Antimigraine Drug Avitriptan Is a Ligand and Agonist of Human Aryl Hydrocarbon Receptor That Induces CYP1A1 in Hepatic and Intestinal Cells

International Journal of Molecular Sciences

Article Antimigraine Drug Avitriptan Is a Ligand and Agonist of Human Aryl Hydrocarbon Receptor that Induces CYP1A1 in Hepatic and Intestinal Cells

Barbora Vyhlídalová 1, Kristýna Krasulová 1 , Petra Peˇcinková 1, Karolína Poulíková 1 , Radim Vrzal 1, ZdenˇekAndrysík 2, Aneesh Chandran 3, Sridhar Mani 4,* and Zdenek Dvorak 1,*

1 Department of Cell Biology and Genetics, Faculty of Science, Palacky University, Slechtitelu 27, 783 71 Olomouc, Czech Republic; [email protected] (B.V.); [email protected] (K.K.); [email protected] (P.P.); [email protected] (K.P.); [email protected] (R.V.) 2 Department of Pharmacology, University of Colorado School of Medicine, Aurora, CO 80045, USA; [email protected] 3 Department of Medicinal Chemistry, College of Pharmacy, University of Michigan, Ann Arbor, MI 48109-1065, USA; [email protected] 4 Department of Genetics and Department of Medicine, Albert Einstein College of Medicine, Bronx, NY 10461, USA * Correspondence: [email protected] (S.M.); [email protected] (Z.D.); Tel.: +1-718-430-2871 (S.M.); +420-58-5634903 (Z.D.) Received: 17 March 2020; Accepted: 15 April 2020; Published: 17 April 2020

Abstract: The efforts for therapeutic targeting of the aryl hydrocarbon receptor (AhR) have emerged in recent years. We investigated the effects of available antimigraine triptan drugs, having an indole core in their structure, on AhR signaling in human hepatic and intestinal cells. Activation of AhR in reporter gene assays was observed for Avitriptan and to a lesser extent for Donitriptan, while other triptans were very weak or no activators of AhR. Using competitive binding assay and by homology docking, we identified Avitriptan as a low-affinity ligand of AhR. Avitriptan triggered nuclear translocation of AhR and increased binding of AhR in CYP1A1 promotor DNA, as revealed by immune-fluorescence microscopy and chromatin immune-precipitation assay, respectively. Strong induction of CYP1A1 mRNA was achieved by Avitriptan in wild type but not in AhR-knockout, immortalized human hepatocytes, implying that induction of CYP1A1 is AhR-dependent. Increased levels of CYP1A1 mRNA by Avitriptan were observed in human colon carcinoma cells LS180 but not in primary cultures of human hepatocytes. Collectively, we show that Avitriptan is a weak ligand and activator of human AhR, which induces the expression of CYP1A1 in a cell-type specific manner. Our data warrant the potential off-label therapeutic application of Avitriptan as an AhR-agonist drug.

Keywords: Aryl Hydrocarbon Receptor; Antimigraine drugs; Triptans; repurposing

1. Introduction The aryl hydrocarbon receptor (AhR) is a transcription factor belonging to the family of basic helix-loop-helix transcription factors. In its inactive form, the AhR resides in the cytosol in complex with chaperone proteins. Ligand binding to the AhR induces dissociation of the protein complex and triggers nuclear translocation of the ligand-receptor complex. Transcriptionally active heterodimer of AhR with AhR nuclear translocator (ARNT) is formed in the nucleus and it binds to speciﬁc response elements in the promotors of AhR-target genes. Ligands of AhR comprise a plethora of structurally diverse compounds, including both xenobiotics (e.g., polyaromatic hydrocarbons, polyhalogenated

Int. J. Mol. Sci. 2020, 21, 2799; doi:10.3390/ijms21082799 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2020, 21, 2799 2 of 15 biphenyls, natural phenolics, benzimidazole proton pump inhibitors) and endogenous substances (e.g., intermediary and microbial metabolites of tryptophan, tetrapyrroles, eicosanoids) [1]. The AhR transcriptionally controls a wide array of genes, including those involved in xenobiotic metabolism, immune homeostasis, cell cycle, differentiation and energy metabolism. Hence, the AhR is a critical player in human physiology (e.g., hematopoiesis) [2] and also in many pathophysiological processes such as diabetes, carcinogenesis, inflammation, infection or cardiovascular diseases [3–5]. The attempts for therapeutic and preventive targeting of AhR have emerged in recent years [6]. Both natural and synthetic AhR agonists and antagonists are potential drug candidates. An intriguing and respected strategy in current pharmacotherapy is repositioning (off-label use) of a clinically used drug. Indeed, the AhR active drugs, such as tranilast, flutamide or omeprazole, might be effective chemotherapeutics for the treatment of breast and pancreatic cancers [7]. An anti-leprosy Food and Drug Administration (FDA)-approved drug and AhR antagonist clofazimine suppressed multiple myeloma in transgenic mice [8]. Targeting of AhR with antagonists was suggested as a strategy for delaying the relapse during the treatment of melanoma with vemurafenib [9] or for inhibiting constitutive AhR activity in prostate cancer [10]. The use of AhR ligands is not limited to anti-cancer therapy but given the roles of AhR in the intestines and skin, targeting the AhR is challenging also in the treatment of inflammatory bowel disease (IBD) or skin pathologies. Indeed, tranilast is used in the treatment of atopic dermatitis [11]. The drawback with long term use of these compounds is their side-effects and off-target effects, as reported for omeprazole [12]. Thus, there is a perpetual need for the discovery of safer AhR ligands for future therapeutic use. The suitable candidates for off-targeting AhR could be the antimigraine drugs of triptan class, which have an indole core in their structure. The manifold of indole-based compounds were demonstrated as ligands of AhR, including synthetic xenobiotic indoles (e.g., methylindoles and methoxyindoles) [13], dietary indoles (e.g., indole-3-carbinol and diindolylmethane) [14] and microbial catabolites of tryptophan, such as skatole [15], tryptamine, indole-3-acetate [16] and indole [17]. In the current study, we examined the effects of clinically used triptans [18], including Sumatriptan, Naratriptan, Rizatriptan, Eletriptan, Zolmitriptan, Almotriptan and Frovatriptan, on transcriptional activity and functions of AhR. We also tested Avitriptan [19] and Donitriptan [20], triptans that were developed but never marketed. Employing the methods of RT-PCR, western blotting, reporter-gene assays, ChIP-assay, radio-ligand binding assay, protein immune-precipitation, in situ immune-fluorescence and in silico docking, we demonstrate that Avitriptan is a weak ligand and agonist of AhR that induces the expression of the AhR-target genes. Our data warrant the potential therapeutic application of Avitriptan as AhR-agonist drug, which is further promoted by the fact that Avitriptan already passed phase I and II of clinical tests.

2. Results

2.1. Triptans Are Activators of Human AhR In the first series of experiments, we examined agonist and antagonist effects of triptans on AhR using reporter gene assay. For this purpose, we incubated stably transfected human hepatoma AZ-AHR cells for 24 h with triptans (maximal tested concentrations were selected based on limited solubility of individual compounds) in the presence or the absence of diverse AhR agonists, including TCDD (2,3,7,8-tetrachlorodibenzo-p-dioxin), BaP (Benzo[a]pyrene) and FICZ (6-Formylindolo[3,2-b]carbazole). Avitriptan, Donitriptan and Naratriptan activated dose-dependently AhR, while other triptans were inactive (Figure1A). The activation was rather weak and the relative e fficacy of triptans in 100 µM concentration as compared to TCDD (luciferase induction approx. 1900-fold) decreased in order—Avitriptan (~3%) > Donitriptan (~1.5%) > Naratriptan (~0.5%). Tested triptans did not display antagonist effects against AhR (Figure1B) and the decrease of agonists-induced luciferase activity of AhR by several triptans were rather due to their intrinsic cytotoxicity in AZ-AHR cells (Figure1C). Time-course analyzes revealed the differential dynamics of AhR time-dependent activation by Avitriptan Int. J. Mol. Sci. 2020, 21, 2799 3 of 15 Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 3 of 15 andselected Donitriptan, as two most which active were triptans selected for as detailed two most investigation. active triptans In short for detailed periods investigation.of incubation (<12 In short h), periodsDonitriptan of incubation was a (more<12 h),robust Donitriptan activator was than a more Avitriptan. robust activator In comparison, than Avitriptan. we observed In comparison, after weprolonged observed incubation after prolonged (>12 h) incubation(Figure 1D), ( >which12 h) is (Figure consistent1D), whichwith dose-response is consistent withinverse dose-response effects after inverse24 h (Figure effects after1A). 24The h (Figureplausible1A). explanation The plausible for explanationsuch a behavior for such could a behavior be existing could substantial be existing substantialdifferences di betweenfferences the between degrees the of triptans degrees interactions of triptans interactions with drug transporters with drug transporters [21]. [21].

