Role of the Small Regulatory RNAs Lpr10 and Lpr17 in the Regulation of the Stress

Response in Legionella pneumophila

Joseph Saoud

Department of Natural Resource Sciences

Faculty of Agriculture and Environmental Sciences

McGill University

December 2020

A thesis submitted to McGill University in partial fulfillment of the requirements of the degree

of Doctor of Philosophy

© Joseph Saoud 2020 Table of Contents

Abstract ...... 7 Résumé ...... 9 Acknowledgements ...... 12 Contribution to knowledge...... 18 Contribution of authors ...... 20 Contribution of Authors Chapter 3...... 20 Contribution of Authors Chapter 4...... 20 Contribution of Authors Chapter 5...... 20 List of Abbreviations ...... 22 Chapter 1: Introduction ...... 25 Chapter 2: Literature Review ...... 28 2.1 Introduction ...... 28 2.2 Legionella’s General Characteristics ...... 31 2.3 Life Cycle ...... 33 2.4 Host Cell Infection ...... 34 2.4.1 Attachment and Entry ...... 35 2.4.2 Establishment of the LCV ...... 36 2.4.3 Replication ...... 36 2.4.4 Egress ...... 37 2.5 Immune Response: ...... 37 2.5.1 Cytokine Production ...... 38 2.5.2 Detection ...... 38 2.5.3 Oxidative Burst ...... 41 2.6 Secretion Systems in Legionella ...... 42 2.6.1 Type I Secretion System (T1SS): Lss ...... 42 2.6.2 Type II Secretion System (T2SS): Lsh ...... 43 2.6.3 Type IVa Secretion System (TIVaSS): Lvh ...... 44 2.6.4 Type IVb Secretion System (TIVbSS): Icm/Dot ...... 44 2.7 Major Regulators of Legionella ...... 48 2.7.1 Sigma Factors...... 49 2.7.2 Quorum Sensing...... 52 2.7.3 Stringent Response...... 53 2.7.4 Two-Component Systems (TCS) ...... 54 2.8 Small Regulatory RNAs (sRNA)...... 58 2.8.1 Base-Pairing sRNAs ...... 58 2.8.2 Protein-Binding sRNAs ...... 59

2 2.8.3 RNA Chaperones ...... 59 2.8.4 sRNAs in Other Bacteria ...... 61 2.8.5 sRNAS in Legionella pneumophila ...... 67 2.9 Regulation by sRNAs ...... 70 2.9.1 Negative Regulation by sRNAs ...... 71 2.9.2 Positive Regulation by sRNAs...... 74 2.10 Thermal Stress Response ...... 76 2.10.1 RpoH Regulon ...... 77 2.10.2 RpoE Regulon ...... 78 2.11 Protein Misfolding ...... 78 2.11.1 Protein Aggregation ...... 79 2.11.2 Chaperones ...... 80 2.11.3 Toxicity of Protein Aggregates ...... 82 2.12 Tail-Specific Proteases ...... 83 2.12.1 Tsp in Pseudomonas aeruginosa ...... 83 2.12.2 Tsp in Staphylococcus aureus ...... 84 2.12.3 Tsp in Chlamydia trachomatis ...... 84 2.12.4 Tsp in Salmonella ...... 85 2.12.5 Tsps and Outer Membrane Proteins ...... 85 Connecting Text Chapter 3 ...... 87 The small regulatory RNA Lpr10 regulates the expression of RpoS in Legionella pneumophila ...... 88 3.1 ABSTRACT ...... 89 3.2 INTRODUCTION: ...... 90 3.3 RESULTS ...... 95 3.3.1 Lpr10 is expressed in PE phase ...... 95 3.3.2 rpoS and several other genes are upregulated in the Lpr10 mutant ...... 98 3.3.3 Deletion of Lpr10 improves survival in water ...... 101 3.3.4 Lpr10 pairs to the 5’ region of rpoS mRNA ...... 103 3.3.5 A putative third and fourth rpoS TSS are located upstream of Lpr10 binding site ...... 106 3.4 DISCUSSION ...... 110 3.5 EXPERIMENTAL PROCEDURES ...... 116 3.5.1 Bacterial strains and media ...... 116 3.5.2 Survival in water ...... 117 3.5.3 Deletion of lpr10 and complementation of the mutant ...... 118 3.5.4 RNA extraction ...... 122 3.5.5 Northern Blotting ...... 122 3.5.6 5’ RACE...... 123 3.5.7 3’ RACE...... 124 3.5.8 DNA microarray ...... 124 3.5.9 Quantitative PCR ...... 125

3 3.5.10 Exposure to water ...... 125 3.5.11 RT-PCR...... 126 3.5.12 Primer extension ...... 126 3.5.13 In vitro transcription and radiolabelling ...... 127 3.5.14 EMSA ...... 127 3.5.15 In line probing ...... 128 3.6 ACKNOWLEDGMENTS ...... 128 3.7 AUTHOR CONTRIBUTIONS ...... 129 3.8 SUPPLEMENTARY EXPERIMENTAL PROCEDURES ...... 130 3.8.1 Acanthamoeba castellanii culture ...... 130 3.8.2 Vermamoeba vermiformis culture ...... 130 3.8.3 THP-1 culture...... 130 3.8.4 Infections...... 131 3.9 Supplementary Figures ...... 132 3.10 References ...... 135 Connecting Text Chapter 4 ...... 141 Legionella pneumophila’s Tsp is important for surviving thermal stress in water and inside amoeba ...... 142 4.1 ABSTRACT ...... 143 4.2 IMPORTANCE ...... 144 4.3 INTRODUCTION...... 145 4.4 RESULTS ...... 150 4.4.1 Tsp is important for L. pneumophila to survive thermal stress...... 150 4.4.2 Tsp is important for intracellular multiplication in V. vermiformis following a temperature shift...... 151 4.4.3 Lpr17 is expressed in E phase ...... 153 4.4.4 tsp is transcribed in E and PE phase ...... 153 4.4.5 Tsp is expressed in PE phase ...... 155 4.4.6 Lpr17 is repressed during thermal stress ...... 156 4.4.7 CpxR regulates tsp independently of Lpr17...... 157 4.4.8 The response regulator CpxR is important for surviving thermal stress ...... 158 4.5 DISCUSSION ...... 160 4.6 MATERIAL AND METHODS ...... 164 4.6.1 Bacterial strains and media ...... 164 4.6.2 Deletion of tsp and complementation of the mutant ...... 166 4.6.3 Thermal stress ...... 167 4.6.4 Vermamoeba vermiformis culture and infection ...... 167 4.6.5 RNA extraction ...... 170 4.6.6 Northern Blotting ...... 171 4.6.7 RT-PCR...... 172 4.6.8 Quantitative PCR ...... 172

4 4.6.9 Cloning of Tsp with polyhistidine tag ...... 173 4.6.10 Western blot ...... 173 4.7 ACKNOWLEDGMENTS ...... 174 4.8 References ...... 175 Connecting Text Chapter 5 ...... 182 Chapter 5: The Tail-Specific Protease Tsp is Required for Legionella pneumophila Intracellular Multiplication ...... 183 5.1 Abstract ...... 184 5.2 Introduction ...... 185 5.3 Material and Methods ...... 189 5.3.1 Bacterial Strains ...... 189 5.3.2 THP-1 Culture ...... 192 5.3.3 Ethics Statement...... 192 5.3.4 Bone-Marrow Derived Macrophages Isolation ...... 192 5.3.5 Infections...... 193 5.3.6 MTT Viability Assay ...... 194 5.3.7 Sodium-Sensitivity ...... 194 5.3.8 ELISA ...... 195 5.4 Results ...... 195 5.4.1 Tsp is Important for Intracellular Multiplication in Macrophages ...... 195 5.4.2 Macrophages Viability is Reduced Following Infection by the tsp Mutant ...... 196 5.4.3 Infection of Macrophages with the tsp Mutant Induces an Increased Production of TNF- ...... 197 5.4.4 The tsp Mutant is Competent for Icm/Dot Translocation ...... 199 5.5 Discussion...... 201 5.6 Acknowledgments ...... 204 5.7 References ...... 205 General Discussion ...... 212 6.1 Lpr10 ...... 212 6.1.1 Regulation of Sigma Factors ...... 213 6.1.2 Lpr10 and Sigma Factor Competition...... 213 6.1.3 Detection ...... 215 6.2 Lpr17 and Tsp ...... 216 6.2.1 Lpr17 Partly Overlaps lpg0500 ...... 217 6.2.2 sRNAs Antisense to Tsps...... 219 6.3 Regulation by sRNA: Simple and Complex...... 219 6.4 Limitations ...... 221 6.4.1 Molecular Biology Tools ...... 221 6.4.2 Redundancy and Host Specificity ...... 222

5 6.4.3 Identification of sRNAs by Other Groups ...... 222 6.4.4 Target Prediction ...... 223 6.4.5 Northern Blot ...... 224 6.4.6 Microarray...... 224 6.4.7 Intracellular Multiplication ...... 225 6.5 Future Experiments ...... 226 Conclusion ...... 228 Appendix ...... 230 Complete List of References ...... 231

6 Abstract

Legionella pneumophila (Lp) is a Gram-negative, strictly aerobic bacterium that causes

Legionnaire’s disease (LD) in humans, a severe form of pneumonia with a fatality rate approaching 50% in individuals with a compromised immune system. Lp is an important cause of nosocomial and community-acquired pneumonia. Lp is found in natural and man-made aquatic environments where it replicates within protozoa. Inhalation of Lp-contaminated aerosols results in the infection of human alveolar macrophages, leading to the development of LD.

Small regulatory RNAs (sRNA) are short RNA molecules involved in post- transcriptional regulation. Previous studies have identified over 700 small regulatory RNAs expressed by Lp, but only a few have been characterized. Preliminary results showed that some of the sRNAs were differentially regulated in the exponential (E) phase and post-exponential

(PE) phase, in water, and by key transcriptional regulators. These experiments allowed the creation of a list of candidate sRNAs that potentially regulate genes in response to stress. The objectives of this thesis were to confirm the expression and size of the sRNAs, identify sRNAs that regulate Lp’s stress response, and identify the targets of these sRNAs. This thesis will focus on two sRNAs: the trans-encoded sRNA Lpr10 and the cis-encoded sRNA Lpr17. The expression of these two sRNAs was confirmed by northern blot and their size, transcription start site (TSS), and end were identified by RACE.

The Lpr10 sRNA is expressed in PE phase and in water. A microarray analysis of the transcriptome of a Lpr10 mutant in PE phase identified rpoS, the stress response sigma factor, as a possible target of Lpr10. RNAPredator, a prediction software, identified a putative binding site for Lpr10 in the rpoS mRNA, which was confirmed by EMSA and in-line probing. Using primer extension, a novel transcription start sites for rpoS, named TSS3, was identified. A polycistronic

7 mRNA produced from nlpD’s TSS was detected by RT-PCR, indicating the possibility of a fourth transcription start site (TSS4) for rpoS. The transcripts originating from TSS3 and TSS4 are regulated by the Lpr10 sRNA. The transcripts originating from the previously identified

TSS1 and TSS2 are not regulated by Lpr10. Regulation of rpoS by Lpr10 is based on a feedback loop between Lpr10 and RpoS. When RpoS levels are low, RpoS is produced from 4 different transcripts. However, as RpoS concentration increases, RpoS induces the expression of Lpr10, which is presumed to inhibit translation from the transcripts originating from TSS3 and TSS4, effectively reducing its overall translation level. Therefore, Lpr10 plays a role in maintaining an optimal intracellular concentration of RpoS in the post-exponential phase and in water.

The Lpr17 sRNA is encoded on the complementary strand of a gene coding a tail-specific protease (tsp). Lpr17 is expressed in E phase, while the Tsp protein is expressed in PE phase.

This result suggests that Lpr17 sRNA negatively regulates the expression of Tsp in E phase and under normal growth conditions. The CpxR/A two-component system, a major regulator in Lp, regulates Tsp in a Lpr17-independent manner. The role of Tsp in Lp was investigated. Tsp is important for surviving thermal stress. Furthermore, Tsp is required for optimal infection of amoeba if the temperature changes during infection. The tsp mutant is also unable to replicate within macrophages. The defect in intracellular multiplication is linked to an increased production of TNF-alpha by macrophages in response to the tsp mutant, which leads them to undergo apoptosis in order to limit Lp infection.

In conclusion, two regulatory sRNA involved in Lp’s response to stress have been characterized. The Lpr10 sRNA is involved in a regulatory feedback loop with RpoS, the stress response sigma factor. The Lpr17 sRNA regulates a tail-specific protease that is important for surviving thermal stress and for replication in host cells.

8 Résumé

Legionella pneumophila (Lp) est une bactérie Gram négatif aérobie stricte responsable de la maladie du légionnaire chez l’humain, qui se présente sous la forme d’une pneumonie aiguë sévère ayant un taux de mortalité d’environ 50 % chez les personnes avec un système immunitaire affaibli. Lp est une cause importante de pneumonie nosocomiale et communautaire.

Lp se trouve dans des systèmes aquatiques naturels et artificiels où la bactérie se réplique à l’intérieur de protozoaires, tels que les amibes. L’inhalation de gouttelettes d’eau contaminées amène la bactérie au niveau des poumons, où Lp infectent les macrophages alvéolaires et se répliquent à l’intérieur de ceux-ci.

Les petits ARN non codants sont de courtes molécules d’ARN qui permettent une régulation post-transcriptionnelle. Quelques études transcriptomiques ont mené à la découverte de plus de 700 petits ARN non codants chez Lp. Cependant, peu parmi eux furent caractérisés.

Des études préliminaires ont identifié plusieurs petits ARN différentiellement régulés durant la phase exponentielle (E) et post exponentielle (PE), dans l’eau, et par plusieurs régulateurs de Lp.

Ces études permirent d’identifier plusieurs petits ARN qui régulent potentiellement des gènes en réponse à un stress. Une liste de petits ARN candidats fut compilée afin de déterminer leurs rôles dans la régulation génique de Lp en réponse au stress. Les objectifs de cette thèse furent de confirmer l’expression et la taille des petits ARN candidats, d’identifier les petits ARN régulant la réponse au stress chez Lp, ainsi qu’identifier les cibles de ces petits ARN. Cette thèse se concentrera sur deux petits ARN : Lpr10, codé en trans et Lpr17, codé en cis. L’expression de ces deux petits ARN fut confirmée par buvardage de northern et leur taille, site d’initiation de la transcription (SIT) et la fin furent déterminés par RACE.

9 Le petit ARN Lpr10 est exprimé en phase PE et dans l’eau. Une analyse du transcriptome d’un mutant Lpr10 dans la phase PE par puce à ADN permit l’identification de rpoS, le facteur sigma de la réponse au stress, comme cible. RNAPredator, un logiciel informatique de prédiction de cibles de petits ARN, a permis d’identifier un site de liaison putatif entre Lpr10 et l’ARN messager de rpoS. Cette liaison fut confirmée par EMSA et in-line probing. Un nouveau SIT de rpoS, nommé SIT3, fut identifiés par extension d’amorce. Un ARN messager polycistronique provenant du SIT de nlpD fut détecté par RT-PCR, indiquant la possibilité de la présence d’un quatrième site d’initiation de la transcription (SIT4) pour rpoS. Les transcrits provenant de SIT3 et SIT4 sont régulés par Lpr10. Les transcrits provenant de SIT1 et SIT2, précédemment identifiés, ne sont pas affectés par Lpr10. La régulation de rpoS par Lpr10 est basée sur une boucle de rétroaction régulatrice entre RpoS et Lpr10. Lorsque les concentrations de RpoS sont faibles, celui-ci est produit à partir de 4 transcrits différents. Lorsque la concentration de RpoS est élevée, RpoS induit l’expression de Lpr10 qui est présumé d’inhiber la traduction à partir des transcrits provenant de SIT3 et SIT4. Lpr10 permet la régulation de la quantité de RpoS présent dans la bactérie lorsque celle-ci se retrouve dans l’eau ou dans la phase post-exponentielle.

Le petit ARN Lpr17 est codé sur le brin complémentaire du gène codant une protéase C terminal (tsp). Lpr17 est exprimé dans la phase exponentielle tandis que la protéine Tsp est exprimée dans la phase post-exponentielle. Lpr17 semble donc régulé négativement l’expression de Tsp dans la phase exponentielle et dans des conditions normales de croissance. Le système à deux composantes CpxR/A, un régulateur majeur chez Lp, régule l’expression de Tsp indépendamment de Lpr17. Le rôle de Tsp fut investigué. Tsp est requise pour la survie d’un stress thermique. De plus, Tsp est nécessaire pour une infection optimale d’amibes si un changement de température a lieu lors de l’infection. Tsp est importante pour la réplication

10 intracellulaire dans les macrophages. Le défaut de réplication observé chez un mutant tsp est lié à une production plus élevée de TNF-alpha par les macrophages en réponse au mutant tsp. TNF- alpha induit l’apoptose des macrophages, limitant ainsi la prolifération de Lp.

En conclusion, deux petits ARN régulateurs impliqués dans la réponse au stress de Lp furent caractérisés. Le petit ARN Lpr10 fait partie d’une boucle de rétroaction régulatrice avec

RpoS, le facteur sigma de la réponse au stress. Le petit ARN Lpr17 régule une protéase C- terminale nécessaire pour survivre un stress thermique et pour la réplication dans les cellules hôtes.

11 Acknowledgements

I would like to thank my father for his support not only throughout my PhD, but throughout my entire academic years. I got my good work ethics from him. I learnt to work hard as long as it takes and that you can rest when you are dead. He is probably why I never took a vacation since my master’s degree, started in 2013.

I would like to acknowledge myself too. I know it is not usual, but people that know me would confirm that I am not your usual PhD student. I have developed an amazing work ethic during my life, and I have worked tirelessly throughout my PhD, cramming as many experiments as possible. I always maintained my motivation to do experiments. Perhaps my motivation was not as high when it came to writing, but I am sure it was on par if not above the average PhD student. If I could bottle my awesomeness and sell it, I would have been a billionaire by now.

Luckily, there is no charge for awesomeness. I did have to put up with myself on a daily basis, and that alone deserves a prize.

Most importantly, I would like to thank my supervisor, Professor Sébastien Faucher, for giving me the opportunity to join his lab and complete my PhD. I was unable to join as early as he would have liked, but I am grateful he waited a few months to have me instead of another student for this project. Knowing how lucky I was to find such a great supervisor, I made sure he did not regret his decision to hold off on other students by catching up on the lost time and getting ahead, as well as picking up some of the administrative work. He was definitely the best supervisor I had. He was always welcoming when you needed to chat whether for personal reason or regarding your project. He found out rather early that I do not put up with bs from anybody and managed to deal with it in regard to my interaction with other students. It was not always easy to contain my temper, and he was understanding though he did have to calm me

12 down. Luckily for both of us, I was a lot calmer when I joined his lab compared to before. He did help me grow mentally as well and showed me how to deal with bad situations when it came to students/employees. Thank you for the opportunity and for your great guidance!

My supervisory committee members, Professor Brian Driscoll and Professor Éric Massé, were also instrumental to completing my PhD. We met once a year and, despite giving me a tough time every now and then, they always had constructive feedback and helped guide my project in the right direction. I should be honest though, I am saying they gave me a tough time, but during my last meeting I gave myself a tough time by not being well prepared to answer questions and having all the notions mixed up in my head. The questions were not out of place, it was my brain that forgot to show up.

My comprehensive committee members made me realize how important it is not to memorize all the information you find in articles, but to actually use that knowledge to answer difficult questions. This is a priceless skill to have. Thank you to Professors Éric Massé, Lyle

Whyte, Jean-Benoit Charron, and Nil Basu for being on my committee and for your feedback.

I would like to thank past and present lab members for their help, support, and friendship.

They are not presented in any particular order, so do not take offence. Hana Trigui and Nilmini

Mendis welcomed me when I first got to the lab and provided good feedback in my regards. I really appreciated that.

• Hana was always smiling and in a good mood. I always enjoyed talking to you!

• Nilmini spent a good amount of time the first few weeks training me for which I am

thankful. She is a great and patient teacher and was always eager to share her

knowledge and help out. I believe I made it easy with my previous knowledge and my

quick learning, but she would spend the extra time if it was needed. I saw how she

13 trained other students with less experience, and wow she is patient and good. I do

appreciate the extra effort she put in when baking a cake for my birthday due to my

allergy. She often laughed at my jokes and when they were terrible, I could always

count on Peter McBride to laugh!

• It was usually a fun day when Kiran Paranjape was in the lab. It was great reuniting

with you after working in the same lab during our bachelors. You were reliable and

you were meticulous in your work. Thank you for your friendship and the laughs

throughout the years, it was fun (even though you did not seem to think so according

to your acknowledgement section. That is right, I went there).

• Mariam Saad, your face of despair when hearing my lame puns made my jokes

funnier. It was always fun to hang with you.

• Durai Mani, I will never understand how calm you are. I am happy Kiran and I got

you to open up near the end, we turned you into one of us! You were always ready to

help and it was appreciated. It was great having you as a friend in the lab.

I did not get to supervise many undergrads, mostly due to the nature of the projects available.

Here is one notable mention.

• The best student I had the opportunity to supervise is Bérénice Saget and I am glad

for the opportunity. Except on days when you were tired, you were a fast learner and

a smart student. You put in many hours at the lab and I am glad you did because I did

enjoy the time we spent together. You were fun to talk to and one of the few who

shares my sense of humour as well as my confidence. I know I taught you how to

work well, various techniques from molecular microbiology to infections, and most

importantly, how to be confident and tell people how awesome you are. We

14 motivated each other to stay in shape and go run at the gym until everything shut

down. Running on a treadmill while judging people is far better than running alone

listening to music!

I never got the chance to meet her besides by videoconference, but Marie-Claude Carrier, a PhD student in Professor Éric Massé’s lab, was phenomenal. She helped me with my first paper by performing a few experiments, helped write certain sections of the Lpr10 paper, and corrected the manuscript many times. I usually do not like having someone work on my project because I do not trust their work. However, I quickly trusted you and that is a huge compliment coming from me. You are very smart, hardworking, and very diligent with your work. You did the experiments on top of your other work and without delay. I am glad we got to partner up for a project. I am very thankful not only for all you did for the paper, but for accepting to help out in the first place. Maybe Professor Massé did not give you much of a choice, but I will just stick to the story of you willingly helping out.

I do not know how I would have gotten my work done without the chemidoc and qPCR machine located in Jean-Benoit Charron’s lab. Thank you for letting me use your equipment and for never getting annoyed when I needed you to unlock the door or to log me into the computer. I am also thankful that you provided me with access after-hours to the qPCR machine.

A big thank you to Dr. Dave Meek for his help and ensuring everything is running in the department. He was always there when needed.

The animal facility members made caring for mice easier. Not only did they provide tips when the breeding was not optimal, but they cared for them on a daily basis. They ensured we never ran out of material. Thank you Holly Esak, Diane Langan, and Karen Hope for all your help.

15 The AJ and B6 mice gave me trouble sometimes, they even tried to bite me when I was weaning them, but they gave their life for my experiments. Technically, I took their life for my experiments, but they still died so I have to acknowledge them. Thank you to all, it was MICE knowing you.

I also need to thank Professor Petra Rohrbach, Jeffrey Agyapong, and Dr. Norma

Bautista-Lopez for their help and advice in regard to microscopy. Dr. Sarah Guadiana from

BioTek was simply awesome. She is the representative for the Cytation 5 imaging plate reader.

We had a few videoconference calls where she helped me set up the protocol and told me how to obtain quality images, including one where we went through the protocol as I was setting up the plate. She replied to her emails quickly and was always helpful.

This PhD would not have been possible without the various funding agencies that were involved. A big thank you to CIHR, FRQNT, CRIPA, and McGill.

This list would not be complete without mentioning my two best friends Pierre-André

Casgrain and Alain Perks. We all had messed up schedules and it was difficult to find time to see each other, but we did the most out of that time. It always felt great seeing you guys and know you had my back throughout everything. PA’s daughter was born on the 28th of April 2020 and

Alain’s son will be born in November 2020. So happy for you guys!

I also have to mention Claudio Mikhail. When my body was breaking apart from overworking, you were the only one that realized I just needed to exercise. You got me all fixed up, got me into a healthier lifestyle, and into enjoying working out. Two to three-hour workouts would have been impossible before we met. You are the only person with a humour as dark as mine and love having you as a close friend. You faced many hurdles throughout your life and never gave up, which is inspirational.

16 When I was unsure about applying with Professor Faucher because his website only mentioned he was looking for a master’s student, Christine Lepage pushed me to apply anyways.

I probably would never have applied without her push. She was always supportive throughout my PhD and tolerated my humour and shocking videos which is why I always think she is great.

I need to give a mention to Hennessy, Raynal, Courvoisier, and Plantation for helping me get through this. Every sip tasted amazing and helped me relax at the end of the day. Numerous bottles were sacrificed for the greater good. I bought a bottle of Hennessy V.S. at the start of my

PhD that is only meant to be opened at the end of this journey. I cannot wait to open it. It is just too bad cognac does not age in a sealed bottle.

Finally, I have to thank Brooke, my Kia Forte EX 2015. Yes, I am talking about my car and no I am not crazy. We met in January 2015 and we had a great partnership ever since. She always ensured I made it to the lab and back, never gave me problems, and kept me warm in the winter and cool in the summer. She purred on the road and gave her all when we needed to teach someone a lesson.

“To live is to suffer but to survive, well that’s to find the meaning in the suffering” DMX

“The snakes, the grass, too long to see the lawnmower sitting right next to the tree” DMX

“There is a difference between doing wrong and being wrong” DMX

“Squares in your circle will always fuck up the shape of it” Jadakiss

“I’m cut from a different cloth that no longer exists, self cut” Jadakiss and Styles P

“I’m not cocky, I’m confident. So when you tell me I’m the best, it’s a compliment” Jadakiss

Ruff Ryders!

D-Block!

17 Contribution to knowledge

The work accomplished throughout the thesis contribute to our understanding of the function of two small regulatory RNAs in Legionella pneumophila. In addition, the importance of a tail-specific protease in surviving thermal stress and during infection has been demonstrated.

1. I have shown that the Lpr10 sRNA is part of a regulatory feedback loop which prevents

overexpression of RpoS. Lpr10 is the second trans-encoded sRNA of Lp for which the

target was identified. Lpr10 is the first sRNA in Legionella that regulates rpoS.

2. Two new transcription start sites (TSS) for rpoS, the stress response sigma factor, have

been identified and were termed TSS3 and TSS4. Transcripts originating from TSS3 and

TSS4 are regulated by the Lpr10 sRNA. Our results indicate that the regulation of this

major regulator of gene expression is far more complex than previously thought. The

presence of four transcription start sites indicates the importance of integrating various

stress stimuli in order to respond accordingly to the current situation in and outside the

cell.

3. My work shows that the sRNA Lpr17 likely inhibits translation of Tsp in E phase and

under normal growth conditions. Tsp is expressed in PE phase and following thermal

stress. The two-component system cpxRA was shown to regulate Tsp independently of

Lpr17.

4. I have found two new functions for Tsp in Legionella. Tsp is important for dealing with

thermal stress. A tsp mutant strain was defective for intracellular growth in amoeba

following a temperature shift. This mutant was also unable to survive a thermal stress at

55°C, a temperature encountered in hot water distribution system, typically linked to an

outbreak of Lp.

18 5. Tsp is also required for infection of primary macrophages. A tsp mutant strain displays

less intracellular growth, more cytotoxicity and increases activation of macrophages, as

demonstrated by increased secretion of TNF-alpha. Surprisingly, this effect is

independent of the Icm/Dot secretion system, the main virulence system in Lp.

19 Contribution of authors

Contribution of Authors Chapter 3

I am the co-first author for chapter 3 along with Marie-Claude Carrier. I have conducted the majority of the experiments related to the manuscript including constructing the mutant and the complemented strain, northern blot, RACE, infection of amoeba and macrophages, survival in water, preparation of samples for microarray, microarray, RT-PCR, and qPCR as well as the analysis of the results from the experiments I performed. I wrote the first draft of the manuscript and edited the manuscript. Marie-Claude Carrier performed the various EMSA, in-line probing, and primer extension. She performed the data analysis of the results she generated and helped in editing the manuscript. Éric Massé and Sébastien Faucher helped with the experimental design, data analysis, and editing of the manuscript.

Contribution of Authors Chapter 4

I am the first author of the manuscript. I performed all the experiments presented, analyzed the data generated, wrote the first draft of the manuscript, and edited the manuscript.

Thangadurai Mani performed preliminary experiments including RACE and constructing the mutant strains. He helped with the editing of the manuscript. Sébastien Faucher helped with the experimental design, data analysis, and editing of the manuscript.

Contribution of Authors Chapter 5

I am the first author for the manuscript. I performed all the experiments except for the translocation assay. I analyzed the data, wrote the first draft of the manuscript and edited the manuscript. Thangadurai Mani did the translocation assay and helped with editing the

20 manuscript. Petra Rohrbach and Sébastien Faucher contributed to the experimental design, data analysis, and editing of the manuscript.

21 List of Abbreviations

AYE: ACES-Yeast Extract

CDC: Centre for Disease Control and Prevention (USA)

CFU: Colony Forming Unit

CYE: Charcoal Yeast Extract

DNA: Deoxyribonucleic Acid

E Phase: Exponential Phase

ECDC: European Centre for Disease Control and Prevention

EEA1: Early Endosomal Antigen 1

ER: Endoplasmic Reticulum

GFP: Green Fluorescent Protein

ICM: Intracellular Multiplication

IPTG: Isopropyl-β-D-thiogalactopyranoside

LAMP-1: Lysosomal Associated Membrane Protein

LB: Lysogeny Broth

LCV: Legionella Containing Vacuole

LD: Legionnaires’ Disease

LetA/S: Legionella transmission Activator/Sensor

LPS: Lipopolysaccharide

Lqs: Legionella Quorum Sensing

MIF: Mature Infectious Form

MOI: Multiplicity of Infection

NAIP: Neuronal Apoptosis Inhibitory Protein

22 NLR: Nod-Like Receptor

Nt: Nucleotide

OD: Optical Density

PAMP: Pathogen-Associated Molecular Pattern

PCR: Polymerase Chain Reaction

PE Phase: Post-Exponential Phase

PHB: Poly-3-Hydroxybutyrate ppGpp: Guanosine Pentaphosphate

PRR: Pattern Recognition Receptor

PtdIns(3)P : Phosphatidylinositol 3-phosphate qPCR: Quantitative Polymerase Chain Reaction

RACE: Rapid Amplification of cDNA Ends

RBS: Ribosome Binding Site

RNA: Ribonucleic Acid

RNAP: RNA Polymerase

ROS: Reactive Oxygen Species rRNA: Ribosomal Ribonucleic Acid

SNARE: Soluble NSF Attachment Receptor sRNA: Small regulatory Ribonucleic Acid

TISS/T1SS: Type 1 Secretion System

TIISS/T2SS: Type 2 Secretion System

TIVSS/T4SS: Type 4 Secretion System

TIVaSS/T4aSS: Type 4 A Secretion System

23 TIVbSS/T4bSS: Type 4 B Secretion System

TLR: Toll-Like Receptor

Tx/T0: Time X over Time 0

VBNC: Viable But Not Culturable

WT: Wild Type

24 Chapter 1: Introduction

Legionella pneumophila (Lp) is a Gram-negative strictly aerobic bacterium that inhabits natural and man-made water systems, where it replicates inside amoeba and ciliates (Wadowsky et al. 1991; Taylor et al. 2009). Lp has a biphasic life cycle, alternating between the replicative and transmissive phase, which are mimicked by the exponential phase (E phase) and the post- exponential phase (PE phase), respectively, when grown in rich broth (Byrne and Swanson 1998;

Swanson and Hammer 2000). Lp is able to colonize various artificial water systems capable of generating aerosols, such as cooling towers, hot water distribution systems, and water fountains

(van Heijnsbergen et al. 2015; Paranjape et al. 2019). When Lp-contaminated aerosols are breathed in, Lp finds its way into the lungs where it infects alveolar macrophages, causing a severe pneumonia known as Legionnaires’ Disease or a milder form characterized by flu-like symptoms called Pontiac Fever (Percival and Williams 2014). With the increase of man-made water systems, Lp infections are on the rise. Between the years 2000 and 2014, the cases of legionellosis in the USA have increased by 286 % (Garrison et al. 2016). In 2013-2014,

Legionella was responsible for 94 % of hospitalization and all death related to waterborne disease in the USA (McClung et al. 2017). Across Europe from 2016 to 2017, the number of cases has increased by 30 % and the mortality rate has reached 8 % (ECDC 2019).

Small regulatory RNAs (sRNA) are short RNA molecules usually involved in post- transcriptional regulation (Apura et al. 2019). They can positively or negatively regulate their targets. They are involved in various bacterial processes, such as metabolism, stress response, and virulence (Apura et al. 2019; Desgranges et al. 2020). Cis-encoded sRNAs are encoded on the complementary strand of the gene they regulate and therefore have a perfect complementarity with their target mRNA (Apura et al. 2019). Trans-encoded sRNAs, on the other hand, are

25 encoded within their own locus and display an imperfect complementarity with their target mRNA (Apura et al. 2019). In silico, microarray, and RNA-sequencing studies have identified over 700 sRNAs in Lp; however, only a few have been characterized (Faucher et al. 2010;

Weissenmayer et al. 2011; Sahr et al. 2012). Microarrays were previously used to study the transcriptome of Lp in various conditions such as E and PE phase, in water, and in mutants of major regulators (Faucher et al. 2010; Li et al. 2015; Trigui et al. 2015). Some sRNAs in these studies were differentially regulated in the conditions tested, suggesting a role in regulating stress and/or virulence in Lp. A list of candidate sRNAs was drawn and I confirmed the expression of these sRNAs in both E and PE phase by northern blot. Rapid Amplification of cDNA Ends

(RACE) was used to identify the transcription start site and the end of the small RNAs detected by northern blot. Deletion mutants of the sRNAs detected by northern blot were screened for various phenotypes. A summary of the candidate sRNAs is presented in Table 1 in Appendix 1.

The thesis presented here focuses on two sRNAs for which a phenotype was found early on: the trans-encoded Lpr10 and the cis-encoded Lpr17.

Since Lpr10 was found to be regulated in water and by RpoS, we hypothesized that

Lpr10 plays a role in survival in water and it regulates genes involved in dealing with starvation, as water is a nutrient poor environment. The objectives were to identify genes regulated by

Lpr10, to determine the role of Lpr10 in survival in water, and if it is required for intracellular multiplication (ICM) in host cells.

Lpr17 is encoded on the complementary strand of a gene coding for a tail-specific protease (tsp). Since these proteases are involved in dealing with thermal stress and virulence, we hypothesized that a tsp mutant will be unable to survive thermal stress and unable to replicate in host cells. Given that cis-encoded sRNAs regulate the gene encoded on the complementary

26 strand, we also hypothesized that Lpr17 will either upregulate or downregulate the expression of

Tsp by targeting the tsp mRNA. The objectives were to test the importance of Tsp during thermal stress at 55 C as well as during infection of host cells, and to determine the role of

Lpr17 in the regulation of tsp.

27 Chapter 2: Literature Review

2.1 Introduction

Full-bodied and complex or medium bodied and fruity? Few minutes of contemplation, the decision should not be this difficult! I finally settle on full-bodied and complex, as I cannot resist the curves and the colour; a gorgeous bell shape figure with a silky dark copper tone. I remove the wrapper and bring my nose closer as the aroma of apple, apricot, clove, and cinnamon harmoniously fuse together and tickle my nose, teasing me. After a few swirls, with an enormous smile on my face, I finally decide to go for a taste. The fruity taste complements the clove and cinnamon. Wow, the taste is amazing. I thought to myself, we both need to breathe a little right now. As the temperature seems to suddenly climb, I reach in the freezer and grab two ice cubes. We both rush to my room, I sit down in my computer chair staring at the shiny heavenly creature sitting on my computer desk, staring back at me with a naughty smile. As I start writing this paragraph, I knew I made the right choice. A glass of Hennessy V.S.O.P.

Privilege is the partner I need right now to write my thesis. As my drink starts to chill, a subtle taste of vanilla can now be perceived. The ice cubes are slightly melting, diluting the cognac. As terrible as this might sound, the Master Blenders at the Hennessy cognac house took that into consideration. The added water along with the temperature drop reveals a noticeable sweet taste, perhaps of honey or light caramel, along with a subtle tone of oak and violet. The after taste has a slight bitterness to it, perfectly balancing the various tones and enough to bring me back down from the clouds. Combined with the spice aroma, this is simply divine.

Cognac is a type of brandy that must be produced in the region of Cognac, in France

(Faith 2015; Hennessy 2020a). The main variety of grape that must be used is called Ugni Blanc, but it can be mixed with the Folle Blanche and Collombard grape variety (Faith 2013). The

28 producers are allowed to use up to 10 % of other select grape varieties, such as Folignan,

Jurançon Blanc, Meslier St-François, Montils, or Semillon (Faith 2013). While brandy is only distilled once, cognac is double distilled in copper stills, a process that can only take place between the 1st of November and the 31st of March (Faith 2013; Awad et al. 2017; Hennessy

2020a). The resulting eau-de-vie, containing 70 % alcohol, is aged in Limousin or Tronçais oak barrels (Faith 2013; Mytnikova 2019). The minimum alcohol content of cognac when sold is 40

%, and pure water is usually added during the aging process to reduce the alcohol content to the desired level (Faith 2015). The various cognacs can now be blended together, bottled, and enjoyed. The three main cognac classifications are: V.S. (Very Special) if the youngest cognac in the blend was aged for 2 years, V.S.O.P. (Very Special Old Pale) if the youngest cognac is 4 years old, and X.O. (Extra Old) if the youngest cognac is 6 years old (Lukacs 2002; Faith 2013).

By the same classification, when I graduate, I will be a V.S.O.Ph.D!

From the start to the end of the process, as well as all the components required to make cognac, have one thing in common: water. It is the source of life, not only because it is required for hydration, but what kind of world would we be living in without cognac?! However, water can also make us ill and can even be lethal. For the longest time, the general population associated waterborne diseases with gastrointestinal diseases arising from Escherichia coli and

Vibrio cholerae, the latter still causing major outbreaks worldwide (Wang et al. 2013; Deen et al.

2020; Reynolds et al. 2020). However, a new danger associated with water was discovered in

1976. On that year, the Bellevue-Stratford Hotel in Philadelphia was hosting the American

Legion Convention when suddenly 221 attendees fell ill, of whom 34 passed away in the following weeks (Fraser et al. 1977). The pathogen responsible for the disease was isolated by

29 the Center for Disease and Control (CDC) and called Legionella pneumophila (Lp) (Fraser et al.

1977; Winn 1988).

Lp is a Gram-negative, rod-shaped, and strictly aerobic Gammaproteobacteria (Percival and Williams 2014). All identified Legionella species are motile, with the exception of

Legionella oakridgensis, Legionella londinensis, and Legionella nautarum (Percival and

Williams 2014). It causes an atypical pneumonia that can be quite severe known as

Legionnaires’ Disease (LD), but can also cause a milder illness with flu-like symptoms called

Pontiac Fever (Percival and Williams 2014). LD affects organs other than the lungs, such as the gastrointestinal, nervous, and urinary systems (Caterino 2013). The effects on other organs are the result of dissemination of the bacteria within the body (Caterino 2013). The incubation period for LD is 2 to 14 days while that of Pontiac Fever is 5 to 66 hours. LD symptoms can last weeks to months, while the symptoms of Pontiac Fever last for 2 to 7 days (Percival and

Williams 2014). Symptoms of LD include fever, a non-productive cough, headache, weakness, myalgias, rigors, diarrhea, delirium, dyspnea, fatigue, bloody or purulent sputum, and bradycardia (Percival and Williams 2014). Symptoms of Pontiac Fever are fever, chills, myalgia, and headache (Percival and Williams 2014). Fatality of LD is often associated with acute renal failure, disseminated intravascular coagulation, shock, respiratory insufficiency, coma, and circulatory collapse (Percival and Williams 2014). The people most at risk of developing LD are males older than 50, smokers, immunocompromised individuals, and people suffering from cancer or diabetes (Mondino et al. 2020). It is difficult to differentiate between a pneumonia caused by Legionella and a pneumonia caused by other microorganisms such as Streptococcus,

Mycoplasma, and Chlamydia due to their similar clinical aspects (Roig et al. 1991; Edelstein

1993; Diederen 2008). Therefore, it is important for patients with symptoms of pneumonia to be

30 tested for Legionella and positive cases reported to the appropriate government authorities

(Marrie et al. 2010). Identification of the contaminated water supply would ensue, and corrective measures can be taken. The early identification of a pending outbreak could prevent it from occurring (Marrie et al. 2010).

2.2 Legionella’s General Characteristics

Despite being linked with the first outbreak of 1976, Legionella had previously been isolated in 1943 from guinea pigs, and in 1954 from protozoa (Tatlock 1944; Hookey et al.

1996). The Legionella genus contains 65 species, of which Lp is responsible of 70 % of legionellosis, a term used to describe disease caused by Legionella (Percival and Williams 2014;

Rizzardi et al. 2015; Mondino et al. 2020).

Cases of legionellosis can be community acquired, nosocomial, domestically acquired or travel associated. Lp is responsible for 80-90 % of LD cases in the USA and Europe, with Lp serogroup 1 causing approximately 90 % of all legionellosis cases (Mondino et al. 2020). Lp serogroup 1 encodes various enzymes that modify the LPS, which contributes to the serogroup’s higher virulence (Cazalet et al. 2008).

Other Legionella species that cause disease in humans are Legionella longbeachae,

Legionella micdadei, Legionella bozemanii, and Legionella dumoffi (Percival and Williams

2014). Legionella longbeachae is often found in soil and compost and causes 50 to 60 % of legionellosis cases in Australia and New Zealand, though they represent 1 % of worldwide cases

(Finsel and Hilbi 2015; Mondino et al. 2020).

Legionella prefers to use amino acids as a source of carbon (Percival and Williams 2014).

Arginine, cysteine, methionine, serine, threonine, and valine are essential amino acids for the

31 growth of most Legionella isolates (Percival and Williams 2014). L. ookridgensis and L. spiritensis do not require cysteine for growth (Percival and Williams 2014). Legionella is superoxide dismutase positive, weakly peroxidase positive, weakly catalase positive, oxidase variable, and many species produce -lactamase (Percival and Williams 2014).

Lp is able to replicate inside at least 30 different species of protozoa such as amoeba and ciliates including Acanthamoeba castellanii and Vermamoeba vermiformis (formerly

Hartmanella vermiformis) (Ensminger 2016; Boamah et al. 2017). Since they are able to grow on laboratory media, they are facultative parasites of protozoa (Rihova et al. 2017).

Up to 80 % of freshwater environments contain members of Legionella (Borella et al.

2005; Devos et al. 2005). However, infections from natural water systems do not occur, probably because the concentrations of Lp are too low to cause disease (Fields et al. 2002; CDC 2018).

Transmission of Legionella infection between humans is possible though rare, as only one suspected case of human-to-human transmission has been reported (Correia et al. 2016).

Lp infections are treated with antibiotics. Erythromycin is usually given, and ciprofloxacin and rifampicin are also effective against Lp (Percival and Williams 2014). The antibiotic class of fluoroquinolones is very effective at treating Lp, unlike -lactams and aminoglycosides. Despite showing promising minimum inhibitory concentration values in laboratory conditions, -lactams and aminoglycosides do not seem to be effective when Lp is inside host cells (Percival and Williams 2014). Furthermore, many Legionella species express a

-lactamase, making this class of antibiotic ineffective against it (Percival and Williams 2014).

Other antibiotics that were shown to be effective are clarithromycin, azithromycin, ciprofloxacin, tetracycline, and doxycycline (Percival and Williams 2014).

32 2.3 Life Cycle

Lp has a biphasic life cycle, alternating between the replicative phase and the transmissive phase, though further phases have been suggested (Byrne and Swanson 1998;

Swanson and Hammer 2000; Molofsky and Swanson 2004). The most important virulence factor during host cell infection is the Icm/Dot type IVb secretion system (see section 2.6.4.1 for details), which injects over 330 effector proteins inside the cytoplasm of the host cells in order to stop phagolysosome fusion and establish a replicative niche (Ensminger 2016). When nutrient concentrations are elevated, Lp is in the replicative phase. It is not motile, resistant to sodium, not cytotoxic, and generally sensitive to stress (Byrne and Swanson 1998; Hammer et al. 2002;

Forsbach-Birk et al. 2004; Eisenreich and Heuner 2016). However, as nutrients become scarce,

Lp will switch to the transmissive phase where it will express cytotoxicity-related traits and genes required for infection of a new host, becoming motile, salt-sensitive, and resistant to various stresses including heat, oxidative stress and acid stress (Byrne and Swanson 1998;

Forsbach-Birk et al. 2004; Faucher et al. 2011; Correia et al. 2016; Eisenreich and Heuner 2016).

When Lp is grown in rich broth, the replicative phase can be mimicked by the exponential phase

(E phase) and the transmissive phase can be mimicked by the post-exponential phase (PE phase).

During infection of protozoa, after reaching the transmissive phase, it is reported that Lp can further differentiate into the mature infectious form (MIF), which is a spore-like form that is more resistant to various stresses (Garduno et al. 2002). When compared to cells grown to post- exponential phase in rich broth, MIFs are shorter, have a different cell wall structure, are more infectious, and are more resistant to stresses including antibiotics, detergents, pH, and oxidative stress (Faulkner and Garduno 2002; Garduno et al. 2002; Koubar et al. 2011). Lp does not

33 differentiate into the MIF form following infection of macrophages, and the authors suggest this could explain the inability of transmission between humans (Abdelhady and Garduño 2013).

RpoS and the LetA/S-CsrA system are important for the switch between the replicative and transmissive phase, as well as the transition into the MIF form (Molofsky and Swanson

2004; Berk et al. 2008; Faulkner et al. 2008). ppGpp, the alarmone produced in response to starvation of amino acids and fatty acids, initiates the stringent response which is important for

Lp to switch between the replicative and transmissive phase (Hammer and Swanson 1999;

Bachman and Swanson 2001; Tiaden et al. 2007; Dalebroux et al. 2009; Dalebroux et al. 2010).

Details on regulatory system of Lp are provided in section 2.7.

2.4 Host Cell Infection

Besides protozoa and alveolar macrophages, Lp is able to infect various human cell types such as fibroblasts, epithelial cells, and peripheral blood monocytes (Percival and Williams

2014). Minor differences in the infection of different hosts exist, but the basis of the infection cycle is the same. There are four steps in the infection of host cells by Lp. The first step is attachment and entry, the second step is establishment of the LCV, the third step is replication, and the fourth step is egress (Eisenreich and Heuner 2016). Figure 1 summarizes the four steps of host cell infection.

34

Figure 1: Schematization of host cell infection by Legionella pneumophila. The infection of host cells can be divided in 4 steps, highlighted by the green rectangles. 1: Attachment and entry;

2: Establishment of the LCV; 3: Replication; 4: Egress. See main text for details.

2.4.1 Attachment and Entry

Lp can enter host cells by conventional phagocytosis or by coiling phagocytosis (Horwitz

1984; Elliott and Winn 1986; Rechnitzer and Blom 1989; Bozue and Johnson 1996). Coiling phagocytosis consists of asymmetrical engulfment of a bacteria where pseudopods surround the extracellular bacteria before internalization (Rittig et al. 1998). Internalization of Lp by

Dictyostelium discoideum occurs by micropinocytosis, a form of receptor-independent endocytosis (Peracino et al. 2010). The attachment to host cells is dependent on the flagellum and various proteins: EnhC, PilE, RtxA, SdeA, LadC, LcI, Momp, and Hsp60 (Eisenreich and

35 Heuner 2016). The type 1 secretion system (T1SS) is required for entry into the host cell and seems to promote internalization by host cells (Hilbi et al. 2001; Watarai et al. 2001; Fuche et al.

2015). RtxA is a substrate of T1SS and plays a role as an adhesin and as a pore-forming toxin

(Cirillo et al. 2001; Cirillo et al. 2002; Fuche et al. 2015). RtxA is similar to the adhesin LapA of

Pseudomonas fluorescens (Brown et al. 2020).

2.4.2 Establishment of the LCV

Once inside the host cell, Legionella will modify the phagosome into a comfortable niche known as the Legionella containing vacuole (LCV). The Icm/Dot type 4 secretion system is crucial for modifying the phagosome and establishing the LCV (Horwitz 1983b). Effectors are secreted into the host cell which will 1) prevent the fusion between the phagosome and lysosome and 2) recruit mitochondria and smooth vesicles from the endoplasmic reticulum (ER) within 15 minutes of internalization and vesicles from the rough ER and ribosomes within 4 hours post- infection (Horwitz 1983a; Abu Kwaik 1996; Tilney et al. 2001; Eisenreich and Heuner 2016).

2.4.3 Replication

The availability of nutrients within the host regulates Lp differentiation from the transmissive phase to the replicative phase. Once the LCV is established, Lp will replicate, which usually starts 4 to 8 hours post-infection (Abu Kwaik 1996; Abu Kwaik et al. 1998). By the end of the replication cycle, the host cell will be filled with hundreds of Lp cells (Molmeret et al.

2004).

36 2.4.4 Egress

Once nutrients are scarce inside the host cell, Lp will differentiate into the transmissive phase, released into the cytoplasm, and exit the host cell by lysing it (Eisenreich and Heuner

2016). During infection of protozoa, Lp will further differentiate into MIFs before being released into the cytoplasm. Various enzymes are implicated in the lysis process, including RtxA, legiolysin, the metalloprotease MspA and phospholipases (Eisenreich and Heuner 2016). Lp can also exit protozoa without cell lysis by using the LepA and LepB proteins (Chen et al. 2004). Lp released in this manner will be enclosed in a vacuole (Chen et al. 2004). Lp is able to survive up to 6 months in these vacuoles, and they are highly infectious to humans (Chen et al. 2004;

Bouyer et al. 2007). The Lp cells released into the extracellular environment are ready to infect a new host cell or survive in the environment until a new host is encountered (Eisenreich and

Heuner 2016).

2.5 Immune Response:

The first line of defence against Legionella is the innate immunity which relies on pattern recognition receptors (PRRs) to recognize pathogen associated molecular patterns (PAMPs), molecules solely expressed by the invading microorganisms (Park et al. 2017). PRRs can be divided into two groups: Toll-like receptors (TLR) and Nod-like receptors (NLR). TLRs recognize substrates on the cell surface or on the surface of a vacuole such as a phagosome

(Akira et al. 2006). NLRs recognize substrates in the cytoplasm (Akira et al. 2006). PRRs that detect ligands within the cytoplasm or on the surface of vacuoles are crucial for the immune response against Legionella as it is an intracellular pathogen that is able to replicate within a vacuole.

37 Phagocytes, such as macrophages, play a crucial role in innate immunity and will allow the activation of the adaptive immunity and production of antibodies (Amer 2010; Luo 2012).

Patients who have recovered from legionellosis have circulating anti-Legionella antibodies in their serum and the adaptive immune response is faster during a second Legionella infection

(Joller et al. 2007; Rudbeck et al. 2008).

2.5.1 Cytokine Production

The body produces various cytokines in response to a Lp infection. The main cytokines produced are TNF-, IFN-, IL-1, IL-6, IL-8, and IL-12. They regulate the immune system in order to limit Lp proliferation (Kragsbjerg et al. 1995; Tateda et al. 1998; Friedman et al. 2002;

Percival and Williams 2014). TNF- will activate phagocytes, increase the ability of macrophages to kill intracellular bacteria, and protect neighbouring cells from infections by intracellular pathogens (Friedman et al. 2002; Percival and Williams 2014). Neutrophils, in presence of TNF-, will increase phagocytosis and oxidative burst (Friedman et al. 2002). TNF-

 will also stimulate a further production of IFN- (Percival and Williams 2014). IFN- limits the amount of iron inside the host cell by decreasing intracellular concentration of ferritin and downregulating transferrin receptors (Percival and Williams 2014). IL-12 will induce production of TNF- by Th1 cells, resulting in an increased number of activated macrophages, which are more resistant to Legionella (Friedman et al. 2002).

2.5.2 Detection

Activation of NLRs leads to the activation of sets of proteins known as the inflammasome, which results in the cleavage and activation of caspase-1 (Mascarenhas and

38 Zamboni 2017). Activation of caspase-1 leads to the processing and activation of IL-1 and IL-

18, and results in pyroptosis, a form of inflammatory cell death characterized by presence of pores in the membrane, swelling, and osmotic lysis causing the release of inflammatory cytokines in the extracellular environment (Mascarenhas and Zamboni 2017). Inflammasomes are important for restricting replication of many pathogens, including Lp (Mascarenhas and

Zamboni 2017).

2.5.2.1 Mouse Model

The guinea pig was the first animal model used to investigate Lp infection as the guinea pig is highly susceptible to Lp infection and displays symptoms similar to LD in humans

(Baskerville et al. 1981). However, the guinea pig is not suitable for studying the immunological response of Lp as guinea pig-specific commercially produced reagents and kits are rare and difficult to procure (Brown et al. 2013). This caused a shift to work with mice despite having only one strain of mice, the A/J strain, that is permissive to Lp infection (Brown et al. 2013).

When infected intratracheally, the A/J mice develop an acute pneumonia similar to humans within 48 hours post-infection (Brown et al. 2013). Macrophages derived from the A/J strain are permissive for Lp replication (Brown et al. 2013). In contrast, C57BL/6 and BALB/c mice are resistant to the infection and their macrophages are resistant to intracellular growth of Lp

(Brieland et al. 1994; Brown et al. 2013).

2.5.2.2 Nod-Like Receptors

In mice, NAIP5, a member of the NLR family of immune receptors, recognizes bacterial flagellin in the cytosol, which leads to the activation of the inflammasome and caspase-1,

39 therefore limiting the extent of the infection (Lamkanfi and Dixit 2009; Brown et al. 2013; Liu and Shin 2019). A flagellin-deficient strain of Lp is able to replicate in mice that are restrictive to the growth of the WT (Brown et al. 2013). A mutation in the NAIP5 gene of A/J mice prevents them from detecting intracellular flagellin, therefore allowing Lp to grow intracellularly (Diez et al. 2003; Wright et al. 2003; Lamkanfi and Dixit 2009; Newton et al. 2010; Brown et al. 2013).

NAIP6 is also able to recognize Lp’s flagellin but is much less efficient than NAIP5 (Kofoed and

Vance 2011; Zhao et al. 2011).

Unlike murine macrophages, human macrophages only express one known NAIP gene, hNAIP, which is able to detect the needle proteins of bacterial T3SS and sometimes flagellin

(Yang et al. 2013; Kortmann et al. 2015). This is dependent on the hNAIP isoform, as only one isoform is highly identical to the murine NAIP5 (Kortmann et al. 2015). A full-length isoform of hNAIP is required for flagellin detection, a form found in human primary macrophages, but not in human immortalized macrophages such as THP-1 and U937, making these two cell lines unable to react to flagellin (Kortmann et al. 2015). Other isoforms of hNAIP are unable to detect flagellin.

2.5.2.3 DNA Detection

The AIM2 inflammasome is activated in response to double-stranded DNA which leads to caspase-1 mediated pyroptosis (Monroe et al. 2009; Ge et al. 2012). Lp’s DNA is released into the cytoplasm of the host cell, which is detected by the AIM2 inflammasome (Laguna et al.

2006). The SdhA effector limits DNA leakage from the LCV, which prevents activation of the

AIM2 inflammasome (Ge et al. 2012). sdhA-deficient Lp cells are unable to prevent AIM2

40 inflammasome activation and have significantly more DNA leakage from the LCV compared to

WT Lp (Ge et al. 2012).

2.5.2.4 Toll-Like Receptors

TLR4 is usually responsible for recognizing Gram-negative bacteria’s LPS while TLR2 recognizes cell wall components such as lipoteichoic acid, peptidoglycan, and lipoproteins from

Gram-positive and Gram-negative bacteria (Liu and Shin 2019). TLR4 is important for the immune response against many Gram-negative pathogens, however it is not important when dealing with Lp (Liu and Shin 2019). TLR2 detects Lp’s LPS rather than TLR4, which is due to a distinct lipid A structure of the LPS that is composed of unusually long branched-chain fatty acids (Zahringer et al. 1995; Girard et al. 2003; Shim et al. 2009).

2.5.3 Oxidative Burst

Macrophages and neutrophils produce large quantities of reactive oxygen species (ROS) in response to PAMPS and cytokines (Virag et al. 2019). This release of ROS is termed oxidative burst (Virag et al. 2019). This process is essential for dealing with microorganisms following phagocytosis (Jakubczyk et al. 2020). Alveolar macrophages produce very little reactive oxygen species (ROS) in response to WT Lp, but they do produce it in response to Icm/Dot deficient strains, due to the Icm/Dot-dependent inhibition of phagosome maturation (Harada et al. 2007;

Ziltener et al. 2016). ROS are mostly important for the bactericidal activity of neutrophils against

Lp, while alveolar macrophages rely on TNF- produced by macrophages and neutrophils to restrict intracellular Lp replication (Ziltener et al. 2016).

41 2.6 Secretion Systems in Legionella

Legionella’s secretion systems play an essential role in its pathogenicity. Legionella contains one type I secretion system, one type II secretion system, and two type IV secretion systems. They are all involved in the infection of host cells. They are described below. Figure 2 summarizes the main secretion systems of Lp.

Figure 2: Main secretion systems encoded by Legionella pneumophila. See main text for details.

2.6.1 Type I Secretion System (T1SS): Lss

The type one secretion system (T1SS) is found in various Gram-negative bacteria and it translocates unfolded proteins directly from the cytoplasm to the extracellular environment

(Green and Mecsas 2016). The Lss T1SS is only found in L. pneumophila and absent from the

42 other Legionella species (Mondino et al. 2020). It secretes the RtxA toxin (Fuche et al. 2015).

The system is important for entry into host cells, but not required for intracellular multiplication

(Fuche et al. 2015).

2.6.2 Type II Secretion System (T2SS): Lsh

The type II secretion system (T2SS) is common in Gram-negative bacteria (Green and

Mecsas 2016). It transports proteins in a two-step process. Unfolded proteins are first translocated from the cytoplasm to the periplasm via a Sec pathway while folded proteins are translocated to the periplasm using a twin-arginine translocon (Tat) pathway (Green and Mecsas

2016). Once in the periplasm, proteins will fold into their tertiary conformation and they will then be translocated to the extracellular environment by a dedicated T2SS apparatus (Green and

Mecsas 2016).

As with the Icm/Dot T4bSS, the T2SS is found in all Legionella species (Mondino et al.

2020). Lp uses the Sec pathway to transport unfolded proteins and the Tat pathway to transport folded proteins (Buck et al. 2004; Buck et al. 2005; Rossier and Cianciotto 2005). The T2SS is composed of 12 structural genes (Cianciotto 2013). More than 25 effector proteins of the T2SS have been identified and the system is important for ICM in amoeba and macrophages as well as for persistence in the lungs (Hales and Shuman 1999; Rossier et al. 2004; Truchan et al. 2017).

Some effectors are associated with the LCV membrane (Truchan et al. 2017). Most substrates of the T2SS are hydrolytic enzymes that facilitate host cell infection (Cianciotto 2013; Kuhle and

Flieger 2013). The T2SS effectors are highly upregulated when Lp is grown in a biofilm at 20 C and some effectors can inhibit the growth of other microorganisms, allowing Lp to persist in nature (Hindre et al. 2008; Stewart et al. 2011; Cianciotto 2013). Similar to what is observed

43 with Icm/Dot, some T2SS effectors are host specific. NttA is important for infection of A. castellanii but is dispensable for infection of V. vermiformis (Rossier et al. 2008; Rossier et al.

2009; Tyson et al. 2013). The RNase SrnA, the acetyltransferase PlaC, and the metalloprotease

ProA are necessary for optimal ICM in V. vermiformis, but not in A. castellanii (Rossier et al.

2008; Rossier et al. 2009; Tyson et al. 2013).

2.6.3 Type IVa Secretion System (TIVaSS): Lvh

Type IV secretion systems (T4SS) can transport DNA and proteins (Green and Mecsas

2016). They secrete substrates directly into the target cell, which can be bacteria or eukaryotic cells (Green and Mecsas 2016). The Lvh secretion system is important for infection of host cells at 30 C but is otherwise not required for infection of amoeba and macrophages (Segal et al.

1999; Ridenour et al. 2003). It is also important for DNA transfer by conjugation (Segal et al.

1999).

2.6.4 Type IVb Secretion System (TIVbSS): Icm/Dot

The Icm/Dot (intracellular multiplication/defective organelle trafficking) type IVb secretion system (T4bSS) is the most important virulence factor of Legionella and is able to secrete over 330 effector proteins inside the host cell (Ensminger 2016). The effectors prevent the fusion between the phagosome and the lysosome and allows Legionella to replicate intracellularly (Ensminger 2016). This secretion system is composed of 27 genes of which 22 genes code for structural proteins and five genes code for chaperones able to interact with effector proteins (Liu and Shin 2019). The Icm/Dot secretion system can be divided into three sections. The first section is the inner membrane receptor responsible for substrate detection (Qiu

44 and Luo 2013). The second section is the transmembrane core that goes through the inner and outer membrane (Qiu and Luo 2013). The third section is the outer membrane core that will penetrate into the host cell (Qiu and Luo 2013). The Icm/Dot chaperones induce a conformational change of the substrates to facilitate the recognition of the C-terminal translocation signal (Cambronne and Roy 2007).

2.6.4.1 Icm/Dot Effectors

Currently, over 330 effector proteins are known to be translocated by the Philadelphia-1 strain of Lp, which corresponds to more than 10 % of its proteome (Chien et al. 2004; Ensminger

2016). This represents five times the number of Type 3 secretion system effectors identified in

Escherichia coli O157:H7 and Salmonella enterica (Tobe et al. 2006; Van Engelenburg and

Palmer 2010). Most effectors are dispensable for growth in macrophages, except for sdhA and mavN, where mutants of these two effectors cause a severe defect in intracellular growth

(Ensminger 2016). Deleting approximately 31 % of the Icm/Dot effectors does not prevent Lp from replicating in macrophages, which seems to be the result of effector redundancy (O'Connor et al. 2011; Ensminger 2016). The redundancy allows Lp strains to infect various hosts, as some effectors might only be required in specific circumstances (Ensminger 2016). Deletion of a cluster of effectors does lead to restriction of replication in specific hosts, supporting this theory

(O'Connor et al. 2011). Some of the effectors in Lp’s arsenal contain eukaryotic-like domains, suggesting that they have been acquired from host cells by horizontal gene transfer (de Felipe et al. 2008). The role of some effectors in the infection cycle of Lp will be discussed below.

45 2.6.4.2 Effectors and the LCV

The host GTPases Rab1, Arf1, and Sar1 are important for the recruitment of ER-derived vesicles to the LCV. Multiple effectors target these GTPases such as SidM, SidD, LepB, AnkX,

Lem3, and LidA (Murata et al. 2006; Ingmundson et al. 2007; Machner and Isberg 2007;

Mukherjee et al. 2011; Neunuebel et al. 2011; Tan et al. 2011). The RalF effector recruits Arf1 to the LCV and activates it (Nagai et al. 2002). Two Icm/Dot effectors, SidK and WipB, will prevent acidification of the vacuole by blocking the vacuolar ATPase, inhibiting ATP hydrolysis and proton translocation (Xu et al. 2010; Prevost et al. 2017).

The host GTPase Rab5 is a major regulator of the early endocytic pathway and allows the

PtdIns(3)P-mediated recruitment of early endosomal antigen 1 (EEA1) (Lawe et al. 2002). The effector VipD, once bound to Rab5, will remove the PtdIns(3)P from the vacuole, therefore preventing recruitment of EEA1 and blocking the fusion between the phagosome and lysosome

(Gaspar and Machner 2014). Rab7 is a GTPase that replaces Rab5 during phagosome maturation and will induce fusion between the late endosome and the lysosome (Rink et al. 2005). The effector PieE is able to bind both Rab5 and Rab7, though the mechanism is unknown (Mousnier et al. 2014). The establishment of the LCV is dependent on the recruitment of vesicles originating from the endoplasmic reticulum (ER) (Robinson and Roy 2006).

The fusion between the LCV and ER-derived vesicles occur through the interaction between the Sec22b SNARE on the ER-derived vesicle and a SNARE on the LCV (Arasaki and

Roy 2010). The LseA and LegC3 effectors act as SNARE proteins and promote fusion between

ER vesicles and the LCV (Bennett et al. 2013; King et al. 2015; Shi et al. 2016). However, the

SidM effector alone is able to induce SNARE-dependent fusion (Arasaki et al. 2012). As the

LCV matures, it carries autophagosome markers on its surface (Amer and Swanson 2005). A few

46 Icm/Dot effectors play a role in inhibiting the degradation of the LCV by the host’s autophagy machinery such as RavZ, Lpg1137, and LpSPL (Choy et al. 2012; Rolando et al. 2016; Arasaki et al. 2017).

2.6.4.2.1 Effectors and the Immune System

Legionella alters the NF-B pathway, which regulates the host immune response, in two steps (Bartfeld et al. 2009). Legionella will initially inhibit apoptosis in order to replicate but will later allow apoptosis to occur in order to escape the depleted host. In the early stages of infection, the effectors LegK1 and LnaB activate NF-B while Lgt1, Lgt2, Lgt3, SidI, and SidL downregulate the NF-B inhibitor, IB (Ge et al. 2009; Losick et al. 2010; Fontana et al. 2011).

At the later stages of infection, the MavC effector will inhibit NF-B signalling (Gan et al.

2019).

SidF inactivates two proapoptotic proteins, BNIP3 and Bcl-rambo while SdhA also prevents host cell death by an unknown mechanism (Laguna et al. 2006; Banga et al. 2007;

Mondino et al. 2020). Five effectors are able to activate caspase-3 mediated apoptosis: Ceg18,

Lem12, LegS2, VipD, and Lpg0716 (Zhu et al. 2013). Regulating the apoptotic pathway allows

Legionella to keep the cells alive when it replicates and allows Legionella to exit the host cell by inducing apoptosis when it is done replicating.

The SdhA effector is important in maintaining LCV integrity and preventing macrophage cell death, allowing bacterial replication (Laguna et al. 2006; Creasey and Isberg 2012).

47 2.7 Major Regulators of Legionella

Expression of virulence factors requires a lot of energy and resources, therefore regulating expression of these factors to produce them only when they are needed is important

(Chakravarty and Masse 2019). The major regulators in Legionella are important for the switch between the replicative and transmissive phase in vivo and the exponential and post-exponential phase in vitro. The major regulators include two sigma factors, RpoS and FliA, the stringent response regulated by RelA and SpoT, the Lqs quorum sensing system, and four two-component systems, CpxR/A, PmrA/B, Lpg0277/0278, and LetA/S-RsmX/Y/Z-CsrA. Figure 3 summarizes the major regulators of Legionella. They are described below.

48

Figure 3: Schematization of the major regulatory cascade of Legionella pneumophila. See main text for details.

2.7.1 Sigma Factors

Transcription allows the expression of genetic material from DNA, a process that relies on RNA polymerase (Abril et al. 2020). RNA polymerase uses a template DNA strand to synthesize a complementary RNA molecule (Abril et al. 2020). The core RNA polymerase is composed of 5 subunits and the RNA polymerase becomes complete once a sigma factor binds the core RNA polymerase, and is sometimes referred as the RNA polymerase holoenzyme (Abril et al. 2020). Sigma factors are a group of transcription factors responsible for the specificity of

RNA polymerase (Tripathi et al. 2014). They recognize a specific sequence in the promoter and

49 direct the RNA polymerase to transcribe a subset of genes (Tripathi et al. 2014; Abril et al.

2020). RpoD (70 or D) is the main sigma factor and is often referred to as the housekeeping sigma factor (Tripathi et al. 2014). It recognizes a large number of promoters and allows the transcription of genes required during exponential growth (Tripathi et al. 2014). Bacteria code for various alternative sigma factors to transcribe genes required in specific conditions. RpoH

(32 or H) is required to respond to thermal stress, FliA (28 or F) regulates genes required for the synthesis of the flagella, and RpoS (38 or S) is expressed during stationary phase, starvation, and in response to general stress (Tripathi et al. 2014; Paget 2015).

2.7.1.1 RpoS

RpoS is an alternative sigma factor mainly found in Betaproteobacteria and

Gammaproteobacteria (Dong and Schellhorn 2010). RpoS is the major regulator of the general stress response in E. coli, including resistance to oxidative stress, heat stress, acid stress, osmotic stress, starvation, and DNA damage (Dong and Schellhorn 2010; Landini et al. 2014). RpoS also regulates genes involved in virulence and pathogenesis (Sledjeski et al. 1996; Majdalani et al.

2001; Dong and Schellhorn 2010; Battesti et al. 2011; Landini et al. 2014). In E. coli, RpoS’ regulon comprises approximately 500 genes, representing approximately 10 % of its genome

(Landini et al. 2014). About 140 out of the 500 genes are classified as part of RpoS’ core regulon as their regulation by RpoS is independent of the growth conditions or exposure to a specific stress (Landini et al. 2014). The regulation of the other genes is dependent on other regulators

(Landini et al. 2014). Other genes regulated by RpoS include genes involved in biofilm formation, metabolism, protein processing, regulation, and transport (Dong and Schellhorn 2010;

Landini et al. 2014). Since RpoS is involved in the general stress response, it allows the bacteria

50 to have a cross-protection, where the expression of RpoS in response to a stress allows the bacteria to be more resistant to other stresses (Battesti et al. 2011).

In Lp, RpoS does not contribute to growth-phase dependent stress resistance, unlike what is observed in E. coli, Vibrio cholerae, and Pseudomonas aeruginosa (Hales and Shuman 1999;

Hammer and Swanson 1999; Bachman and Swanson 2001). In Lp, despite rpoS mRNA levels being highest in E phase, the protein levels are highest during PE phase (Dong and Schellhorn

2010). During E phase, RpoS is only important for surviving osmotic shock and is dispensable for stress survival in PE phase as Lp cells become more resistant in PE and stationary phase

(Hales and Shuman 1999). While Lp is replicating, RpoS allows optimal replication by downregulating genes involved in motility, infectivity, and cytotoxicity (Bachman and Swanson

2001; Bachman and Swanson 2004). However, as Lp enters PE phase, RpoS upregulates genes involved in the transmissive phase such as Mip, required for invasion and replication in amoeba and macrophages, and ProA, a secreted protease that is cytotoxic to macrophages and required for virulence in the guinea pig model (Dong and Schellhorn 2010). RpoS is important for the expression of various Icm/Dot effectors, but not for the expression of Icm/Dot structural genes

(Zusman et al. 2002; Hovel-Miner et al. 2009). RpoS regulates the expression of LqsR, the response regulator of the quorum sensing system, which plays a role in motility, cell division, and virulence in macrophages and amoeba (Tiaden et al. 2007). Upon entry in the host cell, genes regulated by RpoS prevent the accumulation of the host’s phagolysosomal protein LAMP-

1, which prevents phagolysosome fusion (Bachman and Swanson 2001). Genes regulated by

RpoS are also important for the pore-forming activity of Lp during the transmissive phase (Abu-

Zant et al. 2006). The stringent response as well as RpoS are crucial for regulating gene expression that allows Lp’s survival in water (Trigui et al. 2015; Mendis et al. 2018). When

51 exposed to water, RpoS influences the transcription of 669 genes, 75 % of which are downregulated (Trigui et al. 2015). The downregulated genes are mainly involved in replication, transcription, and translation (Trigui et al. 2015). In water, RpoS downregulates SpoT in order to maintain a high level of the alarmone ppGpp, which is produced during starvation, therefore allowing a maximal starvation response (Trigui et al. 2015).

2.7.1.2 FliA

The alternative sigma factor FliA (28 or F) regulates the expression of genes involved in flagellum biosynthesis and is found in all motile Gram-negative and Gram-positive bacteria

(Paget 2015). Legionella becomes motile in PE phase as amino acids become scarce, and therefore the expression of the flagella genes correspond with Legionella becoming virulent

(Byrne and Swanson 1998; Heuner and Steinert 2003; Bruggemann et al. 2006). RpoD allows a basal expression of fliA in E phase (Schulz et al. 2012). In PE phase, the transcription of fliA is increased by ppGpp, RpoS, the transcription factor DksA, and the transcription regulator FleQ, a major activator of flagellar genes (Hovel-Miner et al. 2009; Schulz et al. 2012). CsrA represses the translation of fliA and fleQ in E phase (Fettes et al. 2001; Molofsky and Swanson 2003; Sahr et al. 2017). FliA plays a role in contact-dependent cytotoxicity, helps avoid lysosomal degradation, and is important for replication in Dictyostelium discoideum (Hammer et al. 2002;

Heuner et al. 2002; Molofsky et al. 2005; Schulz et al. 2012).

2.7.2 Quorum Sensing

Lqs, the Legionella quorum sensing system, produces and responds to the signalling molecule LAI-1 (Legionella autoinducer-1) (Tiaden et al. 2007; Spirig et al. 2008). It involves

52 LqsA (the autoinducer synthase), and a two-component system (see section 2.7.4) composed of the membrane sensor kinases LqsS and LqsT and the response regulator LqsR (Tiaden et al.

2007; Spirig et al. 2008; Tiaden et al. 2010; Kessler et al. 2013). The Lqs system is involved in motility, natural competence, entry into replicative phase, uptake of Lp by phagocytes, and formation of extracellular filaments (Tiaden et al. 2007; Tiaden et al. 2008; Tiaden et al. 2010;

Kessler et al. 2013). LqsR is regulated by RpoS, LetA, and CsrA (Tiaden et al. 2007; Sahr et al.

2009).

2.7.3 Stringent Response

The stringent response is a general stress response to starvation that is triggered by the alarmone ppGpp (Hobbs and Boraston 2019). RelA and SpoT, together, control the level of ppGpp within bacteria. RelA, a ppGpp synthetase, is able to produce ppGpp during amino acid starvation (Zhu et al. 2019). SpoT, a ppGpp synthetase and hydrolase, will produce ppGpp in response to starvation to fatty acids, carbon, phosphate, and iron (Zhu et al. 2019). SpoT will degrade ppGpp when the period of starvation has passed (Hobbs and Boraston 2019).

In Legionella, the switch between the replicative and transmissive phase is triggered by the alarmone ppGpp, which accumulates as nutrients become scarce (Byrne and Swanson 1998). ppGpp is produced by RelA in response to low amino acid concentration while SpoT produces ppGpp in response to low fatty acid concentrations (Hammer and Swanson 1999; Dalebroux et al. 2009). ppGpp will activate the expression of LetA/S and RpoS which leads to the expression of the sRNAs RsmX/RsmY/RsmZ (see section 2.7.4.4) (Rasis and Segal 2009; Sahr et al. 2012).

These sRNAs will relieve the repression of genes required for the transmissive phase by

53 sequestering CsrA, an RNA-binding protein that serves as a post-transcriptional regulator (Rasis and Segal 2009; Sahr et al. 2012). The CsrA system is described in detail in section 2.7.4.4.

2.7.4 Two-Component Systems (TCS)

Two-component systems (TCS) rely on a membrane associated sensor histidine kinase and a cytoplasmic response regulator (Hoch and Varughese 2001). Upon activation by a stimulus, the sensor will autophosphorylate itself and pass that phosphoryl group to the response regulator in order to activate it (Gao and Stock 2010). In most cases, the response regulator is a

DNA-binding protein that will activate or repress transcription of its target genes (Capra and

Laub 2012). Some response regulators can also be phosphorylated by acetyl phosphate, independently of the sensor kinase (Wolfe 2010).

2.7.4.1 CpxR/A

The CpxR/A two-component system is comprised of the CpxA sensor histidine kinase and the CpxR response regulator (Hunke et al. 2012; Vogt and Raivio 2012). In E. coli, the

CpxR/A system responds to various envelope stresses and misfolded proteins within the periplasm (De Wulf et al. 1999). CpxR/A is upregulated by RpoS upon entry to the stationary phase (De Wulf et al. 1999). In Legionella, the CpxR/A TCS controls the expression of Icm/Dot structural genes and effectors, as well as 14 substrates of the type II secretion system (Gal-Mor and Segal 2003a; Altman and Segal 2008; Feldheim et al. 2016; Tanner et al. 2016). CpxR/A also regulates letE and oxyR (Feldheim et al. 2016). A cpxR mutant is not defective in monoinfection in A. castellanii and HL-60 derived human macrophages, but is outcompeted by the WT during co-infection of A. castellanii (Gal-Mor and Segal 2003a; Feldheim et al. 2016). A

54 cpxA mutant has a much less severe defect compared to the cpxR mutant, due to the fact that cpxR can be phosphorylated by acetyl phosphate, bypassing the cpxA sensor kinase (Feldheim et al. 2016). LetE regulates genes that are regulated by CsrA and links the CpxR/A TCS with the

LetA/S-RsmX/Y/Z-CsrA regulatory cascade, which is discussed in section 2.7.4.5 (Feldheim et al. 2016). LetE also connects the CpxR/A TCS to the lqs quorum sensing system as CsrA downregulates LqsR (Rasis and Segal 2009; Feldheim et al. 2016).

2.7.4.2 PmrA/B

PmrA is the response regulator and PmrB is the sensor kinase (Zusman et al. 2007). The

PmrA/B two-component system upregulates CsrA and at least 43 Icm/Dot effectors (Zusman et al. 2007; Al-Khodor et al. 2009; Rasis and Segal 2009). It is involved in motility and intracellular replication in amoeba and macrophages (Zusman et al. 2007; Al-Khodor et al.

2009).

2.7.4.3 Lpg0277/Lpg0278

A putative two-component system has been identified in Lp, where Lpg0278 is the histidine kinase receptor and Lpg0277 is the response regulator (Levet-Paulo et al. 2011; Hughes et al. 2019). This system controls production of c-di-GMP in Lp (Levet-Paulo et al. 2011). lpg0279, a gene that is upregulated in MIF cells, is located upstream of the two-component system and cotranscribed with the lpg0278/lpg0279 two-component system (Abdelhady and

Garduño 2013; Hughes et al. 2019). The system is expressed in PE phase and is upregulated by

RpoS when essential amino acids are lacking (Hughes et al. 2019). The two-component system promotes accumulation of poly-3-hydroxybutyrate (PHB), a reserve of energy source found

55 abundantly in MIFs, improves survival in low-nutrient media, and promotes transition to PE phase (Hughes et al. 2019). Lpg0279 negatively regulates the concentration of c-di-GMP present in the cell (Hughes et al. 2019).

2.7.4.3.1 c-di-GMP

c-di-GMP also regulates the switch between the replicative and transmissive phase (Levi et al. 2011). Lp codes for 22 different known enzymes involved in the metabolism of c-di-GMP

(Levi et al. 2011; Allombert et al. 2013). Three of these proteins promote biofilm formation while two proteins inhibit biofilm formation (Pécastaings et al. 2016). The c-di-GMP regulatory cascade play a role in virulence as it regulates various Icm/Dot effectors that prevents phagolysosome fusion, increases cytotoxicity, affects replication within host cells and transmission to other host cells (Levi et al. 2011; Allombert et al. 2013).

2.7.4.4 LetA/S-RsmX/Y/Z-CsrA

CsrA (carbon storage regulator A) is a post-transcriptional regulator, first identified in E. coli, involved in carbohydrate uptake and metabolism, biofilm formation, motility, and quorum sensing (Romeo and Babitzke 2018). CsrA is an RNA-binding protein that generally downregulates genes by binding at or near the ribosome binding site, making it inaccessible to the ribosome and/or by inducing the degradation of the transcript (Romeo and Babitzke 2018).

CsrA can also positively regulate gene expression, by covering RNase E cleavage site, as in the case of the flhDC operon (Yakhnin et al. 2013). In Lp, CsrA induces expression of genes required for replication while inhibiting expression of genes required for the transmissive phase

(Molofsky and Swanson 2003). Upregulation of genes by CsrA is a result of stabilizing the target

56 mRNAs and promoting translation (Romeo and Babitzke 2018). In Lp, CsrA regulates carbon metabolism, motility, and virulence by regulating at least 40 Icm/Dot effector proteins (Sahr et al. 2017). CsrA interacts with over 450 mRNA in Lp, affecting translation, transcription, and/or stability (Sahr et al. 2009; Sahr et al. 2017). CsrA regulates RpoS, LqsR, relA, and its own expression (Sahr et al. 2017). CsrA is sequestered by three sRNAs, RsmX, RsmY, and RsmZ, that are regulated by the LetA/S two-component system (Sahr et al. 2009; Edwards et al. 2010;

Sahr et al. 2012).

The LetA/S two-component system is a homolog of BarA/UvrY of E. coli and

GacS/GacA of Pseudomonas (Pernestig et al. 2001; Marutani et al. 2008). The LetA/S system is an important regulator of genes required for the transmissive phase (Hammer et al. 2002). In response to lack of nutrients, the LetA/S system positively regulates the expression of the

RsmX/Y/Z sRNAs, which sequester the post-transcriptional regulator CsrA (Sahr et al. 2009;

Edwards et al. 2010; Sahr et al. 2012). Sequestering of CsrA by RsmX/Y/Z removes the inhibition of genes required for the transmissive phase. RsmX is absent in the Lp Philadelphia-1 strain and L. longbeachae (Sahr et al. 2012). The LetA/S system is important for entry into host cell and establishing the LCV, but it is not important for intracellular replication (Sahr et al.

2009; Sahr et al. 2017). The system positively regulates the expression of Icm/Dot structural and effector genes, RpoH, and GspA, a global stress response protein (Abu Kwaik et al. 1997;

Hammer et al. 2002; Gal-Mor and Segal 2003b; Rasis and Segal 2009; Sahr et al. 2009; Nevo et al. 2014; Sahr et al. 2017). LetE downregulates the expression of RsmX/Y/Z, allowing CsrA to bind to its target mRNAs (Feldheim et al. 2016).

57 2.8 Small Regulatory RNAs (sRNA)

Small regulatory RNAs usually act as post-transcriptional regulators and are important in allowing bacteria to quickly adapt to environmental changes (Jørgensen et al. 2020). They are short RNA molecules, ranging between 50 and 500 nucleotides and can be transcribed from their own loci or processed from a larger transcript (Apura et al. 2019; Desgranges et al. 2020). sRNAs are involved in regulating virulence, iron homoeostasis, membrane and surface remodeling, motility, biofilm, sugar metabolism, transporters, transcription factors, quorum sensing, and toxin-antitoxin systems (Wagner and Romby 2015). sRNAs can be divided into two groups, base-pairing sRNAs that act on RNA transcripts or protein-binding sRNAs that target proteins (Apura et al. 2019; Desgranges et al. 2020).

2.8.1 Base-Pairing sRNAs

Base-pairing sRNAs are the most common type of sRNAs and they can be further divided into two groups based on their location within the genome: cis-encoded and trans- encoded sRNAs (Wagner and Romby 2015; Apura et al. 2019). Cis-encoded sRNAs are encoded on the complementary strand of their target and exhibit perfect complementarity to the mRNA target (Jørgensen et al. 2020). Trans-encoded sRNAs, on the other hand, are encoded within their own loci and form an imperfect pairing with their target mRNA (Jørgensen et al. 2020). Base- pairing sRNAs will bind at or near the ribosome binding site (RBS) to inhibit translation and/or induce degradation of the mRNA (Jørgensen et al. 2020). Binding of the sRNA in the 5’ untranslated region (UTR) far away upstream of the RBS tends to positively regulate translation of the transcript (Jørgensen et al. 2020). In Gram-negative bacteria, trans-encoded sRNAs often rely on the chaperones Hfq or ProQ for binding to their target (Jørgensen et al. 2020).

58 2.8.2 Protein-Binding sRNAs

Protein-binding sRNAs are rarely found in Gram-positive bacteria (Jørgensen et al.

2020). Protein-binding sRNAs tend to titre the proteins they target to relieve its regulating effect

(Westermann 2018). The two most studied protein-binding sRNAs are the CsrB homologs

RsmX/Y/Z and the 6S RNA, which are discussed in section 2.7.4.5 and section 2.8.5.1 respectively (Westermann 2018). Two other protein-binding sRNAs involved in ethylamine utilization have been discovered. They are EutX in Enterococcus faecalis and Rli55 in Listeria monocytogenes (DebRoy et al. 2014; Mellin et al. 2014). EutX sequesters EutV, an anti- terminator protein that prevents the transcription of genes required for ethanolamine metabolism, which is used as a carbon source during host infection (DebRoy et al. 2014). Rli55 titres EutV, a negative regulator for ethanolamine metabolism (Mellin et al. 2014). A strain unable to use ethanolamine is defective for intracellular growth (Mellin et al. 2014).

2.8.3 RNA Chaperones

2.8.3.1 Hfq

Hfq is an RNA binding protein initially discovered in E. coli as a host factor required for efficient bacteriophage Q replication (Franze de Fernandez et al. 1968). Hfq, or a homolog, is encoded by approximately 50 % of bacterial species (Sun et al. 2002). Hfq is not considered a major regulator in Gram-positive bacteria. There is only one sRNA in Gram-positive bacteria that is known to require Hfq for its activity: LhrA from Listeria monocytogenes (Christiansen et al. 2006; Jørgensen et al. 2020).

59 The dependency on Hfq is dependent on three factors (Jousselin et al. 2009):

1. The GC content: the higher the GC content is, the more likely Hfq is needed. Hfq

is dispensable in microorganisms with a low GC content.

2. The length of the sRNA-mRNA interaction: If the interaction between the sRNA

and the target mRNA is over 30 consecutive nucleotides, Hfq is not required.

3. The C-terminal extension length of Hfq: In bacteria that possess an Hfq with a

short C-terminal end, the chaperone is not needed for base pairing between the

sRNA and the mRNA.

In Lp, Hfq is regulated by RpoS and the LetA/S two-component system, where its expression is upregulated during the post-exponential phase (Oliva et al. 2017). Hfq promotes motility and is important for optimal Lp growth within A. castellanii at environmental temperatures (McNealy et al. 2005; Oliva et al. 2017). A Lp strain lacking Hfq has a longer lag phase, a reduced growth rate in media where the iron concentrations are low, a reduced expression of Fur, the ferric uptake regulator, and a slightly reduced intracellular growth

(McNealy et al. 2005; Faucher and Shuman 2011). To date, only two direct targets of Hfq in Lp have been identified, the hfq mRNA and the Anti-hfq sRNA, meaning Hfq autoregulates itself

(McNealy et al. 2005; Oliva et al. 2017; Oliva et al. 2018). Hfq may not be important for all sRNA-mRNA interactions, probably due to the short C-terminal end of Hfq and the low GC content of Lp’s genome, which is at 38 % GC (McNealy et al. 2005; Faucher and Shuman 2011).

2.8.3.2 ProQ

ProQ is an RNA-binding protein involved in post-transcriptional regulation that is conserved in Gram-negative bacteria, but absent in Gram-positive bacteria (Olejniczak and Storz

60 2017). While Hfq and CsrA bind to RNA based on sequence, ProQ binds to RNA based on secondary structure, and binds the 3’ UTR of mRNAs (Holmqvist et al. 2018). Legionella codes for RocC, a homolog of ProQ (Attaiech et al. 2016). RocC negatively regulates competence in

Legionella by interacting with the RocR sRNA, the only sRNA it is known to bind (Attaiech et al. 2016; Olejniczak and Storz 2017). This is in contrast with ProQ found in E. coli and S. enterica which is able to bind various sRNAs and mRNAs (Olejniczak and Storz 2017). RocR is discussed in the sRNA section 2.8.5.4.

2.8.4 sRNAs in Other Bacteria

Examples of well-characterized sRNAs are described below. Characterised sRNAs in Lp will be discussed in section 2.8.5. A non-exhaustive list of bacterial sRNAs is presented in Table

2.

2.8.4.1 ArcZ, DsrA, and RprA

These three sRNAs act as positive regulators of rpoS by binding the 5’ UTR and opening a hairpin that occludes the RBS (Sledjeski et al. 1996; Majdalani et al. 2001; Mandin and

Gottesman 2010). Hfq is required for stabilization of these sRNAs and to promote interaction with the rpoS mRNA (Battesti et al. 2011). ArcZ is upregulated in aerobic conditions and downregulated in anaerobic conditions by the ArcB/ArcA two-component system, which indirectly downregulates rpoS (Mandin and Gottesman 2010). DsrA is expressed at temperatures below 25 C and under osmotic shock conditions and induces the expression of RpoS, which will induce the expression of otsA and otsB (Sledjeski et al. 1996; Lease et al. 1998; Majdalani et al.

1998; Lease et al. 2004). These genes are required for synthesis of trehalose, which protects the

61 cell at low temperatures and therefore acts as an osmoprotectant (Kandror et al. 2002). The expression of RprA is induced by the Rcs phosphorelay system, which is important for biofilm formation (Majdalani et al. 2002). Expression of RprA increases RpoS concentration, and RpoS is necessary for biofilm formation (Adams and McLean 1999; Collet et al. 2008). The bacteria need the right concentration of RpoS for optimal biofilm synthesis (Ferrières et al. 2009). RprA is able to induce rpoS translation during osmotic shock in the absence of DsrA (Majdalani et al.

2001).

2.8.4.2 LhrC

In L. monocytogenes, LhrC is expressed during intracellular growth in macrophages, in response to envelope stress, and by heme, which L. monocytogenes comes in contact with during dissemination in humans (Sievers et al. 2014; Santos et al. 2018; Ross et al. 2019). LhrC downregulates the adhesin LapB, helping the bacteria evade the host immune response (Sievers et al. 2014). LhrC also represses the OppA membrane protein and the T-cell stimulating antigen

TcsA (Sievers et al. 2015; Ross et al. 2019).

2.8.4.3 McaS

McaS is a trans-encoded sRNA found in E. coli and Salmonella spp. that is able to bind mRNA as well as proteins, including Hfq and CsrA, and induces motility as well as inhibit formation of curli-containing biofilm (Jørgensen et al. 2012; Thomason et al. 2012; Jørgensen et al. 2013; Nues et al. 2015; Andreassen et al. 2018). Upon entry into stationary phase, McaS is expressed and will bind the 5’ UTR of the flhDC operon to remove a secondary structure preventing the translation of the flagellar operon (Thomason et al. 2012). McaS also interacts

62 with the csgD mRNA, required for the switch between the planktonic and biofilm states, and promotes degradation of the McaS-csgD duplex by RNase E (Andreassen et al. 2018).

2.8.4.4 PrrF1 and PrrF2

PrrF1 and PrrF2 are two homologs of RyhB found in P. aeruginosa and are important for virulence and for maintaining iron and heme homoeostasis (Wilderman et al. 2004; Reinhart et al. 2015). The sequence of PrrF1 and PrrF2 are 95 % identical (Wilderman et al. 2004). When iron concentrations are low, the two sRNAs will repress nonessential iron-requiring proteins

(Wilderman et al. 2004). They also regulate quorum sensing and are important for acute lung infections (Oglesby et al. 2008; Reinhart et al. 2015).

2.8.4.5 RNAIII

S. aureus’ RNAIII is a trans-encoded sRNA that is controlled by the agr quorum sensing system (Boisset et al. 2007). It is one of the first sRNAs discovered and the first dual-function sRNAs discovered (Raina et al. 2018; Westermann 2018). Dual-function sRNAs also function as a mRNA coding for a protein. The 5’ region of RNAIII encodes a -hemolysin while the rest of the sRNA regulates various genes (Williams and Harper 1947; Kantor et al. 1972; Janzon and

Arvidson 1990; Novick et al. 1993). RNAIII upregulates the -hemolysin and the extracellular adherence protein and downregulates rot, the repressor of toxins, and genes encoding surface proteins (Morfeldt et al. 1995; Geisinger et al. 2006). RNAIII is important for invasion and infection of new host cells and prevents biofilm formation (Boisset et al. 2007). It is a major regulator of virulence genes and is responsible for the switch between the early stage of infection and the late stage of infection (Novick et al. 1993; Raina et al. 2018). To do so, RNAIII

63 downregulates genes required for the synthesis of various surface proteins and induces the synthesis of secreted virulence factors (Raina et al. 2018).

2.8.4.6 RyhB

Fur is a master transcriptional regulator found in many bacteria that is required for maintaining iron homoeostasis (Masse et al. 2005). When iron concentrations are high, Fur will repress genes involved in iron acquisition such as siderophores (Masse et al. 2005). During iron starvation, the RyhB sRNA regulates genes involved in iron utilization and transport, ensuring the availability of iron for the essential iron-using proteins (Massé and Gottesman 2002; Masse et al. 2005). It also induces the production of siderophores, which are iron chelating molecules, and is important for virulence of UPEC strains (Prévost et al. 2007; Salvail et al. 2010;

Porcheron et al. 2014). RyhB regulates over 50 genes involved in iron utilization and import

(Chareyre and Mandin 2018). RyhB downregulates most genes that constitute its regulon. One of the genes that is upregulated is shiA, which codes for a shikimate transporter, a precursor for synthesis of the siderophore enterobactin (Prévost et al. 2007). RyhB is able to recruit RNase E and induce the degradation of the target mRNA-RyhB complex (Prevost et al. 2011). RyhB regulates fur through a regulatory feedback loop (Vecerek et al. 2007).

RyhB is important for acid resistance of Shigella flexneri, cell invasion and cell-to-cell spread of Shigella dysenteriae, motility, chemotaxis, and biofilm formation of V. cholerae, and iron acquisition and capsule biosynthesis in Klebsiella pneumoniae (Davis et al. 2005; Mey et al.

2005; Oglesby et al. 2005; Murphy and Payne 2007; Africa et al. 2011; Huang et al. 2012).

64 2.8.4.7 SgrS

Accumulation of phosphosugars in bacteria causes a glucose-phosphate stress, which is alleviated by SgrS. The sRNA will target the ptsG mRNA, which codes a protein required in the glucose transport system (Vanderpool and Gottesman 2004). The sgrS sRNA is also a mRNA that codes for a small protein, SgrT, responsible for inhibiting glucose import (Wadler and

Vanderpool 2007). SgrS also regulates the Salmonella SopD effector that plays a role in virulence (Papenfort et al. 2012).

2.8.4.8 Spot 42

Spot 42 is important for catabolic repression when glucose is available. When glucose is abundant, the sRNA Spot 42 will downregulate genes required for metabolizing sugars other than glucose, such as the galactokinase GalK required for using galactose (Møller et al. 2002).

Table 2: Non-exhaustive list of small regulatory RNAs in bacteria.

Bacteria sRNA Cis/Trans Function Reference Brucella AbcR-1/AbcR-2 Trans Survival in (Caswell et al. abortus macrophages 2012) and mice Chlamydia IhtA Trans RB to EB (Tattersall et al. trachomatis differentiation 2012) Enterococcus EutX Trans Ethanolamine (DebRoy et al. faecalis metabolism 2014) Erwinia ArcZ/OmrAB/RmaA Trans Flagella (Schachterle et amylovora al. 2019) GadY Cis Acid stress (Opdyke et al. 2004) GcvB Cis Acid stress (Jin et al. 2009)

65 Escherichia MicF Trans Outer (Mizuno et al. coli membrane 1984) proteins OmrA/OmrB Trans Outer (Argaman et al. membrane 2001; Guillier proteins; and Gottesman motility 2006; Lay and Gottesman 2012a) OxyS Trans Oxidative (Altuvia et al. stress 1997; Altuvia et al. 1998; Zhang Escherichia et al. 1998; coli Argaman and Altuvia 2000; Lay and Gottesman 2012a) PapR Trans Adhesion (Lane and Mobley 2007; Khandige et al. 2015) 5’ureB-sRNA Cis Acid stress (Wen et al. Helicobacter 2011) pylori IsoA1 Cis Toxin (Arnion et al. production 2017) AspocR Cis Propanediol (Mellin et al. metabolism 2013) Rli27 Trans Survival in (Quereda et al. plasma 2014; Quereda Listeria et al. 2016) monocytogenes Rli55 Trans Ethanolamine (Mellin et al. metabolism 2014) SreA/SreB Trans Major (Loh et al. 2009) virulence regulator Mycobacterium Mcr7 Trans Tat secretion (Solans et al. tuberculosis system 2014)

66 Neisseria NrrF Trans Iron (Mellin et al. meningitidis homeostasis 2007; Mellin et al. 2010) Pseudomonas RsmV/RsmW/RsmY/RsmZ Trans Sequester (Janssen et al. aeruginosa CsrA 2018) Salmonella IsrM Trans (Ge et al. 2012) Shigella RnaG Cis Dissemination (Giangrossi et flexneri in host al. 2010) RsaA Trans Biofilm (Romilly et al. formation 2014; Tomasini et al. 2017) Staphylococcus SprA Cis Toxin (Sayed et al. aureus production 2011; Sayed et al. 2012) SprD Trans Survival in (Chabelskaya et host al. 2010) Qrr 1-4 Trans Quorum (Lenz et al. sensing 2004; Shao et al. 2013; Feng et al. 2015; Ball et al. 2017; Quereda Vibrio cholerae and Cossart 2017) TarA Trans Glucose (Richard et al. transport 2010) TarB Trans Intestinal (Davies et al. colonization 2012) VqmR Trans Biofilm; toxin (Papenfort et al. production 2015)

2.8.5 sRNAS in Legionella pneumophila

RsmY and RsmZ, the homologs of E. coli’s CsrB and CsrC, were the first sRNAs identified in the Lp Paris strain (Sahr et al. 2009). The following year, in silico analysis in the Lp

Philadelphia-1 strain identified 143 putative sRNAs (Faucher et al. 2010). This method relied on identifying Rho-independent terminators in intergenic regions (Faucher et al. 2010). Microarray analysis reduced the number of putative sRNAs to 22 (Faucher et al. 2010). Out of the 22

67 sRNAs, only 6 were detected by northern blot (Faucher et al. 2010). Subsequently, RNA- sequencing performed in 2011 using the Philadelphia-1 strain led to the identification of 70 new sRNAs in Lp (Weissenmayer et al. 2011). In 2012, RNA-sequencing in the Paris strain identified

713 sRNAs, of which 622 were cis-encoded and 91 were trans-encoded (Sahr et al. 2012). There were two main differences in the two RNA-sequencing experiments. Firstly, the RNA- sequencing was performed in different strains, and the genome of the Paris strain is approximately 100 kbp larger than the genome of the Philadelphia-1 stain. Secondly, Sahr et al. performed the RNA-sequencing on RNA treated and untreated with Tobacco acid pyrophosphatase (TAP), while Weissenmayer’s RNA sequencing was done on TAP untreated

RNA only (Weissenmayer et al. 2011; Sahr et al. 2012). Newly synthesized transcripts have three phosphates on the 5’ end (Luciano et al. 2017). TAP is able to remove two phosphates at the 5’ end of the transcripts (Luciano et al. 2017). By only sequencing TAP untreated RNA, it is difficult to differentiate full-length transcripts from degraded transcripts. Comparing the results obtained from TAP treated and TAP untreated RNA, it becomes possible to identify primary full-length transcripts, and eliminate transcripts that result from degradation. Currently, more than 700 sRNAs have been identified in Lp, 60 % of which are regulated depending on the growth phase (Weissenmayer et al. 2011; Sahr et al. 2012). Only a few sRNAs in Lp have been characterized and they are discussed below.

2.8.5.1 6S RNA

The 6S RNA is a ubiquitous protein-binding RNA that regulates transcription by binding to the sigma factor of RNA polymerase (Wassarman 2007). In Lp, the 6S sRNA is required for intracellular multiplication in amoeba and macrophages (Faucher et al. 2010). It induces the

68 expression of 127 genes in PE phase, including genes coding for Icm/Dot effectors, stress response genes, and genes responsible for nutrient acquisition (Faucher et al. 2010; Trigui et al.

2013).

2.8.5.2 Anti-Hfq

In Lp, the cis-encoded sRNA Anti-Hfq regulates expression of the RNA chaperone Hfq during the exponential phase (Oliva et al. 2017). In E phase, Anti-Hfq sRNA, with the help of the Hfq protein, binds to the Hfq mRNA and recruits RNase III to degrade the transcript. As Lp enters the post-exponential phase, Anti-Hfq sRNA is not expressed and Hfq protein levels increase (Oliva et al. 2017).

2.8.5.3 Lpr0035

The Lpr0035 sRNA is found in the mobile genetic element pLP45 and plays a role in regulation of entry into host cells and host-specific intracellular multiplication (Jayakumar et al.

2012). A lpr0035 deletion mutant is defective for entry and intracellular multiplication in amoeba and macrophages (Jayakumar et al. 2012).

2.8.5.4 RocR

RocR is a Legionella-specific and highly conserved trans-encoded sRNA that regulates natural transformation in Lp (Attaiech and Charpentier 2017; Durieux et al. 2019). In the exponential phase, RocR, with the help of the mRNA chaperone RocC, will prevent translation and lead to the degradation of its target mRNAs, the genes encoding the DNA uptake system

(Attaiech and Charpentier 2017). These genes include comEA, comEC, comF, comM, and radC

69 (Durieux et al. 2019). Both RocC and RocR are expressed in E phase, and as Legionella reaches the transition between E phase and the stationary phase, the levels of RocC decrease, causing

RocR to be degraded as it is unstable in the absence of the chaperone (Attaiech and Charpentier

2017). As a result, a rocR or rocC deletion mutants are constitutively competent (Durieux et al.

2019). The Lp Lens strain also encodes the sRNA RocRp that is 80% identical to RocR (Durieux et al. 2019). Unlike RocR, RocRp is expressed at the transition between E phase and the stationary phase, making the strain not transformable (Durieux et al. 2019). RocRp requires the chaperone RocC for its function and is able to complement a rocR mutant (Durieux et al. 2019).

2.9 Regulation by sRNAs

Transcription, translation, and mRNA degradation in bacteria are interconnected. mRNAs are translated before transcription is finished and translation can protect mRNAs from degradation (Meyer 2016). Therefore, regulating the translation of an mRNA can impact transcription and mRNA degradation (Meyer 2016). The ribosome binding site (RBS; also called

Shine-Dalgarno sequence or SD) is a sequence upstream of the start codon and is important for initiation of translation as it allows the interaction between the ribosome and the mRNA (Meyer

2016). The formation of a secondary structure such as a stem loop (also called a hairpin) that occludes the RBS would therefore prevent translation, and this method is a common regulatory mechanism (Meyer 2016). The formation of a stem loop is a very dynamic process where the stem loop undergoes conformational changes at the microsecond scale (Chiaruttini and Guillier

2019). In simpler terms, the stem loop undergoes rapid and successive folding and unfolding.

The binding of the ribosome on the mRNA prevents ribonucleases from degrading the transcript

(Meyer 2016). A simple schematization of a bacterial mRNA is shown in Figure 4.

70

Figure 4: Schematization of a bacterial monocistronic (A) and polycistronic (B) mRNA. See main text for details.

mRNAs contain a 5’ untranslated region (UTR) which contains various regulatory elements (Fröhlich and Papenfort 2020). Riboswitches, RNA thermometers, ribosome standby sites, and translation enhancer elements are located in the 5’ UTR (Serganov and Nudler 2013;

Fröhlich and Papenfort 2020).

sRNAs are able to positively or negatively regulate gene expression. In general, sRNAs that positively regulate gene expression bind upstream of the RBS, in the 5’ UTR, while sRNAs that negatively regulate gene expression will bind at or near the ribosome binding site (Fröhlich and Papenfort 2020).

The regulation methods used will be discussed in this section.

2.9.1 Negative Regulation by sRNAs

2.9.1.1 Inhibition by Sequestering the Ribosome Binding Site

The main mechanism of action of sRNA to negatively regulate their target is to bind at the 5’ end of their target mRNA either at or near the ribosome binding site (Wagner and Romby

71 2015). This binding sterically inhibits the binding of the 30S subunit of the ribosome, therefore preventing translation of the transcript (Wagner and Romby 2015).

2.9.1.2 Binding to Translational Enhancer

Translational enhancer sequences help liberate the ribosome during initiation of translation (Takahashi et al. 2013). The S1 RNA chaperone is a protein bound to the 30S ribosomal subunit. The S1 chaperone is able to bind linear AU-rich enhancer sequences and activate translation (Cifuentes-Goches et al. 2019). S1 is important for the docking of the mRNA with the 30S ribosome subunit and the formation of the translation initiation complex (Cifuentes-

Goches et al. 2019). The SgrS sRNA binds to the AU-rich enhancer sequence of the manY mRNA and prevents the binding of the S1, therefore inhibiting translation (Azam and

Vanderpool 2020).

2.9.1.1 Affecting Ribosome Standby Site

Ribosome standby sites are single-stranded regions of the mRNA that allow the unspecific binding of the 30S ribosome and prevent the formation of a stable secondary structure that would hide the RBS (Unoson and Wagner 2007). The 30S ribosome binds a stretch of Us in the 5’ region of the mRNA, upstream of the RBS and the secondary structure that occludes it

(Unoson and Wagner 2007). Binding near the RBS allows the 30S ribosome to quickly bind to the RBS once it becomes available, at a much faster rate than free diffusing ribosomes (Unoson and Wagner 2007). In this case, the rate of initiation of translation is no longer dependent on the recruitment of the 30S ribosome, but on the rate of folding and unfolding of the RNA inhibitory secondary structure (Unoson and Wagner 2007). The S1 chaperone is able to unfold secondary

72 structures hiding the ribosome standby site of the tisAB and lpp mRNAs, promoting translation of these mRNAs (Andreeva et al. 2018; Romilly et al. 2019). The LstR sRNA will inhibit translation of the tisAB operon by binding at the S1 binding site, preventing the unfolding of the secondary structure. The GcvB sRNA also binds at the S1 binding site to prevent translation of the gltI and yifK mRNAs (Darfeuille et al. 2007; Sharma et al. 2007; Yang et al. 2014).

2.9.1.2 Transcriptional Attenuation

Transcription attenuation is usually caused by the presence of a premature terminator in the

5’ UTR of an mRNA and results in transcription termination before a functional protein-coding mRNA has been synthesized (Naville and Gautheret 2010). This mode of regulation was initially discovered in the regulation of the tryptophan operon whose transcription is dependent on the availability of tryptophan within the cell (Naville and Gautheret 2010). It was later identified as a regulation mechanism for other amino acid coding operons (Naville and Gautheret 2010).

Transcription attenuation caused by a sRNA was identified as a regulatory mechanism for the

RnaG sRNA of Shigella flexneri (Giangrossi et al. 2010). The binding of RnaG to its target mRNA leads to the formation of a secondary structure that acts as an intrinsic terminator

(Giangrossi et al. 2010). The terminator blocks the progression of the RNA polymerase, destabilizing the RNA:DNA duplex and releasing the RNA polymerase, terminating transcription (Giangrossi et al. 2010).

2.9.1.3 mRNA Degradation

mRNA degradation begins with the endoribonuclease RNase E cleaving the transcript at an internal site (Meyer 2016). RNase E recognizes a 5’ monophosphate on the mRNA or the

73 sRNA that is bound to the mRNA (Bandyra et al. 2012; Lay and Gottesman 2012b). Most sRNAs are degraded along with their mRNA target. However, some sRNAs can dissociate from their target and bind to another transcript, as exemplified by ChiX (Lay and Gottesman 2012b).

Following RNase E cleavage, exoribonucleases such as PNPase, RNase II, or RNase R will degrade the rest of the transcript (Bandyra and Luisi 2018). RNase E can form a complex with these exoribonuclease to form an RNA degradosome, which allows a cooperation between the ribonucleases (Bandyra and Luisi 2018).

The degradation of the mRNA can be seen as a side effect of inhibition of translation.

When the sRNA prevents ribosome-binding to the mRNA, the mRNA becomes an easier target for degradation by RNases (Morita et al. 2006). Often, degradation is not necessary for inhibition as it was demonstrated with SgrS (Morita et al. 2006). The binding of the sRNA prevents the binding of the ribosome and translation is inhibited.

Nevertheless, some sRNAs act by causing the degradation of their target without affecting initiation of translation. The MicC and SdsR sRNAs in Salmonella bind approximately

70 nucleotides downstream of the ompD mRNA start codon, and recruit RNaseE to degrade the sRNA-mRNA duplex (Pfeiffer et al. 2009; Wagner 2009; Frohlich et al. 2012). The same mechanism is employed by RyhB on fadL and ompA transcripts and by MicF on the lpxR mRNA

(Papenfort et al. 2010; Corcoran et al. 2012a).

2.9.2 Positive Regulation by sRNAs

2.9.2.1 Disruption of Secondary Structure

In some cases, the RBS is sequestered by a secondary structure found at the 5’ end of the mRNA. The binding of the sRNA near the secondary structure allows a conformational change

74 that will open the loop and allow the ribosome to access the RBS and initiate translation (Wagner and Romby 2015). This mechanism is widespread. The RNAIII sRNA disrupts a secondary structure hiding the RBS of the hla mRNA (Morfeldt et al. 1995). The same mechanism is also employed by the ArcZ, DsrA, and RprA sRNAs during positive regulation of rpoS (Majdalani et al. 1998; Majdalani et al. 2002; Mandin and Gottesman 2010)

2.9.2.2 Stabilisation of Target mRNA

The binding of the sRNA can stabilize the target mRNA. This is accomplished by the binding of the sRNA at or near the RNase E binding site, blocking the RNase E from binding and cleaving the mRNA (Wagner and Romby 2015). The GadY sRNA prevents cleavage of the gadX mRNA, a regulator of acid tolerance (Opdyke et al. 2004).

2.9.2.3 Protein-Binding sRNA

This category includes the sRNAs RsmY and RsmZ, which titre CsrA. This mechanism is explained in the section 2.7.4.5.

2.9.2.4 Transcriptional Interference

Transcriptional interference occurs when the transcription of one gene with a strong promoter represses the transcription of another cis gene with a weak promoter (Shearwin et al.

2005; Palmer et al. 2011; Sedlyarova et al. 2016). This phenomenon can occur with convergent promoters, tandem promoters, or overlapping promoters (Shearwin et al. 2005). The RNA polymerase elongation complex can be disrupted by DNA-bound transcription factors, DNA-

75 binding proteins, other RNA polymerases, or sRNAs (Palmer et al. 2011; Sedlyarova et al.

2016).

In E. coli, the termination factor Rho is able to bind long 5’ UTRs of the mRNA and terminate transcription by dissociating the transcription elongation complex (Sedlyarova et al.

2016). The 5’ UTR of the rpoS mRNA has a Rho binding site (Sedlyarova et al. 2016). The binding sites of the three sRNAs (ArcZ, DsrA, and RprA; discussed in section 2.8.4.1) in the 5’

UTR of rpoS overlap with and/or are in proximity of the Rho binding site (Sedlyarova et al.

2016). In addition to unfolding the RBS-occluding stem loop, these sRNAs prevent Rho from terminating the transcription of rpoS (Sedlyarova et al. 2016). This occurs either by preventing binding of Rho to the RNA or by acting as a roadblock, stopping Rho’s progression (Sedlyarova et al. 2016). The roadblock is effective because Rho’s helicase activity is unable to unwind

RNA:RNA complexes (Sedlyarova et al. 2016). It is also possible for the sRNA-mRNA complex to stimulate Rho-mediated termination. This could occur if the binding of the sRNA results in a conformational change that makes the Rho-binding site available (Sedlyarova et al. 2016).

2.10 Thermal Stress Response

An increase in temperature causes unfolding of proteins, leading to protein aggregates that can become lethal if they accumulate inside the cell (Richter et al. 2010; Schumann 2016).

The change in protein homoeostasis activates the heat shock response (Schumann 2016). In order to save energy, refolding misfolded proteins is preferred over degradation and de novo protein synthesis (Richter et al. 2010). E. coli has two thermal stress regulons, the RpoH (also known as

H or 32) and RpoE (also known as E or 24) thermal stress regulons (Schumann 2016). The former responds to misfolded proteins in the cytoplasm while the latter is involved in misfolded

76 proteins in the periplasm (Cooper and Ruettinger 1975; Grossman et al. 1984; Hiratsu et al.

1995; