JOURNAL of NEMATOLOGY Effector Gene Vap1 Based DGGE

JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2018-055 Issue 4 | Vol. 50

Effector gene vap1 based DGGE fingerprinting to assess variation within and among Heterodera schachtii populations

Rasha Haj Nuaima,1,2 Johannes Roeb,3 Johannes Hallmann,3 Matthias Daub,4 Sandra Otte5 and Abstract 1 Holger Heuer * Populations of beet cyst nematodes Heterodera schachtii vary in 1Julius Kühn-Institut, Federal aggressiveness and virulence toward sugar beet varieties, but also Research Centre for Cultivated in traits like host range, or decline rate in the field. Diversity of their Plants, Institute for Epidemiology essential pathogenicity gene vap1 is shaped by diversifying selection and Pathogen Diagnostics, and gene flow. The authors developed a technique to study inter- Messeweg 11-12, 38104 Braun- population variation and intra-population diversity and dynamics of H. schweig, Germany. schachtii based on the gene vap1. Degenerate primers were designed to amplify, clone, and sequence this gene from diverse species and 2 Department of Plant Protection, populations of cyst nematodes. This resulted in a high diversity of Faculty of Agriculture, Euphrates sequences for H. schachtii, and allowed to design non-degenerated University, Syria. primers to amplify a fragment suitable for sequence dependent 3Julius Kühn-Institut, Federal separation of gene variants in denaturing gradient gel electrophoresis Research Centre for Cultivated (DGGE). The developed primers span a highly variable intron and Plants, Institute for Epidemiology part of a slightly variable exon. A marker comprised of the 14 mostly and Pathogen Diagnostics, detected gene variants was established for gel-to-gel comparisons. For Toppheideweg 88, 48161 Münster, individual juveniles up to six gene variants were resolved and substantial Germany. variation within and among cysts was observed. A fast and easy DNA

4 extraction procedure for 20 pooled cysts was established, which Julius Kühn-Institut, Federal provided DGGE patterns with high similarity among replicate samples Research Centre for Cultivated from field populations. Permutation tests on pairwise similarities within Plants, Institute for Plant Protec- and among populations showed significant differences among vap1 tion in Field Crops and Grassland, patterns of field populations of H. schachtii. Similarly, gene diversity Dürener Str. 71, 50189 Elsdorf, as expressed by the Shannon index was statistically different among Germany. field populations. In conclusion, the DGGE technique is a fast and – 5Strube Research GmbH & Co. KG, compared to sequencing approaches – inexpensive tool to compare Hauptstraße 1, 38387 Söllingen, populations of H. schachtii and link observed biological characteristics Germany. to genetic pattern. *E-mail: holger.heuer@julius-kuehn. de. Key words Beet cyst nematode, Genetic fingerprinting technique, Heterodera This paper was edited by Axel schachtii, Method, Electrophoresis, vap1 gene, Venom allergen like Elling. protein. Received for publication May 24, 2018.

The beet cyst nematode Heterodera schachtii caus- cultivars (Müller, 1999; Curto, 2008). As previous es considerable economic losses in sugar beet (Beta studies indicated, H. schachtii is an inconsistent fac- vulgaris) production. Annual losses are estimated to tor in the plant-parasite interaction, since geographic reach about 95 million dollars in the EU alone (Müller, populations can vary quite substantial in their aggres- 1999). Current control strategies include wide rota- siveness and virulence toward sugar beet varieties tions with non-host crops, the use of nematode re- (Müller, 1992; Griffin, 1981), and may differ in other sistant or tolerant sugar beet cultivars and cover crop- biological traits like host range, hatching dynamics, ping with resistant oilseed radish or white mustard or natural decline rate in the field (Griffin, 1981, 1982,

1 © The Society of Nematologists 2018. Effector gene vap1 based DGGE fingerprinting to assess variation within and among Heterodera schachtii populations