FigureFigure 1.1. TranscriptionalTranscriptional activity activity of of aryl aryl hydrocarbon hydrocarbon receptor receptor (AhR). (AhR). (i) (i) Dose-response Dose-response analyses–AZ-AHRanalyses–AZ-AHR cells cells were were incubated incubated for 24 for h with 24 h vehicle with (DMSO—dimethyl vehicle (DMSO—dimethyl sulfoxide; 0.1% sulfoxide; v/v) µ 0.1%and/orv/ vtriptans) and/ orin concentrations triptans in concentrations ranging from 1 ranging nM to 200 from µM, 1 in nM the absence to 200 (agonistM, in mode) the absence or in (agonistthe presence mode) (antagonist or in mode) the presence of model (antagonistAhR agonists mode) comprising of model TCDD (2,3,7,8-tetrachlorodibenzo- AhR agonists comprising TCDDp-dioxin; (2,3,7,8-tetrachlorodibenzo- 13.5 nM), BaP (Benzo[a]pyrene;p-dioxin; 15.8 13.5 µM nM),) and BaPFICZ (Benzo[a]pyrene; (6-Formylindolo[3,2-b]carbazole; 15.8 µM) and FICZ22.6 (6-Formylindolo[3,2-b]carbazole;µM). (A) Agonist analyses. (B) Antagonist 22.6 µM). (analyses.A) Agonist (C analyses.) MTT cell ( Bviability) Antagonist assay. analyses. (ii) Time-course (C) MTT cellanalyses—AZ viability assay. AHR (ii) cells Time-course were incubated analyses—AZ for 0–48 h AHRwith DMSO cells were (0.1% incubated v/v), TCDD for (10 0–48 nM), h with Avitriptan DMSO (0.1%(100 µM)v/v), TCDDand Donitriptan (10 nM), Avitriptan (100 µM) (100 (D).µ FollowingM) and Donitriptan the treatments (100 µ M)cells (D were). Following lysed and the luciferase treatments cellsactivity were was lysed measured. and luciferase Experiments activity were was measured.performed Experiments in three consecutive were performed passages in of three AZ-AHR consecutive cells. passagesData are of expressed AZ-AHR as cells. a fold Data induction are expressed of luciferase as a fold inductionactivity over of luciferasecontrol cells activity (agonist) over controlor as cells (agonist) or as percentage of maximal induction (antagonist) and they are the mean SD from percentage of maximal induction (antagonist) and they are the mean ± SD from measurements± measurementsperformed in quadruplicates. performed in quadruplicates. 2.2. Avitriptan and Donitriptan induce CYP1A1 in Hepatic and Intestinal Cells via AhR 2.2. Avitriptan and Donitriptan induce CYP1A1 in Hepatic and Intestinal Cells via AhR We studied the induction of prototypical AhR target gene CYP1A1 by triptans in hepatic We studied the induction of prototypical AhR target gene CYP1A1 by triptans in hepatic and and intestinal cell models. Avitriptan and Donitriptan but not Naratriptan, dose-dependently intestinal cell models. Avitriptan and Donitriptan but not Naratriptan, dose-dependently induced induced CYP1A1 mRNA in intestinal adenocarcinoma cells LS180 after 24 h of incubation (Figure2A). CYP1A1 mRNA in intestinal adenocarcinoma cells LS180 after 24 h of incubation (Figure 2A). The The induction was rather weak and the levels of CYP1A1 mRNA were increased approx. 38-fold and induction was rather weak and the levels of CYP1A1 mRNA were increased approx. 38-fold and 8-fold by Avitriptan and Donitriptan in 100 µM concentrations, respectively. The relative eﬃcacies of 8-fold by Avitriptan and Donitriptan in 100 µM concentrations, respectively. The relative efficacies Avitriptan (~4%) and Donitriptan (~1%) were consistent with those observed in reporter gene assays in of Avitriptan (~4 %) and Donitriptan (~1 %) were consistent with those observed in reporter gene AZ-AHR cells. The level of CYP1A1 protein in LS180 cells after 48 h of incubation was signiﬁcantly assays in AZ-AHR cells. The level of CYP1A1 protein in LS180 cells after 48 h of incubation was increased only by Avitriptan (Figure2A). Importantly, unlike in hepatoma AZ-AHR cells, Avitriptan significantly increased only by Avitriptan (Figure 2A). Importantly, unlike in hepatoma AZ-AHR CYP1A1 andcells, Donitriptan Avitriptan wereand Donitriptan not cytotoxic were in intestinal not cytotoxi LS180c in cells intestinal (Figure LS1802A). Induction cells (Figure of 2A). InductionmRNA inof immortalized CYP1A1 mRNA human in hepatocytesimmortalized MIHA, human incubated hepatocytes for 24 MIHA, h with TCDD,incubated Avitriptan for 24 andh with Donitriptan TCDD, wasAvitriptan 150-fold, and 215-fold Donitriptan and 16-fold,was 150-fold, respectively. 215-fold Triptansand 16-fold, did respectively. not induce CYP1A1Triptans didmRNA not induce in AhR knockoutCYP1A1 mRNA variant in of AhR MIHA knockout cells, implyingvariant of theMIHA AhR-dependent cells, implying induction the AhR-dependent of CYP1A1 induction by triptans of (FigureCYP1A12B). by In triptans contrast, (Figure in typical 2B). In primary contrast, human in typical hepatocytes primary human cultures, hepato preparedcytes cultures, from healthy prepared liver from healthy liver tissue donors, Avitriptan and Donitriptan caused an only weak and

Int. J. Mol. Sci. 2020, 21, 2799 4 of 15

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 4 of 15 tissue donors, Avitriptan and Donitriptan caused an only weak and non-signiﬁcant increase of CYP1A1 non-significantmRNA, by 2-fold increase and 4-fold of CYP1A1 respectively, mRNA, while by TCDD2-fold inducedand 4-foldCYP1A1 respectively,mRNA while between TCDD 400-fold induced and 1600-foldCYP1A1 mRNA (Figure between2C). Cell 400-fold type-speciﬁc and 1600-fold induction (Figure of CYP1A1 2C). couldCell type-specific be due to the induction extensive of oxidative CYP1A1 couldmetabolism, be due whichto the wasextensive described oxidative for Avitriptan metabolism [22,, 23which]. was described for Avitriptan [22,23].

Figure 2. Induction of CYP1A1. Cells were incubated with triptans (100 µM), TCDD (10 nM) and /or vehicleFigure 2. (0.1% Induction DMSO) of forCYP1A1. 24 h (mRNA Cells were analyses, incubated MTT wi test)th andtriptans 48 h (100 (protein µM), analyses). TCDD (10 The nM) levels and/or of CYP1A1vehicle (0.1%mRNA DMSO) and protein for 24 h were (mRNA determined analyses, by MTT the means test) and of RT-PCR 48 h (protein and western analyses). blot, The respectively. levels of (CYP1A1A) Experiments mRNA and in three protein consecutive were determined passages by of humanthe means colon of RT-PCR adenocarcinoma and western cells blot, LS180. respectively. Upper bar graph shows a fold induction of CYP1A1 mRNA over control cells. Data are expressed as mean SD. (A) Experiments in three consecutive passages of human colon adenocarcinoma cells LS180. Upper± barRT-PCR graph was shows carried a out fold in triplicatesinduction (technicalof CYP1A1 replicates). mRNA *over= significantly control cells. different Data from are DMSO-treatedexpressed as meancells (p ±< SD.0.05); RT-PCR dashed was horizontal carried out insert in triplicates shows borderline (technical 2-fold replicates). induction. * = Representativesignificantly different western from blot DMSO-treatedof CYP1A1 protein cells is shown.(p < 0.05); Bottom dashed plot showshorizontal MTT cellinsert viability shows assay. borderline (B) Human 2-fold immortalized induction. +/+ / Representativehepatocytes MIHA-(AhR western blot) of and CYP1A1 MIHA-(AhR protein− − is). sh Barown. graph Bottom shows plot a fold shows induction MTT cell of CYP1A1 viabilitymRNA assay. over control cell. Data are expressed as mean SD from three consecutive cell passages. RT-PCR (B) Human immortalized hepatocytes MIHA-(AhR± +/+) and MIHA-(AhR−/−). Bar graph shows a fold wasinduction carried of out CYP1A in triplicates1 mRNA (technical over control replicates). cell. *Data= significantly are expressed different as frommean DMSO-treated ± SD from three cells p p C (consecutive< 0.05); #= cellsignificantly passages. RT-PCR different was from carried wild-type out cellsin triplicates ( < 0.05) (technical ( ) Experiments replicates). in primary *= significantly human hepatocytes cultures obtained from three different liver tissue donors. Bar graph shows a fold induction different from DMSO-treated cells (p < 0.05); #= significantly different from wild-type cells (p < 0.05) of CYP1A1 mRNA over control cells. Data are expressed as mean SD. RT-PCR was carried out in (C) Experiments in primary human hepatocytes cultures obtained± from three different liver tissue triplicates (technical replicates). donors. Bar graph shows a fold induction of CYP1A1 mRNA over control cells. Data are expressed as mean ± SD. RT-PCR was carried out in triplicates (technical replicates).

