surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent.

Cover cells present over short cells of exodermis. Hairs present in BSC 123.

Algal cells present in BSC 213 and K 433-75-04420. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩-thickened in K 433-75-04420;

∩- to -thickened in BSC 123; and primarily -thickened in BSC 213.

Proliferations present in BSC 123 and K 433-75-04420. CORTEX 14 to 16 cells wide. Hyphae present in BSC 213. Water-storage cells with pitted to banded birefringent walls, often slightly thickened. Aeration units present.

ENDODERMAL CELLS -thickened. PERICYCLIC CELLS usually thin-walled opposite xylem and thick-walled opposite phloem; completely thin-walled in BSC

123. VASCULAR CYLINDER 18- to 25-arch. Vascular tissue embedded in parenchyma and thin-walled sclerenchyma in BSC 123; embedded in only 178 sclerenchyma in BSC 213 and K 433-75-04420. PITH parenchymatous or thin- walled and sclerenchymatous in BSC 123. Cells circular in TS.

Ossiculum

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Ad- and abaxial cuticle 6.25 µm thick. HAIRS absent. Sunken areas in epidermis abundant. STOMATA abaxial. Outer ledges thin, inner ledges thin; cuticular horns small to ± prominent. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric.

HYPODERMIS absent. FIBER BUNDLES present singly along each margin, composed of many thick-walled fibers surrounding two to five small thin-walled cells. MESOPHYLL homogeneous, 12 to 19 cells wide. Water-storage cells with birefringent bands, often slightly thickened. Cells above midrib unmodified.

VASCULAR BUNDLES arranged in a V-shaped pattern as a result of leaf TS shape. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found associated with phloem sclerenchyma only; encircling fiber bundles

Root. Roots not available.

Plectrelminthus

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Ad- and abaxial cuticle 1.25 to 2.5 µm thick. HAIRS multicellular, glandular.

STOMATA abaxial; rarely adaxial in K 391-83-04788. Outer ledges thin to thick, inner ledges thick; cuticular horns small. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. 179

HYPODERMIS ad- and abaxial. Fibrous idioblasts forming a single row and occurring singly or in pairs scattered among mesophyll chlorenchyma cells.

Adaxial fibrous idioblasts larger than abaxial idioblasts. FIBER BUNDLES absent. MESOPHYLL 13 to 17 cells wide, heterogeneous with columnar adaxial cells and isodiametric abaxial cells. Water-storage cell walls not birefringent.

Thick-walled fibrous idioblasts concentrated near hypodermis. Cells above midrib slightly modified in BSC 69, distinctly modified in K 391-83-04788 and

WLS 624. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct.

STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN four to five cells wide. Endovelamen cells angular, isodiametric to radially elongate; outer layers composed of smaller, thicker-walled cells than inner layers. Distinct endovelamen thickenings absent. Cover cells present over short cells of the exodermis. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily ∩-thickened in BSC 69 and K

391-83-04788; primarily -thickened in WLS 624. Proliferations absent.

CORTEX 19 to 23 cells wide. Water-storage cell walls with birefringent bands.

Aeration units present in BSC 69. ENDODERMAL CELLS usually -thickened to rarely ∪-thickened in K 391-83-04788. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 17- to 40-arch. Vascular tissue embedded in thin-walled parenchyma in K 391-83- 180

04788 and WLS 624; embedded in sclerenchyma in BSC 69. PITH sclerenchymatous. Cells circular in TS.

Podangis

Leaf. Podangis dactyloceras possesses terete leaves with no discernible adaxial epidermis. CUTICLE smooth to ridged along the contours of the epidermal cells; 5.0 to 6.25 µm thick. HAIRS rare, multicellular, glandular.

STOMATA abaxial. Outer ledges thin to moderate, inner ledges thick.

Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS conical.

HYPODERMIS abaxial. Fibrous idioblasts forming an almost continuous layer infrequently interrupted by chlorenchyma cells. FIBER BUNDLES absent.

MESOPHYLL 27 to 45 cells wide, heterogeneous with several rows of columnar cells surrounding a central suture of isodiametric to periclinally flattened cells.

Water-storage cell walls birefringent, concentrated in central suture of mesophyll.

Cells above midrib unmodified. VASCULAR BUNDLES forming a circle around central suture. Sclerenchyma associated with both xylem and phloem poles.

Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Endovelamen cells angular, isodiametric to radially elongate; outer layer composed of thicker-walled cells than inner layer. Distinct endovelamen thickenings absent. Cover cells present over short cells of the exodermis. Hairs present in BSC 70 and BSC 227. Algal cells present in BSC 227 and K 16654. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily -thickened. Proliferations absent. 181

CORTEX 12 to 18 cells thick. Water-storage cells birefringent and smooth to pitted. Aeration units present in BSC 227. ENDODERMAL CELLS strongly - thickened in BSC 227 and K 16654. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 20- to 30- arch. Xylem rays without distinct metaxylem elements in BSC 70 and BSC 227.

Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Rangaeris

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 1.25 to 15.0 µm thick; abaxial cuticle 2.5 to 8.75 µm thick. HAIRS infrequent, multicellular, glandular. STOMATA abaxial; ad- and abaxial in R. muscicola; slightly sunken in R. muscicola (K 181164). Outer ledges thin to thick but primarily moderate, inner ledges thick. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric in R. longicaudata and R. schliebenii; frequently conical ad- and abaxially in R. muscicola; conical abaxially in R. amaniensis. HYPODERMIS adaxial only in R. longicaudata; ad- and abaxial in R. amaniensis, R. muscicola, and R. schliebenii.

Fibrous idioblasts thin- to thick-walled, distributed in a single row below the epidermis interrupted by chlorenchyma. FIBER BUNDLES absent.

MESOPHYLL 13 to 20 cells wide; homogeneous in R. amaniensis and R. muscicola; heterogeneous with columnar adaxial cells and isodiametric abaxial cells in R. longicaudata and R. schliebenii. Lignified, moderately thickened fibrous idioblasts scattered throughout mesophyll in R. schliebenii; cells 182 isodiametric and angular in TS (Fig. 3-17), elongate in LS. Water-storage cells with birefringent walls found only above the midrib in R. muscicola; water-storage cell walls not birefringent in all other species examined. Cells above the midrib distinctly modified. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath indistinct.

STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to four cells wide. Endovelamen cells angular, isodiametric to radially elongate; outer layer composed of thicker-walled cells than inner layer. Distinct endovelamen thickenings absent. Cover cells present over short cells of the exodermis. Algal cells abundant in R. amaniensis (WLS

975) and R. muscicola (K 181164). Hyphae present in R. longicaudata and R. schliebenii. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily -thickened. Proliferations present in R. amaniensis (K 084-81-

01290) and R. longicaudata. CORTEX 14 to 34 cells wide. Mucilage globules abundant in R. longicaudata. Water-storage cell walls with birefringent bands.

Aeration units present in R. amaniensis (WLS 975) and R. muscicola.

ENDODERMAL CELLS -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 15- to 29- arch. Xylem clusters without distinct metaxylem elements in R. muscicola (BSC

86). Vascular tissue embedded in sclerenchyma, cell walls of embedding sclerenchyma thickest around phloem clusters in R. amaniensis (WLS 975) and 183 above phloem clusters in R. schliebenii. PITH sclerenchymatous. Cells circular in TS.

Rhipidoglossum

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells, occasionally papillose in R. bilobatum and R. xanthopollinium. Adaxial cuticle

1.25 µm to 12.5 µm thick; abaxial cuticle less than 1.25 µm to 7.5 µm thick.

HAIRS glandular and multicellular; basal cell sunken into buttress of raised epidermal cells in R. bilobatum; hairs absent in R. curvatum and R. obanense.

STOMATA abaxial; ad- and abaxial in R. obanense. Outer ledges thin to thick, inner ledges moderate to thick. Substomatal chambers small, irregularly shaped.

EPIDERMAL CELLS periclinally oriented to isodiametric; conical in R. subsimplex and R. xanthopollinium. HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL 9 to 19 cells thick; heterogeneous with columnar anticlinal adaxial cells and isodiametric abaxial cells in R. bilobatum, R. pulchellum, and R. xanthopollinium (BSC 191); homogeneous in all other specimens examined.

Water-storage cells with variously formed birefringent bands in R. obanense; absent R. kamerunense, R. pulchellum, R. subsimplex, and R. xanthopollinium.

Cells above midrib unmodified in R. curvatum; slightly modified in R. bilobatum,

R. kamerunense, R. obanense, R. rutilum, and R. xanthopollinium; distinctly modified in R. pulchellum and R. subsimplex. VASCULAR BUNDLES with thin- walled sclerenchyma at xylem and phloem groups in R. kamerunense and R. xanthopollinium. Bundle sheath indistinct in R. curvatum, R. kamerunense, and 184

R. obanense. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to four cells wide. Epivelamen cells isodiametric in

R. curvatum and R. kamerunense; radially elongate in all other specimens examined. Endovelamen cells angular, isodiametric to radially elongate; outermost layers of cells thicker-walled than inner layers. Distinct endovelamen thickenings ridged in R. obanense, absent in all other species examined. Cover cells absent in R. obanense and R. pulchellum; present over short cells of exodermis in all other specimens examined. Hairs present in R. xanthopollinium.

Hyphae present in R. pulchellum, R. rutilum, and R. subsimplex. Algal cells present in R. bilobatum, R. curvatum, and R. xanthopollinium. EXODERMAL

CELLS radially elongate to isodiametric. Long cell walls ∩-thickened in R. kamerunense, R. obanense, and R. xanthopollinium (K 396-82-04315); - thickened in all other specimens examined. Proliferations present in R. bilobatum, R. curvatum, R. pulchellum, and R. subsimplex. CORTEX 11 to 28 cells wide. Starch grains abundant in R. pulchellum. Hyphae present in R. rutilum. Water-storage cell walls birefringent and smooth to pitted in R. bilobatum, R. curvatum, R. pulchellum, R. rutilum, R. subsimplex, and R. xanthopollinia; birefringent walls absent in R. kamerunense and R. obanense.

Single modified cortical layer of thin- to thick-walled cells surrounding the endodermis (Fig. 3-29) in R. curvatum and R. pulchellum. Aeration units present in R. bilobatum, R. kamerunense, R. obanense, R. subsimplex, R. xanthopollinium (BSC 191). ENDODERMAL CELLS strongly -thickened in R. 185 bilobatum, R. curvatum, R. pulchellum, and R. subsimplex. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR

CYLINDER 7- to 20-arch. Xylem clusters without distinct metaxylem elements in

R. curvatum and R. obanense. Vascular tissue embedded in sclerenchyma, cell walls of embedding sclerenchyma thickest around phloem clusters in R. pulchellum, R. rutilum, R. subsimplex, and R. xanthopollinium (BSC 191). PITH usually sclerenchymatous, but parenchymatous in R. kamerunense. Cells circular in TS.

Sobennikoffia

Leaf. CUTICLE ridged to papillose. Adaxial cuticle 6.25 to 13.75 µm thick; abaxial 6.25 to 12.5 µm thick. HAIRS multicellular, glandular. STOMATA abaxial. Outer ledges thin to primarily thick, inner ledges thick; cuticular horns small in S. humbertiana (BSC 230) and S. robusta (WLS 977). Substomatal chamber small, anticlinally oriented. EPIDERMAL CELLS typically papillose to occasionally conical. HYPODERMIS absent. FIBER BUNDLES absent.

MESOPHYLL 14 to 19 cells wide; heterogeneous with columnar adaxial cells and isodiametric abaxial cells in S. robusta; isobilateral in S. humbertiana, with columnar cells surrounding a central region of isodiametric cells. Water-storage cells with birefringent bands. Cells above midrib distinctly modified. VASCULAR

BUNDLES collateral, in one row. Sclerenchyma associated with xylem and phloem poles. Bundle sheath distinct, cell walls occasionally thickened.

STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma. 186

Root. VELAMEN two to four cells wide. Epivelamen cells isodiametric in

S. robusta (WLS 977); radially elongate in all other specimens examined.

Endovelamen cells angular, isodiametric to radially elongate; cells of the outermost layers often thicker-walled than those of the inner layers. Distinct endovelamen thickenings smooth. Cover cells present over short cells of exodermis. Hairs and hyphae present in S. robusta (WLS 977). Algal cells present in S. robusta (BSC 138). EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily -thickened. Proliferations absent.

CORTEX 15 to 22 cells wide. Water-storage cells with birefringent bands.

Aeration units present. ENDODERMAL CELLS -thickened. PERICYCLIC

CELLS thin-walled opposite xylem and thick-walled opposite phloem in S. robusta; thin-walled with thinly lignified cells opposite phloem clusters in S. humbertiana. VASCULAR CYLINDER 8- to 18-arch. Xylem without distinct metaxylem elements in S. robusta (WLS 977). Vascular tissue embedded in thin-walled parenchyma or thinly lignified cells in S. humbertiana; embedded in thick-walled sclerenchyma in S. robusta. PITH sclerenchymatous, thin-walled in

S. humbertiana. Cells circular in TS.

Solenangis (excluding S. aphylla = Microcoelia aphylla)

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 5.0 to 12.5 µm thick; abaxial cuticle 5.0 to 7.5 µm thick. HAIRS multicellular, glandular; rare to infrequent in S. clavata, with basal cell sunken into raised buttress of epidermal cells; absent in S. wakefieldii. STOMATA abaxial; infrequently sunken in S. clavata (WLS 593). Outer ledges thin, inner 187 ledges thick. Substomatal chambers small, irregularly shaped. EPIDERMAL

CELLS periclinally oriented to isodiametric adaxially and conical abaxially in S. clavata (WLS 182, WLS 593); conical ad- and abaxially in S. wakefieldii.

HYPODERMIS ad- and abaxial, composed of thick-walled fibrous idioblasts occurring singly or in groups of two or three cells forming a single layer interspersed among thin-walled chlorenchyma. FIBER BUNDLES absent.

MESOPHYLL homogeneous, 12 to 15 cells wide. Water-storage cells with birefringent walls infrequent in S. clavata, absent in S. wakefieldii. Cells above midrib distinctly modified in S. clavata, slightly modified in S. wakefieldii.

VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells isodiametric in

S. wakefieldii; radially elongate in S. clavata. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen wall thickenings absent.

Cover cells present over short cells of exodermis. Hairs present in S. clavata (K

431-81-05035). Algal cells present in S. clavata (WLS 182). EXODERMAL

CELLS radially elongate to isodiametric. Long cell walls ∪-thickened in S. wakefieldii, ∩-thickened with radial wall swellings in S. clavata. Proliferations present in S. clavata (K 431-81-05035). CORTEX 9 to 10 cells wide. Water- storage cell walls smooth to pitted. Aeration units present. ENDODERMAL

CELLS -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick- 188 walled opposite phloem. VASCULAR CYLINDER 11- to 20-arch. Xylem rays without distinct metaxylem elements in S. clavata (WLS 593). Vascular tissue embedded in sclerenchyma, cell walls of embedding sclerenchyma thickest around phloem clusters in S. clavata (WLS 182, K 431-81-05035). PITH sclerenchymatous. Cells circular in TS.

Sphyrarhynchus

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells, infrequently papillose on the abaxial surface in K 356-81-03860. Adaxial cuticle

2.5 to 3.75 µm thick; abaxial cuticle 2.5 to 5.0 µm thick. HAIRS glandular and multicellular with basal cell sunken into raised buttress of epidermal cells.

STOMATA ad- and abaxial. Outer ledges thin to moderate. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS usually conical.

HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL homogeneous,

13 to 14 cells wide. Water-storage cells with birefringent walls absent. Large raphide idioblasts situated just below the epidermises, forming raised areas (Fig.

3-31). Cells above midrib slightly modified. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells isodiametric.

Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen wall thickenings absent. Cover cells present over short cells of exodermis. Hairs and hyphae present. EXODERMAL CELLS radially elongate 189 to isodiametric. Long cell walls primarily -thickened to slightly ∩-thickened.

Proliferations absent. CORTEX 10 or 11 cells wide. Hyphae present. Water- storage cell walls birefringent and edge thickened. Aeration units present.

ENDODERMAL CELLS usually -thickened to infrequently ∪-thickened.

PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 7- to 9-arch. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Figure 3-31. Leaf TS of Sphyrarhynchus schliebenii showing large raphide idioblast (arrowhead) forming raised area just below epidermis. Scale bar = 50 µm.

Summerhayesia

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 2.5 µm thick; abaxial cuticle 3.75 µm thick. HAIRS absent. 190

STOMATA abaxial. Outer ledges moderate; inner ledges moderate to thick.

Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric adaxially, conical abaxially. HYPODERMIS ad- and abaxial. Fibrous idioblasts in one row interrupted by thin-walled chlorenchyma. Abaxial idioblasts thicker-walled than adaxial idioblasts. FIBER

BUNDLES absent. MESOPHYLL 18 cells wide, heterogeneous with columnar adaxial cells and isodiametric abaxial cells. Water-storage cells with birefringent walls absent. Fibrous idioblasts scattered throughout mesophyll, very similar in appearance to hypodermal idioblasts but generally thinner-walled. Cells above midrib distinctly modified. VASCULAR BUNDLES collateral, in one row.

Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN four cells wide. Epivelamen cells isodiametric and thin- walled. Endovelamen cells isodiametric to radially elongate, thin-walled with fine anastomosing radial wall thickenings. Distinct endovelamen wall thickenings absent. Cover cells present over short cells of the exodermis. EXODERMAL

CELLS radially elongate to isodiametric. Long cell walls primarily -thickened.

Proliferations absent. CORTEX 16 cells wide. Water-storage cells with birefringent bands. Aeration units absent. ENDODERMAL CELLS usually - thickened to infrequently ∪-thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 11-arch. 191

Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Tridactyle

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 1.25 to 12.5 µm thick; abaxial less than 1.25 to 7.5 µm thick.

HAIRS multicellular, glandular. STOMATA abaxial; ad- and abaxial in T. filifolia and T. tridentata; slightly sunken in T. crassifolia and T. tridentata. Outer ledges thin to thick, inner ledges moderate to thick. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric; conical adaxially in T. bicaudata (BSC 208), T. scottellii, and occasionally in T. tridentata; conical abaxially in T. bicaudata (BSC 262, K 366-80-03811) and T. tridentata; papillose abaxially in T. bicaudata (BSC 208) and T. scottellii.

HYPODERMIS ad- and abaxial. Thick-walled fibrous idioblasts occurring singly or in groups of two or three forming in a single row interrupted by mesophyll chlorenchyma. Abaxial idioblasts usually thicker-walled than adaxial idioblasts.

FIBER BUNDLES absent. MESOPHYLL 10 to 23 cells wide; heterogeneous with columnar adaxial cells and isodiametric abaxial mesophyll cells in T. bicaudata

(BSC 208, BSC 262), T. crassifolia, T. filifolia, T. furcistipes, T. scottellii, T. tanneri, and T. tridentata; homogeneous in T. bicaudata (K 366-80-03811) and T. tridactylites. Water-storage cells with birefringent walls infrequent and banded in

T. tanneri; smooth to pitted in T. crassifolia and T. furcistipes; absent in T. bicaudata, T. filifolia, T. scottellii, T. tridactylites, and T. tridentata. Fibrous idioblasts scattered throughout mesophyll in all species examined except T. 192 crassifolia. Cells above midrib distinctly modified in T. bicaudata, T. furcistipes,

T. scottellii, T. tanneri, and T. tridactylites; slightly modified in T. crassifolia, T. filifolia, and T. tridentata. VASCULAR BUNDLES collateral, in one row.

Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma in T. bicaudata (BSC 208, BSC

262), T. crassifolia, T. filifolia, and T. tridentata; only associated with phloem sclerenchyma in T. bicaudata (K 366-80-03811), T. furcistipes, T. scottellii, T. tanneri, and T. tridactylites.

Root. VELAMEN two to five cells wide; sloughed off in T. filifolia.

Epivelamen cells radially elongate in all species except T. tanneri, where they are isodiametric to infrequently radially elongate. Cells thin-walled in T. scottellii and

T. tridentata. Tufts of several anticlinally oriented cells scattered along the epivelamen of T. bicaudata (BSC 208, BSC 262), T. crassifolia, and T. furcistipes

(Fig. 3-32). Endovelamen cells angular, isodiametric to radially elongate; outer layers composed of thicker-walled cells than inner layers. Distinct endovelamen wall thickenings absent. Cover cells absent in T. tanneri (BSC 271), present over short cells of exodermis in all other specimens examined. Hairs present in T. scottellii and T. tanneri. Hyphae present in T. tanneri (BSC 271) and T. tridentata. Algal cells present in T. bicaudata (BSC 208, K 366-80-03811), T. scottellii, and T. tridactylites (K 25166). EXODERMAL CELLS radially elongate to isodiametric. Long cell walls -thickened to infrequently ∩-thickened in T. bicaudata (BSC 208, BSC 262) and T. tanneri (K 366-80-03811). Proliferations 193 present in T. filifolia, T. scottellii, T. tanneri (BSC 271), and T. tridactylites (K

25166); absent in T. bicaudata, T. crassifolia, T. furcistipes, T. tanneri (K 097-76-

00664), T. tridactylites (BSC 96), and T. tridentata. CORTEX 14 to 28 cells wide.

Cells often irregularly shaped in T. tridentata. Hyphae present in T. scottellii, T. tanneri (BSC 271), and T. tridentata. Water-storage cell walls with birefringent edge thickenings in T. bicaudata (BSC 206, BSC 262); birefringent bands in T. bicaudata (K 366-80-03811), T. crassifolia, T. filifolia, T. furcistipes, T. scottellii,

T. tanneri, T. tridactylites, and T. tridentata. Aeration units present in T. bicaudata, T. furcistipes, T. scottellii, T. tanneri (BSC 271), and T. tridactylites

(BSC 96). ENDODERMAL CELLS primarily -thickened to rarely ∪-thickened in

T. bicaudata (BSC 208). PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 11- to 33-arch. Vascular tissue usually embedded in sclerenchyma; embedding tissue parenchymatous and thin-walled in T. furcistipes. In T. tridactylites (K 25166), thin-walled parenchyma forms wings of tissue around phloem clusters. PITH sclerenchymatous. Cells circular in TS.

