Multiplex Image-Based Autophagy Rnai Screening Identifies SMCR8
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Anti-Rab11 Antibody (ARG41900)
Product datasheet [email protected] ARG41900 Package: 100 μg anti-Rab11 antibody Store at: -20°C Summary Product Description Goat Polyclonal antibody recognizes Rab11 Tested Reactivity Hu, Ms, Rat, Dog, Mk Tested Application IHC-Fr, IHC-P, WB Host Goat Clonality Polyclonal Isotype IgG Target Name Rab11 Antigen Species Mouse Immunogen Purified recombinant peptides within aa. 110 to the C-terminus of Mouse Rab11a, Rab11b and Rab11c (Rab25). Conjugation Un-conjugated Alternate Names RAB11A: Rab-11; Ras-related protein Rab-11A; YL8 RAB11B: GTP-binding protein YPT3; H-YPT3; Ras-related protein Rab-11B RAB25: RAB11C; CATX-8; Ras-related protein Rab-25 Application Instructions Application table Application Dilution IHC-Fr 1:100 - 1:400 IHC-P 1:100 - 1:400 WB 1:250 - 1:2000 Application Note IHC-P: Antigen Retrieval: Heat mediation was recommended. * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Hepa cell lysate Calculated Mw 24 kDa Observed Size ~ 26 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS, 0.05% Sodium azide and 20% Glycerol. Preservative 0.05% Sodium azide www.arigobio.com 1/3 Stabilizer 20% Glycerol Concentration 3 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. -
Analysis of Trans Esnps Infers Regulatory Network Architecture
Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation. -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
Replace This with the Actual Title Using All Caps
UNDERSTANDING THE GENETICS UNDERLYING MASTITIS USING A MULTI-PRONGED APPROACH A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Asha Marie Miles December 2019 © 2019 Asha Marie Miles UNDERSTANDING THE GENETICS UNDERLYING MASTITIS USING A MULTI-PRONGED APPROACH Asha Marie Miles, Ph. D. Cornell University 2019 This dissertation addresses deficiencies in the existing genetic characterization of mastitis due to granddaughter study designs and selection strategies based primarily on lactation average somatic cell score (SCS). Composite milk samples were collected across 6 sampling periods representing key lactation stages: 0-1 day in milk (DIM), 3- 5 DIM, 10-14 DIM, 50-60 DIM, 90-110 DIM, and 210-230 DIM. Cows were scored for front and rear teat length, width, end shape, and placement, fore udder attachment, udder cleft, udder depth, rear udder height, and rear udder width. Independent multivariable logistic regression models were used to generate odds ratios for elevated SCC (≥ 200,000 cells/ml) and farm-diagnosed clinical mastitis. Within our study cohort, loose fore udder attachment, flat teat ends, low rear udder height, and wide rear teats were associated with increased odds of mastitis. Principal component analysis was performed on these traits to create a single new phenotype describing mastitis susceptibility based on these high-risk phenotypes. Cows (N = 471) were genotyped on the Illumina BovineHD 777K SNP chip and considering all 14 traits of interest, a total of 56 genome-wide associations (GWA) were performed and 28 significantly associated quantitative trait loci (QTL) were identified. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human. -
Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks
906 • The Journal of Neuroscience, January 25, 2017 • 37(4):906–921 Systems/Circuits Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks X Laurence D. Picton, XFilipe Nascimento, XMatthew J. Broadhead, XKeith T. Sillar, and XGareth B. Miles School of Psychology and Neuroscience, University of St Andrews, St Andrews KY16 9JP, United Kingdom Ubiquitously expressed sodium pumps are best known for maintaining the ionic gradients and resting membrane potential required for generating action potentials. However, activity- and state-dependent changes in pump activity can also influence neuronal firing and regulate rhythmic network output. Here we demonstrate that changes in sodium pump activity regulate locomotor networks in the spinal cord of neonatal mice. The sodium pump inhibitor, ouabain, increased the frequency and decreased the amplitude of drug-induced locomotor bursting, effects that were dependent on the presence of the neuromodulator dopamine. Conversely, activating the pump with the sodium ionophore monensin decreased burst