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 5 of 15

2.3. AvitriptanInt. J. Mol. Sci.is 2020a Low-Affinity, 21, 2799 Ligand of AhR 5 of 15 Avitriptan and Donitriptan activated AhR and induced the CYP1A1 gene by the AhR-dependent mechanism2.3. Avitriptan in multiple Is a Low-A cellffi models.nity Ligand Therefore, of AhR we carried out radio-ligand competitive binding assay to determineAvitriptan whether and these Donitriptan two triptans activated AhRinteract and inducedwith AhR the CYP1A1 directly. gene Binding by the AhR-dependent of 3H-TCDD at mouse AhR wasmechanism dose-dependently in multiple cell inhibited models. Therefore, by Avitriptan, we carried implying out radio-ligand that it competitive binds AhR binding directly. assay The effects 3 of Avitriptanto determine were whether weak, these suggesting two triptans that interact it withis a AhRlow-affinity directly. Binding ligand of ofH-TCDD AhR at(Figure mouse 3). While AhR was dose-dependently inhibited by Avitriptan, implying that it binds AhR directly. The effects of Donitriptan did not displace 3H-TCDD from AhR, it is probably very low-affinity ligand of AhR, not Avitriptan were weak, suggesting that it is a low-affinity ligand of AhR (Figure3). While Donitriptan detectabledid not by displace our assay,3H-TCDD given from the structural AhR, it is probably and functional very low-a similarityffinity ligand with of AhR, Avitriptan. not detectable Corroborating these byobservations, our assay, given docking the structural studies and also functional suggested similarity the with low-affinity Avitriptan. binding Corroborating of Avitriptan these and Donitriptanobservations, to human docking AhR. studies Both also suggestedAvitriptan the low-aand ffiDonitriptannity binding ofshowed Avitriptan a andcomparatively Donitriptan similar bindingto humanaffinity AhR. of − Both3.1 kcal/mol Avitriptan andand Donitriptan −3.4 kcal/mol, showed respectively. a comparatively Though similar bindinghydrophobic affinity ofinteractions 3.1 kcal/mol and 3.4 kcal/mol, respectively. Though hydrophobic interactions largely contribute largely− contribute to the− binding mode of the compound, both Avitriptan and Donitriptan also form to the binding mode of the compound, both Avitriptan and Donitriptan also form hydrogen bond hydrogeninteractions bond interactions with the protein with backbone the protei N-H orn backbone C=O groups N-H (Figure or4 C=O). groups (Figure 4).

3 H-TCDD radioligand binding assay

Figure 3. Radio-ligand binding assay. Cytosolic protein from Hepa1c1c7 cells was incubated with FigureAvitriptan 3. Radio-ligand (1–1000 µ M),binding Donitriptan assay. (1–1000 CytosolicµM), FICZprotei (10n nM;from positive Hepa1c1c7 control), cells dexamethasone was incubated with (100 nM; negative control) or vehicle (DMSO; 0.1% v/v; corresponds to specific binding of Avitriptan (1–1000 µM), Donitriptan (1–1000 µM), FICZ (10 nM; positive control), dexamethasone [3H]-TCDD = 100%) in the presence of 2 nM [3H]-TCDD. Specific binding of [3H]-TCDD was determined 3 (100 nM;as a negative difference betweencontrol) total or vehicle and non-specific (DMSO; TCDF 0.1% (200 v/ nM;v; corresponds 2,3,7,8-tetrachlorodibenzofuran) to specific binding reactions. of [ H]-TCDD = 100%)* = insignificantly the presencedifferent of from2 nM negative [3H]-TCDD. control Specific (p < 0.05). binding Three independent of [3H]-TCDD experiments was determined were as a differenceperformed, between and total the incubations and non-specific and measurements TCDF (200 were nM; done 2,3,7,8-tetrachlorodibenzofuran) in triplicates in each experiment reactions. (technical replicates). The error bars represent the mean SD. * = significantly different from negative control (p ±< 0.05). Three independent experiments were performed, and the incubations and measurements were done in triplicates in each experiment (technical replicates). The error bars represent the mean ± SD.

Int.Int. J. J. Mol. Mol. Sci. Sci. 20202020, ,2121, ,x 2799 FOR PEER REVIEW 66 of of 15 15

A B

FigureFigure 4. 4. AvitriptanAvitriptan and and Donitripan Donitripan binding binding at at hAhR hAhR.. Mode Mode of of interaction interaction of of Avitriptan Avitriptan ( (AA)) and and DonitriptanDonitriptan ( (BB)) with with ligand ligand binding binding domain domain of of hAhR. hAhR. Dotted Dotted lines lines denote denote th thee hydrogen hydrogen bonding bonding interactioninteraction and and the the protein protein residues residues involved involved in in hydrophobic hydrophobic interactions interactions are are shown shown by by red red spikes. spikes. H-bondH-bond distance distance is is shown shown alongside. alongside. (C (C) )Top Top 10 10 protein protein templates templates used used by by I-TASSER I-TASSER for for homology homology modellingmodelling hAhR hAhR LBD. LBD. The The sequence sequence alignment alignment of of hAhR hAhR LBD LBD versus versus the the templates templates used used in in the the model model buildingbuilding is is presented. presented.

2.4.2.4. Avitriptan Avitriptan and and Donitriptan Donitriptan Tr Triggerigger Nuclear Translocation of AhR FollowingFollowing the the binding binding of of the the ligand ligand at at AhR, AhR, the the ea earlyrly cellular cellular response response is is a a translocation translocation of of AhR AhR fromfrom the the cytosol cytosol to to the the nucleus. nucleus. Therefore, Therefore, we we an analyzedalyzed the the nuclear nuclear translocation translocation of of AhR AhR under under the the influenceinﬂuence of of Avitriptan Avitriptan and and Donitriptan. Donitriptan. We We incubated incubated human human intestinal intestinal LS174T LS174T cells cellsfor 90 for min 90 with min thewith vehicle, the vehicle, TCDD TCDD (10 nM), (10 nM), Avitriptan Avitriptan (100 (100 µMµ) M)and and Donitriptan Donitriptan (100 (100 µM)µM) and and we we evaluated evaluated intracellularintracellular localizationlocalization of of AhR AhR using using immune-ﬂuorescence. immune-fluorescence. In vehicle-treated In vehicle-treated cells, AhR cells, was AhR localized was localizedpredominantly predominantly in cytosol in (2–9% cytosol of positive (2–9% of nuclei), positive whereas nuclei), TCDD whereas triggered TCDD translocation triggered translocation of AhR into of AhR into the nucleus (48–63% of positive nuclei). Both Avitriptan and Donitriptan caused nuclear

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 7 of 15 Int. J. Mol. Sci. 2020, 21, 2799 7 of 15 translocation of AhR; however, AhR partially resided in cytosol, which compromised the quantification.the nucleus Nevertheless, (48–63% of positive these nuclei). observations Both Avitriptan im andply Donitriptan weak agonist caused nucleareffects translocation of triptans of at AhR (FigureAhR; 5). however, AhR partially resided in cytosol, which compromised the quantiﬁcation. Nevertheless, these observations imply weak agonist eﬀects of triptans at AhR (Figure5).