Ypsilopus

Leaf. Leaves of Y. viridiflorus are terete along most of their length, except for the leaf sheath which encircles the stem. Adaxial epidermal characteristics were derived from sections of this leaf sheath. CUTICLE smooth to ridged along the contours of the epidermal cells. Adaxial cuticle less than 1.25 to 7.5 µm thick; abaxial cuticle less than 1.25 to 6.25 µm thick. HAIRS multicellular, glandular in Y. viridiflorus; absent in Y. longifolius. STOMATA abaxial. 194

Figure 3-32. Root TS of Tridactyle crassifolia showing tufts in epivelamen. Scale bar = 100 µm.

Outer ledges moderate to thick, inner ledges thick. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric; rarely conical abaxially in Y. longifolius. HYPODERMIS ad- and abaxial in Y. longifolius, abaxial only in Y. viridiflorus. Fibrous idioblasts occurring singly or in groups of two to several cells, distributed among mesophyll chlorenchyma cells in a single row. FIBER BUNDLES absent. MESOPHYLL 10 to 17 cells wide, homogeneous in Y. longifolius (K 224-84-01904) and Y. viridiflorus; heterogeneous with columnar adaxial cells and isodiametric abaxial cells in Y. longifolius (BSC 273). Water-storage cells with birefringent walls rare in Y. 195 viridiflorus, absent in Y. longifolius. Cells above midrib distinctly modified in Y. longifolius and unmodified in Y. viridiflorus. VASCULAR BUNDLES collateral, in one row in Y. longifolius; arranged in a single row with a small vascular bundle situated above the larger midrib bundle in the leaf sheath of Y. viridiflorus.

During development, the bundles presumably twist to form a single row of variously oriented vascular strands. In all sections examined, the midrib has rotated 90o from its configuration within the leaf sheath (so the xylem and phloem units of different vascular bundles face the leaf margins, Fig. 3-33).

Sclerenchyma associated with xylem and phloem poles. Bundle sheath distinct.

STEGMATA only associated with phloem sclerenchyma in Y. longifolius (K 224-

84-01904) and Y. viridiflorus, associated with xylem and phloem sclerenchyma in

Y. longifolius (WLS 625).

Root. VELAMEN two to four cells wide. Epivelamen cells thin-walled and isodiametric to radially elongate in Y. longifolius; isodiametric only in Y. viridiflorus. Endovelamen cells angular, isodiametric to radially elongate. Cell walls thin to slightly thickened; outer layers often thicker-walled than inner layers.

Distinct endovelamen thickenings absent. Cover cells present over exodermal short cells. Hairs present in Y. longifolius (BSC 273). Hyphae present in Y. viridiflorus, algal cells in Y. longifolius. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls -thickened in Y. viridiflorus, ∪-thickened in Y. longifolius. Proliferations present in Y. viridiflorus. CORTEX 9 to 23 cells wide.

Water-storage cell walls birefringent and smooth to pitted in Y. longifolius; with birefringent bands in Y. viridiflorus. Aeration units present in Y. longifolius (BSC 196

273) and Y. viridiflorus. ENDODERMAL CELLS -thickened. PERICYCLIC

CELLS thin-walled opposite xylem and thick-walled opposite phloem.

VASCULAR CYLINDER 8- to 15-arch. Vascular tissue embedded in sclerenchyma, cell walls of embedding sclerenchyma thickest around phloem groups in Y. longifolius (WLS 625). PITH mainly sclerenchymatous, central-most region of Y. longifolius (WLS 625) parenchymatous. Cells circular in TS.

Figure 3-33. Leaf TS of Ypsilopus viridiflorus showing twisted vascular bundles. Scale bar = 200 µm.

Anatomy of Subtribe Aeridinae

Acampe

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 11.25 µm thick; abaxial cuticle 8.75 µm thick. HAIRS multicellular, glandular. STOMATA abaxial, superficial to sunken. Outer ledges thin, inner ledges thick. Substomatal chambers small, irregularly shaped. EPIDERMAL

CELLS periclinally oriented to isodiametric. HYPODERMIS absent. FIBER

BUNDLES absent. MESOPHYLL homogeneous, 16 cells wide. Water-storage cells with birefringent bands. Cells above midrib distinctly modified. VASCULAR 197

BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough- surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two to three cells wide. Epivelamen cells isodiametric in

K 23465; radially elongate in BSC 147. Endovelamen cells angular, isodiametric to radially elongate; cells of outer layer thicker-walled than those of the inner layer. Distinct endovelamen thickenings absent. Cover cells present over short cells of exodermis. Hairs present. Algal cells present in K 23465. EXODERMAL

CELLS radially elongate to isodiametric. Long cell walls primarily -thickened.

Proliferations present in K 23465. CORTEX 17 cells wide. Water-storage cells with birefringent bands. Aeration units absent. ENDODERMAL CELLS - thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 12- to 14-arch. Xylem rays without distinct metaxylem elements in K 23465. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Amesiella

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 7.5 µm thick; abaxial cuticle 5.0 µm thick. HAIRS multicellular, glandular. STOMATA ad- and abaxial. Outer ledges thin, inner ledges thick.

Substomatal chamber large, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric, infrequently conical abaxially. HYPODERMIS absent.

FIBER BUNDLES absent. MESOPHYLL 20 cells wide, isobilateral with columnar anticlinal cells surrounding central core of isodiametric cells. Water-storage cells 198 with finely banded birefringent wall thickenings. Cells above midrib unmodified.

VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA absent.

Root. VELAMEN three cells wide. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent.

Cover cells present over short cells of exodermis. Hairs present. EXODERMAL

CELLS radially elongate to isodiametric. Long cell walls -thickened to infrequently ∩-thickened. Proliferations present. CORTEX 17 cells wide. Water- storage cells with finely banded birefringent wall thickenings. Aeration units present. ENDODERMAL CELLS -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 11- arch. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous.

Cells circular in TS.

Chiloschista

Leaf. Species of Chiloschista possess caducous leaves, and most specimens sampled in my study were leafless at the time material was harvested for anatomical study. Therefore, only two of the six specimens (C. parishii and C. lunifera) were used to describe the leaf anatomy of Chiloschista. CUTICLE smooth to ridged along the contours of the epidermal cells. Ad- and abaxial cuticle less than 1.25 µm thick. HAIRS simple, eglandular (Fig. 3-34). Epidermal cells somewhat raised around base of hairs. STOMATA ad- and abaxial. Outer ledges thin to moderate, inner ledges moderate to thick; cuticular horns inconspicuous. Substomatal chambers small, irregularly shaped. EPIDERMAL 199

CELLS periclinally oriented to isodiametric. HYPODERMIS absent. FIBER

BUNDLES absent. MESOPHYLL homogeneous, 10 to 14 cells wide. Water- storage cells with birefringent walls absent. Cells above midrib unmodified.

VASCULAR BUNDLES collateral, in one row. Thin-walled sclerenchyma associated with phloem and xylem poles. STEGMATA absent.

Root. VELAMEN often absent to three cells wide. Epivelamen cells isodiametric in C. lunifera (BSC 149); isodiametric to radially elongate in C. parishii (BSC 22); radially elongate in all other specimens examined.

Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells present over short cells of exodermis. Hairs present in C. lunifera and C. parishii. Hyphae present in C. lunifera (BSC 179) and C. parishii (BSC 22). Algal cells present in C. lunifera and C. usneoides. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily -thickened. Proliferations present in C. lunifera, C. parishii

(all specimens except BSC 163), and C. usneoides. CORTEX 10 to 13 cells wide. Hyphae present in C. lunifera (BSC 179) and C. parishii (BSC 22). Water- storage cells with birefringent walls absent. Aeration units present.

ENDODERMAL CELLS -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 5- to 8-arch.

Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells circular in TS. 200

Figure 3-34. Leaf TS of Chiloschista lunifera showing eglandular trichome. Scale bar = 50 µm.

Microtatorchis

Leaf. Although many species of Microtatorchis are leafless, the specimen examined in my study (M. iboetii) generally possesses leaves, but these were not available for examination because only roots were available from the spirit collection of the National Herbarium Netherlands.

Root. VELAMEN often absent to two cells wide. Epivelamen cells isodiametric to tangentially flattened and thin-walled. Endovelamen cells angular, thin-walled, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells absent. Hairs present. EXODERMAL CELLS 201 radially elongate to isodiametric. Long cell walls primarily -thickened.

Proliferations present. CORTEX 11 cells wide. Water-storage cell walls birefringent and smooth to pitted. Aeration units absent. ENDODERMAL CELLS

-thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 3-arch. Vascular tissue embedded in sclerenchyma. PITH sclerenchymatous. Cells isodiametric and ± angular in TS.

Neofinetia

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 13.75 µm thick; abaxial cuticle 8.75 to 13.75 µm thick. HAIRS absent. STOMATA abaxial, superficial to slightly sunken. Outer ledges thin to moderate, inner ledges moderate to thick. Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS conical. HYPODERMIS ad- and abaxial, composed of thick-walled fibrous idioblasts forming one row adaxially and two rows abaxially, interrupted by thin-walled chlorenchyma. FIBER

BUNDLES absent. MESOPHYLL homogeneous, 15 to 16 cells wide.

Birefringent water-storage cells smooth to pitted. Thick-walled fibrous idioblasts scattered throughout. Cells above midrib slightly modified. VASCULAR

BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough- surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN three cells wide. Epivelamen cells radially elongate.

Endovelamen cells angular, isodiametric to radially elongate; cells of outer layer usually thicker-walled than those of the inner layers. Distinct endovelamen 202 thickenings ridged. Cover cells present over short cells of exodermis. Algal cells present. EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily -thickened. Proliferations present. CORTEX 16 to 19 cells wide.

Water-storage cells with birefringent bands. Large, fibrous idioblasts scattered throughout (Fig. 3-35). Aeration units absent. ENDODERMAL CELLS - thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 9- to 12-arch. Vascular tissue embedded in sclerenchyma, cell walls of embedding sclerenchyma thickest around phloem clusters. PITH sclerenchymatous. Cells circular in TS.

Figure 3-35. Root TS of Vanda flabellata showing large, fibrous idioblasts of cortex. Scale bar = 100 µm. 203

Phalaenopsis

Leaf. While most species of Phalaenopsis are leafy, of the three species examined only P. deliciosa had well-developed photosynthetic leaves. The other two species were deciduous and were leafless when harvested for anatomical study. The following description applies only to leaves of P. deliciosa. CUTICLE smooth to ridged along the contours of the epidermal cells. Ad- and abaxial cuticle 2.5 µm thick. HAIRS absent. STOMATA abaxial. Outer ledges thin to moderate, inner ledges moderate to thick; cuticular horns inconspicuous.

Substomatal chambers small, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS absent. FIBER BUNDLES absent. MESOPHYLL homogeneous, 15 cells wide. Water-storage cells with birefringent walls absent. Cells above midrib distinctly modified. VASCULAR

BUNDLES collateral, in one row. Thin-walled sclerenchyma associated with xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN two cells wide. Epivelamen cells isodiametric to tangentially flattened in P. deliciosa and P. hainanensis; radially elongate in all other species examined. Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings absent. Cover cells present over short cells of exodermis. Hairs present in P. deliciosa. Algal cells present in P. deliciosa and P. wilsonii. EXODERMAL CELLS radially elongate to isodiametric.

Long cell walls ∩-thickened in P. hainanensis and P. wilsonii; strongly ∩- 204 thickened in P. deliciosa. Proliferations present in P. deliciosa and P. wilsonii.

CORTEX 10 to 21 cells wide. Starch grains present in P. deliciosa. Cells isodiametric to tangentially elongate in P. hainanensis. Water-storage cells with birefringent walls infrequent in P. wilsonii and absent in P. deliciosa and P. hainanensis. Aeration units present. ENDODERMAL CELLS heavily - thickened in P. deliciosa. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 7- to 9-arch. Vascular tissue embedded in sclerenchyma. PITH parenchymatous to thick-walled and sclerenchymatous in P. deliciosa and P. hainanensis. Cells circular in TS.

Taeniophyllum

Leaf. All species of Taeniophyllum are leafless and only possess brown, nonphotosynthetic scales along the stem.

Root. VELAMEN often absent to two cells wide. Epivelamen cells isodiametric in T. biocellatum, T. fasciola, T. sp. (BSC 170); isodiametric to tangentially flattened in T. smithii and T. sp. (BSC 171). Endovelamen cells angular, isodiametric to radially elongate. Distinct endovelamen thickenings ridged in T. biocellatum and T. fasciola, absent in T. sp (BSC 170, 171) and T. smithii. Cover cells absent. Hairs present in T. biocellatum, T. fasciola, and T. sp. (BSC 171). EXODERMAL CELLS radially elongate to isodiametric. Long cell walls ∩-thickened in T. fasciola, T. smithii, and T. sp. (BSC 170); -thickened in

T. sp. (BSC 171) and T. biocellatum. Proliferations present in T. sp. (BSC 170) and T. biocellatum. CORTEX 4 to 24 cells wide. Cells isodiametric to radially and tangentially elongate. Starch grains and hyphae present in T. sp. (BSC 170) 205 and T. biocellatum. Water-storage cell walls birefringent and smooth to pitted in

T. sp. (BSC 171), T. biocellatum, T. fasciola, and T. smithii (BSC 181); with birefringent bands in T. smithii (BSC 182); birefringent walls absent in T. sp.

(BSC 170). Aeration units present. ENDODERMAL CELLS heavily - thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 5- to 8-arch. Xylem arms without distinct metaxylem elements in T. fasciola. Vascular tissue embedded in thick- walled sclerenchyma. PITH sclerenchymatous. Cells thick-walled and circular in

TS.

Trichoglottis

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Ad- and abaxial cuticle 8.75 µm thick. HAIRS rare, multicellular, glandular.

STOMATA ad- and abaxial. Outer ledges thin, inner ledges moderate to thick.

Substomatal chamber large, irregularly shaped. EPIDERMAL CELLS periclinally oriented to isodiametric. HYPODERMIS absent. FIBER BUNDLES absent.

MESOPHYLL homogeneous, 16 cells wide. Water-storage cells with birefringent finely banded walls. Cells above midrib distinctly modified. VASCULAR

BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct. STEGMATA contain spherical, rough- surfaced silica bodies found in association with phloem and xylem sclerenchyma.

Root. VELAMEN three cells wide. Epivelamen cells radially elongate.

Endovelamen cells angular, isodiametric to radially elongate; cells in the outer layer thicker-walled than those of the inner layers. Distinct endovelamen 206 thickenings absent. Cover cells present over short cells of exodermis.

EXODERMAL CELLS radially elongate to isodiametric. Long cell walls primarily

-thickened. Proliferations absent. CORTEX 20 cells wide. Water-storage cells with birefringent finely banded walls, often slightly thickened. Aeration units present. ENDODERMAL CELLS -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 21- arch. Vascular tissue embedded in thick-walled sclerenchyma. PITH sclerenchymatous. Cells circular in TS.

Vanda

Leaf. CUTICLE smooth to ridged along the contours of the epidermal cells.

Adaxial cuticle 10.0 µm thick; abaxial cuticle 6.25 µm thick. HAIRS absent.

STOMATA abaxial. Outer ledges thin to moderate, inner ledges thick.

Substomatal chamber small, usually wedged between hypodermal fibers.

EPIDERMAL CELLS conical. HYPODERMIS ad- and abaxial, composed of one or two rows of very thick-walled fibrous idioblasts interspersed with thin-walled chlorenchyma. FIBER BUNDLES absent. MESOPHYLL homogeneous, 16 cells wide. Birefringent water-storage cells smooth to pitted. Thick-walled fibrous idioblasts scattered throughout abaxial mesophyll. Cells above midrib slightly modified. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with both xylem and phloem poles. Bundle sheath distinct.

STEGMATA contain spherical, rough-surfaced silica bodies found in association with phloem and xylem sclerenchyma. 207

Root. VELAMEN three to four cells wide. Epivelamen cells radially elongate. Endovelamen cells angular, isodiametric to radially elongate; cells of the outer layer thicker-walled than those of the inner layer. Distinct endovelamen walls absent. Cover cells present over short cells of exodermis. EXODERMAL

CELLS radially elongate to isodiametric. Long cell walls primarily -thickened.

Proliferations absent. CORTEX 21 cells wide. Cells often irregularly shaped.

Thick-walled fibrous idioblasts abundant throughout. Water-storage cell walls birefringent and smooth to pitted. Single modified cortical layer of thin- to thick- walled cells surrounding the endodermis. Aeration units present.

ENDODERMAL CELLS -thickened. PERICYCLIC CELLS thin-walled opposite xylem and thick-walled opposite phloem. VASCULAR CYLINDER 31-arch.

Xylem rays without distinct metaxylem elements. Vascular tissue embedded in sclerenchyma, cell walls of embedding sclerenchyma thickest around phloem clusters. PITH mainly sclerenchymatous with scattered thin-walled parenchyma in the center. Cells circular in TS.

Anatomy of Tribe Epidendreae, Subtribe Polystachyinae

Neobenthamia

Leaf. CUTICLE smooth to slightly ridged; 2.5 µm thick ad- and abaxially.

HAIRS absent. STOMATA superficial, abaxial only. Outer and inner ledges thin to moderate; cuticular horns prominent. Substomatal chamber small, irregularly shaped. EPIDERMAL CELLS isodiametric to periclinally oriented, thickened along the outer tangential walls. HYPODERMIS adaxial, composed of one to two cell layers of large mucilage-containing water-storage cells (Fig. 3-36). FIBER

BUNDLES absent. MESOPHYLL homogeneous, 8 cells wide. Water-storage 208 cells with birefringent walls absent. Large mucilage-containing cells scattered throughout mesophyll. Cells above midrib distinctly modified from surrounding mesophyll. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with xylem and phloem poles. Bundle sheath distinct, composed of thin-walled chlorenchyma. STEGMATA absent.

Root. VELAMEN three cells wide. Epivelamen cells isodiametric and thin- walled to ∪-thickened with fine anastomosing radial wall thickenings.

Endovelamen cells isodiametric and rounded, evenly thickened. Cells of the outer layer thicker-walled than those of the inner layers. Cover cells absent.

EXODERMAL CELLS radially elongate to isodiametric. Long cell walls - thickened; short cells thin-walled to ∩-thickened. Exodermal proliferations present, but not well-developed. TILOSOMES webbed (Fig. 3-37). CORTEX nine cells wide. Cells thin-walled and primarily isodiametric; chloroplasts present throughout. Birefringent water-storage cells smooth-walled. Mucilage-containing idioblasts scattered throughout. Aeration units absent. ENDODERMAL CELLS isodiametric, -thickened; passage cells thin-walled, opposite xylem.

PERICYCLE mainly thick-walled, small groups of thin-walled cells opposite xylem. VASCULAR CYLINDER 13-arch. Xylem arms each with one to several large, distinct tracheary elements; phloem clusters round to elliptical in TS.

Vascular tissue embedded in thick-walled sclerenchyma. PITH sclerenchymatous. Cells round in TS. 209

Figure 3-36. Leaf TS of Polystachya longiscapa showing water-storage cells and the absence of stegmata associated with the vascular bundles. Scale bar = 100 µm.

Polystachya

Leaf. CUTICLE smooth to ridged. Adaxial cuticle less than 1.25 to 2.5 µm thick; abaxial cuticle up to 1.25 µm thick. HAIRS rare, glandular, multicellular with sunken basal cell in P. modesta; absent in P. concreta and P. longiscapa. 210

STOMATA superficial, abaxial only. Outer ledges thin to thick; inner ledges moderate to thick; cuticular horns small. Substomatal chamber small, irregularly shaped. EPIDERMAL CELLS isodiametric to periclinally oriented. Walls evenly thickened to thickened only along the outer tangential surface. HYPODERMIS adaxial, composed of one to three layers of large, thin-walled, mucilage- containing water-storage idioblasts. FIBER BUNDLES absent. MESOPHYLL homogeneous, 10 to 15 cells wide. Water-storage cells with birefringent walls absent. Large, mucilage-containing idioblasts scattered throughout. Cells above midrib distinctly modified from surrounding mesophyll, most prominent in P. longiscapa. VASCULAR BUNDLES collateral, in one row. Sclerenchyma associated with xylem and phloem clusters, cells thicker-walled near phloem.

Bundle sheath distinct, composed of thin-walled chlorenchyma. STEGMATA absent.

Root. VELAMEN three to four cells wide. Epivelamen cells isodiametric to tangentially flattened, thin-walled in P. concreta and P. modesta to ∪-thickened in P. longiscapa. Radial wall thickenings fine and anastomosing. Endovelamen cells isodiametric and rounded; walls thin to evenly thickened. Cover cells absent. Hairs present in P. concreta. EXODERMAL CELLS isodiametric to radially elongate. Long cell walls ∩-thickened in P. concreta and P. modesta, - thickened in P. longiscapa. Short cells thin-walled to ∩-thickened. Exodermal proliferations absent. TILOSOMES webbed. CORTEX 10 to 20 cells wide.

Cells thin-walled, isodiametric to radially elongate; chloroplasts present throughout in P. modesta and P. longiscapa. Water-storage cells with 211

Figure 3-37. Root TS of Polystachya longiscapa showing webbed tilosomes. a) Light micrograph. Scale bar = 100 µm. b) Scanning electron micrograph. Scale bar = 23.1 µm. 212 birefringent smooth to banded walls in P. longiscapa; birefringent walls smooth with edge thickenings in P. concreta; birefringent walls absent in P. modesta.

Mucilage-containing idioblasts present throughout. Aeration units absent.