1988). Underlying these differences is the genetic a molecular technique to separate pooled DNA frag- variation within and among local populations (Griffin, ments of the same length but with different sequenc- 1982; Müller, 1998). Thus, a better knowledge of the es (Muyzer and Smalla, 1998). For example, DGGE population genetics in H. schachtii is of importance in fingerprints utilizing the variation of the effector gene understanding population dynamics and spread, and msp1 have been successfully applied to analyze the would finally contribute to a better nematode man- genetic heterogeneity of Meloidogyne incognita pop- agement (Kaplan et al., 1999; Plantard and Porte, ulations from different regions (Adam et al., 2014). The 2004). Previous studies on the genetic structure of homologue of the msp1 gene in Meloidogyne is the H. schachtii populations applied microsatellite markers venom allergen-like protein gene vap1 in cyst nema- on individual nematodes (Plantard and Porte, 2004; todes (McCarter et al., 2003). It belongs to the SCP/ Montarry et al., 2015; Gracianne et al., 2016; Kim et al., TAPS family coding for proteins, which are secreted 2016). However, for practical reasons not enough in- by all mammals-parasitic and plant-parasitic nema- dividual specimen can be analyzed to get a sufficient todes (Jasmer et al., 2003; Cantacessi et al., 2009). representation of populations of plant-parasitic nem- SCP/TAPS proteins include several molecules that atodes, which can reach several billion individuals per are major players in host-pathogen interactions (Can- hectare in infested areas (Plantard and Porte, 2004). tacessi et al., 2009). Vap1 of cyst nematodes are pro- Thus, the development of an appropriate genetic duced in the nematode gland cells and are expressed marker will help to unravel the genetic structure of in the early stages of the parasitism process (Gao et al., H. schachtii populations on the scale of fields and 2001; Lozano-Torres et al., 2014). The molecular tar- landscapes. Two elements have to be considered get of Vap1 in the plant cell is an extracellular matrix, when choosing the molecular genetic markers, the including the hubs in the plant basal immunity like DNA regions of interest and the molecular technique the apoplastic papain-like cysteine and subtilisin-like used to detect the corresponding genetic variation serine proteases (Müller, 1980; Misas-Villamil et al., (Chenuil and Anne, 2006). A polymorphic DNA region 2016). Since the components of the plant extracellu- is required to allow sufficient genetic discrimination at lar matrix are diversified in their structure and biolog- the intraspecific and interspecific levels without exhib- ical activity (Aumailley and Gayraud, 1998), it is likely iting null alleles caused by non-binding of PCR prim- that the gene coding for the effector protein Vap1 ex- ers (Chenuil and Anne, 2006). The appropriateness of hibits genetic variation among the species and pop- the molecular technique used to explore the variation ulations of cyst nematodes. It was hypothesized that in the DNA sequences is considered by the level of variation in vap1 can be used to distinguish popula- resolution of the genetic variability, the statistical anal- tions of H. schachtii. The objective of this study was ysis available for the technique and both the time and to evaluate the potential of PCR-DGGE fingerprinting cost of materials (Patricia et al., 1998). Within this re- based on the vap1 effector gene to characterize the spect, mitochondrial DNA markers like MT-CO1 are genetic variation within and among populations of of limited use as they represent a single locus that in H. schachtii. most cases is maternally inherited, and only allow to distinguish species, not populations (Johnson et al., Materials and methods 2006). Microsatellites are often used as markers in population genetics of higher organisms, but their iso- Origin of nematode populations lation appears to be difficult for many invertebrates, including plant-parasitic nematodes (Castagnone- In total, 66 populations of cyst nematodes represent- Sereno et al., 2010). In addition, the development ing six species were obtained from different locations of such operational microsatellite markers requires in Germany, France, and Norway (Table 1). The mo- considerable time and efforts and resulting micro- lecular identification at the level of species was con- satellites might end up having null alleles (Meglecz ducted by PCR amplification and sequencing of the et al., 2004). Consequently, markers for studying cytochrome c oxidase subunit I (COI). Thirteen of populations of plant-parasitic nematodes need to be those 66 populations (i.e., Vechelde, Bodenstedt, Titz- specific enough for genetic analyses of hundreds or Kalrath, Hottorf, Artenay, Ingeleben, Söllingen, Peine, thousands of individuals within a population but still Sonnenhof, Vanikum, Acholshausen, Großgoltern, be able to detect differences among populations Köchingen) were collected from soil samples by cen- from different origin. One option could be to pool the trifugal floatation with a MgSO4 solution of 1.28 g/ DNA of a noticeable number of individuals and ana- cm³ (Müller, 1980). Nine out of those 13 populations lyze the variants of a polymorphic genetic region by were previously propagated for two generations on DGGE fingerprinting. DGGE has been developed as oilseed rape (Brassica napus ‘NK-fair’) under green-

2 JOURNAL OF NEMATOLOGY

Table 1. Sampling locations of 66 cyst nematodes populations.

Cyst nematode Number Population/location Origin

Heterodera schachtii 8 Köchingen, Grossgoltern, Lower Saxony/Germany Ingeleben, Peine, Söllingen, Sonnenhof, Vechelde, Bodenstedt Heterodera schachtii 12 Asperden, Hottorf, Münster, North Rhine-Westphalia/Germany Vanikum, Titz-Kalrath Heterodera schachtii 1 Artenay Centre-Val de Loire/France Heterodera schachtii 1 Acholshausen Bavaria/Germany Heterodera betae 1 Asperden North Rhine-Westphalia/Germany Heterodera betae 1 Braunschweig Lower Saxony/Germany Heterodera avenae 1 Münster North Rhine-Westphalia/Germany Heterodera filipjevi 1 Münster North Rhine-Westphalia/Germany Globodera spp. 29 diverse Lower Saxony/Germany Globodera spp. 11 diverse Norway house conditions (20/16°C), starting from either cysts ed by centrifugal flotation as described above. A or second stage juveniles (J2) according to the objec- single cyst from each of the six samples was trans- tive of this study as described below. The nematode ferred into a 1.5 ml tube containing 300 µl 2 mM ZnCl2 materials of the further 53 populations were obtained as hatching solution. Five freshly hatched juveniles from the German institutions of Julius Kühn- Institut in were individually fished from each sample into 1.5 ml Braunschweig, Münster and Elsdorf. tubes containing 10 µl water and squashed with a micro pestle for subsequent DNA extraction (see Preparing the nematode materials for below). The second approach used single cysts de- the molecular study rived from a single cyst propagation. This was done independently for six populations. For each popula- To identify and amplify gene fragments specific for H. tion, composite soil samples of about 2 kg each were schachtii, the vap1 sequence of the six different cyst obtained from sugar beet fields located near Ingel- nematode species had to be determined. To achieve eben, Söllingen, Peine, Sonnenhof and Vanikum, all this aim, 12 populations of H. schachtii originating in Germany, and Artenay in France. Cysts were ex- from Vechelde, Bodenstedt, Titz-Kalrath, Asperden tracted by centrifugal flotation and a single cyst cul- and 8 ones from Münster, 1 population of H. filipjevi, ture was established for each population on oilseed 1 population of H. avenae, 2 populations of H. betae, rape. Since the single cyst culture failed in case of 12 populations of Globodera pallida, and 28 popula- the Peine population, 10 cysts were used instead for tions of G. rostochiensis were processed. From each propagation. Sixteen weeks after inoculation, two life population the sample of 1 to 10 cysts was used for cycles representing two generations of H. schachtii DNA extraction. Cysts of each sample were squashed were completed. Cysts from each population were with a micro pestle in a 1.5 ml tube containing 20 µl of collected by washing the growth substrate under run- water. ning tap water through a 250-µm aperture sieve. The To study the genetic variation within and among content of the sieve was then transferred to a filter H. schachtii populations, three approaches were fol- paper. Five individual cysts were picked per popula- lowed. For the first approach, single J2 were used tion and separately transferred into 1.5 ml tubes con- that hatched from single cysts collected from six sites taining 20 µl water. Finally, cysts were crushed with a within the same field. The six soil samples were ran- micro pestle for subsequent DNA extraction. domly taken from an infested sugar beet field near The third approach was for testing the DNA patterns Hottorf, Germany. For each sample, one core was of pooled cysts of H. schachtii populations in DGGE taken containing 600 g of soil. Cysts were extract- fingerprinting of vap1, and to achieve this purpose,