Figure Figure5. Nuclear 5. Nuclear translocation translocation of of AhR. AhR. FluorescenceFluorescence images images depict depict sub-cellular sub-cellular localization localization of AhR in of AhR LS174T cells incubated for 90 min with vehicle (DMSO; 0.1% v/v), TCDD (10 nM), Avitriptan (100 µM) in LS174T cells incubated for 90 min with vehicle (DMSO; 0.1% v/v), TCDD (10 nM), Avitriptan (100 and Donitriptan (100 µM). The staining procedure is described in detail in Materials and Methods µM) andsection. Donitriptan The whole (100 staining µM). protocol The was staining performed proc inedure three consecutive is described cell passages in detail with in all testedMaterials and Methodscompounds section. inThe duplication. whole staining Representative protocol micrographs was performed LS174T cells in arethree shown. consecutive Size bars insertedcell passages in with all testedindividual compounds pictures in are duplication. equal to 50 µ M.Representative micrographs LS174T cells are shown. Size bars μ inserted2.5. Formation in individual of AhR-ARNT pictures Heterodimer are equal by to Avitriptan 50 M. and Donitriptan Within the canonical AhR signaling pathway, the AhR forms a heterodimer with ARNT upon AhR 2.5. Formationtranslocation of AhR-ARNT in the cell nucleus. Heterodimer Thus, we by studied Avitriptan the formation and Donitriptan of the AhR-ARNT complex by means Withinof protein the immune-precipitationcanonical AhR signaling in human pathway, intestinal LS180 the cellsAhR incubated forms a for heterodimer 90 min and 18 with h with ARNT the upon vehicle, TCDD, Avitriptan (100 µM) and Donitriptan (100 µM). Robust formation of AhR-ARNT dimer AhR translocation in the cell nucleus. Thus, we studied the formation of the AhR-ARNT complex by was induced by TCDD but not by Avitriptan and Donitriptan, in cells incubated for 90 min (Figure6). means Afterof protein 18 h of incubationimmune-precipitation with TCDD, heterodimerization in human intestinal of AhR with LS180 ARNT cells was veryincubated weak, due for to the90 min and 18 h withdrop the in AhRvehicle, protein TCDD, levels caused Avitriptan by ligand-dependent (100 µM) and AhR Donitriptan degradation, which (100 isµM). also evidentRobust by formation the of AhR-ARNTdrastic dimer decrease was of AhR induced protein by in TCDD total cell but lysates. not Similarly, by Avitriptan faint levels and of Donitriptan, ARNT protein afterin cells co-IP incubated for 90 minwere (Figure observed 6). with After Avitriptan 18 h of and incubation Donitriptan wi (Figureth TCDD,6). Taking heterodimerization in account the marginal of eAhRﬀects with of ARNT triptans after 90 min of incubation with the degradation of AhR protein in prolonged incubation times, was very weak, due to the drop in AhR protein levels caused by ligand-dependent AhR degradation, the eﬀects of triptans on AhR-ARNT heterodimerization could not be reliably assessed. which is also evident by the drastic decrease of AhR protein in total cell lysates. Similarly, faint levels of ARNT protein after co-IP were observed with Avitriptan and Donitriptan (Figure 6). Taking in account the marginal effects of triptans after 90 min of incubation with the degradation of AhR protein in prolonged incubation times, the effects of triptans on AhR-ARNT heterodimerization could not be reliably assessed.

Int. J. Mol. Sci. 2020, 21, 2799 8 of 15 Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 8 of 15

Figure 6. HeterodimerizationFigure 6. Heterodimerization of of AhR AhR with with ARNT. ARNT. Protein Protein immunoprecipitation immunoprecipitation—formation – formation of AhR- of AhR-ARNTARNT heterodimer heterodimer in in LS180 LS180 cells cells incubated incubated for 90 min for and 90 18 min h with and vehicle 18 h (DMSO; with vehicle0.1% v/v), TCDD (DMSO; 0.1% v/v), (10 nM), Avitriptan (100 µM) and Donitriptan (100 µM). Representative immunoblots of immuno- TCDD (10 nM), Avitriptan (100 µM) and Donitriptan (100 µM). Representative immunoblots of precipitated protein eluates and total cell lysates are shown. Experiments were performed in three immuno-precipitatedconsecutive cell protein passages. eluates and total cell lysates are shown. Experiments were performed in three consecutive cell passages. 2.6. Avitriptan and Donitriptan Enhance the Recruitment of AhR into CYP1A1 Promotor 2.6. Avitriptan andThe Donitriptancapability of Avitriptan Enhance and the Donitriptan Recruitment to enhance of AhR the intobinding CYP1A1 of AhR in Promotor the promotor of its target gene CYP1A1 was studied by ChIP. For this purpose, human intestinal LS174T cells were The capabilityincubated offorAvitriptan 90 min and 18 and h with Donitriptan the vehicle, to TCDD, enhance Avitriptan the binding (100 µM) ofand AhR Donitriptan in the promotor of its target gene(100 CYP1A1 µM). The enrichment was studied of the byCYP1A1 ChIP. promotor For this with purpose, AhR in cells human incubated intestinal with TCDD LS174T for 90 cells were incubated formin 90 and min 18 andh (two 18 hconsecutive with the cell vehicle, passages TCDD, of LS174T Avitriptan cells) was (100approx.µM) 4-fold and and Donitriptan 16-fold, (100 µM). respectively. Donitriptan increased the binding of AhR in the CYP1A1 promotor approx. 2.5-fold The enrichmentafter 90 of min the of incubation CYP1A1 and promotor unlike in the with case of AhR TCDD, in the cells effect incubated remained after with 18 h of TCDD incubation for 90 min and 18 h (two consecutivewith 1.7-fold induction. cell passages On the contrary, of LS174T Avitriptan cells) caused was a weak approx. decrease 4-fold(0.4-fold) and of AhR 16-fold, binding respectively. Donitriptanin increased the CYP1A1 the promotor binding after ofa shor AhRt period in the of incubation CYP1A1 (90 promotor min), while prolonged approx. incubation 2.5-fold for after 90 min of 18 h yielded approx. 3-fold increased binding (Figure 7). This time-dependent differential dynamics incubation andof Avitriptan unlike and in theDonitriptan case of at TCDD, AhR binding the to eff CYP1A1ect remained promoter afterwas consistent 18 h of with incubation the effects with 1.7-fold induction. Onobserved the contrary, in reporter Avitriptan gene assay (Figure caused 1D) aand weak protein decrease immune-preci (0.4-fold)pitation of (Figure AhR 6). binding in the CYP1A1 promotor after a short period of incubation (90 min), while prolonged incubation for 18 h yielded approx. 3-fold increased binding (Figure7). This time-dependent di fferential dynamics of Avitriptan and Donitriptan at AhR binding to CYP1A1 promoter was consistent with the effects observed in reporter geneInt. assay J. Mol. (FigureSci. 2020, 211, xD) FOR and PEER proteinREVIEW immune-precipitation (Figure6). 9 of 15