ENDODERMAL CELLS isodiametric; thin-walled in P. modesta, slightly - thickened in P. concreta; and -thickened in P. longiscapa. Passage cells thin- walled, opposite xylem. PERICYCLE mainly thin-walled with small groups of lignified cells opposite phloem in P. concreta and P. modesta. Cells thin-walled opposite xylem and thick-walled opposite phloem in P. longiscapa. VASCULAR

CYLINDER 11- to 14-arch. Xylem rays each with one to several large, distinct tracheary elements; phloem clusters round to elliptical in TS. Vascular tissue embedded in parenchyma in P. modesta; thin-walled sclerenchyma and parenchyma in P. concreta; sclerenchyma in P. longiscapa. PITH completely parenchymatous in P. concreta and P. modesta; outer ring of sclerenchymatous and inner ring of parenchymatous tissue in P. longiscapa. Cells round in TS.

Phylogenetic Analyses of Vandeae

Initial heuristic analyses of 169 taxa using 26 vegetative anatomical and morphological characters (Tables 3-2 and 3-4) initially produced 100 equally parsimonious trees. These trees were then swapped to completion, resulting in

20,000+ equally parsimonious trees with L = 227, CI = 0.154, RI = 0.745, and RC

= 0.115 (Fig. 3-38). A bootstrap consensus revealed little resolution among the

169 taxa examined (Fig. 3-39). The monophyly of Vandeae, however, was well- supported (90% BS) using members of Polystachyinae as outgroups. The characters supporting Vandeae as a clade were: loss of tilosomes; presence of stegmata; loss of mucilage; and presence of a monopodial stem (Fig. 3-40). 213

Three ingroup clades were maintained with at least 50% bootstrap support (BS):

Sobennikoffia humbertiana + S. robusta (77% BS); Cyrtorchis praetermissa + C. ringens (55% BS); and Angraecopsis amaniensis + A. breviloba (50% BS).

However, Angraecopsis amaniensis + A. breviloba was the only clade not collapsed in the strict consensus (Fig. 3-40). These two species of Angraecopsis were supported by the presence of deciduous leaves.

Discussion

Comparative Anatomy

Vandeae can be characterized by several vegetative features including a monopodial habit; the presence of spherical stegmata within the leaves; a loss of mucilage throughout the plant body; and a loss of tilosomes (Fig. 3-40). Of these characters, the presence of a single, continuously growing stem apex is probably one of the most important evolutionary steps toward the unique type of leaflessness within Vandeae. If a reduction in vegetative output by decreasing stem length and reducing leaves to vestigial organs is controlled by one or two genes, it could then be switched on or off relatively easily. This vegetative reduction could allow plants to allot more energy towards sexual reproduction, giving leafless orchids a novel way of thriving within the harsh canopy environment (Benzing et al., 1983). Root aeration units were commonly observed throughout Vandeae and may have been another important evolutionary step toward the development of leaflessness. Although many orchids possess photosynthesizing roots, leaves remain the primary organs responsible for fixing carbon in the majority of Orchidaceae (including most Figure 3-38. One of 20,000+ equally parsimonious trees using anatomical and morphological data. a) Angraecinae (italics) and Aeridinae (bold type). Polystachyinae (outgroup) are indicated with a black rectangle. b) Subset of Angraecinae + Aeridinae. c) Subset of Angraecinae + Aeridinae. Branches that do not collapse in the strict consensus are indicated with an open circle. Filled boxes received at least 50% bootstrap support. 215

Aerangis biloba Cyrtorchis chailluana Aerangis coriacea Diaphananthe bidens clade b Aerangis kotschyana Angraecum birrimense Angraecum eichlerianum clade c Aerangis somalensis Cyrtorchis arcuata ssp. whytei Microcoelia caespitosa Rhipidoglossum rutilum Microcoelia corallina Angraecum eburneum ssp. giryamae Microcoelia exilis Angraecum eburneum ssp. superbum var. longicalcar Microcoelia macrantha Rhipidoglossum xanthopollinium Microcoelia macrorrhynchia Oeonia rosea Microcoelia perrieri Aerangis verdickii Microcoelia smithii Podangis dactyloceras Taeniophyllum fasciola Bolusiella maudiae Taeniophyllum smithii Bolusiella iridifolia Microcoelia megalorrhiza Chiloschista lunifera Dendrophylax barrettiae Chiloschista parishii Dendrophylax alcoa Phalaenopsis wilsonii Microcoelia obovata Chiloschista usneoides Microcoelia physophora Chiloschista pusilla Microcoelia stolzii Phalaenopsis hainanensis Microcoelia aphylla Angraecopsis amaniensis Dendrophylax filiformis Angraecopsis breviloba Dendrophylax funalis Sphyrarhynchus schliebenii Chamaeangis lanceolata Mystacidium flanaganii Chamaeangis sarcophylla Mystacidium braybonae Chamaeangis vesicata Mystacidium capense Chamaeangis odoratissima Angraecopsis parviflora Rhipidoglossum obanense Taeniophyllum sp. BSC171 Diaphananthe fragrantissima Ancistrorhynchus refractus Trichoglottis atropurpurea Ypsilopus viridiflorus Calyptrochilum emarginatum Jumellea arachnantha Acampe papillosa Jumellea phalaenophora Jumellea sagittata Taeniophyllum biocellatum Cribbia confusa b Bolusiella batesii Rhipidoglossum curvatum Aerangis ugandensis Microtatorchis iboetii Cyrtorchis aschersonii Angraecum gabonense Angraecum distichum Rhipidoglossum subsimplex Rhipidoglossum bilobatum Angraecum conchiferum Angraecum eburneum Angraecum eburneum ssp. superbum Bonniera appendiculata Angraecum dives Angraecum eburneum ssp. xerophilum Sobennikoffia humbertiana Ancistrorhynchus clandestinus Sobennikoffia robusta Tridactyle tanneri Calyptrochilum christyanum Summerhayesia zambesiaca Amesiella philippinensis Neofinetia falcata Rhipidoglossum pulchellum Ypsilopus longifolius Lemurorchis madagascariensis Vanda flabellata Angraecum rutenbergianum Rangaeris muscicola Aerangis confusa Cyrtorchis arcuata Aerangis luteoalba var. rhodosticta Oeoniella polystachys Eurychone rothschildiana Angraecum chevalieri Microcoelia bulbocalcarata Angraecum cultriforme Microcoelia globulosa Angraecum erectum Angraecum sacciferum Rangaeris amaniensis Dendrophylax gracilis Tridactyle bicaudata Campylocentrum pachyrrhizum Tridactyle tridactylites Campylocentrum poeppigii Listrostachys pertusa Dendrophylax lindenii Tridactyle filifolia Dendrophylax porrectus Tridactyle scottellii Dendrophylax varius Tridactyle furcistipes Campylocentrum fasciola Jumellea arborescens Campylocentrum sullivanii Jumellea filicornoides Taeniophyllum sp. BSC170 Cyrtorchis praetermissa Aeranthes grandiflora Cyrtorchis ringens Angraecum germinyanum Jumellea flavescens Lemurella pallidiflora Eggelingia ligulifolia Angraecum teres Angraecum pungens Phalaenopsis deliciosa Angraecum subulatum Aerangis kirkii Tridactyle tridentata Diaphananthe lorifolia Plectrelminthus caudatus Cryptopus paniculatus Rangaeris schliebenii Beclardia macrostachya Ancistrorhynchus metteniae Diaphananthe millarii Jumellea confusa Microterangis hildebrandtii Aeranthes arachnites Rangaeris longicaudata Aeranthes caudata Tridactyle crassifolia Aeranthes peyrotii Angraecum multinominatum Angraecum calceolus Aeranthes ramosa Rhipidoglossum kamerunense Neobathiea grandidieriana c Aerangis thomsonii Cribbia brachyceras Solenangis clavata Solenangis wakefieldii Campylocentrum micranthum Cryptopus elatus Aerangis macrocentra Ossiculum aurantiacum Neobenthamia gracilis 0.5 changes Polystachya longiscapa a Polystachya concreta Outgroup Polystachya modesta 216

Aerangis biloba Traditional Aerangidinae Aerangis confusa Aeranthes arachnites Aerangis coriacea Aeranthes caudata Aerangis kirkii Aeranthes grandiflora Aerangis kotschyana Aeranthes peyrotii Aerangis luteoalba var. rhodosticta Aeranthes ramosa Aerangis macrocentra Angraecum birrimense Aerangis somalensis Angraecum calceolus Aerangis thomsonii Angraecum chevalieri Aerangis ugandensis Angraecum conchiferum Aerangis verdickii Angraecum cultriforme Ancistrorhynchus clandestinus Angraecum distichum Ancistrorhynchus metteniae Angraecum dives Ancistrorhynchus refractus Angraecum eburneum 50 Angraecopsis amaniensis Angraecum eburneum ssp. giryamae Angraecopsis breviloba Angraecum eburneum ssp. superbum Angraecopsis parviflora Angraecum eburneum ssp. superbum var. longicalcar Beclardia macrostachya Angraecum eburneum ssp. xerophilum Bolusiella batesii Angraecum eichlerianum Bolusiella iridifolia Angraecum erectum Bolusiella maudiae Angraecum gabonense Chamaeangis lanceolata Angraecum germinyanum Chamaeangis odoratissima Angraecum multinominatum Chamaeangis sarcophylla Angraecum pungens Chamaeangis vesicata Angraecum rutenbergianum Cribbia brachyceras Angraecum sacciferum Cribbia confusa Angraecum sesquipedale Cyrtorchis arcuata Angraecum subulatum Cyrtorchis arcuata ssp. whytei Angraecum teres Cyrtorchis aschersonii Bonniera appendiculata Cyrtorchis chailluana Calyptrochilum christyanum 55 Cyrtorchis praetermissa Calyptrochilum emarginatum Cyrtorchis ringens Campylocentrum fasciola Diaphananthe bidens Campylocentrum micranthum Diaphananthe fragrantissima Campylocentrum pachyrrhizum Diaphananthe lorifolia Campylocentrum poeppigii Diaphananthe millarii Campylocentrum sullivanii Eggelingia ligulifolia 90 Cryptopus elatus Eurychone rothschildiana Cryptopus paniculatus Listrostachys pertusa Dendrophylax alcoa Microcoelia bulbocalcarata Dendrophylax barrettiae Microcoelia caespitosa Dendrophylax filiformis Microcoelia corallina Dendrophylax funalis Microcoelia exilis Dendrophylax gracilis Microcoelia globulosa Dendrophylax lindenii Microcoelia macrantha Dendrophylax porrectus Microcoelia macrorrhynchia Dendrophylax varius Microcoelia megalorrhiza Jumellea arachnantha Microcoelia obovata Jumellea arborescens Microcoelia perrieri Jumellea confusa Microcoelia physophora Jumellea filicornoides Microcoelia smithii Jumellea flavescens Microcoelia stolzii Jumellea phalaenophora Microterangis hildebrandtii Jumellea sagittata Mystacidium braybonae Lemurella pallidiflora Mystacidium capense Lemurorchis madagascariensis Mystacidium flanaganii Neobathiea grandidieriana Plectrelminthus caudatus Oeonia rosea Podangis dactyloceras Oeoniella polystachys Rangaeris amaniensis Ossiculum aurantiacum Rangaeris longicaudata 77 Sobennikoffia humbertiana Rangaeris muscicola Sobennikoffia robusta Rangaeris schliebenii Acampe papillosa Rhipidoglossum bilobatum Amesiella philippinensis Rhipidoglossum curvatum Chiloschista lunifera Rhipidoglossum kamerunense Chiloschista parishii Rhipidoglossum obanense Chiloschista pusilla Rhipidoglossum pulchellum Chiloschista usneoides Rhipidoglossum rutilum Microtatorchis iboetii Rhipidoglossum subsimplex Neofinetia falcata Rhipidoglossum xanthopollinium Phalaenopsis deliciosa Solenangis aphylla Phalaenopsis hainanensis Aeridinae Solenangis clavata Phalaenopsis wilsonii Solenangis wakefieldii Taeniophyllum sp. BSC170 Sphyrarhynchus schliebenii Taeniophyllum sp. BSC171 Summerhayesia zambesiaca Taeniophyllum biocellatum Tridactyle bicaudata Taeniophyllum fasciola Tridactyle crassifolia Taeniophyllum smithii Tridactyle filifolia Trichoglottis philippinensis Tridactyle furcistipes Vanda flabellata Tridactyle scottellii Neobenthamia gracilis Tridactyle tanneri Polystachya concreta Tridactyle tridactylites Polystachya longiscapa Outgroup Tridactyle tridentata Polystachya modesta Ypsilopus longifolius Ypsilopus viridiflorus

Figure 3-39. Bootstrap consensus tree of Vandeae. a) Vandeae with outgroup Polystachyinae (black-filled rectangle) and Aeridinae (open rectangle). b) Traditional Aerangidinae (sensu Dressler, 1993). Numbers above lines are bootstrap percentages. Figure 3-40. Strict consensus of 20,000+ equally parsimonious trees. a) Upper half of tree. b) lower half of tree. Aerangidinae are in bold type, Angraecinae are in italics and Polystachyinae are indicated as the outgroup. Circled letters along the cladogram represent characters supporting each node of the consensus tree. Letters surrounded by squares are those nodes with at least 50% bootstrap support. Numbers outside parentheses represent character numbers, numbers inside parentheses represent character state: A = 2(1), 18(1), 21(1), 22(1); B = 6(0); C = 16(1); D = 8(2); E = 13(1); F = 1(0), 12(1); G = 24(1); H = 11(1); I = 14(3); J = 15(1); K = 12(1); L = 5(0); M = 14(2); N = 14(0); O = 3(1); P = 7(0), 12(1); Q = 23(0); R = 3(1), 11(2); S = 3(1); T = 23(0); U = 15(0); V = 3(2). 218

Aerangis biloba Aerangis confusa Aerangis coriacea Aerangis kirkii Aerangis kotschyana Aerangis luteoalba var. rhodosticta Aerangis macrocentra Aerangis somalensis Aerangis thomsonii Aerangis ugandensis Aerangis verdickii C Podangis dactyloceras B Bolusiella maudiae Ancistrorhynchus clandestinus Ancistrorhynchus metteniae Ancistrorhynchus refractus Aeranthes arachnites G Angraecopsis amaniensis Aeranthes caudata F Angraecopsis breviloba Aeranthes grandiflora E Sphyrarhynchus schliebenii Aeranthes peyrotii Mystacidium flanaganii D Aeranthes ramosa Mystacidium braybonae Angraecum birrimense Mystacidium capense M Angraecum eichlerianum Angraecopsis parviflora Angraecum calceolus Beclardia macrostachya Angraecum conchiferum Bolusiella batesii Angraecum eburneum Bolusiella iridifolia N O Angraecum eburneum ssp. superbum Chamaeangis lanceolata Bonniera appendiculata Chamaeangis odoratissima Angraecum cultriforme Chamaeangis sarcophylla Angraecum distichum Chamaeangis vesicata Angraecum dives Cribbia brachyceras Angraecum eburneum ssp. xerophilum Cribbia confusa P R Sobennikoffia humbertiana I Cyrtorchis arcuata Q Sobennikoffia robusta H Oeoniella polystachys Calyptrochilum christyanum Angraecum chevalieri Angraecum eburneum ssp. giryamae Cyrtorchis arcuata ssp. whytei S Angraecum eburneum ssp. superbum var. longicalcar Cyrtorchis aschersonii Angraecum erectum Cyrtorchis chailluana Angraecum gabonense Cyrtorchis praetermissa Angraecum germinyanum Cyrtorchis ringens T Lemurella pallidiflora Diaphananthe bidens Angraecum multinominatum Diaphananthe fragrantissima Angraecum pungens Diaphananthe lorifolia U Angraecum subulatum Diaphananthe millarii Angraecum rutenbergianum Eggelingia ligulifolia Angraecum sacciferum Eurychone rothschildiana Angraecum sesquipedale Listrostachys pertusa Angraecum teres Microcoelia bulbocalcarata Calyptrochilum emarginatum Microcoelia caespitosa Campylocentrum fasciola Microcoelia corallina Campylocentrum pachyrrhizum Microcoelia exilis Campylocentrum poeppigii Microcoelia globulosa Campylocentrum sullivanii Microcoelia macrantha Cryptopus elatus Microcoelia macrorrhynchia Cryptopus paniculatus Microcoelia megalorrhiza Dendrophylax alcoa Microcoelia obovata Dendrophylax barrettiae Microcoelia perrieri Dendrophylax filiformis Microcoelia physophora Dendrophylax funalis Microcoelia smithii Dendrophylax gracilis Microcoelia stolzii Dendrophylax lindenii Microterangis hildebrandtii Dendrophylax porrectus A Plectrelminthus caudatus Dendrophylax varius Rangaeris amaniensis Jumellea arachnantha Rangaeris longicaudata Jumellea phalaenophora Rangaeris muscicola V Jumellea sagittata Rangaeris schliebenii Taeniophyllum biocellatum Rhipidoglossum bilobatum Jumellea arborescens Rhipidoglossum curvatum Jumellea confusa Rhipidoglossum kamerunense Jumellea filicornoides Rhipidoglossum obanense Jumellea flavescens Rhipidoglossum pulchellum Lemurorchis madagascariensis Rhipidoglossum rutilum Neobathiea grandidieriana Rhipidoglossum subsimplex Oeonia rosea Rhipidoglossum xanthopollinium Ossiculum aurantiacum Solenangis aphylla Solenangis clavata Acampe papillosa Amesiella philippinensis J Solenangis wakefieldii K Campylocentrum micranthum Chiloschista lunifera Summerhayesia zambesiaca Chiloschista parishii Tridactyle bicaudata Chiloschista pusilla Tridactyle crassifolia Chiloschista usneoides Microtatorchis iboetii Tridactyle filifolia Tridactyle furcistipes Neofinetia falcata Tridactyle scottellii Phalaenopsis deliciosa Tridactyle tanneri Phalaenopsis hainanensis Tridactyle tridactylites Phalaenopsis wilsonii Taeniophyllum sp. BSC170 Tridactyle tridentata Ypsilopus longifolius Taeniophyllum sp. BSC171 Ypsilopus viridiflorus Taeniophyllum fasciola Taeniophyllum smithii Trichoglottis atropurpurea Vanda flabellata

Neobenthamia gracilis L Polystachya longiscapa Polystachya concreta Outgroup Polystachya modesta

Vandeae). In order to shift the evolutionarily function of from leaf to root, the root must have developed some method of retarding water loss while, at the same time, exchanging CO2 and O2. In conjunction with pneumathodes 219 within the velamen (which occur throughout Epidendroideae), aeration units probably serve as the only means of gas exchange in roots of leafless Vandeae and are potentially analogous to the stomatal complex of leaves. Aeration units were also observed in many leafy vandaceous taxa, but they have not been detected in any other group of Orchidaceae. This suggests a preadaptive significance to the formation of aeration units in the process of becoming leafless. While their presence and possible function within roots was noted as far back as the late 19th century (Haberlandt, 1914; Leitgeb, 1864; Schimper, 1888), their physiology was not fully understood for another 100 years (Benzing et al.,

1983; Cockburn et al., 1985).

The distinct thickenings of the inner tangential endovelamen wall superficially resemble tilosomes and occurred scattered throughout Vandeae in the following genera: Aeranthes, Angraecum, Chamaeangis, Cyrtorchis,

Diaphananthe, Jumellea, Lemurorchis, Neofinetia, Rhipidoglossum,

Sobennikoffia, and Taeniophyllum. However, endovelamen thickenings differed from tilosomes in that they occur over both long and short cells (as opposed to only short cells) of the exodermis and they appear to be distinctive wall thickenings (as opposed to the excrescences of the endovelamen wall). Smooth endovelamen wall thickenings are only known to occur in species of Angraecum and the closely related genus Sobennikoffia. These smooth thickenings are structurally distinct from ridged endovelamen thickenings, which appear scattered primarily in angraecoid genera (Aeranthes, Chamaeangis, Cyrtorchis,

Diaphananthe, Jumellea, Lemurorchis, Neofinetia, Rhipidoglossum, and 220

Taeniophyllum). The function of endovelamen thickenings is unknown but may be similar to that hypothesized for tilosomes, namely, as a means to prevent water loss via transpiration (Benzing et al., 1982; Pridgeon et al., 1983).

Exodermal proliferations are common throughout Vandeae as well as in the outgroup Polystachyinae. They occur where the velamen has been lost, are superficially similar in cell type to the velamen (i.e., large, empty, lignified and/or suberized cells), and may function similarly in mechanical protection (Pridgeon, personal communication).

Exodermal cell walls were most commonly ∩-thickened, frequently grading into -thickened. Notable exceptions to this thickening pattern were limited to four genera. Microcoelia and Solenangis possessed radial swellings and/or grooves (Figs. 3-10 and 3-30) along their primarily ∩-thickened walls. Exodermal walls were ∪-thickened in Beclardia, Solenangis wakefieldii, Calyptrochilum christyanum, and Ypsilopus longifolius.

Foliar fiber bundles exhibited a variety of distributional patterns within the mesophyll but were restricted to a few members of Angraecinae. Bundles were most commonly composed of only thick-walled cells that were either restricted to leaf margins (Angraecum distichum, A. sesquipedale, and Ossiculum) or found as a single row below the epidermis and scattered among vascular bundles

(Angraecum teres). Fiber bundles of A. subulatum were composed of both thin and thick-walled cells (cf. figure 18 in Stern & Judd, 2002) and found alternating in a single row with the vascular bundles. All species of Aeranthes examined

(with the exception of an immature specimen of A. arachnites) possessed fiber 221 bundles distributed in a single abaxial row and composed of thick-walled cells surrounding one to three small, thin-walled cells.

Epidermal and mesophyll cells above the midrib in leaves were frequently slightly to distinctly modified in most genera of Vandeae. This collection of cells, especially the distinctly modified ones, most closely resembles the “median unfolding tissue” first described by Löv (1926) and then by Solereder and Meyer

(1930), which functions in the unfolding of leaves during development. Esau

(1958; 1977) described similar “bulliform” cells occurring in several monocot families, especially Poaceae. Very similar cells were also found in leaves of

Maxillaria by Holtzmeier et al. (1998).

Cladistics

Based on vegetative structure, Vandeae formed a well-supported (90% BS) clade (Fig. 3-40) distinguished from the closely related Polystachyinae (Cameron et al., 1999; Chase et al., 2003) by the loss of mucilage and tilosomes (features that are almost universal within Polystachyinae), the development of spherical silica bodies along sclerenchymatous cells within leaves, and a monopodial growth habit. The monophyly of Vandeae is also strongly supported by chloroplast and nuclear sequence data from the current study (see Chapter 2) as well as floral anatomy and morphology (Freudenstein & Rasmussen, 1999).

However, the utility of vegetative anatomy and morphology seems to be limited for this distinct tribe of orchids (Fig. 3-39). There were only three moderately to weakly supported clades (77%, 55%, and 50%). Only one of these clades

(Angraecopsis amaniensis + A. breviloba) was also found in the strict consensus tree. 222

Of the remaining unsupported groups (those with less than 50% BS) within the strict consensus tree (Fig. 3-40), two clades were in agreement with the molecular analyses of the current study: 1) Angraecopsis, Sphyrarhynchus, and

Mystacidium, supported by the presence of edge-thickened water-storage cells and 2) Neobenthamia gracilis and Polystachya longiscapa, supported by a reversal to -thickened exodermal cell walls. Jumellea arachnantha, J. phalaenophora, and J. sagittata (Angraecinae) were grouped together based on the presence of distinct ridged endovelamen wall thickenings. However, the leafless species Taeniophyllum biocellatum (Aeridinae) was also included in this clade. Several species of Angraecum formed several clades, together with

Sobennikoffia, based on the presence of distinct, smooth endovelamen wall thickenings: A. eburneum ssp. giryamae + A. eburneum ssp. superbum var. longicalcar, A. eburneum ssp. xerophilum + Sobennikoffia, A. eburneum + A. eburneum ssp. superbum. All of the remaining unsupported clades within the strict consensus tree were not consistent with traditional or molecular hypotheses of phylogeny and were probably based on homoplasious similarities instead of true synapomorphies.

Rhipidoglossum has traditionally been segregated from Diaphananthe based on floral features (Summerhayes, 1960), but a closer examination of the floral morphology by Cribb and Summerhayes (Cribb, 1989; Summerhayes,

1960) led them to believe the two genera were conspecific. Molecular data from my study supported the two genera as distinct, but vegetative anatomy was not helpful in distinguishing these genera. CHAPTER 4 ANATOMICAL EVOLUTION WITHIN ANGRAECINAE

Introduction

Molecular characters, such as sequence data from nrITS or cpDNA, are usually considered to genetically independent of gene regions that code for plant form. Therefore, one of the most widely accepted methods of exploring structural evolution has been to map morphological and anatomical characters onto an independent molecular topology (deQueiroz, 1996). However, it is also important not to exclude data sets (e.g., anatomical data), because these data can add support to tree topologies and excluding them may give erroneous results

(Donoghue & Sanderson, 1992). In order to examine the evolution of leaf and root anatomy as well as the structural evolution of leaflessness within

Angraecinae and Aerangidinae, both approaches (mapping morphological characters onto molecular trees and tracing morphological changes on trees derived from combined analyses) were used and subsequently compared.

Materials and Methods

To compare consistent data sets and perform combined analyses, taxon sampling from anatomical and molecular data sets were pruned so that each contained the same species. However, corresponding species from each data set were not necessarily from the same specimen, and anatomical data from several specimens of the same species were often combined. A total of 112 ingroup and four outgroup species were used in all analyses (Table 4-1).

223 224

Twenty-six structural characters were used (Table 3-2), with 24 parsimony informative for this subset of Vandeae (Table 4-3). All sequence data from ITS, matK, and trnL-F were combined into a large molecular matrix of 3916 characters, 993 of which were parsimony informative. The computer program

Paup*4.0 was used to perform parsimony analyses with all characters unordered.

A heuristic search strategy of branch-swapping by SPR step-wise addition was implemented with 1000 random-addition replicates, holding 10 trees at each step, with the MULTREES option on. Due to limited computational resources

(400Mhz G3 processor), the maximum number of trees saved for all analyses was limited to 20,000. The resulting shortest trees from this initial analysis were then swapped to completion, with a maximum number of 20,000 trees saved.

Levels of support (% BS) were estimated with 1000 bootstrap replicates, using the SPR algorithm of branch swapping for 10 random-addition replicates per bootstrap replicate.

Evolution of structural characters was examined in two ways, and both methods were subsequently compared. First, anatomical and molecular data were analyzed separately. The anatomical characters were then mapped onto a molecular topology (randomly chosen from 20,000+ trees) using MacClade 4.06 for Mac OS X (Maddison & Maddison, 2000) in order to examine patterns of anatomical and morphological evolution. These mapping results were then compared to the second method in which anatomical characters were traced onto a combined structural and molecular topology (randomly chosen from 690 trees) using MacClade. Table 4-1. Taxa of Vandeae examined for combined molecular and anatomical study. Anatomical DNA Taxona Sourced Vouchere (location)f numberb numberc Tribe Vandeae Lindl., Subtribe Angraecinae Summerh. Aerangis biloba (Lindl.) Schltr. BSC 285 B 232 FLMNH hort. Whitten (FLAS) A. biloba BSC 4 SEL hort. (1994-0052A) No voucher A. confusa J.L.Stewart BSC 256 B 310 B. Bytebier, Africa Bytebier s.n. (EA) A. confusa K 345-81-03740 Kew hort. Cribb s.n. (K) A. coriacea Summerh. BSC 269 B 318 B. Bytebier, Africa Bytebier 562 (EA) A. coriacea BSC 212 Hoosier Orchid Co. No voucher A. kirkii (Rchb.f.) Schltr. BSC 253 B 302 B. Bytebier, Africa Bytebier 637 (EA) A. kotschyana (Rchb.f.) Schltr. BSC 270 B 316 B. Bytebier, Africa Bytebier 671 (EA) A. luteoalba var. rhodosticta (Kraenzl.) BSC 252 B 308 B. Bytebier, Africa Bytebier 691 (EA) J.L.Stewart A. macrocentra (Schltr.) Schltr. BSC 226 B 327 J. Hermans hort. Kew 779 (K) A. somalensis (Schltr.) Schltr. BSC 263 B 298 B. Bytebier, Africa Bytebier 1549 (EA) A. thomsonii (Rolfe) Schltr. BSC 266 B 309 B. Bytebier, Africa Kirika 968 (EA) A. ugandensis Summerh. BSC 238 B 303 B. Bytebier, Africa Bytebier 681 (EA) A. ugandensis K 45064 Kew hort. No voucher A. ugandensis WLS 1004 Kew hort. (1990-1559) No voucher A. verdickii (DeWild.) Schltr. BSC 204 B 267 Countryside Orchids No voucher Aeranthes arachnites (Thouars) Lindl. BSC 129 B 13 Cal-Orchid Carlsward 198 (FLAS) A. arachnites WLS 1081 Kew hort. (1987-2133) No voucher A. grandiflora Lindl. BSC 128 B 127 Cal-Orchid Carlsward 238 (FLAS) A. grandiflora K 559-69-04918 Kew hort. Stewart 1120 (K) Ancistrorhynchus metteniae (Kraenzl.) BSC 192 B 239 Uzumara Orchids No voucher, ver. La Croix Summerh. Angraecopsis amaniensis Summerh. K 082-82-00606 Kew hort. Gassner & Cribb 193 (K) A. amaniensis B 252 Uzumara Orchids No voucher, ver. La Croix A. breviloba Summerh. BSC 255 B 285 B. Bytebier, Africa Bytebier 307 (EA) A. parviflora (Thouars) Schltr. BSC 220 J. Hermans hort. Kew 4363 (K) A. parviflora K 366-80-03819 Kew hort. La Croix 49 (K) A. parviflora B 251 Uzumara Orchids Carlsward 291 (FLAS) Angraecum calceolus Thouars BSC 11 B 24 SEL hort. (1996-0480A) No voucher A. chevalieri Summerh. BSC 13 B 19 SEL hort. (1997-0160) Carlsward 208 (SEL) A. conchiferum Lindl. BSC 241 B 305 B. Bytebier, Africa Bytebier 616 (EA) Table 4-1. Continued Anatomical DNA Taxona Sourced Vouchere (location)f numberb numberc Angraecum conchiferum K 120-82-01054 Kew hort. Brummitt 15966 (K) A. cultriforme Summerh. BSC 210 B 257 Countryside Orchids Carlsward 298 (FLAS) A. distichum Lindl. BSC 12 SEL hort. (1985-0821A) Carlsward 224 (SEL) A. distichum B 4 Cal-Orchid Carlsward 237 (FLAS) A. dives Rolfe BSC 268 B 314 B. Bytebier, Africa Marimoto 42 (EA) A. eburneum Bory BSC 186 B 221 FLMNH hort. Carlsward 335 (FLAS) A. eburneum ssp. superbum (Thouars) BSC 154 B 28 FLMNH hort. Carlsward 186 (FLAS) H.Perrier = A. eburneum 1 A. eburneum ssp. superbum = A. eburneum 1 BSC 141 FLMNH hort. Carlsward 182 (FLAS) A. eburneum ssp. superbum var. longicalcar BSC 206 B 263 Countryside Orchids No voucher Bosser = A. eburneum 2 A. eburneum ssp. xerophilum H.Perrier BSC 187 B 226 WLS hort. Carlsward 275 (FLAS) = A. eburneum 3 A. eichlerianum Kraenzl. BSC 140 W 719 FLMNH hort. Carlsward 284 (FLAS) A. erectum Summerh. BSC 274 B 306 B. Bytebier, Africa Bytebier 801 (EA) A. germinyanum Hook.f. BSC 207 B 261 Santa Cruz Orchids No voucher A. rutenbergianum Kraenzl. BSC 234 B 265 Santa Cruz Orchids Carlsward 300 (FLAS) A. teres Summerh. BSC 272 B 304 B. Bytebier, Africa Bytebier 675 (EA) Beclardia macrostachya (Thouars.) A.Rich BSC 217 J. Hermans hort. Kew 3536 (K) B. macrostachya B 249 Uzumara Orchids Photo (FLAS), ver. La Croix Bolusiella batesii (Rolfe) Schltr. BSC 19 B 78 SEL hort. (1997-0173A) Carlsward 152 (FLAS), Nkongmeneck 2087 (SEL) B. iridifolia (Rolfe) Schltr. BSC 250 B 319 B. Bytebier, Africa Bytebier 1113 (EA) B. maudiae (Bolus) Schltr. BSC 259 B 287 B. Bytebier, Africa Bytebier 485 (EA) Bonniera appendiculata (Frapp. ex Cordem.) BSC 228 B 334 J. Hermans hort. Kew 4232 (K) Cordem. Calyptrochilum christyanum (Rchb.f.) Summerh. BSC 148 B 22 SEL hort. (1997-0239A) Carlsward 194 (SEL) C. christyanum BSC 20 SEL hort. (1997-0165B) No voucher C. christyanum BSC 137 Andy’s Orchids No voucher Campylocentrum fasciola (Lindl.) Cogn. BSC 153 B 37 Hamlyn Orchids, Jamaica Carlsward 185 (FLAS) C. micranthum (Lindl.) Rolfe BSC 143 J. Ackerman, Puerto Rico Ackerman 3341 (UPRRP) C. micranthum B 60 Cal-Orchid (Mexico) Carlsward 180 (FLAS) Table 4-1. Continued Anatomical DNA Taxona Sourced Vouchere (location)f numberb numberc Campylocentrum pachyrrhizum (Rchb.f.) Rolfe BSC 157 Fakahatchee State Preserve, No voucher Florida C. pachyrrhizum B 112 J. Ackerman, Puerto Rico Ackerman s.n. (UPRRP) C. poeppigii (Rchb.f.) Rolfe BSC 144 B 15 H. Carnevali, Mexico Carnevali 4507 (CICY) C. sullivanii Fawc. & Rendle BSC 280 B 276 Hamlyn Orchids, Jamaica Carlsward 301 (FLAS) Chamaeangis odoratissima (Rchb.f.) Schltr. WLS 13 E. Ayensu Sanford 659/66 (IFE) Chamaeangis odoratissima B 247 Uzumara Orchids No voucher, ver. La Croix C. sarcophylla Schltr. BSC 239 B 284 B. Bytebier, Africa Bytebier 339 (EA) C. vesicata (Lindl.) Schltr. BSC 267 B 311 B. Bytebier, Africa Bytebier 796 (EA) C. vesicata BSC 219 J. Hermans hort. Kew 399 (K) C. vesicata K 084-81-01305 Kew hort. Bailes 363 (K) Cribbia brachyceras (Summerh.) Senghas BSC 236 B 283 B. Bytebier, Africa Bytebier 361 (EA) C. brachyceras K 084-81-01175 Kew hort. Bailes 258 (K) C. brachyceras WLS 1057 Kew hort. (1981-3763) No voucher C. confusa P.J.Cribb BSC 214 B 332 J. Hermans hort. Kew 3936 (K) Cryptopus elatus (Thouars.) Lindl. BSC 189 B 236 Uzumara Orchids No voucher, ver. La Croix C. paniculatus H.Perrier BSC 223 B 336 J. Hermans hort. Kew 5392 (K) C. paniculatus BSC 117 Andy’s Orchids Carlsward 294 (FLAS) Cyrtorchis arcuata (Lindl.) Schltr. BSC 249 B 300 B. Bytebier, Africa Bytebier 676 (EA) C. chailluana (Hook.f.) Schltr. BSC 29 B 50 SEL hort. (1996-0294) Carlsward 156 (SEL) C. praetermissa Summerh. BSC 203 B 271 Countryside Orchids No voucher C. praetermissa WLS 1213 SEL hort. (1978-531) No voucher C. ringens (Rchb.f.) Summerh. BSC 30 B 98 SEL hort. (1997-0154A) Carlsward 226 (FLAS), Nkongmeneck 1388 (SEL) Dendrophylax barrettiae Fawc. & Rendle BSC 152 B 36 Hamlyn Orchids, Jamaica Carlsward 199 (FLAS) D. filiformis (Sw.) Carlsward & Whitten BSC 185 W 917 J. Ackerman, Puerto Rico Whitten 1842 (FLAS) D. funalis (Sw.) Benth. ex Rolfe BSC 32 Andy’s Orchids Photo (FLAS) D. funalis K 18265 Kew hort. No voucher D. funalis B 233 FLMNH hort., Jamaica Carlsward 302 (FLAS) D. lindenii (Lindl.) Benth. ex Rolfe BSC 71 Unknown garden origin No voucher D. lindenii BSC 156 Fakahatchee State Preserve, No voucher Florida D. lindenii W 716 Hamlyn Orchids, Jamaica Photo (FLAS) Table 4-1. Continued Anatomical DNA Taxona Sourced Vouchere (location)f numberb numberc Dendrophylax porrectus (Rchb.f.) Carlsward & BSC 142 J. Ackerman, Puerto Rico Ackerman 3340 (UPRRP) Whitten D. porrectus BSC 145 G. Carnevali, Mexico Carnevali 5907 (CICY) D. porrectus BSC 158 Fakahatchee State Preserve, No voucher Florida D. porrectus BSC 184 Hamlyn Orchids, Jamaica Carlsward 184 (FLAS) D. porrectus B 366 Fish-eating Creek, Florida Carlsward 329 (FLAS) D. varius (Gmel.) Urb. BSC 168 UPRRP, rehydrated material Ackerman 2727 (UPRRP) D. varius B 362 Dominican Republic Whitten 1960 (JBSD) Diaphananthe fragrantissima (Rchb.f.) Schltr. BSC 240 B 317 B. Bytebier, Africa Kirika 536 (EA) D. lorifolia Summerh. BSC 248 B 301 B. Bytebier, Africa Bytebier 346 (EA) D. millarii (Bolus) H.P.Linder BSC 205 B 270 Countryside Orchids Carlsward 346 (FLAS) Eurychone rothschildiana (O’Brien) Schltr. BSC 288 B 231 Sunset Orchids Whitten (FLAS) Jumellea confusa (Schltr.) Schltr. BSC 211 Countryside Orchids No voucher J. confusa B 103 W. L. Stern hort. Carlsward 228 (FLAS) J. sagittata H.Perrier BSC 43 B 114 SEL hort. (1981-1182A) Carlsward 232 (SEL) J. sagittata BSC 229 J. Hermans hort. Kew 1150 (K) Lemurella pallidiflora Bosser BSC 218 B 328 J. Hermans hort. Kew 4958 (K) Lemurorchis madagascariensis Kraenzl. BSC 231 B 335 J. Hermans hort. Kew 5383 (K) Listrostachys pertusa (Lindl.) Rchb.f. BSC 194 B 241 Uzumara Orchids No voucher, ver. La Croix L. pertusa WLS 2 E. Ayensu Sanford 675/66 (IFE) Microcoelia aphylla (Thouars) Summerh. BSC 174 B 1 Andy’s Orchids Carlsward 341 (FLAS) M. aphylla BSC 225 J. Hermans hort. Kew 2389 (K) M. bulbocalcarata L.Jonsson BSC 197 B 244 Uzumara Orchids No voucher, ver. La Croix M. corallina Summerh. BSC 195 B 242 Uzumara Orchids No voucher, ver. La Croix M. exilis Lindl. BSC 184 B 213 Sunset Orchids Whitten (FLAS) M. exilis BSC 175 BNBG, spirit collection 87-0103 (BR) M. exilis BSC 275 B. Bytebier, Africa Bytebier 1255 (EA) M. globulosa (Hochst.) L.Jonsson BSC 177 BNBG, spirit collection 91-0194-71 (BR) M. globulosa BSC 243 B. Bytebier, Africa PCP 488 (EA) M. globulosa B 126 Uzumara Orchids Carlsward 259 (FLAS) M. macrantha (H.Perrier) Summerh. BSC 232 B 326 J. Hermans hort. Kew 5391 (K) M. macrantha BSC 176 BNBG, spirit collection 90-0043 (BR) Table 4-1. Continued Anatomical DNA Taxona Sourced Vouchere (location)f numberb numberc Microcoelia megalorrhiza (Rchb.f.) Summerh. BSC 247 B 296 B. Bytebier, Africa Bytebier 1250 (EA) M. obovata Summerh. BSC 254 B 289 B. Bytebier, Africa Bytebier 1256 (EA) Microcoelia physophora (Rchb.f.) Summerh. BSC 244 B 299 B. Bytebier, Africa Bytebier 629 (EA) M. smithii (Rolfe) Summerh. BSC 251 B 313 B. Bytebier, Africa Bytebier 1248 (EA) M. stolzii (Schltr.) Summerh. BSC 196 B 243 Uzumara Orchids Carlsward 287 (FLAS) M. stolzii WLS 981 Kew hort. (224-84-01954) No voucher Microterangis hildebrandtii (Rchb.f.) Senghas BSC 222 B 329 J. Hermans hort. Kew 2616 (K) Mystacidium braybonae Summerh. BSC 134, 135 B 59 Andy’s Orchids Carlsward 179 (FLAS) M. capense (L.f.) Schltr. K 261-83-03283 Kew hort. Stewart s.n. M. capense B 108 Countryside Orchids Whitten 1781 (FLAS) M. flanaganii (Bolus) Bolus BSC 224 B 338 J. Hermans hort. Kew 5084 (K) Neobathiea grandidieriana (Rchb.f.) Garay BSC 193 B 240 Uzumara Orchids No voucher, ver. La Croix N. grandidieriana BSC 216 J. Hermans hort. Kew 3450 (K) Oeonia rosea Ridl. BSC 166 B 102 FLMNH hort. Whitten (FLAS) O. rosea BSC 221 J. Hermans hort. Kew 3222 (K) Oeoniella polystachys (Thouars) Schltr. BSC 123 B 66 Cal-Orchid Carlsward 221 (FLAS) O. polystachys BSC 213 J. Hermans hort. Kew 2194 (K) O. polystachys K 433-75-04420 Kew hort. Mason 1073 (K) Podangis dactyloceras (Rchb.f.) Schltr. BSC 227 B 330 J. Hermans hort. Kew 4999 (K) P. dactyloceras BSC 70 SEL hort. (1996-0293A) No voucher P. dactyloceras K 16654 Kew hort. No voucher Rangaeris amaniensis (Kraenzl.) Summerh. BSC 265 B 292 B. Bytebier, Africa Bytebier & Kirika 26 (EA) R. amaniensis K 084-81-01290 Kew hort. Bailes 348 (K) R. amaniensis WLS 975 Kew hort. (084-81-01176) No voucher R. muscicola (Rchb.f.) Summerh. BSC 86 B 44 SEL hort. (1997-0177A) Carlsward 169 (FLAS) R. muscicola BSC 209 Countryside Orchids No voucher R. muscicola K 181164 Kew hort. No voucher Rhipidoglossum kamerunense (Schltr.) Garay BSC 190 Uzumara Orchids No voucher, ver. La Croix R. kamerunense B 157 SEL hort. (1997-0188A) Carlsward 248 (FLAS) Nkongmeneck 3030 (SEL) R. rutilum (Rchb.f.) Schltr. BSC 37 SEL hort. (1997-0186A) Carlsward 157 (FLAS), Nkongmeneck 3027 (SEL) R. rutilum B 245 Uzumara Orchids Carlsward 288 (FLAS) Table 4-1. Continued Anatomical DNA Taxona Sourced Vouchere (location)f numberb numberc Rhipidoglossum subsimplex (Summerh.) Garay BSC 264 B 288 B. Bytebier, Africa Bytebier 546 (EA) R. xanthopollinium (Rchb.f.) Schltr. BSC 191 B 238 Uzumara Orchids No voucher, ver. La Croix R. xanthopollinium K 396-82-04315 Kew hort. La Croix 346 (K) Sobennikoffia humbertiana H.Perrier BSC 230 J. Hermans hort. Kew 3044 (K) S. humbertiana WLS 103 Unknown garden origin Millot s.n. S. humbertiana B 275 P. Simon hort. Carlsward 304 (FLAS) Solenangis clavata (Rolfe) Schltr. K 431-81-05035 Kew hort. No voucher S. clavata WLS 182 E. Ayensu Sanford 1724/65 (IFE) S. clavata WLS 593 Kew hort. (431-81-05035) No voucher S. clavata B 229 Uzumara Orchids No voucher, ver. La Croix Solenangis wakefieldii (Rolfe) P.J.Cribb & BSC 245 B 291 B. Bytebier, Africa Bytebier 627 (EA) J.L.Stewart Sphyrarhynchus schliebenii Mansf. BSC 261 B 315 B. Bytebier, Africa Bytebier 393 (EA) S. schliebenii K 356-81-03860 Kew hort. Protzen s.n. Tridactyle bicaudata (Lindl.) Schltr. BSC 262 B 307 B. Bytebier, Africa Bytebier 348 (EA) T. bicaudata BSC 208 Countryside Orchids No voucher T. bicaudata K 366-80-03811 Kew hort. La Croix 41 (K) T. crassifolia Summerh. BSC 95 B 73 SEL hort. (1997-0165A) Carlsward 174 (FLAS), Nkongmeneck 2076 (SEL) T. filifolia (Schltr.) Schltr. BSC 242 B 295 B. Bytebier, Africa Bytebier 707 (EA) T. furcistipes Summerh. BSC 237 B 290 B. Bytebier, Africa Bytebier 1731 (EA) T. scottellii (Rendle) Schltr. BSC 260 B 294 B. Bytebier, Africa Bytebier 497 (EA) T. tanneri P.J.Cribb BSC 271 B 293 B. Bytebier, Africa PCP 198 (EA) T. tanneri K 097-76-00664 Kew hort. Cribb 10038 (K) Ypsilopus longifolius (Kraenzl.) Summerh. BSC 273 B 282 B. Bytebier, Africa Bytebier 609 (EA) Y. longifolius K 224-84-01904 Kew hort. No voucher Y. longifolius WLS 625 Kew hort. (224-84-01904) No voucher Y. viridiflorus P.J.Cribb & J.L.Stewart BSC 257 B 280 B. Bytebier, Africa Bytebier 402 (EA) Tribe Vandeae Lindl., Subtribe Aeridinae Pfitzer Acampe papillosa (Lindl.) Lindl. BSC 147 B 25 SEL hort. (1991-0066A,B) Carlsward 191 (SEL) A. papillosa K 23465 Kew hort. Cumberlerge 234-65 (K) Table 4-1. Continued Anatomical DNA Taxona Sourced Vouchere (location)f numberb numberc Amesiella philippinensis (Ames) Garay BSC 8 SEL hort. (1987-0157A) No voucher, verified by R. Dressler A. philippinensis B 269 Countryside Orchids Carlsward 295 (FLAS) Neofinetia falcata (Thunb.) Hu BSC 53 B 74 SEL hort. (1993-0377A) Carlsward 163 (SEL) N. falcata K 13660 Kew hort. No voucher Phalaenopsis deliciosa Rchb.f. BSC 45 B 33 SEL hort. (1987-0330A) Carlsward 160 (SEL) Trichoglottis atropurpurea Rchb.f. BSC 90 SEL hort. (1974-0023-602A) Carlsward 171 (SEL) T. atropurpurea B 6 Motes Orchids Carlsward 173 (FLAS) Vanda flabellata (Rolfe ex Downie) Christenson BSC 6 B 20 SEL hort. (1996-0223C,D) Carlsward 192 (SEL) Tribe Epidendreae Humb.Bonpl. & Kunth, Subtribe Polystachyinae Pfitzer Neobenthamia gracilis Rolfe JMH 1005 B 348 Unknown garden origin Carlsward 311 (FLAS) Polystachya concreta (Jacq.) Garay & JMH 986 B 81 SEL hort. (1996-0140A) Carlsward 213 (SEL) H.R.Sweet P. longiscapa Summerh. WLS 1559 B 90 WLS hort., Tanzania No voucher P. modesta Rchb.f. BSC 202 B 65 SEL hort. (1994-0078A) Carlsward 219 (SEL) JMHeaney 984 (FLAS) aTaxon names and authorities follow Kew’s Monocot Checklist (2003). Author abbreviations follow Brummitt and Powell (1992). bBSC numbers represent Barbara S. Carlsward’s anatomical specimens; JMH numbers represent J. Michael Heaney’s anatomical specimens; WLS numbers represent William L. Stern’s anatomical specimens; K numbers represent slides made at the Royal Botanic Gardens, Kew; S numbers represent slides made by E. Ayensu. cB numbers represent Barbara S. Carlsward’s DNA specimens, W numbers represent W. Mark Whitten’s DNA specimens, N numbers represent Norris H. Williams’ DNA specimens, and AY/AF numbers represent accession numbers from the National Center for Biotechnology Information database. dFLMNH hort. are cultivated specimens from Florida Museum of Natural History greenhouse collection; Kew hort. represent live specimens grown at the Royal Botanic Gardens, Kew (numbers are their living plant accession numbers); SEL hort. are cultivated specimens from The Marie Selby Botanical Gardens (numbers represent their living plant accession numbers); SBG hort. are cultivated specimens from the Singapore Botanic Gardens; BNBG spirit collection are alcoholized collections from Belgium National Botanic Garden; NHN spirit collection are alcoholized collections from the National Herbarium Netherlands; and WLS hort. represent live plants from William L. Stern’s personal collection. eSpecimens with “ver. La Croix” are those with no voucher or with only a photo voucher which have been identified by Isobyl La Croix; PCP = East African National Museum’s Plant Conservation Programme. fHerbarium abbreviations follow Holmgren et al. (1990).

Table 4-2. Structural character states for taxa used in cladistic analyses of Angraecinae and Aerangidinae. A = 0/1, B = 0/2, C = 1/2, D = 0/1/2. Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 Tribe Vandeae, Subtribe Angraecinae Aerangis biloba 1 1 0 0 A 1 0 0 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 A. confusa A 1 0 0 1 0 A 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 A. coriacea 1 1 0 0 1 0 0 A 0 1 0 0 0 3 ? 0 0 1 B 0 1 1 0 0 ? 0 A. kirkii A 1 0 0 1 1 0 0 0 1 0 0 0 3 ? 0 0 1 1 0 1 1 1 0 ? 0 A. kotschyana 0 1 0 0 0 0 0 1 0 0 0 0 0 3 ? 0 0 1 1 0 1 1 0 0 ? 0 A. luteoalba var. rhodosticta 0 1 0 0 1 0 1 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 A. macrocentra 0 1 0 0 1 0 0 0 0 0 0 0 0 3 ? 0 0 1 1 0 1 1 0 0 ? 0 A. somalensis 1 1 0 0 1 1 0 1 0 0 0 0 1 3 ? 0 0 1 1 0 1 1 1 0 ? 0 A. thomsonii 0 1 0 0 1 1 0 1 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 A. ugandensis 0 1 0 0 0 A A 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 A. verdickii 1 1 0 0 0 0 0 1 0 0 0 0 1 3 ? 1 0 1 0 0 1 1 1 0 ? 0 Aeranthes arachnites 1 1 2 0 1 1 0 0 0 1 0 A 0 0 0 0 0 1 0 0 1 1 1 0 ? 0 A. grandiflora A 1 0 0 1 1 A 0 0 1 0 0 0 0 0 0 0 1 0 0 1 1 1 0 ? 0 Ancistrorhynchus metteniae 1 1 0 1 1 1 1 A 0 1 0 0 0 2 1 1 0 1 0 0 1 1 1 0 ? 0 Angraecopsis amaniensis A 1 0 0 0 1 0 2 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 1 0 0 A. breviloba 0 1 0 0 0 1 0 2 0 1 0 1 1 3 ? 0 0 1 0 0 1 1 1 1 0 0 A. parviflora 0 1 0 0 0 A 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 A 1 1 0 ? 0 A. calceolus 1 1 0 0 1 1 1 0 0 1 0 0 0 B 0 1 0 1 0 0 1 1 1 0 ? 0 A. chevalieri 1 1 0 0 0 0 0 1 0 1 1 1 0 2 1 0 0 1 0 0 1 1 0 0 ? 0 A. conchiferum 1 1 0 0 A ? A 0 0 1 A A 0 0 0 1 0 1 0 0 1 1 0 0 ? 0 A. cultriforme 1 1 0 0 0 1 0 1 0 1 0 1 0 2 1 0 0 1 1 0 1 1 0 0 ? 0 A. distichum 0 1 2 0 0 0 1 0 0 1 0 1 0 3 ? 1 1 1 0 0 1 1 0 0 ? 0 A. dives 1 1 0 0 0 0 0 1 0 1 1 1 0 3 ? 1 0 1 1 0 1 1 1 0 ? 0 Table 4-2. Continued Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 Angraecum eburneum 1 1 1 0 0 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 0 0 ? 0 A. eburneum 1 1 1 1 0 0 A A 0 0 1 A 0 0 B 0 1 0 1 0 0 1 1 0 0 ? 0 A. eburneum 2 1 1 1 0 0 0 0 0 0 1 0 0 0 3 ? 1 0 1 0 0 1 1 0 0 ? 0 A. eburneum 3 1 1 1 0 1 1 0 1 0 1 2 1 0 2 0 1 0 1 0 0 1 1 0 0 ? 0 A. eichlerianum 0 1 0 0 0 1 0 1 0 0 0 0 0 2 1 0 0 1 A 0 1 1 0 0 ? 0 A. erectum 1 1 0 0 0 1 0 1 0 1 0 1 0 2 1 1 0 1 C 0 1 1 0 0 ? 0 A. germinyanum 0 1 0 0 1 1 1 0 0 1 0 0 0 0 0 1 0 1 0 0 1 1 0 0 ? 0 A. rutenbergianum 0 1 0 0 0 0 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 0 A. teres 0 1 0 0 1 1 1 1 0 1 0 1 0 3 ? 1 0 1 0 0 1 1 1 0 ? 0 Beclardia macrostachya A 1 0 0 2 1 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 Bolusiella batesii 0 1 0 0 0 0 1 0 0 0 ? 0 0 1 1 0 0 1 0 0 1 1 1 0 ? 0 B. iridifolia 1 1 0 0 0 1 0 0 0 0 0 0 1 2 1 0 0 1 0 0 1 1 1 0 ? 0 B. maudiae 1 1 0 0 0 0 0 0 0 0 ? 0 0 3 ? 0 0 1 0 1 1 1 1 0 ? 0 Bonniera appendiculata 1 1 0 0 0 1 1 0 0 1 0 0 0 0 0 1 0 1 0 0 1 1 0 0 ? 0 Calyptrochilum christyanum 1 1 0 0 2 A A 1 0 A 0 A 0 3 ? 1 0 1 1 0 1 1 0 0 ? 0 Campylocentrum fasciola 0 1 0 0 1 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 C. micranthum 0 1 0 0 A 1 0 1 0 0 0 1 0 2 1 1 0 1 0 0 1 1 0 0 ? 0 C. pachyrrhizum 0 1 0 0 1 1 1 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 C. poeppigii 0 1 0 0 1 1 1 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 0 0 ? 2 C. sullivanii 0 1 0 0 1 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 Chamaeangis odoratissima 0 1 2 0 1 ? 1 0 0 0 0 0 1 3 ? 0 0 1 1 0 1 1 0 0 ? 0 C. sarcophylla 0 1 2 0 1 1 0 0 0 1 0 0 1 3 ? 1 0 1 1 0 1 1 1 0 ? 0 C. vesicata 0 1 2 0 1 1 0 A 0 0 0 0 1 3 ? 0 0 1 1 0 1 1 1 0 ? 0 Cribbia brachyceras 0 1 0 0 A A A 0 0 A 0 0 0 B 0 0 0 1 0 0 1 1 0 0 ? 0 C. confusa 0 1 0 0 0 1 1 0 0 1 0 0 0 B 0 0 0 1 0 0 1 1 1 0 ? 0 Cryptopus elatus 0 1 0 0 A 1 0 0 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 C. paniculatus 0 1 0 0 A A 0 0 0 1 0 0 0 3 ? 0 0 1 1 0 1 1 0 0 ? 0 Cyrtorchis arcuata 1 1 0 0 0 1 0 1 0 1 1 1 0 3 ? 0 0 1 0 0 0 1 0 0 ? 0 Cyrtorchis chailluana 1 1 0 0 0 1 0 0 0 0 0 0 0 3 ? 0 0 1 0 0 0 1 0 0 ? 0 Table 4-2. Continued Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 Cyrtorchis praetermissa A 1 2 0 0 A A 1 0 1 1 1 0 0 1 1 0 1 0 1 1 1 0 0 ? 0 C. ringens 1 1 2 0 0 0 0 1 0 1 1 0 0 0 1 1 0 1 0 1 1 1 0 0 ? 0 Dendrophylax barrettiae 0 1 0 0 1 1 0 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 D. filiformis 1 1 0 0 1 1 0 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 D. funalis 1 1 0 0 1 1 A 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 D. lindenii A 1 0 0 1 1 1 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 D. porrectus 0 1 0 0 1 1 A C 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 D. varius A 1 0 0 1 1 1 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 Diaphananthe fragrantissima 1 1 2 0 1 0 0 1 0 0 0 0 1 3 ? 0 0 1 1 0 1 1 0 0 ? 0 D. lorifolia 0 1 0 0 1 1 1 1 0 1 0 0 1 3 ? 0 0 1 1 0 1 1 0 0 ? 0 D. millarii 1 1 0 0 1 1 0 0 0 1 2 2 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 Eurychone rothschildiana 0 1 0 0 1 1 1 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 Jumellea confusa 1 1 2 0 1 1 1 1 0 0 0 0 0 2 1 1 0 1 0 0 1 1 0 0 ? 0 J. sagittata A 1 2 0 0 1 1 0 0 1 0 0 0 2 1 0 0 1 0 1 1 1 1 0 ? 0 Lemurella pallidiflora 0 1 0 0 1 1 0 0 0 1 2 0 0 3 ? 1 0 1 0 0 1 1 0 0 ? 0 Lemurorchis madagascariensis 0 1 2 ? 0 0 1 0 0 1 0 0 0 3 ? 1 0 1 1 0 1 1 1 0 ? 0 Listrostachys pertusa A 1 0 0 0 1 1 0 0 1 0 0 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 Microcoelia aphylla 1 1 0 0 1 1 A 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 0 0 ? 2 M. bulbocalcarata 0 1 0 0 1 1 1 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 M. corallina 0 1 0 0 1 1 0 2 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 M. exilis 0 1 0 0 1 1 A B 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 M. globulosa A 1 0 0 1 1 A B 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 M. macrantha 0 1 0 0 1 1 A 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 M. megalorrhiza 0 1 0 0 1 1 0 1 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 M. obovata 1 1 0 0 1 1 0 C 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 M. physophora 1 1 0 0 1 1 0 C 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 M. smithii 0 1 0 0 1 1 0 0 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 M. stolzii 1 1 0 0 1 1 0 D 0 ? ? ? ? ? ? ? ? ? ? ? 1 1 1 0 ? 2 Microterangis hildebrandtii 1 1 0 0 1 1 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 Table 4-2. Continued Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 Mystacidium braybonae 1 1 0 0 0 1 0 2 0 1 0 0 0 3 ? 1 0 1 0 0 1 1 1 0 ? 0 M. capense 1 1 0 0 0 1 1 2 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 M. flanaganii 1 1 0 0 0 1 0 2 0 1 0 0 1 3 ? 0 0 1 0 0 1 1 1 0 ? 0 Neobathiea grandidieriana 0 1 0 0 1 1 0 0 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 Oeonia rosea 1 1 0 0 0 1 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 Oeoniella polystachys 1 1 0 0 A 1 A 1 0 1 A 1 0 3 ? 0 0 1 A 0 1 1 0 0 ? 0 Podangis dactyloceras 1 1 0 0 0 A 0 0 0 A ? A 0 1 1 1 0 1 0 0 1 1 1 0 ? 0 Rangaeris amaniensis 1 1 0 0 0 A A 1 0 A 0 1 0 2 1 0 0 1 0 1 1 1 0 0 ? 0 R. muscicola 1 1 0 0 0 1 0 1 0 1 A 1 1 2 1 0 0 1 0 1 1 1 1 0 ? 0 Rhipidoglossum kamerunense 0 1 0 0 1 1 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 R. rutilum 1 1 0 0 0 0 0 0 0 1 0 0 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 R. subsimplex 1 1 0 0 0 1 1 0 0 1 A 1 0 3 ? 0 0 1 0 0 1 1 0 0 ? 0 R. xanthopollinium 1 1 0 0 A A 0 0 0 1 A A 0 3 ? A 0 1 0 0 1 1 0 0 ? 0 Sobennikoffia humbertiana 1 1 1 0 0 1 0 1 0 1 2 2 0 3 ? 1 0 1 1 0 1 1 0 0 ? 0 Solenangis clavata A 1 0 0 1 1 A 0 0 A A 0 0 2 1 0 0 1 0 0 1 1 0 0 ? 0 S. wakefieldii 0 1 0 0 2 1 0 0 0 0 1 1 0 2 1 0 0 1 0 0 1 1 0 0 ? 0 Sphyrarhynchus schliebenii 0 1 0 0 0 1 0 2 0 1 0 1 1 3 ? 0 0 1 0 0 1 1 1 0 ? 0 Tridactyle bicaudata 1 1 0 A 0 1 0 D 0 1 A D 0 2 1 A 0 1 0 1 1 1 0 0 ? 0 T. crassifolia 1 1 0 1 0 0 0 1 0 1 0 2 0 2 1 1 0 1 0 0 1 1 0 0 ? 0 T. filifolia ? 1 ? ? 0 ? 1 1 0 1 0 0 1 2 1 1 0 1 0 1 1 1 0 0 ? 0 T. furcistipes 1 1 0 1 0 1 0 1 0 1 0 0 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 T. scottellii 1 1 0 0 0 1 1 1 0 1 1 2 0 2 1 1 0 1 0 1 1 1 0 0 ? 0 T. tanneri A 1 0 ? 0 A A 1 0 A 0 0 0 2 1 1 0 1 1 1 1 1 1 0 ? 0 Ypsilopus longifolius A 1 0 0 2 A 0 0 0 0 0 A 0 2 1 A 0 1 0 1 1 1 1 0 ? 0 Y. viridiflorus 0 1 0 0 0 1 1 1 0 1 0 0 0 1 1 0 0 1 0 1 1 1 1 0 ? 0 Tribe Vandeae, Subtribe Aeridinae Acampe papillosa A 1 0 0 0 0 A 1 0 1 0 0 A 3 ? 0 0 1 1 0 1 1 0 0 ? 0 Amesiella philippinensis 1 1 0 0 0 1 1 1 0 1 0 0 1 3 ? 1 0 0 1 0 1 1 1 0 ? 0 Neofinetia falcata 1 1 2 0 0 0 1 1 1 0 A 1 0 2 1 0 0 1 0 1 1 1 1 0 ? 0 Table 4-2. Continued Taxon Character 1 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 Phalaenopsis deliciosa 0 1 0 0 1 1 1 0 0 0 0 0 0 3 ? 0 0 1 0 0 1 1 1 0 ? 0 Trichoglottis atropurpurea 1 1 0 0 0 1 0 1 0 1 0 0 1 3 ? 0 0 1 1 0 1 1 0 0 ? 0 Vanda flabellata 1 1 0 0 0 1 0 0 1 0 A 1 0 2 1 0 0 1 0 1 1 1 0 0 ? 0 Tribe Epidendreae, Subtribe Polystachyinae Neobenthamia gracilis 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ? 0 ? 0 Polystachya concreta 0 0 0 0 1 0 0 B 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ? 0 ? 0 P. longiscapa 0 0 0 0 0 0 0 A 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ? 1 0 0 P. modesta 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ? 0 ? 0 237

Results

Structural Characters Mapped onto Molecular Topologies

Heuristic analyses resulted in 20,000+ equally parsimonious trees using anatomical data and 20,000+ trees using molecular sequence data from ITS, matK, and trnL-F (Table 4-3).

Table 4-3. Comparison of tree statistics for each phylogenetic analysis. Molecular characters = combined ITS, matK, and trnL-F. Tree statistics Structural Molecular Combined structural characters characters + molecular L 171 4390 4677 Informative characters 24 993 1017 Trees saved 20,000+ 20,000+ 690 CI1 0.19 0.50 0.48 CI2 0.18 0.41 0.39 RI 0.72 0.70 0.69 RC 0.14 0.35 0.33 Clades with >85% BS 1 63 64

The bootstrap consensus of the anatomical data set (Fig. 4-1) had only three clades with greater than 50% BS support. This topology was almost identical to the topology of the larger anatomical analysis of all Vandeae in

Chapter 2 (Fig. 3-39). Tribe Vandeae were well supported (94% BS) by the following anatomical characters: 1) loss of tilosomes; 2) presence of aeration complexes; 3) presence of spherical stegmata; 4) loss of mucilage; and 5) presence of a monopodial stem. Angraecopsis amaniensis and A. breviloba were weakly supported as sister taxa (65% BS) by the presence of deciduous leaves. Cyrtorchis praetermissa and C. ringens were moderately supported

(72% BS) by the presence of ridged endovelamen thickenings, an adaxial hypodermis, and fibrous foliar idioblasts. 238

Results of the molecular analyses (Fig. 4-1) were very similar to those obtained in previous larger analyses of Angraecinae (Fig. 2-14). Angraecinae

(including Aerangidinae) were monophyletic (100% BS) and sister to Aeridinae

(100% BS), using Polystachyinae for outgroup comparisons. Within

Angraecinae, a large clade of primarily Malagasy taxa (93% BS) was sister to an unresolved clade of Old and New World angraecoids (95% BS).

Of the 26 structural characters used in analyses of all Vandeae (Tables 3-2 and 4-2), the two invariant characters in the reduced analyses of Angraecinae were: 1) the presence of fiber bundles within the leaf, character 17 and 2) type of deciduousness, character 25. Mapping the 24 informative structural characters onto molecular tree number one of 20,000+ (showing all most parsimonious states at each node) there are few patterns of anatomical character evolution revealed because of the extreme homoplasy in the structural data set.

The synapomorphies of Vandeae supported by character mapping (Fig. 4-

2) were :

• Character 2 (Fig. 4-3) loss of tilosomes

• Character 6 (Fig. 4-4) presence of aeration complexes

• Character 14 (Fig. 4-5) loss of a hypodermis

• Character 18 (Fig. 4-6) presence of stegmata

• Character 21 (Fig. 4-7) loss of mucilage

• Character 22 (Fig. 4-8) presence of a monopodial stem.

The remaining structural characters showed very few, if any, patterns of variation mapped onto the molecular tree, revealing their homoplasious nature

(Figs. 4-2 and 4-9 through 4-31). Figure 4-1. Bootstrap consensus trees for the molecular (left) and anatomical (right) data sets. Numbers above branches represent bootstrap percentages for 1000 replicates. 240

99 Aerangis biloba Aerangis confusa 100 95 Aerangis ugandensis 95 Aerangis kirkii Aerangis kotschyana 100 71 Aerangis coriacea 82 Aerangis somalensis Aerangis luteoalba 53 Aerangis macrocentra 99 53 Microterangis hildebrandtii 72 Aerangis thomsonii Aerangis verdickii Eurychone rothschildiana Ancistrorhynchus metteniae 68 80 Bolusiella batesii 100 Bolusiella maudiae Bolusiella iridifolia 100 Microcoelia bulbocalcarata 59 57 Microcoelia megalorrhiza 96 Microcoelia macrantha Solenangis aphylla Microcoelia corallina 100 100 Microcoelia globulosa 99 Microcoelia obovata 100 Microcoelia stolzii 72 100 Microcoelia exilis Microcoelia smithii Microcoelia physophora 100 Angraecopsis amaniensis 65 100 Angraecopsis breviloba 99 Sphyrarhynchus schliebenii Angraecopsis parviflora 52 85 Mystacidium braybonae 100 Mystacidium capense Mystacidium flanaganii 98 100 Cribbia brachyceras 97 Cribbia confusa 80 Rhipidoglossum kamerunense 51 84 95 Rhipidoglossum rutilum Rhipidoglossum subsimplex 91 Rhipidoglossum xanthopollinium Diaphananthe millarii Angraecum distichum Beclardia macrostachya 65 Cryptopus elatus 94 100 Cryptopus paniculatus 99 Oeonia rosea 87 Neobathiea grandidieriana 95 Lemurella pallidiflora 79 Chamaeangis odoratissima 97 Diaphananthe fragrantissima 100 100 Chamaeangis sarcophylla Chamaeangis vesicata Diaphananthe lorifolia 98 Cyrtorchis arcuata 64 Cyrtorchis chailluana 94 100 Cyrtorchis praetermissa 72 Cyrtorchis ringens Listrostachys pertusa Podangis dactyloceras 58 Rangaeris amaniensis 100 Tridactyle tanneri 96 Ypsilopus viridiflorus Rangaeris muscicola Tridactyle bicaudata 100 54 Tridactyle crassifolia Tridactyle scottellii Tridactyle filifolia 100 Tridactyle furcistipes Ypsilopus longifolius 100 Solenangis clavata Solenangis wakefieldii 100 100 Angraecum chevalieri 94 Angraecum cultriforme Angraecum erectum 100 Campylocentrum fasciola 100 77 Campylocentrum sullivanii 100 Campylocentrum pachyrrhizum 88 Campylocentrum micranthum 100 Campylocentrum poeppigii 97 Dendrophylax barrettiae 99 Dendrophylax filiformis 100 66 Dendrophylax funalis Dendrophylax lindenii 95 100 Dendrophylax varius Dendrophylax porrectus Angraecum eichlerianum Calyptrochilum christyanum 100 Aeranthes arachnites Aeranthes grandiflora 100 Angraecum calceolus 92 Angraecum conchiferum 97 Bonniera appendiculata Angraecum germinyanum Angraecum dives 76 71 Angraecum eburneum 95 93 Angraecum eburneum 1 100 Angraecum eburneum 2 Angraecum eburneum 3 70 Angraecum teres Oeoniella polystachys Sobennikoffia humbertiana Angraecum rutenbergianum 100 Jumellea confusa Jumellea sagittata Lemurorchis madagascariensis 99 Acampe papillosa 58 Trichoglottis atropurpurea 100 Neofinetia falcata 100 Vanda flabellata 72 Amesiella philippinensis Phalaenopsis deliciosa 78 Neobenthamia gracilis Polystachya longiscapa 100 Polystachya concreta Polystachya modesta 241

7 Neobenthamia gracilis 24 Polystachya longiscapa 5 Polystachya concreta Polystachya modesta 10 1 Aerangis biloba Aerangis confusa 5 Aerangis ugandensis 11 6 Angraecum chevalieri Aerangis kirkii 1 19 Angraecum cultriforme 10 8 5 Aerangis kotschyana 16 Angraecum erectum 1 Aerangis coriacea 10 19 13 Campylocentrum fasciola Aerangis somalensis 8 12 Campylocentrum sullivanii 7 Aerangis luteoalba Campylocentrum pachyrrhizum 19 10 Aerangis macrocentra 26 Campylocentrum micranthum 1 Microterangis hildebrandtii Campylocentrum poeppigii 10 8 Aerangis thomsonii 26 16 1 5 13 Dendrophylax barrettiae Aerangis verdickii 14 1 Dendrophylax filiformis 7 Eurychone rothschildiana Dendrophylax funalis 16 7 4 Ancistrorhynchus metteniae Dendrophylax lindenii 7 1 Bolusiella batesii 6 Dendrophylax varius 20 Bolusiella maudiae Dendrophylax porrectus 13 Bolusiella iridifolia Angraecum eichlerianum 7 Microcoelia bulbocalcarata 8 Microcoelia megalorrhiza b Microcoelia macrantha 23 8 Microcoelia aphylla Microcoelia corallina 26 Microcoelia obovata Microcoelia globulosa Microcoelia stolzii Microcoelia exilis Microcoelia smithii Microcoelia physophora 14 Solenangis clavata 12 5 Solenangis wakefieldii 21 20 16 14 Cyrtorchis arcuata 11 10 8 23 Cyrtorchis chailluana Beclardia macrostachya 14 10 Cyrtorchis praetermissa Cryptopus elatus 19 6 Cyrtorchis ringens Cryptopus paniculatus 1 20 14 8 Podangis dactyloceras Oeonia rosea 23 10 16 13 Rangaeris muscicola Neobathiea grandidieriana 16 11 8 Lemurella pallidiflora 20 16 8 Listrostachys pertusa 12 Rangaeris amaniensis c 23 19 Tridactyle tanneri 14 Ypsilopus viridiflorus 4 Tridactyle furcistipes 10 8 5 23 Ypsilopus longifolius Tridactyle bicaudata 13 Tridactyle filifolia 20 6 4 5 Aeranthes arachnites 12 Tridactyle crassifolia Aeranthes grandiflora 11 Tridactyle scottellii 6 Angraecum rutenbergianum Angraecopsis amaniensis 23 10 8 5 23 Jumellea confusa Angraecopsis breviloba 20 Jumellea sagittata 8 Sphyrarhynchus schliebenii 6 Lemurorchis madagascariensis 16 Mystacidium braybonae 23 Angraecum calceolus 1 7 Mystacidium capense Angraecum conchiferum Mystacidium flanaganii Bonniera appendiculata Angraecopsis parviflora 1 Angraecum germinyanum 14 Cribbia brachyceras Angraecum eburneum 1 Cribbia confusa 5 Angraecum eburneum 1 5 Rhipidoglossum kamerunense 5 6 6 Angraecum eburneum 2 Rhipidoglossum rutilum 11 12 7 Angraecum eburneum 3 1 Rhipidoglossum subsimplex 23 1 Angraecum teres Rhipidoglossum xanthopollinium 16 12 11 5 Oeoniella polystachys Diaphananthe millarii 23 11 6 17 16 7 12 6 3 Angraecum dives Angraecum distichum 11 3 Sobennikoffia humbertiana 14 clade a clade b d 7 Chamaeangis odoratissima 1 3 Diaphananthe fragrantissima 23 16 Chamaeangis sarcophylla 13 Chamaeangis vesicata 7 Diaphananthe lorifolia 16 Calyptrochilum christyanum 22 6 18 2 14 21 clade c 6 Acampe papillosa Trichoglottis atropurpurea 23 7 6 3 20 14 12 9 Neofinetia falcata Vanda flabellata 23 7 18 16 13 Amesiella philippinensis 5 Phalaenopsis deliciosa Figure 4-2. All structural characters mapped onto a representative molecular phylogeny. a) Angraecinae, Aeridinae, and Polystachyinae (outgroup). b) African and New World Angraecinae clade. c) Malagasy Angraecinae clade. d) Malagasy and African Angraecinae clade. Figure 4-3. Tilosome presence mapped onto a representative molecular tree. Figure 4-4. Aeration complex presence mapped onto a representative molecular tree. Figure 4-5. Hypodermal distribution mapped onto a representative molecular tree. Figure 4-6. Stegmata presence mapped onto a representative molecular tree. Figure 4-7. Mucilage loss mapped onto a representative molecular tree. Figure 4-8. Stem condition mapped onto a representative molecular tree. 248

Within the root, epivelamen cell shape (character 1) was basally isodiametric to flattened, and most major clades within Vandeae contained taxa with the derived state in which epivelamen cells were radially elongate (Fig. 4-9).

Using accelerated transformation (ACCTRAN) optimization, epivelamen cell shape became a defining feature for three clades: Aeridinae, the primarily

Malagasy Aeranthes/Sobennikoffia clade, and Ancistrorhynchus/Tridactyle clade

(Fig. 4-10).

Distinct endovelamen wall thickenings (character 3), which have not previously been reported in any other group of orchids, were less frequent and appeared in the Cyrtorchis/Rangaeris, Cribbia/Angraecum distichum,

Chamaeangis/Diaphananthe, Aeridinae, Aeranthes/Lemurorchis, and

Angraecum/Sobennikoffia clades (Fig. 4-11). Ridged thickenings were the most common type and formed a synapomorphy for the Chamaeangis odoratissima/C. vesicata clade. Using ACCTRAN, ridged thickenings were also a synapomorphy for the Aeranthes/Lemurorchis and Cyrtorchis clades. Smooth thickenings were unique to the Angraecum/Sobennikoffia clade and were a defining character for the clade of Angraecum eburneum.

Velamen tufts (character 4) were relatively rare and of little phylogenetic value. They occurred scattered in the Ancistrorhynchus/Bolusiella and

Listrostachys/Tridactyle clades (Fig. 4-12). Exodermal thickenings (character 5) showed a scattering of both derived states (∩- and ∪-thickened), with ∩- thickened being the most common (Fig. 4-13). Exodermal proliferations

(character 7) were scattered throughout the ingroup and outgroup and were also 249 of little phylogenetic value (Fig. 4-14). Cell wall ornamentation of the root water- storage cells (character 8) was most commonly banded (Fig. 4-15) and defined the following three clades: Cyrtorchis/Tridactyle, Angraecum chevalieri/A. eichlerianum, and Angraecum calceolus/Sobennikoffia. Using ACCTRAN optimization, banded thickenings also defined the Chamaeangis/Calyptrochilum,

Aeranthes/Sobennikoffia, and Aeridinae clades. Water-storage cells with edge- thickenings was a synapomorphy for the Angraecopsis/Mystacidium clade and

(using ACCTRAN optimization) the Microcoelia clade (Fig. 4-16). Root fibers

(character 9) were only present in the Aeridinae clade (Fig. 4-17).

On the leaves, glandular hairs (character 10) were commonly found throughout Vandeae and were absent in the members of Polystachyinae examined. When mapped using ACCTRAN, the presence of foliar hairs was a synapomorphy for Vandeae (Fig. 4-18). When mapped using the delayed transformation optimization (DELTRAN), the presence of foliar hairs was a synapomorphy for the Angraecinae clade (Fig. 4-19).

Adaxial and abaxial epidermal cell shape (characters 11 and 12, respectively) were relatively uninformative, showing very few discernible patterns

(Figs. 4-20 and 4-21). Conical adaxial epidermal cells defined the Cyrtorchis clade, and conical abaxial cells defined the Angraecum chevalieri/Dendrophylax and Angraecopsis breviloba + Sphyrarhynchus clades. Tridactyle crassifolia + T. scottellii were united by the presence of papillose abaxial epidermal cells.

The amphistomatal condition (character 13) occurred scattered throughout

Vandeae (Fig. 4-22), but was a synapomorphy for the 250

Chamaeangis/Diaphananthe and Angraecopsis breviloba + Sphyrarhynchus clades. With ACCTRAN optimization, Angraecopsis amaniensis/Mystacidium flanaganii was also defined by the amphistomatal condition. The loss of a hypodermis was a synapomorphy for Vandeae (character 14), with the adaxial + abaxial distribution being the most common derived state (Fig. 4-5). In those vandaceous taxa with a hypodermis, cells may be thin-walled or fibrous

(character 15, Fig. 4-23). The presence of a fibrous hypodermis was a unifying feature for Vandeae, using ACCTRAN optimization (Fig. 4-24). A reversion from a fibrous to a thin-walled hypodermis occurred in the Aeranthes/Sobennikoffia and Angraecopsis/Angraecum distichum clades.

Mesophyll differentiation (character 16) was commonly homogeneous for most Vandeae, but two large clades were defined by the presence of a heterogeneous mesophyll: Cyrtorchis/Tridactyle and Angraecum calceolus/Sobennikoffia (Fig. 4-25). The derived state of wall ornamentation on the leaf water-storage cells (character 19) was predominantly banded, except in

Aerangis coriacea (smooth to pitted and edge-thickened cells present) and

Angraecum erectum (banded and edge thickenings present). Banded thickenings defined the Chamaeangis/Calyptrochilum, Angraecum cultriforme +

A. erectum, and Acampe + Trichoglottis clades (Fig. 4-26). With ACCTRAN optimization, banded thickenings was also a homoplasious synapomorphy for

Vandeae, with a reversal back to smooth-walled in the large Aerangis/Lemurella clade. The presence of mesophyll fiber idioblasts (character 20) was a 251 synapomorphy for the Cyrtorchis/Tridactyle and Vanda + Neofinetia clades (Fig.

4-27).

Only a few morphological characters were used in my study. The deciduous character state of leaf persistence (character 24) was found in the

Angraecopsis/Sphyrarhynchus clade and in Polystachyinae (Fig. 4-28). Using

ACCTRAN optimization, the presence of deciduous leaves was a synapomorphy for the Angraecopsis/Sphyrarhynchus clade. Leaves were most commonly well- developed and evergreen in Vandeae and Polystachyinae (character 26), except in the clades containing leafless genera. The most common type of leaflessness

(and the only condition for this subset of Vandeae) was that in which leaves were scale-like and nonphotosynthetic (Fig. 4-29). Scale-like leaves were a shared derived feature of the American leafless clade (Campylocentrum/Dendrophylax) and the African/Malagasy clade (Microcoelia). Caducous, vestigial leaves, which represent the alternative type of leaflessness found in Aeridinae (Chiloschista and Phalaenopsis) was much less common and does not occur in Angraecinae.

The monopodial stem was a synapomorphy for Vandeae (Fig. 4-8), and the derived state of a short monopodial stem (character 23) seemed to be scattered throughout Vandeae (Fig. 4-30). Several small clades were united by the presence of a short stem (Ancistrorhynchus/Bolusiella, Microcoelia,

Chamaeangis sarcophylla + C. vesicata, Dendrophylax, Campylocentrum fasciola + C. pachyrrhizum, Angraecopsis amaniensis/A. parviflora, Tridactyle tanneri + Ypsilopus viridiflorus, Podangis + Rangaeris muscicola,

Aeranthes/Lemurorchis, and Amesiella + Phalaenopsis). However, using 252

ACCTRAN optimization (Fig. 4-31), abbreviated monopodial stems united a large clade of Angraecinae (Aerangis/Angraecum distichum clade) and several other smaller clades, including the New World Angraecinae (Campylocentrum +

Dendrophylax).

Structural Characters Traced along Combined Topologies

Bootstrap consensus topologies of the structural and molecular data sets were compared for homogeneity assessment. Because there were no hard incongruencies among the data sets, the structural data were combined with the molecular data for phylogenetic analysis. Heuristic searches produced 690 most parsimonious trees with only slightly lower CI and RI values than molecular data alone (Table 4-3). However, there were more clades with greater than 85% BS support and many fewer trees (Table 4-3, Fig. 4-1, and Fig. 4-32) using the combined data set than there were using molecular data alone.

Results of tracing 24 informative anatomical and morphological characters along one of the 690 most parsimonious trees of the combined analysis were extremely similar to that of mapping the same structural characters onto a molecular phylogeny (Figs. 4-2 and 4-33). The synapomorphies supporting

Vandeae were almost the same in both instances, with the exception of hypodermal composition (character 15). However, when ACCTRAN optimization was used to map character 15 onto a molecular topology, it also formed a synapomorphy of Vandeae. Most differences in the patterns of character evolution between mapping and tracing were due to the slightly different topologies of the combined and molecular trees. Figure 4-9. Epivelamen cell shape mapped onto a representative molecular tree. Figure 4-10. Epivelamen cell shape mapped onto a representative molecular tree using the ACCTRAN optimization algorithm. Figure 4-11. Distinct thickenings of the inner endovelamen wall mapped onto a representative molecular tree. Figure 4-12. Velamen tuft presence mapped onto a representative molecular tree. Figure 4-13. Exodermal thickening type mapped onto a representative molecular tree. Figure 4-14. Exodermal proliferations mapped onto a representative molecular tree. Figure 4-15. Water-storage cell wall ornamentation mapped onto a representative molecular tree. Figure 4-16. ACCTRAN optimization of water-storage cell wall ornamentation mapped onto a representative molecular tree. Figure 4-17. Root fibers mapped onto a representative molecular tree. Figure 4-18. ACCTRAN optimization of foliar hairs mapped onto a representative molecular tree. Figure 4-19. DELTRAN optimization of foliar hairs mapped onto a representative molecular tree. Figure 4-20. Adaxial epidermal cell shape mapped onto a representative molecular tree. Figure 4-21. Abaxial epidermal cell shape mapped onto a representative molecular tree. Figure 4-22. Stomatal distribution mapped onto a representative molecular tree. Figure 4-23. Hypodermal composition mapped onto a representative molecular tree. Figure 4-24. ACCTRAN optimization of hypodermal composition mapped onto a representative molecular tree. Figure 4-25. Mesophyll differentiation mapped onto a representative molecular tree. Figure 4-26. Leaf water-storage cell wall ornamentation mapped onto a representative molecular tree. Figure 4-27. Mesophyll fiber idioblasts mapped onto a representative molecular tree. Figure 4-28. Leaf persistence mapped onto a representative molecular tree. Figure 4-29. Leaf morphology mapped onto a representative molecular tree. Figure 4-30. Monopodial stem length mapped onto a representative molecular tree. Figure 4-31. ACCTRAN optimization of monopodial stem length mapped onto a representative molecular tree. 276

Discussion

With the burgeoning use of molecular characters in phylogenetic analyses, the use of morphological characters has been a controversial issue. The two primary arguments are the homoplasious nature of morphological data and the difficulty of assessing homology (deQueiroz, 1996; Givnish & Sytsma, 1997;

Scotland et al., 2003). However, most systematists agree that morphological data can be potentially useful in phylogenetic analyses, especially in combination with molecular data (Albert, 1994; Doyle et al., 1994; Kron et al., 2002; Rudall et al., 1998; Sheahan & Chase, 1996; Smith & Sytsma, 1994). Even the combination of data from independent sources (not just from morphological but from different gene regions as well) has been called into question (Miyamoto &

Fitch, 1995). Several statistical tests have been designed to measure congruence (Johnson & Soltis, 1998), but have been shown to be overly sensitive and show false heterogeneity (Graham et al., 1998; Soltis et al., 1998).

While the partition homogeneity test was used to assess congruency between morphological and molecular data sets in my study, it proved to be overly sensitive in all cases (giving probability values that were generally much less than 0.5, even between chloroplast data sets). Instead, I used a manual approach of comparing bootstrap topologies to assess homogeneity between data sets (Whitten et al., 2000).

Not surprisingly, combining structural data with molecular data introduced more homoplasy into the analysis and therefore slightly lowered the CI and RI values (as compared to only using molecular data). However, analyses of the 277

Aerangis biloba 98 95 Aerangis confusa 100 Aerangis ugandensis 83 Aerangis kirkii Aerangis kotschyana Beclardia macrostachya Aerangis coriacea 54 Cryptopus elatus 62 Aerangis somalensis 64 89 100 Cryptopus paniculatus 100 Aerangis luteoalba 99 Oeonia rosea Aerangis macrocentra 88 Neobathiea grandidieriana Aerangis thomsonii 100 58 Lemurella pallidiflora Aerangis verdickii Microterangis hildebrandtii Eurychone rothschildiana Ancistrorhynchus metteniae b 62 86 Bolusiella batesii 100 Bolusiella maudiae Bolusiella iridifolia 100 Microcoelia bulbocalcarata 52 56 Microcoelia megalorrhiza 93 Microcoelia macrantha Solenangis aphylla 50 Microcoelia corallina 100 100 Microcoelia obovata 100 Microcoelia globulosa 99 Microcoelia stolzii 70 100 Microcoelia exilis Microcoelia smithii Microcoelia physophora Angraecum chevalieri Angraecopsis amaniensis 100 100 97 Angraecum cultriforme 100 Angraecopsis breviloba Angraecum erectum Sphyrarhynchus schliebenii 65 100 Campylocentrum fasciola 87 Mystacidium braybonae 100 81 Campylocentrum sullivanii 99 100 Mystacidium capense 100 Campylocentrum pachyrrhizum Mystacidium flanaganii 89 Campylocentrum micranthum Angraecopsis parviflora Campylocentrum poeppigii 100 100 Cribbia brachyceras Dendrophylax barrettiae 97 97 92 Cribbia confusa 99 Dendrophylax filiformis 63 Rhipidoglossum kamerunense 99 Dendrophylax funalis Rhipidoglossum rutilum 62 72 96 100 Dendrophylax lindenii Rhipidoglossum subsimplex 89 88 Dendrophylax varius Rhipidoglossum xanthopollinium Dendrophylax porrectus Diaphananthe millarii Angraecum eichlerianum 89 clade b 68 Chamaeangis odoratissima 97 Diaphananthe fragrantissima c Chamaeangis sarcophylla 100 99 Chamaeangis vesicata 53 91 Diaphananthe lorifolia Calyptrochilum christyanum 98 Cyrtorchis arcuata 100 Cyrtorchis chailluana 60 Cyrtorchis praetermissa Cyrtorchis ringens Listrostachys pertusa Podangis dactyloceras Rangaeris amaniensis 51 100 Tridactyle tanneri 99 97 Ypsilopus viridiflorus Rangaeris muscicola Tridactyle bicaudata 100 Aeranthes arachnites 100 60 Tridactyle crassifolia Aeranthes grandiflora Tridactyle scottellii Angraecum calceolus Tridactyle filifolia 94 Angraecum conchiferum 100 Tridactyle furcistipes 97 Bonniera appendiculata Ypsilopus longifolius Angraecum germinyanum Angraecum dives 100 100 Solenangis clavata Solenangis wakefieldii 68 73 Angraecum eburneum 99 87 Angraecum eburneum 1 91 clade c 99 Angraecum eburneum 2 Angraecum distichum Angraecum eburneum 3 91 77 Angraecum teres clade d Oeoniella polystachys 99 Acampe papillosa Sobennikoffia humbertiana Trichoglottis atropurpurea Angraecum rutenbergianum Amesiella philippinensis 100 54 99 Jumellea confusa Phalaenopsis deliciosa Jumellea sagittata 100 Neofinetia falcata Lemurorchis madagascariensis Vanda flabellata 75 Neobenthamia gracilis Polystachya longiscapa a 100 Polystachya concreta d Polystachya modesta Figure 4-32. Bootstrap consensus tree using structural and molecular data. Numbers above branches represent BS percentages from 1000 replicates. a) Angraecinae, Aeridinae, and Polystachyinae (outgroup). b) Malagasy Angraecinae. c) New World Angraecinae sister to several African Angraecum species. d) Malagasy and African Angraecinae. 278

Polystachya concreta Polystachya modesta 7 Neobenthamia gracilis 24 Polystachya longiscapa 10 1 Aerangis biloba Aerangis confusa 5 Aerangis ugandensis 7 Aerangis kirkii Chamaeangis odoratissima 3 1 8 10 5 Aerangis kotschyana Diaphananthe fragrantissima 16 23 13 23 Chamaeangis sarcophylla 1 Aerangis coriacea 19 13 10 Chamaeangis vesicata Aerangis somalensis 19 7 7 Aerangis luteoalba Diaphananthe lorifolia 16 1 19 23 Aerangis macrocentra Calyptrochilum christyanum 11 6 Angraecum chevalieri 1 Microterangis hildebrandtii 1 8 23 Aerangis thomsonii 19 Angraecum cultriforme 16 1 5 13 16 Aerangis verdickii Angraecum erectum 23 8 7 Eurychone rothschildiana 8 Campylocentrum fasciola 12 16 7 4 Ancistrorhynchus metteniae Campylocentrum sullivanii 7 1 Bolusiella batesii Campylocentrum pachyrrhizum 6 26 20 Bolusiella maudiae Campylocentrum micranthum 13 Bolusiella iridifolia 26 Campylocentrum poeppigii 7 Microcoelia bulbocalcarata Dendrophylax barrettiae 14 1 8 Microcoelia megalorrhiza Dendrophylax filiformis Microcoelia macrantha Dendrophylax funalis 8 23 Microcoelia aphylla Dendrophylax lindenii Microcoelia corallina Dendrophylax varius 26 Microcoelia obovata Dendrophylax porrectus Microcoelia globulosa Angraecum eichlerianum Microcoelia stolzii b Microcoelia exilis Microcoelia smithii Microcoelia physophora 23 Solenangis clavata 14 5 12 Solenangis wakefieldii 21 20 Cyrtorchis arcuata 8 10 Cyrtorchis chailluana 16 3 Cyrtorchis praetermissa Cyrtorchis ringens Rangaeris amaniensis 8 19 16 Tridactyle tanneri 14 Ypsilopus viridiflorus 13 Rangaeris muscicola 14 Podangis dactyloceras 7 Listrostachys pertusa 8 4 Tridactyle furcistipes 23 5 10 23 Ypsilopus longifolius Tridactyle bicaudata 3 Aeranthes arachnites 13 7 8 Tridactyle filifolia Aeranthes grandiflora 20 6 4 12 Tridactyle crassifolia Angraecum calceolus 7 7 11 Tridactyle scottellii 15 1 Angraecum conchiferum Angraecopsis amaniensis 23 Bonniera appendiculata Angraecopsis breviloba 1 Angraecum germinyanum 8 Sphyrarhynchus schliebenii 19 5 6 Angraecum dives 23 3 12 16 Mystacidium braybonae Sobennikoffia humbertiana 1 7 Mystacidium capense Angraecum eburneum Mystacidium flanaganii 12 8 12 8 5 Angraecum eburneum 1 3 Angraecopsis parviflora 6 Angraecum eburneum 2 23 11 14 Cribbia brachyceras Angraecum eburneum 3 1 Cribbia confusa 16 Oeoniella polystachys 5 Rhipidoglossum kamerunense 7 1 Angraecum teres 6 Rhipidoglossum rutilum Angraecum rutenbergianum 7 12 7 23 10 8 5 1 Rhipidoglossum subsimplex 14 Jumellea confusa Rhipidoglossum xanthopollinium 3 20 Jumellea sagittata 12 5 11 Diaphananthe millarii 19 Lemurorchis madagascariensis 23 17 12 7 3 6 16 Angraecum distichum c 23 8 clade b Beclardia macrostachya 10 Cryptopus elatus 19 Cryptopus paniculatus 1 Oeonia rosea 10 Neobathiea grandidieriana 16 11 22 6 18 2 14 21 15 Lemurella pallidiflora clade c 6 23 19 Acampe papillosa Trichoglottis atropurpurea 1 19 18 16 13 Amesiella philippinensis 5 1 Phalaenopsis deliciosa 20 14 12 9 6 3 Neofinetia falcata 23 Vanda flabellata

Figure 4-33. All structural characters mapped onto a representative combined phylogeny. a) Angraecinae, Aeridinae, and Polystachyinae (outgroup). b) African and New World Angraecinae clade. c) Malagasy and African Angraecinae clade. 279 combined data set also produced fewer trees with more strongly supported clades (Table 4-3), a result congruent with several other phylogenetic studies of plants (Doyle et al., 1994; Koehler et al., 2002; Rudall et al., 1998; Sheahan &

Chase, 1996). Presumably, even with an extremely homoplasious data set (such as the structural one used here), the phylogenetic signal of the combined data can still enhance results derived from individual data sets (Källersjö et al., 1999;

Nandi et al., 1998).

One of the goals of this chapter was to compare two methodologies of examining character evolution: 1) mapping structural characters onto a molecular topology and 2) tracing structural characters onto a combined topology. Both methods gave very similar results, which should be expected if both data sets (structural and molecular) are producing the same phylogenetic signal. Another reason for these similar results is the strength of the phylogenetic signal from the molecular data set versus that from the structural data set. Given the number of characters in each data set (24 vs. 1002 informative characters), the signal from the molecular data set should be much stronger than that of the structural one. In this case, the strongest phylogenetic result was the monophyly of Vandeae (supported by seven structural characters), which was seen in both the mapping and tracing methodologies.

Another goal of this chapter was to examine the steps leading to leaflessness in Angraecinae and Aerangidinae. Because of the homoplasious nature of the structural characters used, very little can be concluded about the structural evolution toward leaflessness. In examining individual characters 280 mapped onto molecular (or combined) topologies, the only clear morphological change is in leaf morphology that varies from green, photosynthetic, and well- developed to brown, nonphotosynthetic, and scale-like. Possessing a scale-like leaf is the most common type of leaflessness that occurs in Microcoelia,

Dendrophylax, Campylocentrum, and Taeniophyllum. It is possible that some of the synapomorphies noted in Vandeae may have served as precursors toward leaflessness, and leaflessness might have developed independently several times within the tribe. For facilitated gas exchange, the loss of tilosomes could be significant because tilosomes presumably function in water retention

(Pridgeon, 1987). More importantly, the development of an aeration complex below pneumathodes in roots established a method of gas exchange analogous to that of stomatal complexes in leaves. The monopodial habit could also be a significant step in developing the reduced stem found in most leafless taxa.

It has been hypothesized that leaflessness evolved as a way for plants to allocate more resources toward reproduction and to limit resources toward the elaboration of a vegetative plant body (Benzing & Ott, 1981). The reduction of leaves to scales and stems to small bodies consisting almost entirely of an apical meristem would be a more direct process involving fewer steps with the monopodial plant form than with the sympodial plant body with pseudobulbs. CHAPTER 5 CONCLUSIONS

The primary objective of my dissertation was to examine the evolution of leaflessness within the orchid tribe Vandeae, a condition that represents a unique method by which plants survive in the epiphytic environment. As a basis for answering questions of leafless evolution within Vandeae, a phylogenetic hypothesis of the entire tribe (leafless and leafy members) was developed using molecular sequence data as well as structural data from vegetative anatomy and morphology.

Sequence data derived from the ITS gene region for all subtribes

(Aeridinae, Aerangidinae, and Angraecinae) supported a monophyletic Vandeae, with members of Polystachyinae used as outgroups. With this overall phylogeny, it appears that leaflessness has arisen at least six times within Vandeae (Fig. 5-

1): three times in Asia with Taeniophyllum, Chiloschista, and Phalaenopsis; once in Africa and Madagascar with Microcoelia; and at least twice in the New World with Dendrophylax and Campylocentrum. Given their disparate geographical distribution, at least three of these leafless events probably occurred independently of one another.

Focusing on the Angraecinae and Aerangidinae, additional sequence data from the chloroplast regions matK and trnL-F supported a large Angraecinae +

Aerangidinae clade (the “angraecoids”). Within the Old World angraecoids,

281 Figure 5-1. Strict consensus of 20,000+ most parsimonious trees from ITS sequence data. Green branches represent leafy taxa, and black branches represent leafless taxa. Bars along branches indicate where leaflessness has arisen (with the respective genus). From left to right the taxon illustrations are: Campylocentrum sp., Dendrophylax funalis, Microcoelia globulosa, Chiloschista parishii, and Phalaenopsis wilsonii. 283 there have traditionally been five genera with leafless species: Chaulidion (one species); Encheiridion (two species); Microcoelia (23 species); Solenangis (2 leafless species); and Taeniorrhiza (one species). From my study, it is clear that the leafless members of Solenangis are actually species of Microcoelia.

Encheiridion has already been transferred into Microcoelia by Jonsson (1981), and it seems likely that Chaulidion deflexicalcaratum is also probably another species of Microcoelia. The phylogenetic position of Taeniorrhiza, however, is still uncertain.

Currently, there are two New World angraecoid genera: Dendrophylax with

13 leafless species and Campylocentrum with 35 leafy and leafless species. The previously recognized segregate leafless genera (Harrisella, Polyrrhiza, and

Polyradicion) are specialized members of Dendrophylax. Leaflessness has occurred at least twice in tropical America: once in the ancestor of Dendrophylax and at least once within Campylocentrum (Carlsward et al., 2003).

In order to answer questions about the structural evolution of leaflessness, the pattern of variation in anatomical and morphological characters of roots and leaves were examined in two different ways: 1) mapped onto an independent molecular topology and 2) traced onto a combined molecular + structural topology. These two methods gave essentially the same results and differed only slightly in topology. Given the homoplasious nature of the anatomical and morphological characters used, few conclusions about the structural evolution of leaflessness could be discerned. However, characters that seemed to be the most important precursors in the development of leaflessness within Vandeae 284 were: 1) monopodial habit; 2) aeration complex; and 3) loss of tilosomes. Based on leaf morphology, two different types of leaflessness have arisen within

Vandeae: plants with nonphotosynthetic scale leaves (Microcoelia,

Dendrophylax, Campylocentrum, and Taeniophyllum) and plants with caducous, partially photosynthetic leaves (Chiloschista and Phalaenopsis) (Cockburn et al.,

1985).

Given the limited taxon sampling of my study (Table 2-2), very few taxonomic changes can be suggested. The most important name change is that of the traditional subtribes Aerangidinae and Angraecinae (the “angraecoids”).

Individually, these subtribes are polyphyletic, but together they form a well- supported monophyletic group in all molecular analyses. I propose recognizing a broadly circumscribed subtribe Angraecinae (Summerh., Kew Bulletin 20: 188,

1966) which includes Aerangidinae (Summerh., Kew Bulletin 20: 188, 1966).

Three important changes in generic circumscriptions are suggested. The first concerns Rhipidoglossum, which had been previously lumped with

Diaphananthe based on a continuum of floral features (Cribb, 1989;

Summerhayes, 1960). Rhipidoglossum should be maintained as distinct from

Diaphananthe, but should include Cribbia. Most members of Diaphananthe in my study (excluding D. millarii) formed a monophyletic group with Chamaeangis.

Because the genus Diaphananthe is an older name than Chamaeangis, the name Diaphananthe should take precedence.

The inclusion of Microterangis within Aerangis is the second generic circumscription. The floral morphology of Microterangis closely resembles that of 285

Chamaeangis, and the seven species of Microterangis were initially considered to be a section of Chamaeangis by Schlechter (1918). However, the two species of Microterangis sampled in my study (including the type species, M. hariotiana) form a clade firmly embedded within Aerangis, and both species are transferred below. Because the type species of Microterangis is being transferred, the five remaining species not sampled for my study will be left in a state of nomenclatural limbo. The remaining five species of Microterangis may form part of the large Aerangis clade (along with M. hariotiana and M. hildebrandtii); they may form a clade that will need a new generic name; or they may be closely related to other genera of Angraecinae. Further, detailed study is needed to determine these relationships.

Aerangis hariotiana (Kraenzl.) Carlsward , comb. nov. Basionym. Mystacidium hariotianum Kraenzl., Journal de Botanique (Morot) 11: 153, 1897. Synonyms. Saccolabium hariotianum (Kraenzl.) Finet, Bulletin de la Société Botanique de France 54, Mémoire 9: 32, 1907. Chamaeangis hariotiana (Kraenzl.) Schltr. Beihefte zum Botanischen Centralblatt. Kassel 33: 426, 1915.

Aerangis hildebrandtii (Rchb.f.) Carlsward, comb. nov. Basionym. Angraecum hildebrandtii Rchb.f. Gardeners’ Chronicle: 725, 1878. Synonym. Chamaeangis hildebrandtii (Rchb.f.) Garay Botanical Museum Leaflets 23: 165, 1972.

The last generic circumscription deals with Microcoelia and Solenangis.

Both leafless members of Solenangis (S. aphylla and S. cornuta) should be considered in Microcoelia, making Microcoelia and the remaining leafy members of Solenangis monophyletic. The combination of M. aphylla already exists (see below), but a new combination, M. cornuta, is required (see below). The genus 286

Solenangis, which was based on a leafy species (S. scandens), is monophyletic and probably sister to Microcoelia.

Microcoelia aphylla (Thouars) Summerh., Bulletin of Miscellaneous Information, Royal Botanic Gardens, Kew: 233, 1936. Basionym. Angraecum aphyllum Thouars, Histoire Particulière des Plantes Orchidées: 72, 1822. Synonyms. Gussonea aphylla A.Rich., Mémoires de la Société d'Histoire Naturelle de Paris 4: 68, 1828. Saccolabium aphyllum Lindl., Genera and Species of Orchidaceous Plants: 223, 1833. Mystacidium aphyllum T.Durand & Schinz, Conspectus Florae Africae 5: 51, 1894. Rhaphidorhynchus aphyllus Finet, Mémoires de la Société Botanique de France, Paris 9: 35, 1907. Angraecum defoliatum Schltr., Annales du Musee d'Histoire Naturelle de Marseille 1: 191, 1913. Gussonea defoliata Schltr., Beihefte zum Botanischen Centralblatt. Kassel 33: 425, 1915. Solenangis aphylla (Thouars) Summerh., Botanical Museum Leaflets 11: 159, 1943.

Microcoelia cornuta (Ridley) Carlsward, comb. nov. Basionym. Gussonea cornuta Ridl., Journal of Botany, London 23: 310, 1885. Synonyms. Angraecum cornutum Rchb.f, Flora 68: 538, 1885. Angraecum cyclochilum Schltr., Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 38: 160, 1906. Rhaphidorhynchus cornutus Finet, Mémoires de la Société Botanique de France, Paris 9: 34, 1907. Solenangis cornuta (Ridl.) Summerh., Botanical Museum Leaflets 11: 160. APPENDIX PARALOGY IN VANDEAE

The ITS gene regions have been some of the most popular for use in phylogenetic analyses in the past decade. However, it has only been in the past few years that scientists have realized the potential pitfalls of using ITS (Alvarez

& Wendel, 2003; Bailey et al., 2003; Muir et al., 2001). Paralogy in Vandeae has been reported by other workers for the Asian Aeridinae (J. Schulman and A.

Kocyan, personal communication), but has not been reported for other the angraecoid subtribes of Vandeae until now (Table 2-1 contains a list of suspected paralogous taxa).

Angraecinae suspected of possessing paralogous taxa were identified by the large 40 bp indel at the beginning of ITS2. When these taxa were included in

ITS analyses for the entire tribe, their position was weakly supported as sister to the remaining Vandeae (Fig. A-1). This strange topology (in which these

Angraecinae do not form a clade with the remaining Angraecinae) also suggests paralogy.

However, two interesting notes should be made here. First, cloning of

Angraecum calceolus revealed only one copy of the ITS region (whereas most cloning studies of paralogous Vandeae have found multiple copies of ITS). If these sequences truly represent paralogy, then the 17/26SE primers (Table 2-3) used in my reactions were probably preferentially annealing to paralogous ITS

287 288

Figure A-1. Bootstrap consensus tree for ITS data set of all Vandeae. a) Outgroup and orthologous Angraecinae. b) New World Angraecinae plus African species of Angraecum. c) Paralogous clade of Angraecinae. Bootstrap percentages above branches are based on 1000 replicates. 289 copies. To test this hypothesis, different primers (that will bind preferentially to orthologous ITS regions) could be used for future cloning experiments.

More interestingly, the paralogous Angraecinae form a well-supported clade

(87% BS) that is also supported by the combined chloroplast data sets (90% BS,

Fig. 2-12). The primary difference between the topologies of the ITS and chloroplast data sets was the strange sister position of the paralogous

Angraecinae clade to the remaining Vandeae (all Angraecinae formed a monophyletic group sister to Aeridinae using chloroplast data). There are at least two potential explanations for the support of this paralogous clade by chloroplast data. The simplest explanation is that paralogy originated in the ancestor of this clade and was passed on to all of its descendents (which are primarily Malagasy). Alternatively, there could also be some sort of paralogy or polymorphism in the chloroplast data sets (Wolfe & Randle, 2004).

Pseudogenes in matK have been reported in Aeridinae (D. Jarrell, personal communication) and could be present in Angraecinae. However, it seems unlikely that both gene regions (presumably independent of one another) would have independently evolved in the same taxa to give the same gene genealogies.

The ITS and chloroplast gene regions both need further study in

Angraecinae. Cloning of more Angraecinae may reveal multiple copies of ITS

(as found in Aeridinae), which could reveal how paralogy evolved in Vandeae.

Cloning and comparisons of chloroplast data sets may also unravel interesting patterns in gene evolution. LIST OF REFERENCES

Albert VA. 1994. Cladistic relationships of the slipper orchids (Cypripedioideae: Orchidaceae) from congruent morphological and molecular data. Lindleyana 9: 115-132.

Alvarez I, Wendel JF. 2003. Ribosomal ITS sequences and plant phylogenetic inference. Molecular Phylogenetics and Evolution 29: 417-434.

Arends JC, Stewart J. 1989. Aerangis gracillima: a definitive account of a rare African orchid of and . Lindleyana 4: 23-29.

Arends JC, Van der Burg WJ, Van der Laan FM. 1980. Notes on African orchids. In: Arends JC and Wit HCDd, eds. Liber gratulatorius in honorem H.C.D. de Wit. Wageningen, The Netherlands: H. Veenman & Zonen. 449.

Arends JC, Van der Laan FM. 1983. Cytotaxonomy of the monopodial orchids of the African and Malagasy regions. Genetica 62: 81-94.

Arends JC, Van der Laan FM. 1986. Cytotaxonomy of the Vandeae. Lindleyana 1: 33-41.

Atwood JT. 1986. The size of the Orchidaceae and the systematic distribution of epiphytic orchids. Selbyana 9: 171-186.

Bailey CD, Carr TG, Harris SA, Hughes CE. 2003. Characterization of angiosperm nrDNA polymorphism, paralogy, and pseudogenes. Molecular Phylogenetics and Evolution 29: 435-455.

Barthlott W. 1981. Epidermal and seed surface characters of plants: systematic applicability and some evolutionary aspects. Nordic Journal of Botany 1: 345-355.

Bentham G. 1881. Notes on Orchideae. Journal of the Linnean Society. Botany. 18: 281-360.

Benzing DH, Friedman WE, Peterson G, Renfrow A. 1983. Shootlessness, velamentous roots, and the pre-eminence of Orchidaceae in the epiphytic biotope. American Journal of Botany 70: 121-133.

Benzing DH, Ott DW. 1981. Vegetative reduction in epiphytic Bromeliaceae and Orchidaceae: its origin and significance. Biotropica 13: 131-140.

290 291

Benzing DH, Ott DW, Friedman WE. 1982. Roots of (Orchidaceae): structure and function of the velamen-exodermis complex. American Journal of Botany 69: 608-614.

Blattner FR. 1999. Direct amplification of the entire ITS region from poorly preserved plant material using recombinant PCR. BioTechniques 27: 1180-1186.

Brummitt RK, Powell CE. 1992. Authors of plant names. Kew, United Kingdom: Royal Botanic Gardens.

Burns-Balogh P, Funk VA. 1986. A phylogenetic analysis of the Orchidaceae. Smithsonian Contributions to Botany 61: 1-79.

Burr B, Barthlott W. 1991. On a velamen-like tissue in the root cortex of orchids. Flora 185: 313-323.

Cameron KM. 2001. An expanded phylogenetic analysis of Orchidaceae using three plastid genes: rbcL, atpB, and psaB. American Journal of Botany 88: 104.

Cameron KM, Chase MW, Whitten WM, Kores PJ, Jarrell DC, Albert VA, Yukawa T, Hills HG, Goldman DH. 1999. A phylogenetic analysis of the Orchidaceae: evidence from rbcL nucleotide sequences. American Journal of Botany 86: 208-224.

Carlsward BS, Stern WL, Judd WS, Lucansky TW. 1997. Comparative leaf anatomy and systematics in Dendrobium, sections Aporum and Rhizobium (Orchidaceae). International Journal of Plant Sciences 158: 332-342.

Carlsward BS, Whitten WM, Williams NH. 2003. Molecular phylogenetics of neotropical leafless Angraecinae (Orchidaceae): reevaluation of generic concepts. International Journal of Plant Sciences 164: 43-51.

Charard R. 1963. Contributions a l'étude cyto-taxonomique des Orchidées. Revue de Cytologie et de Biologie Végétales 26: 1-58.

Chase M, Freudenstein JV, Cameron KM. 2003. DNA data and Orchidaceae systematics: a new phylogenetic classification. In: Dixon KW, Kell SP, Barrett RL and Cribb PJ, eds. Orchid conservation. Kota Kinabalu, : Natural History Publications. 69-89.

Cheadle VI, Kosakai H. 1982. The occurrence and kinds of vessels in Orchidaceae. Phyta (India), Studies on Living & Fossil Plants, Plant Commemoration Volume 1982: 45-57. 292

Chiang SHT, Chou T. 1971. Histological studies on the roots of orchids in Taiwan. Taiwania 16: 1-29.

Christenson EA. 2001. Phalaenopsis: a monograph. Portland, Oregon: Timber Press.

Cockburn W, Goh JC, Avadhani PN. 1985. Photosynthetic carbon assimilation in a shootless orchid, Chiloschista usneoides (Don) Lindl. Plant Physiology 77: 83-86.

Cribb P. 1989. Flora of tropical east Africa, Orchidaceae. Rotterdam, The Netherlands: A.A. Balkema.

Curtis KM. 1917. The anatomy of the six epiphytic species of the Orchidaceae. Annals of Botany 31: 133-149.

Das S, Paria N. 1992. Stomatal structure of some Indian orchids with reference to . Bangladesh Journal of Botany 21: 65-72. deQueiroz K. 1996. Including the characters of interest during tree reconstruction and the problems of circularity and bias in studies of character evolution. American Naturalist 148: 700-708.

De Wildeman E. 1916. Additions á la flore du Congo. Bulletin du Jardin Botanique de l'Ètat (Bruxelles) 5: 117-268.

Donoghue MJ, Sanderson MJ. 1992. The suitability of molecular and morphological evidence in reconstructing plant phylogeny. In: Soltis PS, Soltis DE and Doyle JJ, eds. Molecular systematics of plants. New York, New York: Chapman and Hall. 340-368.

Doyle JA, Donoghue MJ, Zimmer EA. 1994. Integration of morphological and ribosomal RNA data on the origin of angiosperms. Annals of the Missouri Botanical Garden 81: 419-450.

Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11-15.

Dressler RL. 1981. The orchids: natural history and classification. Cambridge, Massachusetts: Harvard University Press.

Dressler RL. 1987. Cladistic analysis of the Orchidaceae: a commentary. Lindleyana 2: 66-71.

Dressler RL. 1989. The vandoid orchids: a polyphyletic grade? Lindleyana 4: 89- 93. 293

Dressler RL. 1993. Phylogeny and classification of the orchid family. Portland, Oregon: Dioscorides Press.

Dressler RL, Dodson CH. 1960. Classification and phylogeny in the Orchidaceae. Annals of the Missouri Botanical Garden 47: 25-68.

Dycus AM, Knudson L. 1957. The role of the velamen of the aerial roots of orchids. Botanical Gazette 119: 78-87.

Engard CJ. 1944. Morphological identity of the velamen and exodermis in orchids. Botanical Gazette 105: 457-462.

Esau K. 1958. Plant anatomy. New York, New York: John Wiley & Sons, Inc.

Esau K. 1977. Anatomy of seed plants. New York, New York: John Wiley & Sons.

Foster AS. 1956. Plant idioblasts: remarkable examples of cell specialization. Protoplasma 46: 184-193.

Freudenstein JV, Rasmussen FN. 1999. What does morphology tell us about orchid relationships?-A cladistic analysis. American Journal of Botany 86: 225-248.

Garay LA. 1960. On the origin of the Orchidaceae. Botanical Museum Leaflets, Harvard University 19: 57-95.

Garay LA. 1972a. On the origin of the Orchidaceae II. Journal of the Arnold Arboretum 53: 202-215.

Garay LA. 1972b. On the systematics of the monopodial orchids I. Botanical Museum Leaflets, Harvard University 23: 149-212.

Gasson P, Cribb PJ. 1986. The leaf anatomy of Ossiculum aurantiacum Cribb & van der Laan (Orchidaceae: Vandoideae). Kew Bulletin 41: 827-832.

Givnish TJ, Sytsma KJ. 1997. Homoplasy in molecular vs. morphological data: the likelihood of correct phylogenetic inference. In: Givnish TJ and Sytsma KJ, eds. Molecular evolution and adaptive radiation. New York, New York: Cambridge University Press. 55-101.

Graham SW, Kohn JR, Morton BR, Eckenwalder JE, Barrett SCH. 1998. Phylogenetic congruence and discordance among one morphological and three molecular data sets from Pontederiaceae. Systematic Biology 47: 545-567.

Haberlandt G. 1914. Physiological plant anatomy. London, United Kingdom: Macmillan. 294

Holmgren PK, Holmgren NH, Barnett LC. 1990. Index herbariorum, Part I: the herbaria of the world. New York, New York: New York Botanical Garden.

Holtzmeier MA, Stern WL, Judd WS. 1998. Comparative anatomy and systematics of Senghas's cushion species of (Orchidaceae). Botanical Journal of the Linnean Society 127: 43-82.

Jarrell DC, Clegg MT. 1995. Systematic implications of the chloroplast-encoded matK gene on the tribe Vandeae (Orchidaceae). American Journal of Botany 82: 137.

Jarrell DC, Clegg MT. 1996. Molecular evolution of the nuclear rDNA internal transcribed spacers, ITS1 and ITS2, in the subtribe Aeridinae (Orchidaceae). American Journal of Botany 83: 163-164.

Jeyamurthy A, Dagar JC, Rathore RKS. 1990. Some morphological and anatomical observations on an interesting and rare orchid Chiloschista lunifera (Reichb.f.) J.J.Sm. from Andamans. Journal of the Indian Botanical Society 69: 335-338.

Johnson LA, Soltis DE. 1998. Assessing congruence: empirical examples from molecular data. In: Soltis DE, Soltis PS and Doyle JJ, eds. Molecular systematics of plants II: DNA sequencing. Boston, Massachusetts: Kluwer Academic Publishers. 574pp.

Jones K. 1967. The chromosomes of orchids: II. Kew Bulletin 21: 151-156.

Jonsson L. 1979. New combinations in the African genera Chauliodon and Solenangis (Orchidaceae). Botaniska Notiser 132: 381-384.

Jonsson L ed. 1981. A monograph of the genus Microcoelia (Orchidaceae). Motala, Sweden: Borgströms Tryckeri AB.

Jost L. 1887. Ein Beitrag zur Kenntniss der Athmungsorgane der Pflanzen. Botanische Zeitung (Berlin) 45: 601-606, 617-628, 633-642.

Källersjö M, Albert VA, Farris JS. 1999. Homoplasy increases phylogenetic signal. Cladistics 15: 91-93.

Kamemoto H. 1965. Chromosomes and species relationships in the Vanda alliance. Singapore, Asia: Straits Times Press.

Kaushik P. 1983. Ecological and anatomical marvels of the Himalayan orchids. New Delhi, India: Today and Tomorrow's Printers and Publishers. 295

Koehler S, Williams NH, Whitten WM, do Amaral MDE. 2002. Phylogeny of the (Orchidaceae) complex based on morphology and sequence data from nuclear rDNA internal transcribed spacers (ITS) and chloroplast trnL-trnF region. International Journal of Plant Sciences 163: 1055-1066.

Kron KA, Judd WS, Stevens PF, Crayn DM, Anderberg AA, Gadek PA, Quinn CJ, Luteyn JL. 2002. Phylogenetic classification of Ericaceae: Molecular and morphological evidence. Botanical Review 68: 335-423.

Leitgeb H. 1864. Die Luftwurzeln der Orchideen. Denkschriften der Kaiserlichen Akademie der Wissenschaften. Mathematischnaturwissenschaftlichen Klasse 24: 179-222.

Lindley J. 1830-1840. The genera and species of orchidaceous plants. London: Ridgways.

Löv L. 1926. Zur Kenntnis der Entfaltungszellen monokotyler Blätter. Flora 120: 283-343.

Maddison DR, Maddison WP. 2000. MacClade 4: Analysis of Phylogeny and Character Evolution. Version 4.06. Sunderland: Sinauer Associates.

Mansfeld R. 1937. Über das System der Orchidaceae-Monandrae. Notizblatt des Botanischen Gartens und Museums zu Berlin-Dahlem 13: 666-676.

Miyamoto MM, Fitch WM. 1995. Testing species phylogenies and phylogenetic methods with congruence. Systematic Biology 44: 64-76.

Mohana Rao PR, Kumari SVL, Khasim SM, Isaiah JM. 1989. Anatomy of some Sikkim Himalayan orchids with reference to their ecological adaptability. Acta Botanica Indica 17: 229-232.

Møller JD, Rasmussen H. 1984. Stegmata in Orchidales: character state distribution and polarity. Botanical Journal of the Linnean Society 89: 53- 76.

Muir G, Fleming CC, Schlotterer C. 2001. Three divergent rDNA clusters predate the species divergence in Quercus petraea (matt.) liebl. and Quercus robur L. Molecular Biology and Evolution 18: 112-119.

Mulay BN, Panikkar TKB. 1956. Origin, development, and structure of velamen in the roots of some species of terrestrial orchids. Proceedings of the Rajasthan Academy of Sciences 6: 31-48.

Nandi OI, Chase MW, Endress PK. 1998. A combined cladistic analysis of angiosperms using rbcL and non-molecular data sets. Annals of the Missouri Botanical Garden 85: 137-212. 296

Neyland R, Urbatsch LE. 1994. Systematics of the advanced Epidendroideae (Orchidaceae). American Journal of Botany 81: 199.

Neyland R, Urbatsch LE. 1996. Phylogeny of subfamily Epidendroideae (Orchidaceae) inferred from ndhF chloroplast gene sequences. American Journal of Botany 83: 1195-1206.

Nseya AM, Arends JC. 1995. Contributions to the anatomy and caryology of Orchidaceae: the genus Cyrtorchis. Bulletin du Muséum National d'Histoire Naturelle, Paris. Section B, Adansonia 17: 75-93.

Olatunji OA, Nengim RO. 1980. Occurrence and distribution of tracheoidal elements in the Orchidaceae. Botanical Journal of the Linnean Society 80: 357-370.

Oliveira VC, Sajo MG. 1999. Anatomia foliar de especies de Orchidaceae. Revista Brasileira de Botanica 22: 365-374.

Perrier de la Bâthie H. 1941. Orchidées. In: Humbert H, ed. Flore de Madagascar, 49 familie. Tananarive, Madagascar: Imprimerie Officielle.

Pfitzer EHH. 1887. Entwurf einer natürlichen Anordnung der Orchideen. Heidelberg, Germany: Carl Winter.

Porembski S, Barthlott W. 1988. Velamen radicum micromorphology and classification of Orchidaceae. Nordic Journal of Botany 8: 117-137.

Pridgeon AM. 1987. The velamen and exodermis of orchid roots. In: Arditti J, ed. Orchid biology. Reviews and perspectives IV. Ithaca, New York: Cornell University Press. 139-192.

Pridgeon AM, Cribb PJ, Chase M, Rasmussen FN. 1999. Genera Orchidacearum. I. General introduction, Apostasioideae, Cypripedioideae. New York, New York: Oxford University Press.

Pridgeon AM, Stern WL, Benzing DH. 1983. Tilosomes in roots of Orchidaceae: morphology and systematic occurrence. American Journal of Botany 70: 1365-1377.

Prychid CJ, Rudall PJ, Gregory M. 2003. Systematics and biology of silica bodies in . Botanical Review 69: 377-440.

Rambout A. 1996. Se-Al: Sequence Alignment editor, v2.0a11. Published on the internet by the author; http://evolve.zoo.ox.ac.uk/! [accessed on 8 August 2002!]!!.

Rasmussen FN. 1986a. On the various contrivances by which pollinia are attached to viscidia. Lindleyana 1: 21-32. 297

Rasmussen FN. 1986b. An aspect of orchid anatomy and adaptationism. Lindleyana 1: 102-107.

Richard A. 1828. Monographie des Orchidées des Iles de France et de Bourbon. Mémoires de la Société d' Histoire Naturelle de Paris 4: 1-83.

Royal Botanic Gardens, Kew. 2003. World checklist of monocots. Published on the internet by the author; http://www.rbgkew.org.uk/monocotChecklist/! [accessed on 25 February 2004!]!!.

Rudall PJ, Chase MW, Cutler DF, Rusby J, De Bruijn AY. 1998. Anatomical and molecular systematics of Asteliaceae and Hypoxidaceae. Botanical Journal of the Linnean Society 127: 1-42.

Sagawa Y. 1962. Cytological studies of the genus Phalaenopsis. American Orchid Society Bulletin 31: 459-465.

Sakharam Rao J. 1953. Role of velamen tissue in roots of orchids. Science and Culture 19: 97-99.

Sanford WW, Adanlawo I. 1973. Velamen and exodermis characters of West African epiphytic orchids in relation to taxonomic grouping and habitat tolerance. Botanical Journal of the Linnean Society 66: 307-321.

Schimper AFW. 1888. Die epiphytische Vegetation Amerikas. Jena, Germany: Gustav Fischer.

Schlechter R. 1918. Versuch einer natürlichen Neuordnung der afrikanischen agraekoiden Orchidaceen. Beihefte zum Botanischen Centralblatt. Abt. II. 36: 62-181.

Schlechter R. 1926. Das System der Orchidaceen. Notizblatt des Botanischen Gartens und Museums zu Berlin-Dahlem 9: 563-591.

Scotland RW, Olmstead RG, Bennett JR. 2003. Phylogeny reconstruction: the role of morphology. Systematic Biology 52: 539-548.

Senghas K. 1985. Cribbia und Microterangis, zwei neue Orchideen Gattungen. Die Orchidee 36: 19-22.

Senghas K. 1986. Rhipidoglossum. Die Orchidee 18: 1110-1112.

Sheahan MC, Chase MW. 1996. A phylogenetic analysis of Zygophyllaceae R.Br. based on morphological, anatomical and rbcL DNA sequence data. Botanical Journal of the Linnean Society 122: 279-300.

Shindo K, Kamemoto H. 1963. Karyotype analysis of some Sarcanthine orchids. American Journal of Botany 50: 73-79. 298

Singh H. 1986. Anatomy of root in some Orchidaceae. Acta Botanica Indica 14: 24-32.

Smith JF, Sytsma KJ. 1994. Molecules and morphology: congruence of data in Columnea (Gesneriaceae). Plant Systematics and Evolution 193: 37-52.

Solereder H, Meyer FJ. 1930. Systematic anatomy of the monocotyledons. VI. Microspermae. Jerusalem, Israel: Israel Program for Scientific Translations.

Soltis DE, Soltis PS, Mort ME, Chase MW, Savolainen V, Hoot SB, Morton CM. 1998. Inferring complex phylogenies using parsimony: an empirical approach using three large DNA data sets for angiosperms. Systematic Biology 47: 32-42.

Stern WL, Carlsward BS. 2004. Vegetative constants in the anatomy of epiphytic orchids. The Orchid Review 112: 119-122.

Stern WL, Judd WS. 2000. Comparative anatomy and systematics of the orchid tribe Vanilleae excluding Vanilla. Botanical Journal of the Linnean Society 134: 179-202.

Stern WL, Judd WS. 2001. Comparative anatomy and systematics of (Orchidaceae). Botanical Journal of the Linnean Society 136: 153-178.

Stern WL, Judd WS. 2002. Systematic and comparative anatomy of Cymbidieae (Orchidaceae). Botanical Journal of the Linnean Society 139: 1-27.

Storey WB. 1952. Chromosome numbers of some Vanda species and hybrids. American Orchid Society Bulletin 21: 801-806.

Storey WB, Kamemoto H, Shindo K. 1963. Chromosomes of Vanda spathulata and its hybrids. American Orchid Society Bulletin 32: 703-709.

Sulistiarini D. 1986. Leaf anatomy and the taxonomy status of Luisia latipetala. Berita Biologi 3: 143-145.

Summerhayes VS. 1936. African Orchids: VIII. Bulletin of Miscellaneous Information (Royal Botanic Gardens, Kew) 1936: 221-233.

Summerhayes VS. 1942. African Orchids. XII. Botanical Museum Leaflets (Harvard University) 10: 257.

Summerhayes VS. 1943. African Orchids. XIII. Botanical Museum Leaflets (Harvard University) 11: 137-170.

Summerhayes VS. 1960. African Orchids: XXVII. Kew Bulletin 14: 126-157. 299

Summerhayes VS. 1966. African Orchids: XXX. Kew Bulletin 20: 165-199.

Sun Y, Skinner DZ, Liang GH, Hulbert SH. 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics 89: 26-32.

Swofford DL. 1999. PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4.0b10. Sunderland, Massachusettts: Sinauer Associates.

Szlachetko DL. 1995. Systema Orchidalium. Fragmenta Floristica et Geobotanica Supplementum 3: 1-152.

Taberlet P, Gielly L, Pautou G, Bouvet J. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109.

Tara M, Kamemoto H. 1970. Karyotype relationships in Sarcanthinae (Orchidaceae). American Journal of Botany 57: 176-&.

Toscano de Brito ALV. 1996. The use of concentrated ammonia as an excellent medium for the restoration of orchid pollinaria: an example from the subtribe Ornithocephalinae (Orchidaceae). Lindleyana 11: 205-210.

Vermeulen P. 1966. The system of the Orchidales. Acta Botanica Neerlandica 15: 224-253.

Wendel JF, Doyle JJ. 1998. Phylogenetic incongruence: window into genome history and molecular evolution. In: Soltis DE, Soltis PS and Doyle JJ, eds. Molecular systematics of plants II: DNA sequencing. Boston, Massachusetts: Kluwer Academic Publishers. 265-296.

Whitten MW, Williams NH, Chase MW. 2000. Subtribal and generic relationships of Maxillarieae (Orchidaceae) with emphasis on : combined molecular evidence. American Journal of Botany 87: 1842-1856.

Williams NH. 1979. Subsidiary cells in the Orchidaceae: their general distribution with special reference to development in the Oncidieae. Botanical Journal of the Linnean Society 78: 41-66.

Withner CL, Nelson PK, Wejksnora PJ. 1974. The anatomy of orchids. In: Withner CL, ed. The orchids: scientific studies. New York, New York: John Wiley & Sons. 267-347.

Wolfe AD, Randle CP. 2004. Recombination, heteroplasmy, haplotype, polymorphism, and paralogy in plastid genes: implications for plant molecular systematics. Systematic Botany 29: 1011-1020. 300

Woodard JW. 1951. Some chromosome numbers in Phalaenopsis. American Orchid Society Bulletin 20: 356-358.

Ziegler B. 1981. Mikromorphologie der Orchideensamen unter Berücksichtigung taxonomischer Aspekte. Heidelberg: Ruprecht Karls Universität. BIOGRAPHICAL SKETCH

Barbara Sue Carlsward was born in Vero Beach, Florida, on February 7,

1971. She graduated from Vero Beach High School in 1989, and started her undergraduate career at the University of Florida later that same year. In 1993, she earned her Bachelor of Science degree in physics with a minor in Russian language studies. After completing her degree in physics, Barbara enrolled in several zoology and botany courses for 1 year as a postbaccalaureate student, while working for William Louis Stern. Because of Dr. Stern’s positive influence,

Barbara decided on a career in botany and began her graduate program in 1994.

After completing her master’s degree in 1996, Barbara was admitted to the

University of California at Santa Barbara to earn her doctoral degree. After 3 years of turmoil with the Department of Ecology, Evolution and Marine Biology,

Barbara returned to the University of Florida to finish her degree with Dr. Stern.

She received her doctoral degree in December, 2004, and hopes to teach at a small liberal arts college.

301