frequency. When more “natural” locomotor output was evoked using dorsal-root stimulation, ouabain increased burst frequency and extended locomotor episode duration, whereas monensin slowed and shortened episodes. Decreasing the time between dorsal-root stimulation, and therefore interepisode interval, also shortened and slowed activity, suggesting that pump activity encodes information about past network output and contributes to feedforward control of subsequent locomotor bouts. Using whole-cell patch-clamp recordings from spinal motoneurons and interneurons, we describe a long-duration (ϳ60 s), activity-dependent, TTX- and ouabain-sensitive, hyperpolarization (ϳ5 mV), which is mediated by spike-dependent increases in pump activity. The duration of this dynamic pump potential is enhanced by dopamine. -
Genome-Wide Rnai Screening Identifies Human Proteins with A
RESOURCES Genome-wide RNAi screening identifies human proteins with a regulatory function in the early secretory pathway Jeremy C. Simpson1,7, Brigitte Joggerst2, Vibor Laketa2, Fatima Verissimo2, Cihan Cetin2, Holger Erfle2,6, Mariana G. Bexiga1, Vasanth R. Singan1, Jean-Karim Hériché3, Beate Neumann3, Alvaro Mateos2, Jonathon Blake4, Stephanie Bechtel5, Vladimir Benes4, Stefan Wiemann5, Jan Ellenberg2,3 and Rainer Pepperkok2,7 The secretory pathway in mammalian cells has evolved to facilitate the transfer of cargo molecules to internal and cell surface membranes. Use of automated microscopy-based genome-wide RNA interference screens in cultured human cells allowed us to identify 554 proteins influencing secretion. Cloning, fluorescent-tagging and subcellular localization analysis of 179 of these proteins revealed that more than two-thirds localize to either the cytoplasm or membranes of the secretory and endocytic pathways. The depletion of 143 of them resulted in perturbations in the organization of the COPII and/or COPI vesicular coat complexes of the early secretory pathway, or the morphology of the Golgi complex. Network analyses revealed a so far unappreciated link between early secretory pathway function, small GTP-binding protein regulation, actin cytoskeleton organization and EGF-receptor-mediated signalling. This work provides an important resource for an integrative understanding of global cellular organization and regulation of the secretory pathway in mammalian cells. Within higher eukaryotic cells membrane traffic pathways connect the Extensive efforts over many years have revealed a significant number various membrane-bounded organelles, thereby ensuring that they of regulators associated with the secretory pathway. Early biochemical retain the correct complement of proteins and lipids to maintain approaches to identify individual machinery components have started cellular homeostasis. -
Four-Dimensional Live Imaging of Apical Biosynthetic Trafficking Reveals a Post-Golgi Sorting Role of Apical Endosomal Intermediates
Four-dimensional live imaging of apical biosynthetic trafficking reveals a post-Golgi sorting role of apical endosomal intermediates Roland Thuenauera,b,1,2, Ya-Chu Hsua, Jose Maria Carvajal-Gonzaleza,3, Sylvie Debordea,4, Jen-Zen Chuanga, Winfried Römerc,d, Alois Sonnleitnerb, Enrique Rodriguez-Boulana,5, and Ching-Hwa Sunga,5 aMargaret M. Dyson Vision Research Institute, Weill Medical College of Cornell University, New York, NY 10065; bCenter for Advanced Bioanalysis Linz, 4020 Linz, Austria; and cInstitute of Biology II, and dBIOSS Centre for Biological Signalling Studies, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany Edited by Keith E. Mostov, University of California School of Medicine, San Francisco, CA, and accepted by the Editorial Board January 17, 2014 (received for review March 11, 2013) Emerging data suggest that in polarized epithelial cells newly is an important regulator of biological processes that require synthesized apical and basolateral plasma membrane proteins apical trafficking, e.g., lumen formation during epithelial tubu- traffic through different endosomal compartments en route to the logenesis (11), apical secretion of discoidal/fusiform vesicles in respective cell surface. However, direct evidence for trans-endo- bladder umbrella cells (12), and apical microvillus morphogenesis somal pathways of plasma membrane proteins is still missing and and rhodopsin localization in fly photoreceptors (13). However, the mechanisms involved are poorly understood. Here, we imaged despite the physiological importance of trans-endosomal traf- the entire biosynthetic route of rhodopsin-GFP, an apical marker in ficking, the underlying mechanisms remain largely unclear. epithelial cells, synchronized through recombinant conditional ag- Previous studies on trans-endosomal trafficking in polarized gregation domains, in live Madin-Darby canine kidney cells using epithelial cells have relied on pulse chase/cell fractionation pro- spinning disk confocal microscopy. -
Exophilin-5 Regulates Allergic Airway Inflammation by Controlling IL-33–Mediated Th2 Responses
The Journal of Clinical Investigation RESEARCH ARTICLE Exophilin-5 regulates allergic airway inflammation by controlling IL-33–mediated Th2 responses Katsuhide Okunishi,1 Hao Wang,1 Maho Suzukawa,2,3 Ray Ishizaki,1 Eri Kobayashi,1 Miho Kihara,4 Takaya Abe,4,5 Jun-ichi Miyazaki,6 Masafumi Horie,7 Akira Saito,7 Hirohisa Saito,8 Susumu Nakae,9 and Tetsuro Izumi1 1Laboratory of Molecular Endocrinology and Metabolism, Department of Molecular Medicine, Institute for Molecular and Cellular Regulation, Gunma University, Maebashi, Japan. 2National Hospital Organization Tokyo National Hospital, Tokyo, Japan. 3Division of Respiratory Medicine and Allergology, Department of Medicine, Teikyo University School of Medicine, Tokyo, Japan. 4Laboratory for Animal Resource Development and 5Genetic Engineering, RIKEN Center for Biosystems Dynamics Research, Kobe, Japan. 6Institute of Scientific and Industrial Research, Osaka University, Osaka, Japan. 7Department of Respiratory Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan. 8Department of Allergy and Clinical Immunology, National Research Institute for Child Health and Development, Tokyo, Japan. 9Laboratory of Systems Biology, Center for Experimental Medicine and Systems Biology, Institute of Medical Science, The University of Tokyo, Tokyo, Japan. A common variant in the RAB27A gene in adults was recently found to be associated with the fractional exhaled nitric oxide level, a marker of eosinophilic airway inflammation. The small GTPase Rab27 is known to regulate intracellular vesicle traffic, although its role in allergic responses is unclear. We demonstrated that exophilin-5, a Rab27-binding protein, was predominantly expressed in both of the major IL-33 producers, lung epithelial cells, and the specialized IL-5 and IL-13 producers in the CD44hiCD62LloCXCR3lo pathogenic Th2 cell population in mice. -
Rab27a Co-Ordinates Actin-Dependent Transport by Controlling Organelle-Associated Motors and Track Assembly Proteins
ARTICLE https://doi.org/10.1038/s41467-020-17212-6 OPEN Rab27a co-ordinates actin-dependent transport by controlling organelle-associated motors and track assembly proteins Noura Alzahofi1,10, Tobias Welz2,10, Christopher L. Robinson1, Emma L. Page1, Deborah A. Briggs1, Amy K. Stainthorp 1, James Reekes1, David A. Elbe1, Felix Straub2, Wouter W. Kallemeijn 3, Edward W. Tate 3, Philip S. Goff 4, Elena V. Sviderskaya 4, Marta Cantero5,6, Lluis Montoliu 5,6, ✉ Francois Nedelec7, Amanda K. Miles 8, Maryse Bailly 9, Eugen Kerkhoff2 & Alistair N. Hume 1 1234567890():,; Cell biologists generally consider that microtubules and actin play complementary roles in long- and short-distance transport in animal cells. On the contrary, using melanosomes of melanocytes as a model, we recently discovered that the motor protein myosin-Va works with dynamic actin tracks to drive long-range organelle dispersion in opposition to micro- tubules. This suggests that in animals, as in yeast and plants, myosin/actin can drive long- range transport. Here, we show that the SPIRE-type actin nucleators (predominantly SPIRE1) are Rab27a effectors that co-operate with formin-1 to generate actin tracks required for myosin-Va-dependent transport in melanocytes. Thus, in addition to melanophilin/myosin- Va, Rab27a can recruit SPIREs to melanosomes, thereby integrating motor and track assembly activity at the organelle membrane. Based on this, we suggest a model in which organelles and force generators (motors and track assemblers) are linked, forming an organelle-based, cell-wide network that allows their collective activity to rapidly disperse the population of organelles long-distance throughout the cytoplasm.