Figure 7. ChromatinFigure 7. Chromatin immunoprecipitation immunoprecipitation ChIP–binding ChIP–binding of of AhR AhR in CYP1A1 in CYP1A1 promotor. promotor. LS174T cells LS174T cells were incubatedwere with incubated Donitriptan with Donitriptan (100 µ M),(100 AvitriptanµM), Avitriptan (100 (100µ M),µM), TCDDTCDD (10 (10 nM) nM) and/or and vehicle/or vehicle (0.1% (0.1% DMSO) for 90 min and 18 h. Bar graphs show enrichment of CYP1A1 promotor with AhR as DMSO) for 90compared min and to 18 vehicle-treated h. Bar graphs cells. showA representative enrichment DNA offragments CYP1A1 amplified promotor by PCR with analyzed AhR on asa compared to vehicle-treated2% agarose cells. gel A are representative shown. Experiments DNA were fragments performed in ampliﬁed two consecutive by PCR cell passages. analyzed on a 2% agarose gel are shown. Experiments were performed in two consecutive cell passages. 3. Discussion In the current study, we examined the effects of antimigraine drugs of triptan class on AhR-CYP1A1 signaling in human in vitro cell models. Of nine tested triptans, we identified Avitriptan as a lead AhR-active compound. We demonstrate that Avitriptan is a weak agonist and low affinity ligand of AhR, which triggers AhR signaling pathway and induces the expression of AhR target gene CYP1A1 in hepatic and intestinal cells. The AhR is a Janus-faced actor in human physiology and pathophysiology. In the context of intestinal health and disease, the proper activation of the AhR by endogenous, microbial or dietary ligands has beneficial and protective roles in the onset and progression of IBD and other intestinal pathologies. Consistently, insufficient endogenous activation of the AhR, due to the microbiome dysregulation or for dietary reasons, is the risk factor for onset and progression of IBD [4,5,24,25]. Excessive activation of the AhR by xenobiotic ligands such as environmental pollutants or drugs is also detrimental for intestinal health. The key for dual roles of the AhR in intestinal health and disease is not entirely elucidated. Ligand-dependent activation of the AhR can result in an extremely diverse spectrum of biological and toxic effects that occur in a ligand-, species- and tissue-specific manner [26]. On the basis of a novel computational approach for molecular docking to the homology model of the AhR LBD, specific residues within the AhR binding cavity that play a critical role in binding of three distinct groups of chemicals were recently predicted and experimentally confirmed by Giani Tagliabue et al. [27]. A ligand-selective structural hierarchy controlling dimerization of the AhR with ARNT and the recognition of target DNA was described by Seok et al. [28]. Due to its broad roles, not limited to the intestinal health, the AhR is an emerging therapeutic target for the pharmacotherapy of several diseases, including atopic dermatitis, intestinal inflammation or cancer [7,11,29]. Avitriptan was developed by Bristol-Myers Squibb [30] and reached phase III clinical trials. However, it was suspended because, in high doses (150 mg), transiently elevated liver enzymes were reported [31]. Avitriptan is rapidly absorbed from the small intestine and the speed of absorption of cMAX but not AUC, differs between fed and fasted subjects [32]. Plasma maximum concentrations of Avitriptan (cMAX) following oral administration reached up to ~ two (2) µM [19,22]. Intravenous

Int. J. Mol. Sci. 2020, 21, 2799 9 of 15

3. Discussion In the current study, we examined the effects of antimigraine drugs of triptan class on AhR-CYP1A1 signaling in human in vitro cell models. Of nine tested triptans, we identified Avitriptan as a lead AhR-active compound. We demonstrate that Avitriptan is a weak agonist and low affinity ligand of AhR, which triggers AhR signaling pathway and induces the expression of AhR target gene CYP1A1 in hepatic and intestinal cells. The AhR is a Janus-faced actor in human physiology and pathophysiology. In the context of intestinal health and disease, the proper activation of the AhR by endogenous, microbial or dietary ligands has beneficial and protective roles in the onset and progression of IBD and other intestinal pathologies. Consistently, insufficient endogenous activation of the AhR, due to the microbiome dysregulation or for dietary reasons, is the risk factor for onset and progression of IBD [4,5,24,25]. Excessive activation of the AhR by xenobiotic ligands such as environmental pollutants or drugs is also detrimental for intestinal health. The key for dual roles of the AhR in intestinal health and disease is not entirely elucidated. Ligand-dependent activation of the AhR can result in an extremely diverse spectrum of biological and toxic effects that occur in a ligand-, species- and tissue-specific manner [26]. On the basis of a novel computational approach for molecular docking to the homology model of the AhR LBD, specific residues within the AhR binding cavity that play a critical role in binding of three distinct groups of chemicals were recently predicted and experimentally confirmed by Giani Tagliabue et al. [27]. A ligand-selective structural hierarchy controlling dimerization of the AhR with ARNT and the recognition of target DNA was described by Seok et al. [28]. Due to its broad roles, not limited to the intestinal health, the AhR is an emerging therapeutic target for the pharmacotherapy of several diseases, including atopic dermatitis, intestinal inflammation or cancer [7,11,29]. Avitriptan was developed by Bristol-Myers Squibb [30] and reached phase III clinical trials. However, it was suspended because, in high doses (150 mg), transiently elevated liver enzymes were reported [31]. Avitriptan is rapidly absorbed from the small intestine and the speed of absorption of cMAX but not AUC, differs between fed and fasted subjects [32]. Plasma maximum concentrations of Avitriptan (cMAX) following oral administration reached up to ~ two (2) µM[19,22]. Intravenous application of Avitriptan (10 mg) resulted in cMAX of ~ 1 µM[22,33]. The overall bioavailability of orally administered Avitriptan is 17% [19,22,34]. Taken together, the low oral bioavailability of Avitriptan and consequently, its low plasma levels are desirable features if considering Avitriptan orally as an off-label drug for the local therapy of IBD. Also, a recent estimate based on recommended dose and published a fecal excreted fraction of 200 marketed drugs, reports globally >100-times higher drug concentrations in the gut as compared to blood [35]. It implies that oral administration of Avitriptan would result in intra-intestinal local concentrations sufficiently high to activate AhR ( 100 µM), while systemic blood levels will be kept bellow two (2) µM. ≈ We observed cell-specific induction of AhR target gene CYP1A1 in hepatic and intestinal cells. We may only speculate about the mechanisms underlying cell-specific induction, which may comprise differential cellular uptake/intake, metabolism of Avitriptan or distinct interactions with the AhR signaling pathway in cancer (LS180), immortalized (MIHA) and normal cells (primary human hepatocytes). Nevertheless, the lack of CYP1A1 induction in primary cultures of normal human hepatocytes may be considered favorable, in terms of no AhR systemic effects of orally Avitriptan intended for local intestinal treatments. Based on the data reported in the current study, we propose the possibility to repurpose (off-target use) formerly anti-migraine Avitriptan for local intestinal use as anti-IBD treatment through the AhR. This is supported by the facts that—(i) The AhR is emerging and suitable therapeutic target in IBD; (ii) Avitriptan is a ligand and agonist of the AhR; (iii) Avitriptan passed phase I and phase II of clinical studies, which may accelerate its introduction in clinical use; (iv) Orally Avitriptan has low bioavailability and it is not toxic to intestinal cells, which favors its local use in IBD treatment without having undesirable systemic effects. Int. J. Mol. Sci. 2020, 21, 2799 10 of 15

In conclusion, our data reporting activation of AhR by Avitriptan warrant potential off-label therapeutic application of Avitriptan as a AhR-agonist drug in the treatment of intestinal inflammatory pathologies. Ongoing studies should focus on in vitro and in vivo anti-inflammatory capability of Avitriptan.

4. Materials and Methods

4.1. Chemicals Almotriptan malate (purity 98%; cat# SML1210), Avitriptan fumarate (purity 98%; ≥ ≥ cat# BM0009), Donitriptan monohydrochloride (purity 98%; cat# D9071), Eletriptan hydrobromide ≥ (purity 98%; cat# PZ0011), Frovatriptan succinate monohydrate (purity 97%; cat# SML1291), ≥ ≥ Zolmitriptan (purity 98%; cat# SML0248), Benzo[a]pyrene (BaP; B1760, Lot SLBS0038V, purity ≥ 99%), 5,11-Dihydro-indolo[3,2-b]carbazole-6-carboxaldehyde, 6-Formylindolo[3,2-b]carbazole (FICZ; SML1489, Lot 0000026018, purity 99.5%), dimethylsulfoxide (DMSO), Triton X-100, bovine serum albumin and hygromycin B were purchased from Sigma-Aldrich (Prague, Czech Republic). Naratriptan hydrochloride (purity 95%; cat# SC-212362), Rizatriptan benzoate (purity 99%; cat# SC-219983), Sumatriptan (purity 98%; cat# SC-473020) were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) was from Ultra Scientiﬁc (Rhode Island, USA). 2,3,7,8-tetrachlorodibenzofuran (TCDF) was from Ambinter (Orleáns, France). Luciferase lysis buﬀer was from Promega (Madison, California, USA). DAPI (40,6-diamino-2-phenylindole) was from Serva (Heidelberg, Germany). [3H]-TCDD (purity 98.6%; ART 1642, Lot 181018) was purchased from American Radiolabeled Chemicals. Bio-Gel® HTP Hydroxyapatite (1300420, Lot 64079675) was obtained from Bio-Rad Laboratories. All other chemicals were of the highest quality commercially available. Chemical structures of tested triptans are depicted in Figure S1.