3 Effector gene vap1 based DGGE fingerprinting to assess variation within and among Heterodera schachtii populations three populations were selected. Composite soil ware to design degenerate primers of HGvap657f, samples were collected from infested sugar beet HGvap1238r, and HSvap1238r, flanking the vap1 gene fields at Acholshausen, Köchingen and Großgoltern fragments to obtain a PCR-amplicon with an expected in Germany. Cysts were extracted from the soil by size of approx. 600 bp (Table 2). PCR amplification was the above-described centrifugal flotation method. performed in 25 µl volume containing 1 µl template DNA J2 of all three populations were gained by hatching extracted from 1 to 10 cysts, 5x GoTaq buffer, 2.5 mM in 2 mM ZnCl2 using the modified Baermann funnel MgCl2, 0.2 mM deoxynucleoside triphosphates, 0.1 mg/ technique (Baermann, 1917). In total, 240 J2 were ob- ml BSA, 0.6 mM forward primer, 0.3 mM of each reverse tained for the population from Acholshausen, 470 J2 primer, and 1 U GoTaq Flexi polymerase (Promega, for Köchingen, and 740 J2 for Großgoltern. To best Mannheim, Germany). A touchdown PCR was applied conserve the natural variability within a population, to increase the specificity of the primers: 95°C for 5 min, the total of hatched juveniles from each sample was then 10 cycles of 45 sec 95°C, 45 sec 68°C -1°C / used for further propagation on oilseed radish in loess cycle, 90 sec 72°C, then 30 cycles of 45 sec 95°C, substrate. After completing two generations, cysts 45 sec 57°C, 60 sec 72°C, final extension at 72°C for were separated from the loess substrate by washing 5 min, and cooling to 4°C. To confirm the success of the substrate through a 250-µm aperture sieve. Cysts the PCR amplification, 5 µl of the PCR product was collected on the sieve were transferred to filter paper. loaded on a 1.5% (w/v) agarose gel and electropho- To study the gene patterns of pooled cysts for resis was performed at 80 V for 90 min. The agarose each of the three populations, eight replicates of 20 gel was then stained with 0.5 µg/ml ethidium bromide cysts each were collected. Cysts were then soaked and bands were visualized under ultraviolet light. The in 4% sodium hypochlorite (NaOCl) for about 6 min to PCR-amplified vap1 fragments were inserted into the sterilize and clean the outer layer of the cysts. Fol- vector pGEM-T and cloned in Escherichia coli JM109 lowing three washes with distilled water, cysts were high efficiency cells following the protocol provided by transferred into 1.5 ml tubes containing 50 µl water the manufacturer of the TA-cloning kit (Promega, Man- and squeezed with the help of sharp forceps for sub- nheim, Germany). The plasmids carrying a single gene sequent DNA extraction. Additionally, the vap1 pat- fragment were extracted from the bacterial clones us- terns of the single cysts for those three populations ing the Gene JET Plasmid Miniprep kit (Thermo Fish- were analyzed in DGGE. The similar approach was er Scientific, Waltham, MA), and sent for sequencing followed for preparing the single cysts for DNA ex- using vector primers T7 or SP6. A multiple sequence traction, where five single cysts were picked sepa- alignment of the partial regions of the vap1 gene was rately after washing the loess substrate for each pop- created by MUSCLE and Neighbor-Joining tree with ulation and prepared as described above. 1,000 bootstraps using the software of MEGA6 and CLC Main Workbench version 7.8.1. Isolation of nematode genomic DNA For DNA extraction, one volume of lysis buffer con- Development of PCR-DGGE for taining 0.2 M NaCl, 0.2 M Tris-HCl (pH 8.0), 1% (vol/ analyses of vap1 gene variants vol) β-mercaptoethanol, and 0.8 mg/ml proteinase K Based on the sequence alignments of the cloned vap1 (≥30 mAnson Units/mg) was added to one volume of genes and the GenBank accessions, conserved exon the mechanically treated nematode suspension. The regions flanking variable intron regions were identified tubes were incubated in a thermal mixer (Eppendorf, to design non-degenerate primers. Resolving genetic Hamburg, Germany) at 750 rpm and 66°C for two variation in DGGE is enhanced for amplicons being hours. Proteinase K was inactivated in a water bath at less than 500 bp in size and stabilized on one side by 100°C for 5 min. After each incubation step, the tubes a GC-clamp (Myers et al., 1985; Muyzer and Smalla, were centrifuged for 2 min at 13,000 rpm. Lysates 1998). To do so, the primer pair HSvap244f/HSvap548r were stored at −20°C until molecular analyses. was designed to amplify vap1 fragments of approx. 365 bp from plasmid and genomic DNA obtained from Amplification of thevap1 genes of cyst the above mentioned 12 populations of H. schachtii nematode species, cloning and (Table 3). The designed primer pair was also tested sequencing to amplify vap1 gene fragments from genomic DNA of single cysts of H. avenae. For a 25 µl PCR reaction, The GenBank accessions of H. glycines AF374388, H. the master mix was prepared by adding 1 µl of target schachtii CF101080, G. rostochiensis AJ536826, and DNA (5-50 ng) or 1 µl of plasmid DNA with cloned vap1

G. pallida BM416493 were aligned in MEGA6 soft- (20 ng), 5 µl 5x GoTaq buffer, 2.5 mM of MgCl2, 0.2 mM

4 JOURNAL OF NEMATOLOGY

Table 2. Primers to amplify an approx. Table 3. Primers to amplify a vap1 600 bp fragment of the vap1 genes gene fragment of Heterodera spp. for from genomic DNA of Heterodera spp. electrophoretic separation of the PCR and Globodera spp. for sequencing, products by DGGE, and comparison and comparison to the corresponding with the corresponding priming sites in priming sites in vap1 genes of cyst vap1 genes of cyst nematode species. nematode species.

PCR primer or gene Sequence 5¢-3¢ Primer or GenBank Primer or vap1 gene a accession DNA sequence 5¢-3¢ Forward primer AGT TCG TCG ACA ATT HSvap244f TCG GAA GG Forward primer CCA TGC TCT GTT TTG Heterodera schachtii vap1 … ..R … … … … … .. HGvap657f GCW CTT TCT G Heterodera betae vap1 … … … … … … … .. H. glycines AF374388 … … … … … ..T … … . Heterodera filipjevi vap1 … ..A ..T ..C … … … .. H. schachtii CF101080 ..G … … … … ..A … … . Globodera spp. vap1 ..C ..A … ..G ..C W.C G. rostochiensis … .T…C … … ..A … … . … .. AJ536826 Reverse primer clamp- GCC TGG CTC G. pallida BM416493 … ..G ..C … … ..A … … . HSvap548rGCa CAA TGT CCG ATG Reverse primer AGT GGA GGC CCA TGC Heterodera schachtii vap1 … … … … … … … HGvap1238r TTG CTG Heterodera betae vap1 … … … … ..A … … Reverse primer … .TT … … B…….. Heterodera filipjevi vap1 … … … … … … … HSvap1238r Globodera spp. vap1 A….A … … ..C ..A … H. glycines AF374388 … … … … … … …

H. schachtii CF101080 … .TT … … C…….. aDNA sequence of the 5¢GC clamp CGCCCGGGGCG- G. rostochiensis C…TT … … G…….. CGCCCCGGGCGGGGCGGGGGCACGGGGGG; W = A or AJ536826 T, R = A or G. G. pallida BM416493 C…TT … … AC……. pose of studying the genetic structure of Globodera a W = A or T, B = C or G or T; “.” means identical to se- spp. populations (data not shown). quence in first line. deoxynucleoside triphosphates, 4% acetamide (vol/ Data analysis vol), 0.2 mM each of forward and reverse primer and The GelCompar II 6.6 software (Applied Math, Gent, 1 U GoTaq Flexi polymerase (Promega). Cycling con- Belgium) was utilized to create a similarity matrix based ditions for the PCR reaction were as follows: 94°C for on the Pearson correlation coefficient, and to deter- 5 min followed by 35 cycles at 95°C for 30 sec, 54°C mine the Shannon diversity index from DGGE banding for 30 sec and 72°C for 5 min, final extension at 72°C patterns of H. schachtii populations. Comparisons of for 5 min, and cooling to 4°C. DGGE analysis was con- the similarity measures and diversity indices were car- ducted by loading 3-15 µl aliquots of PCR-amplified ried out with PERMTEST (Kropf et al., 2004) and R sta- fragments on a polyacrylamide gel containing denatur- tistical software packages, respectively. ing gradients of 23 to 58%, where 100% denaturants corresponded to 7M urea plus 40% formamide. The

INGENY PhorU2 system (Ingeny, Goes, The Nether- Results lands) was used to run the DGGE gel in 1x Tris-ace- tate-EDTA buffer at 58°C for 16 hr. DGGE profiles were Amplification ofvap1 genes of various cyst visualized by acid silver staining (Heuer et al., 2001). nematodes for sequence determination The multiple sequences obtained from 40 populations of Globodera spp. allowed to design non-degenerate A sequence alignment of published vap1 cDNA clones primers specific to amplifyvap1 fragments for the pur- and expressed sequence tags (ESTs) (GenBank

5 Effector gene vap1 based DGGE fingerprinting to assess variation within and among Heterodera schachtii populations accessions no. AF374388, CF101080, AJ536826, and phisms (variants 3 and 4), or by two substitutions and a BM416493) revealed conserved regions suitable to de- deletion (12 and 13). The PCR products of the 14 vap1 sign degenerate primers (Table 2), which were efficient variants were pooled to generate a vap1 marker for H. to amplify vap1 fragments of about 600 bp from the schachtii, which was used as an external reference in genomic DNA of all cyst nematode species included DGGE profiles ofH. schachtii populations to represent in this study except H. avenae (data not shown). Gene the most frequent gene variants of H. schachtii. DGGE fragments amplified from DNA of the above mentioned fingerprinting of vap1 allowed distinguishing between 12 populations of H. schachtii and from populations of H. schachtii and H. avenae (Fig. 3B). In contrast to the the further cyst nematodes studied here were cloned variants of the vap1 marker of H. schachtii, the gene and sequenced. A collection of 76 vap1 sequences fragments of H. avenae melted earlier in the denatur- was obtained from the cyst nematodes, including one ing gradient. Sequence alignments of the 14 variants sequence of H. filipjevi, five sequences of H. betae, five revealed that the amplified vap1 segment included in- sequences of G. pallida, 20 sequences of H. schachtii, tron and exon regions (Fig. 4A). In the sequence logo, and 45 sequences of G. rostochiensis. The phyloge- the frequency of insertions/deletions and single-nucle- netic analysis of sequence data revealed that the se- otide polymorphisms was higher in the introns than in quence homology of vap1 within the genus is higher the exons. The highly variable intronic sequences of the than among the genera of cyst nematodes studied variants were distant from the GC-clamped primer to here. Furthermore, substantial sequence variation of support separation in DGGE. Interestingly, the translat- vap1 was shown among species of the same genus ed amino acids of the exons revealed sequence differ- (Fig. 1). Sequence variation among the Globodera spe- ences among the 14 gene variants of vap1 (Fig. 4B). cies and populations that originated from Norway and Germany was much lower than among Heterodera Variation of vap1 genes among individuals species and among H. schachtii populations originating from Germany only (Fig. 1). The high variability of from single cysts of H. schachtii vap1 genes among the 20 sequences of H. schachtii Up to six variants of the gene were amplified by as shown in the underlined region of the multiple se- PCR from the genomic DNA of each single J2 of quence alignment provided an indication of the effi- H. schachtii, which appeared as separate bands in ciency of this region as a marker to study the genetic variation within and among populations of H. schachtii (see supplement SD.1).

Development of PCR-DGGE to separate vap1 gene variants of H. schachtii The design of the PCR-DGGE primer pair HSvap244f/ HSvap548r (Table 3) and the corresponding PCR conditions were optimal to amplify the vap1 segments from the plasmid and genomic DNA of H. schachtii. To es- tablish the vap1 marker of H. schachtii, the gene fragments were amplified from the plasmid DNA of the 20 sequenced variants gained from the 12 populations. Six Figure 1: Dendrogram generated clones having similar electrophoretic mobility as oth- from the alignment of amplified and er variants (variants 5 and 6, variants 11 and 13) were sequenced vap1 gene fragments (ca. excluded for better separation of the variants of the 600 bp) of various cyst nematode marker in DGGE. PCR products were slightly varying in species and populations (MUSCLE size around 360 to 380 bp for 12 cloned variants, and alignment and Neighbor-Joining tree around 270 to 290 bp for two variants (Fig. 2A). From with 1,000 bootstraps done with genomic DNA of H. avenae a product of ca. 400 bp was MEGA6). The triangles represent the amplified (Fig. 3A). In the DGGE gradient of 23-58%, 8 vap1 sequences gained from the of 14 vap1 variants obtained from H. schachtii popula- populations of each species. Note that tions could be clearly resolved (Fig. 2B). Variants with there exist two triangles for H. schachtii high similarity in DNA sequence showed similar elec- within which the sequences represent trical mobility. Amplicons with identical electrophoretic higher variability of vap1 genes than for mobility differed only by single-nucleotide polymor- Globodera spp.

6 JOURNAL OF NEMATOLOGY

Figure 2: GC-clamped PCR products amplified from cloned fragments of vap1 genes obtained from populations of Heterodera schachtii originating from Vechelde, Bodenstedt, Titz-Kalrath, Asperden, and Münster. (A) Size separation in 1.5% agarose gel electrophoresis; L: 1 kb ladder. (B) Separation in DGGE; M: marker composed of all 14 fragments.

the DGGE profiles (Fig. 5). DGGE fingerprints of in- level of single cysts. The number and density of the dividual J2 from the same cyst varied markedly. De- electrophoresis bands representing the gene variants spite this internal variation, the vap1 patterns differed varied among most populations. While for the Son- significantly among these cysts derived from the nenhof population two gene patterns were observed, same field population, giving evidence for genetic var- the other studied H. schachtii populations had 3 to 5 iation and gene flow within the Hottorf population of patterns with Artenay being especially heterogeneous H. schachtii. (Fig. 6). The profiles were significantly different among populations of Artenay-Ingeleben, Artenay-Söllingen, Variation and diversity of vap1 genes Ingeleben-Söllingen, Ingeleben-Sonnenhof, Ingele- among H. schachtii populations ben-Vanikum, Söllingen-Sonnenhof, Söllingen-Vani- kum, Peine-Vanikum, Sonnenhof-Vanikum (permuta- We first analyzed the variation ofvap1 genes among tion test on Pearson correlations, P = 0.04, d = 18). six populations of H. schachtii using DNA of single Considering the observed genetic diversity of cysts (Fig. 6). The cysts emerged from a single cyst field populations, we used DNA of 20 pooled cysts propagation posing a strong genetic bottleneck. Nev- for each replicate sample from three populations. The ertheless, the gene pattern varied among the five sin- simple DNA extraction using lysis buffer could be gle cysts of each population, providing an indicator scaled up without problems due to prior cleaning of for the genetic variation within each population at the cyst surfaces by 4% NaOCl. The pattern was highly

7 Effector gene vap1 based DGGE fingerprinting to assess variation within and among Heterodera schachtii populations

Figure 4: Sequence logos of nucleotide sequences (A) and translated protein (B) of 14 vap1 gene variants of Heterodera schachtii in the region used for PCR-DGGE. The exon region included in the gene fragment is underlined. Sequence logos were generated by CLC Main Workbench version (7.8.1).

vap1 patterns. Furthermore, the gene patterns of single cysts for the three populations were analyzed in DGGE and the profiles were significantly different among the populations (permutation test on Pearson correlations, P < 0.001, d = 26). Even though both pro- Figure 3: GC-clamped PCR products files of single cysts and pooled cysts were significant- amplified from the genomic DNA ly different among the populations, the gene pattern of three single cysts of Heterodera of pooled cysts appeared to be more similar than of avenae. (A) 1.5% agarose gel the single cysts for the three populations (Fig. 7). electrophoresis; L: 1 kb ladder. (B) Another way to compare the populations by vap1 DGGE profiles of vap1 gene fragments DGGE fingerprinting is the possibility to quantify the di- of Heterodera avenae from three single versity of gene variants within each of the populations. cysts compared to the distinct gene Within this respect, the calculated vap1 diversity based fragments of Heterodera schachtii in on Shannon index varied significantly among the stud- the marker (L). ied populations, with the population from Großgoltern being more diverse than the populations from fields in similar among all eight replicates for each population Köchingen and Acholshausen (Fig. 8). (Fig. 7). The permutation test on pairwise similarities among populations showed significant differences Discussion among vap1 patterns of the three investigated field populations of H. schachtii (permutation test on Pear- The genetic variability of vap1 allowed differentiation son correlations, P < 0.001, d = 33). The high value within and among populations of H. schachtii by us- of d indicated a high difference of between-popula- ing the PCR-DGGE fingerprinting technique. The de- tion variance and within-population variance of the generate primers amplified thevap1 genes of different

8 JOURNAL OF NEMATOLOGY

Figure 5: Fingerprints of single second stage juveniles from six cysts of of Heterodera schachtii from the field population at Hottorf, North Rhine-Westphalia, Germany. The fingerprints were derived by PCR amplification of vap1 variants and electrophoretic separation by DGGE. The profiles were significantly different among cysts except for cyst2-cyst4, cyst2-cyst5, cyst3-cyst4, cyst4-cyst6 (permutation test on Pearson correlations, p < 0.04, d = 18). M: marker of cloned vap1 variants.

Figure 6: Fingerprints of single cysts from six field populations of Heterodera schachtii analyzed by PCR amplification of vap1 variants and electrophoretic separation in DGGE. M: marker of cloned vap1 variants.

cyst nematode species with about 600 bp in size. onomic range to study population variation without The phylogenetic analysis of the obtained vap1 se- exhibiting null alleles (Lessa, 1992; Li et al., 2010). quences revealed that the amplified gene region Since the mutations distant from the GC-clamped was variable enough to differentiate the species of primer are better detectable in DGGE than those lo- cyst nematodes. Interestingly, the exon region in the cated close to the clamp (Hepburn and Miller, 2008), sequenced gene fragments was about 415 bp and we added the GC-clamp to the reverse primer for op- the variability of the corresponding translated pro- timal separation of the PCR products in DGGE. The tein was higher in populations of H. schachtii than amplified vap1 fragments of single cysts for H. ave- in populations of G. rostochiensis. An explanation nae and H. schachtii highly differed in electrophoret- could be that the host spectrum of G. rostochien- ic mobility in DGGE, thus allowing for differentiation sis is much smaller than for H. schachtii (Castillo, of these species. Since both cyst nematode species 2012). Thus, the parasitism genes modulating the can occur concomitantly in fields where cereals and interaction of nematodes with their host could be sugar beets are rotated, vap1 could be used to distin- less variable in G. rostochiensis than in H. schachtii. guish those two species. Furthermore, the evolutionary forces like mutation DGGE analyses of the variability in the vap1 gene and selection could have been more pronounced in allowed distinction within and among nematode pop- H. schachtii producing several generations per year ulations as shown for H. schachtii. The variation of than in G. rostochiensis with only one generation vap1 within populations of H. schachtii was described per year. at the level of single juveniles. Up to six alleles were Based on the sequence alignments of the Gen- amplified from the DNA of each single juvenile and Bank accessions and the sequenced vap1 genes, appeared as separate bands in DGGE. This putatively non-degenerated primers were designed in the con- is a result of gene duplications which generate redun- served exon regions flanking the variable intronic dant copies of a genetic region on which divergent sequences. The genetic regions amplified by those mutations can act. Gene duplications are referred to primers can be used as a marker across a wide tax- as one of the key factors producing genetic novelty

9 Effector gene vap1 based DGGE fingerprinting to assess variation within and among Heterodera schachtii populations

Figure 7: Fingerprints from three populations of Heterodera schachtii derived by PCR amplification of vap1 variants from DNA of 20 pooled cysts per replicate sample, and electrophoretic separation by DGGE. The profiles were significantly different among all populations (permutation test on Pearson correlations, P < 0.001, d = 33). M: marker of cloned vap1 variants. within and among the populations (Taylor et al., 2001; population because the vap1 patterns in DGGE were Conrad and Antonarakis, 2007). A further factor in- variable. Thus, a large number of individuals from volved in the genetic variation among juveniles within each population had to be investigated. The potential one population as well as among juveniles of a single of DGGE to screen a large number of samples (Myers cyst is the sexual reproduction of H. schachtii, where et al., 1985; Ferris et al., 1996) requires investigating the single female of H. schachtii can be fertilized by the vap1 fingerprints of replicated pooled cysts within more than one male (Plantard and Porte, 2004). This each population. Our results of pooled DNA samples might explain the observed differences in DGGE gene from single juveniles or single cysts showed a high patterns among single cysts generated from a single similarity in DGGE fingerprints and therefore are repre- cyst culture as shown for different populations. sentative for the gene pool of each population. Since To represent the gene pool of a given population accuracy of population genetics increases with sam- and to efficiently compare different populations, it is ple size (Fumagalli, 2013), we consider 8 replicates, important to work with several variants of the vap1 each including approx. 4,000 J2, sufficient to provide gene. However, the gene fragments that have been solid information for comparison of populations. analyzed at the level of single juveniles or single cysts To ease DNA extraction from cysts, cysts were did not represent the whole vap1 fragments of the first incubated in 4% NaOCl to partially dissolve the cyst cuticle. This additional step turned out to be highly efficient in providing a clean suspension of eggs and juveniles and thus saving the costs for DNA purification kits. The gene diversity index is an important indicator to be determined because the genetic diversity plays an essential role in the adaptation of the population and is considered as the raw material of the evolutionary potential of that population (Hughes et al., 2008). The statistical analyses of the calculated Shan- non indices for the diversity of vap1 variants showed significant differences in the gene diversity among the propagated populations. In general, a reduction in the Figure 8: Box-Whisker Plots of the genetic diversity within the population might have oc- Shannon indices calculated for gene curred through the propagation because the inocula- diversity of vap1 based on DGGE tion of a few cysts or juveniles poses a bottleneck (Li profiles of three field populations of and Roossinck, 2004). By decreasing the number of Heterodera schachtii. Different letters juveniles used to propagate the populations, the bot- indicate significant differences in tleneck effect increased. This could explain why the diversity among populations (Tukey’s populations established from the lowest and highest test, P < 0.05, n = 8). number of juveniles had the lowest and highest gene

10 JOURNAL OF NEMATOLOGY diversity index, respectively. However, the gene di- Baermann, G. 1917. Eine einfache Methode zur versity could have varied among the populations es- Auffindung von Anklostomum (Nematoden) Larven in tablished from the same numbers of juveniles. Since Erdproben. Tijdschr. Diergeneeskd. 57:131–137. the vap1 patterns of single juveniles were different not Cantacessi, C., Campbell, B. E., Visser, A., Geld- only within the population but also among individuals hof, P., Nolan, M. J., Nisbet, A. J., Matthews, J. B., of the same cyst, it is reasonable to expect that the Loukas, A., Hofmann, A., Otranto, D., Sternberg, P. W., differences in the gene diversity could also appear and Gasser, R. B. 2009. A portrait of the “SCP/TAPS” between juveniles of the same numbers but from dif- proteins of eukaryotes – developing a framework for fundamental research and biotechnological outcomes. ferent field populations. Especially due to the selec- Biotechnology Advances 27:376–88. tive strength and gene flow, the field populations may Carbone, I., and Kohn, L. 2004. Inferring process vary in their genetic diversity over time and space from pattern in fungal population genetics. in Arora, D. (Carbone and Kohn, 2004). K., and Khachatourians, G. G. (Eds), Fungal genomics, The variability of the vap1 gene locus used in Elsevier, Amsterdam and London: 29–58. this study to characterize H. schachtii populations is Castagnone-Sereno, P., Danchin, E. G. J., Deleury, generated from the high and slight variation in DNA E., Guillemaud, T., Malausa, T., and Abad, P. 2010. sequence of intron and exon regions, respective- Genome-wide survey and analysis of microsatellites ly. As shown, the expected amino acids expressed in nematodes, with a focus on the plant-parasitic spe- from the exon regions were variable through the se- cies Meloidogyne incognita. BMC Genomics 11:598, quenced variants, which could cause a functional doi: 10.1186/1471-2164-11-598. change achieved by different gene variants. Since the Castillo, P. 2012. Systematics of cyst nematodes virulence function of the vap1 gene, which modulates (Nematoda: Heteroderinae). Plant Pathology 61:424. the plant defense, is not known for all plant-parasitic Chenuil, A., and Anne, C. 2006. Choosing the right nematodes (Lozano-Torres et al., 2014; Ravichandra, molecular genetic markers for studying biodiversity: 2014), it would be worthwhile to study the relationship from molecular evolution to practical aspects. Genetica between genetic variation of the vap1 gene and plant 127:101–20, doi: 10.1111/j.1365-3059.2011.02563.x. pathogenicity for different geographic populations of Conrad, B., and Antonarakis, S. E. 2007. Gene du- H. schachtii in the future. plication: a drive for phenotypic diversity and cause of human disease. Annual Review of Genomics and Hu- In conclusion, DGGE fingerprinting based on man Genetics 8:17–35. gene variation of the vap1 gene turned out to be a Curto, G. 2008. Sustainable methods for manage- rapid, reliable and in comparison to sequencing ap- ment of cyst nematodes. in Ciancio, A., and Mukerji, proaches inexpensive tool to investigate genetic vari- K. G. (Eds), Integrated management and biocontrol of ation between cyst nematode species as well as ge- vegetable and grain crops nematodes, Springer, Dor- netic variation within and among populations of the d re c ht: 221– 37. beet cyst nematode H. schachtii. DGGE fingerprinting Ferris, M. J., Muyzer, G., and Ward, D. M. 1996. is especially suitable for analyzing large numbers of Denaturing gradient gel electrophoresis profiles of 16S samples. rRNA-defined populations inhabiting a hot spring mi- crobial mat community. Applied and Environmental Mi- Acknowledgments crobiology 84:340–6. Fumagalli, M. 2013. Assessing the effect of se- The authors thank Elvira Woldt for excellent technical quencing depth and sample size in population genetics assistance. RHN was financed by the German Re- inferences. PLoS One 8:e79667, doi: 10.1371/journal. search Foundation (DFG) grant HE6957/1-1 and the pone.0079667. German Academic Exchange Service (DAAD). Gao, B., Allen, R., Maier, T., Davis, E. L., Baum, T. J., and Hussey, R. S. 2001. Molecular characterisa- tion and expression of two venom allergen-like protein References genes in Heterodera glycines. International Journal for Parasitology 31:1617–25. Adam, M., Hallmann, J., and Heuer, H. 2014. Identi- Gracianne, C., Jan, P. -L., Fournet, S., Olivier, E., fication ofmsp1 gene variants in populations of Meloi- Arnaud, J. -F., Porte, C., Bardou-Valette, S., Denis, M. dogyne incognita using PCR-DGGE. Journal of Nema- -C., and Petit, E. J. 2016. Temporal sampling helps un- tology 46:275–80. ravel the genetic structure of naturally occurring popu- Aumailley, M., and Gayraud, B. 1998. Structure and lations of a phytoparasitic nematode. 2. Separating the biological activity of the extracellular matrix. Journal of relative effects of gene flow and genetic drift. Evolu- Molecular Medicine 76:253–65. tionary Applications 9:1005–16.

11 Effector gene vap1 based DGGE fingerprinting to assess variation within and among Heterodera schachtii populations

Griffin, G. D. 1981. Pathological differences in Het- Lozano-Torres, J. L., Wilbers, R. H. P., Warmer- erodera schachtii populations. Journal of Nematology dam, S., Finkers-Tomczak, A., Diaz-Granados, A., 13:191–5. van Schaik, C. C., Helder, J., Bakker, J., Goverse, A., Griffin, G. D. 1982. Differences in the response of Schots, A., and Smant, G. 2014. Apoplastic venom certain weed host populations to Heterodera schachtii. allergen-like proteins of cyst nematodes modulate the Journal of Nematology 14:174–82. activation of basal plant innate immunity by cell surface Griffin, G. D. 1988. Factors affecting the biology receptors. PLoS Pathogens 10:e1004569, doi: 10.1371/ and pathogenicity of Heterodera schachtii on sugar- journal.ppat.1004569. beet. Journal of Nematology 20:396–404. McCarter, J. P., Dautova Mitreva, M., Martin, J., Hepburn, M., and Miller, G. 2008. A multiple muta- Dante, M., Wylie, T., Rao, U., Pape, D., Bowers, Y., The- tion model system as a test development and training ising, B., Murphy, C. V., Kloek, A. P., Chiapelli, B. J., tool for denaturing gradient gel electrophoresis. Bio- Clifton, S. W., Bird, D. M., and Waterston, R. H. 2003. Rad Bulletin 2342:1–4. Analysis and functional classification of transcripts from Heuer, H., Wieland, G., Schönfeld, J., Schönwälder, the nematode Meloidogyne incognita. Genome Biology A., Gomes, N. C. M., and Smalla, K. 2001. Bacterial 4:R26, doi: 10.1186/gb-2003-4-4-r26. community profiling using DGGE or TGGE analysis. in Meglecz, E., Petenian, F., Danchin, E., D’acier, A. Rochelle, P. A. (Ed.), Environmental molecular micro- C., Rasplus, J. Y., and Faure, E. 2004. High similari- biology: protocols and applications, Horizon Scientific ty between flanking regions of different microsatellites Press, Wymondham: 177–90. detected within each of two species of Lepidoptera: Hughes, A. R., Inouye, B. D., Johnson, M. T. J., Parnassius apollo and Euphydryas aurinia. Molecular Underwood, N., and Vellend, M. 2008. Ecological Ecology 13:1693–700. consequences of genetic diversity. Ecology Letters Misas-Villamil, J. C., van der Hoorn, R. A. L., and 11:609–23. Doehlemann, G. 2016. Papain-like cysteine proteases Jasmer, D. P., Goverse, A., and Smant, G. 2003. as hubs in plant immunity. The New Phytologist Parasitic nematode interactions with mammals and 212:9 02–7. plants. Annual Review of Phytopathology 41:245–70. Montarry, J., Jan, P. -L., Gracianne, C., Overall, A. Johnson, P. C. D., Webster, L. M. I., Adam, A., D. J., Bardou-Valette, S., Olivier, E., Fournet, S., Greni- Buckland, R., Dawson, D. A., and Keller, L. F. 2006. er, E., and Petit, E. J. 2015. Heterozygote deficits in Abundant variation in microsatellites of the parasitic cyst plant-parasitic nematodes: Possible causes and nematode Trichostrongylus tenuis and linkage to a tan- consequences. Molecular Ecology 24:1654–77. dem repeat. Molecular and Biochemical Parasitology Müller, J. 1980. Ein verbessertes Extraktionsver- 148:210–8. fahren für Heterodera schachtii. Nachrichtenblatt des Kaplan, M., Caswell-Chen, E. P., and Williamson, deutschen Pflanzenschutzdienstes 32:21–4. V. M. 1999. Assessment of host-induced selection on Müller, J. 1992. Detection of pathotypes by assess- three geographic isolates of Heterodera schachtii using ing the virulence of Heterodera schachtii populations. RAPD and AFLP markers. Phytopathology 89:68–73. Nematologica 38:50–64. Kim, J., Kim, T., Lee, Y. -C., Chun, J. -Y., Kern, E. M. Müller, J. 1998. New pathotypes of the beet cyst A., Jung, J., and Park, J. -K. 2016. Characterization of nematode (Heterodera schachtii) differentiated on alien 15 microsatellite loci and genetic analysis of Heterod- genes for resistance in beet (Beta vulgaris). Fundamen- era schachtii (Nematoda: Heteroderidae) in South Ko- tal and Applied Nematology 21:519–26. rea. Biochemical Systematics and Ecology 64:97–104. Müller, J. 1999. The economic importance of Kropf, S., Heuer, H., Grüning, M., and Smalla, K. Heterodera schachtii in Europe. Helminthologia 2004. Significance test for comparing complex mi- 36:205–13. crobial community fingerprints using pairwise simi- Muyzer, G., and Smalla, K. 1998. Application of De- larity measures. Journal of Microbiological Methods naturing Gradient Gel Electrophoresis (DGGE) and Tem- 57:187–95. perature Gradient Gel Electrophoresis (TGGE) in micro- Lessa, E. P. 1992. Rapid surveying of DNA se- bial ecology. Antonie van Leeuwenhoek 73:127–41. quence variation in natural populations. Molecular Biol- Myers, R. M., Fischer, S. G., Lermani, L. S., and ogy and Evolution 9:323–30. Maniatis, T. 1985. Nearly all single base substitutions in Li, C., Riethoven, J.-J. M., and Ma, L. 2010. Ex- DNA fragments joined to a GC-clamp can be detected on-Primed Intron-Crossing (EPIC) markers for non-mod- by denaturing gradient gel electrophoresis. Nucleic Ac- el teleost fishes. BMC Evolutionary Biology 10:90, doi: ids Research 13:3131–45. 10.1186/1471-2148-10-90. Patricia, G. P., Allison, A. S., Malcolm, D. S., and Li, H., and Roossinck, M. J. 2004. Genetic bottle- Paul, A. F. 1998. What molecules can tell us about necks reduce population variation in an experimental populations: choosing and using a molecular marker. RNA virus population. Journal of Virology 78:10582–7. Ecology 79:361–182.

12 JOURNAL OF NEMATOLOGY

Plantard, O., and Porte, C. 2004. Population genet- Ravichandra, N. G. 2014. Horticultural Nematology, ic structure of the sugar beet cyst nematode Heterod- Springer, New Delhi. era schachtii: a gonochoristic and amphimictic species Taylor, J. S., van de Peer, Y., and Meyer, A. 2001. with highly inbred but weakly differentiated popula- Genome duplication, divergent resolution and specia- tions. Molecular Ecology 13:33–41. tion. Trends in Genetics 17:299–301.