4.2. Cell Cultures Human Caucasian colon adenocarcinoma cells LS180 (#87021202) and LS174T (#87060401) and mouse hepatoma Hepa1c1c7 cells (#95090613) were purchased from the European Collection of Cell Cultures (ECACC) and used in passage number 5C12. Stably transfected gene reporter cell line AZ-AHR was described elsewhere [36]. Cells were maintained at 37 ◦C and 5% CO2 in a humidiﬁed incubator. Primary human hepatocytes cultures HEP2201014 (male, 76 years) and HEP2201015 (male, 72 years) were purchased from Biopredic International (Rennes, France). Human hepatocytes culture LH79 (male, 60 years) was prepared at the Faculty of Medicine, Palacky University Olomouc. Liver tissue was obtained from Faculty Hospital Olomouc, Czech Republic and the tissue acquisition protocol followed the requirements issued by “Ethical Committee of the Faculty Hospital Olomouc, Czech Republic” and Transplantation law #285/2002 Coll. Primary human hepatocyte cultures were maintained in serum-free cultivation medium. Immortalized non-tumorigenic human hepatocyte cell line MIHA was a generous gift from Dr. Xia Wang and Dr. Jayanta Roy-Chowdhury (Albert Einstein College of Medicine, Yeshiva / +/+ University, NY, USA). AhR knock-out (AhR− −) and control clones (AhR ) were constructed as follows—Parental line was transiently transfected with a mix of pSpCas9(BB)-2A-GFP (PX458) plasmids encoding two gRNAs (AAGTCGGTCTCTATGCCGCT and AGACCGACTTAATACAGAGT) targeting second exon of the AhR gene. Single cell clones were sub-cultured and successful knock-out was conﬁrmed by western blot.

4.3. Cytotoxicity Assay Cells were incubated for 24 h with tested compounds, vehicle (DMSO; 0.1% v/v) and Triton X-100 (1%, v/v), using multi-well culture plates of 96 wells. MTT test was performed and absorbance was measured spectrophotometrically at 540 nm on Inﬁnite M200 (Schoeller Instruments, Prague, Int. J. Mol. Sci. 2020, 21, 2799 11 of 15

Czech Republic). The data were expressed as the percentage of cell viability, where 100% and 0% represent the treatments with vehicle and Triton X-100, respectively.

4.4. Reporter Gene Assay The stably transfected human hepatoma gene reporter cells AZ-AHR [36] were seeded at 96-well culture plates and incubated with test compounds as indicated in detail in ﬁgure legends. Thereafter, the cells were lysed, and luciferase activity was measured on a Tecan Inﬁnite M200 Pro plate reader (Schoeller Instruments, Czech Republic). Measurements were carried out in quadruplicates (technical replicates).

4.5. Isolation of RNA and qRT-PCR The total RNA was isolated by TRI Reagent® (Sigma-Aldrich, St. Louis, MO, USA) and cDNA was synthesized using M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA, USA) in the presence of random hexamers (New England Biolabs, USA). The levels of CYP1A1 and glyceraldehyde-3-phosphate dehydrogenase [GAPDH] mRNAs were determined using the Light Cycler® 480 II apparatus (Roche Diagnostic Corporation, Prague, Czech Republic), as described elsewhere [37]. Measurements were carried out in triplicates. Gene expression was normalized to GAPDH as a housekeeping gene. The data were processed by the delta-delta method.

4.6. Western Blotting Total protein extracts were prepared by using ice-cold lysis buﬀer (150 mM NaCl; 50 mM HEPES; 5 mM EDTA; 1% (v/v) Triton X-100; anti-protease cocktail, anti-phosphatase cocktail). Protein concentration was determined using Bradford reagent. The amount of protein was adjusted to 25 µg per sample. Samples were separated at standard SDS-PAGE followed by western blotting. The following primary antibodies were used for the detection of target proteins—CYP1A1 (mouse-monoclonal, sc-393979, A-9, dilution 1:500, Santa Cruz Biotechnology) and β-actin (mouse-monoclonal, sc-47778, C4, dilution 1:2000, Cell Signaling Technology). Chemiluminescent detection was performed using horseradish peroxidase-conjugated secondary antibodies (anti-mouse, 7076S, dilution 1:2000, Cell Signaling Technology) and WesternSure® PREMIUM Chemiluminescent Substrate (LI-COR Biotechnology) by C-DiGit® Blot Scanner (LI-COR Biotechnology). Experiments were performed in three consecutive cell passages.

4.7. Nuclear Translocation of AhR–Immune Histochemistry LS174T cells were seeded on chamber slides (ibidi GmbH, Grafelfing, Germany) and cultured for two days. Then, cells were incubated for 90 min with vehicle (DMSO; 0.1% v/v), TCDD (10 nM), Avitriptan (100 µM) and Donitriptan (100 µM). After the treatment, cells were washed by PBS, fixed with 4% formaldehyde, permeabilized using 0.1% Triton X-100, blocked with 3% bovine serum albumin and incubated with Alexa Fluor 488 labelled primary antibody against AhR (sc-133088, Santa Cruz Biotechnology, USA), as described previously [13]. Nuclei were stained by 40,6-diamino-2-phenylindole (DAPI) and cells were enclosed by VectaShield® Antifade Mounting Medium (Vector Laboratories Inc., Burlingame, CA, USA). AhR translocation into the nucleus was visualized and evaluated using fluorescence microscope IX73 (Olympus, Japan). The whole staining protocol was performed in three independent experiments with all tested compounds in duplication. The AhR translocation was evaluated visually depending on the distinct signal intensity of AhR antibody in the nucleus and cytosol.

4.8. Chromatin Immunoprecipitation (ChIP) The assay was performed as per the manufacturer recommendations for SimpleChIP Plus Enzymatic Chromatin IP kit (Magnetic Beads) (Cell Signaling Technology; #9005), with minor Int. J. Mol. Sci. 2020, 21, 2799 12 of 15 modiﬁcations, as recently described [13]. Brieﬂy, LS174T cells were seeded in a 60-mm dish and the following day they were incubated with Donitriptan (100 µM), Avitriptan (100 µM), TCDD (10 nM) and/or vehicle (0.1% DMSO) 90 min and 18 h at 37 ◦C. Anti-AhR rabbit monoclonal antibody was from Cell Signaling Technology (D5S6H; #83200). Experiments were performed in two consecutive cell passages.

4.9. Radio-Ligand Binding Assay Cytosolic protein from murine hepatoma Hepa1c1c7 cells (2 mg/mL) was incubated for 2 h at room temperature in the presence of 2 nM [3H]-TCDD with Avitriptan (1–1000 µM), Donitriptan (1–1000 µM), FICZ (10 nM; positive control), dexamethasone (100 nM; negative control) or vehicle (DMSO; 0.1% v/v; corresponds to specific binding of [3H]-TCDD = 100%). Ligand binding to the cytosolic proteins was determined by the hydroxyapatite binding protocol and scintillation counting. Specific binding of [3H]-TCDD was determined as a difference between total and non-specific (TCDF; 200 nM) reactions. Three independent experiments were performed, and the incubations and measurements were done in triplicates in each experiment (technical replicates).

4.10. Protein Immune-Precipitation Formation of AhR-ARNT heterodimer was studied in cell lysates from LS180 cells, which were incubated with TCDD (10 nM), Avitriptan (100 µM), Donitriptan (100 µM) and vehicle (DMSO; 0.1% v/v) for 90 min and 18 h at 37 ◦C. Pierce™ Co-Immunoprecipitation Kit (Thermo Fisher Scientiﬁc), applying covalently coupled AhR antibody (mouse monoclonal, sc-133088, A-3, Santa Cruz Biotechnology) was used. Eluted protein complexes, in parallel with parental total lysates, were resolved on SDS-PAGE gels followed by Western blot and immuno-detection with ARNT 1 antibody (mouse monoclonal, sc-17812, G-3, Santa Cruz Biotechnology). Chemiluminescent detection was performed using horseradish peroxidase-conjugated anti-mouse secondary antibody (7076S, Cell Signaling Technology) and WesternSure® PREMIUM Chemiluminescent Substrate (LI-COR Biotechnology) by C-DiGit® Blot Scanner (LI-COR Biotechnology).

4.11. Molecular Docking Studies Homology model of the ligand binding domain (LBD) of hAhR was generated using the I-TASSER server [38] based on multiple template structures. Amino acid sequence of hAhR LBD residues 270 C400 was obtained from the UniProt database (UniProt ID: P35869). I-TASSER (Iterative Threading ASSEmbly Refinement), which ranked as one of the best server for protein structure prediction in the recent community-wide Critical Assessment of Techniques for Protein Structure Prediction (CASP), uses a hierarchical approach for protein structure prediction that combines multiple threading, ab initio folding and structure refinement for constructing reliable homology based models. The sequence alignment of top 10 templates used by I-TASSER to homology model of the hAhR LBD is illustrated in Figure4C. In accordance with previous modelling approaches [ 13,27], I-TASSER also identified PAS structures as the best template for hAhR modelling, with about 50% of sequence similarity. Out of the five models generated by I-TASSER, the model with the highest C-Score ( 0.05) was selected for − further study. The chosen hAhR LBD structure was further refined by molecular dynamics simulations using GROMACS v2018.1 simulation package (www.gromacs.org). The model was energy minimized and subjected to 10 ns of molecular dynamics simulation at 298 K and the resultant final structure was subsequently used for docking studies. Molecular docking of Avitriptan and Donitriptan to the hAhR LBD was performed with Autodock Vina [39]. The structures of the ligands were downloaded from PubChem and then prepared with the AutoDockTools. Site-directed mutagenesis studies in the past have identified that residues Thr283, His285, Phe289, Phe318, Met342, Phe345, Leu347, Ser359 and Gln377 of mouse AhR were involved in binding interactions with ligands [40,41]. In the present study, we used this binding information to derive the docking site in human counterpart of AhR. Accordingly, a docking space of 20 17 22 Å × × Int. J. Mol. Sci. 2020, 21, 2799 13 of 15 size centered on the pocket lined by residues Thr289, His291, Phe295, Phe324, Met348, Phe351, Leu353, Ser364 and Gln383 of hAhR was generated using AutoDockTool. Docking was performed with setting the exhaustiveness parameter to 100, in order to improve the sampling effort. The docked pose of the compound with highest binding affinity was selected for further investigation. Ligand interaction diagrams were generated using LigPlot+ software [42]. The visual analysis of dock poses were carried out using PyMOL (The PyMOL Molecular Graphics System, v. 1.7.4, Schrodinger, LLC).

4.12. Statistical Analyses Student t-test, one-way analysis of variance (ANOVA) and Dunnett test, were calculated using GraphPad Prism v. 6.0 for Windows (GraphPad Software, La Jolla, CA, USA).

Supplementary Materials: Supplementary materials can be found at http://www.mdpi.com/1422-0067/21/8/2799/s1. Figures S1: Chemical structures of triptans. Author Contributions: Conceptualization, Z.D. and S.M.; methodology & formal analysis, B.V., K.K., P.P., K.P., R.V. and A.C.; resources, Z.D. and Z.A.; writing—original draft preparation, Z.D., S.M. and B.V.; writing—review and editing, Z.D., S.M. and B.V.; supervision, Z.D.; project administration, Z.D.; funding acquisition, Z.D. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by Czech Health Research Council, grant number [NV19-05-00220] (to Z.D.), National Institutes of Health [ES030197; CA 222469] (to S.M.) and in part by The Peer Reviewed Medical Research Program—Investigator Initiated Research Award under Award No. W81XWH-17-1-0479 (to S.M.). Conﬂicts of Interest: The authors declare no conﬂict of interest. The funders had no role in the design of the study; in the collection, analyses or interpretation of data; in the writing of the manuscript or in the decision to publish the results.

Abbreviations

CYP1A1 Cytochrome P450 1A1 AhR Aryl hydrocarbon receptor ARNT Aryl hydrocarbon receptor nuclear translocator TCDD 2,3,7,8-tetrachlorodibenzo-p-dioxin TCDF 2,3,7,8-tetrachlorodibenzofuran BaP Benzo[a]pyrene FICZ 6-Formylindolo[3,2-b]carbazole IBD Inﬂammatory bowel disease LBD Ligand-binding domain DMSO dimethylsulfoxide

References

1. Denison, M.S.; Nagy, S.R. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Ann. Rev. Pharmacol. Toxicol. 2003, 43, 309–334. [CrossRef][PubMed] 2. Angelos, M.G.; Kaufman, D.S. Advances in the role of the aryl hydrocarbon receptor to regulate early hematopoietic development. Curr. Opin. Hematol. 2018, 25, 273–278. [CrossRef][PubMed] 3. Bock, K.W. From TCDD-mediated toxicity to searches of physiologic AHR functions. Biochem. Pharmacol. 2018, 155, 419–424. [CrossRef][PubMed] 4. Bock, K.W. Aryl hydrocarbon receptor (AHR): From selected human target genes and crosstalk with transcription factors to multiple AHR functions. Biochem. Pharmacol. 2019, 168, 65–70. [CrossRef][PubMed] 5. Gutierrez-Vazquez, C.; Quintana, F.J. Regulation of the Immune Response by the Aryl Hydrocarbon Receptor. Immunity 2018, 48, 19–33. [CrossRef] 6. Fang, Z.Z.; Krausz, K.W.; Nagaoka, K.; Tanaka, N.; Gowda, K.; Amin, S.G.; Perdew, G.H.; Gonzalez, F.J. In vivo eﬀects of the pure aryl hydrocarbon receptor antagonist GNF-351 after oral administration are limited to the gastrointestinal tract. Br. J. Pharmacol. 2014, 171, 1735–1746. [CrossRef] 7. Safe, S.; Cheng, Y.; Jin, U.H. The Aryl Hydrocarbon Receptor (AhR) as a Drug Target for Cancer Chemotherapy. Curr. Opin. Toxicol. 2017, 2, 24–29. [CrossRef] Int. J. Mol. Sci. 2020, 21, 2799 14 of 15

8. Bianchi-Smiraglia, A.; Bagati, A.; Fink, E.E.; Affronti, H.C.; Lipchick, B.C.; Moparthy, S.; Long, M.D.; Rosario, S.R.; Lightman, S.M.; Moparthy, K.; et al. Inhibition of the aryl hydrocarbon receptor/polyamine biosynthesis axis suppresses multiple myeloma. J. Clin. Investig. 2018, 128, 4682–4696. [CrossRef] 9. Corre, S.; Tardif, N.; Mouchet, N.; Leclair, H.M.; Boussemart, L.; Gautron, A.; Bachelot, L.; Perrot, A.; Soshilov, A.; Rogiers, A.; et al. Sustained activation of the Aryl hydrocarbon Receptor transcription factor promotes resistance to BRAF-inhibitors in melanoma. Nat. Commun. 2018, 9, 4775. [CrossRef] 10. Ghotbaddini, M.; Moultrie, V.; Powell, J.B. Constitutive Aryl Hydrocarbon Receptor Signaling in Prostate Cancer Progression. J. Cancer Treatment Diagn. 2018, 2, 11–16. 11. Darakhshan, S.; Pour, A.B. Tranilast: A review of its therapeutic applications. Pharmacol. Res. 2015, 91, 15–28. [CrossRef][PubMed] 12. Wilhelm, S.M.; Rjater, R.G.; Kale-Pradhan, P.B. Perils and pitfalls of long-term effects of proton pump inhibitors. Expert Rev. Clin. Pharmacol. 2013, 6, 443–451. [CrossRef][PubMed] 13. Stepankova, M.; Bartonkova, I.; Jiskrova, E.; Vrzal, R.; Mani, S.; Kortagere, S.; Dvorak, Z. Methylindoles and Methoxyindoles are Agonists and Antagonists of Human Aryl Hydrocarbon Receptor. Mol. Pharmacol. 2018, 93, 631–644. [CrossRef][PubMed] 14. Chen, I.; Safe, S.; Bjeldanes, L. Indole-3-carbinol and diindolylmethane as aryl hydrocarbon (Ah) receptor agonists and antagonists in T47D human breast cancer cells. Biochem. Pharmacol. 1996, 51, 1069–1076. [CrossRef] 15. Rasmussen, M.K.; Balaguer, P.; Ekstrand, B.; Daujat-Chavanieu, M.; Gerbal-Chaloin, S. Skatole (3-Methylindole) Is a Partial Aryl Hydrocarbon Receptor Agonist and Induces CYP1A1/2 and CYP1B1 Expression in Primary Human Hepatocytes. PLoS ONE 2016, 11, e0154629. [CrossRef] 16. Jin, U.H.; Lee, S.O.; Sridharan, G.; Lee, K.; Davidson, L.A.; Jayaraman, A.; Chapkin, R.S.; Alaniz, R.; Safe, S. Microbiome-derived tryptophan metabolites and their aryl hydrocarbon receptor-dependent agonist and antagonist activities. Mol. Pharmacol. 2014, 85, 777–788. [CrossRef] 17. Hubbard, T.D.; Murray, I.A.; Bisson, W.H.; Lahoti, T.S.; Gowda, K.; Amin, S.G.; Patterson, A.D.; Perdew, G.H. Adaptation of the human aryl hydrocarbon receptor to sense microbiota-derived indoles. Sci. Rep. 2015, 5, 12689. [CrossRef] 18. Tfelt-Hansen, P.; De Vries, P.; Saxena, P.R. Triptans in migraine: A comparative review of pharmacology, pharmacokinetics and efficacy. Drugs 2000, 60, 1259–1287. [CrossRef] 19. Cutler, N.R.; Salazar, D.E.; Jhee, S.S.; Fulmor, I.E.; Ford, N.; Smith, R.A.; Sramek, J.J. Pharmacokinetics and pharmacodynamics of avitriptan in patients with migraine after oral dosing. Headache 1998, 38, 446–452. [CrossRef] 20. John, G.W.; Perez, M.; Pauwels, P.J.; Le Grand, B.; Verscheure, Y.; Colpaert, F.C. Donitriptan, a unique high-efficacy 5-HT1B/1D agonist: Key features and acute antimigraine potential. CNS Drug Rev. 2000, 6, 278–289. [CrossRef] 21. Wilt, L.A.; Nguyen, D.; Roberts, A.G. Insights into the Molecular Mechanism of Triptan Transport by P-glycoprotein. J. Pharm. Sci. 2017, 106, 1670–1679. [CrossRef] 22. Marathe, P.H.; Greene, D.S.; Barbhaiya, R.H. Disposition of [14C]avitriptan in rats and humans. Drug Metab. Dispos. 1997, 25, 881–888. [PubMed] 23. Marathe, P.H.; Greene, D.S.; Kollia, G.D.; Barbhaiya, R.H. A pharmacokinetic interaction study of avitriptan and propranolol. Clin. Pharmacol. Ther. 1998, 63, 367–378. [CrossRef] 24. Lamas, B.; Richard, M.L.; Leducq, V.; Pham, H.P.; Michel, M.L.; Da Costa, G.; Bridonneau, C.; Jegou, S.; Hoffmann, T.W.; Natividad, J.M.; et al. CARD9 impacts colitis by altering gut microbiota metabolism of tryptophan into aryl hydrocarbon receptor ligands. Nat. Med. 2016, 22, 598–605. [CrossRef][PubMed] 25. Zelante, T.; Iannitti, R.G.; Cunha, C.; De Luca, A.; Giovannini, G.; Pieraccini, G.; Zecchi, R.; D’Angelo, C.; Massi-Benedetti, C.; Fallarino, F.; et al. Tryptophan catabolites from microbiota engage aryl hydrocarbon receptor and balance mucosal reactivity via interleukin-22. Immunity 2013, 39, 372–385. [CrossRef][PubMed] 26. Denison, M.S.; Faber, S.C. And Now for Something Completely Different: Diversity in Ligand-Dependent Activation of Ah Receptor Responses. Curr. Opin. Toxicol. 2017, 2, 124–131. [CrossRef][PubMed] 27. Tagliabue, S.G.; Faber, S.C.; Motta, S.; Denison, M.S.; Bonati, L. Modeling the binding of diverse ligands within the Ah receptor ligand binding domain. Sci. Rep. 2019, 9, 10693. [CrossRef] Int. J. Mol. Sci. 2020, 21, 2799 15 of 15

28. Seok, S.H.; Lee, W.; Jiang, L.; Molugu, K.; Zheng, A.; Li, Y.; Park, S.; Bradfield, C.A.; Xing, Y. Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex. Proc. Natl. Acad. Sci. USA 2017, 114, 5431–5436. [CrossRef] 29. Goettel, J.A.; Gandhi, R.; Kenison, J.E.; Yeste, A.; Murugaiyan, G.; Sambanthamoorthy, S.; Griffith, A.E.; Patel, B.; Shouval, D.S.; Weiner, H.L.; et al. AHR Activation Is Protective against Colitis Driven by T Cells in Humanized Mice. Cell Rep. 2016, 17, 1318–1329. [CrossRef] 30. Saxena, P.R.; De Vries, P.; Wang, W.; Heiligers, J.P.; MaassenVanDenBrink, A.; Bax, W.A.; Yocca, F.D. Effects of avitriptan, a new 5-HT 1B/1D receptor agonist, in experimental models predictive of antimigraine activity and coronary side-effect potential. Naunyn. Schmiedeberg’s Arch. Pharmacol. 1997, 355, 295–302. [CrossRef] 31. Meng, C.Q. Migraine: Current drug discovery trend. Curr. Med. Chem. 1997, 4, 385–404. 32. Marathe, P.H.; Sandefer, E.P.; Kollia, G.E.; Greene, D.S.; Barbhaiya, R.H.; Lipper, R.A.; Page, R.C.; Doll, W.J.; Ryo, U.Y.; Digenis, G.A. In vivo evaluation of the absorption and gastrointestinal transit of avitriptan in fed and fasted subjects using gamma scintigraphy. J. Pharmacokinet. Biopharm. 1998, 26, 1–20. [CrossRef] [PubMed] 33. Sharma, A.; Jusko, W.J.; Fulmor, I.E.; Norton, J.; Uderman, H.D.; Salazar, D.E. Pharmacokinetics and pharmacodynamics of avitriptan during intravenous administration in healthy subjects. J. Clin. Pharmacol. 1999, 39, 685–694. [CrossRef][PubMed] 34. Marathe, P.H.; Greene, D.S.; Lee, J.S.; Barbhaiya, R.H. Assessment of effect of food, gender, and intra-subject variability in the pharmacokinetics of avitriptan. Biopharm. Drug Dispos. 1998, 19, 153–157. [CrossRef] 35. Maier, L.; Pruteanu, M.; Kuhn, M.; Zeller, G.; Telzerow, A.; Anderson, E.E.; Brochado, A.R.; Fernandez, K.C.; Dose, H.; Mori, H.; et al. Extensive impact of non-antibiotic drugs on human gut bacteria. Nature 2018, 555, 623–628. [CrossRef] 36. Novotna, A.; Pavek, P.; Dvorak, Z. Novel stably transfected gene reporter human hepatoma cell line for assessment of aryl hydrocarbon receptor transcriptional activity: Construction and characterization. Environ. Sci. Technol. 2011, 45, 10133–10139. [CrossRef] 37. Vrzal, R.; Knoppová, B.; Bachleda, P.; Dvoˇrák, Z. Effects of oral anorexiant sibutramine on the expression of cytochromes P450s in human hepatocytes and cancer cell lines. J. Biochem. Mol. Toxicol. 2013, 27, 515–521. [CrossRef] 38. Roy, A.; Kucukural, A.; Zhang, Y. I-TASSER: A unified platform for automated protein structure and function prediction. Nat. Protoc. 2010, 5, 725–738. [CrossRef] 39. Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [CrossRef] 40. Soshilov, A.A.; Denison, M.S. Ligand promiscuity of aryl hydrocarbon receptor agonists and antagonists revealed by site-directed mutagenesis. Mol. Cell. Biol. 2014, 34, 1707–1719. [CrossRef] 41. Motto, I.; Bordogna, A.; Soshilov, A.A.; Denison, M.S.; Bonati, L. New aryl hydrocarbon receptor homology model targeted to improve docking reliability. J. Chem. Inf. Model. 2011, 51, 2868–2881. [CrossRef][PubMed] 42. Laskowski, R.A.; Swindells, M.B. LigPlot+: Multiple ligand-protein interaction diagrams for drug discovery. J. Chem. Inf. Model. 2011, 51, 2778–2786. [CrossRef][PubMed]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).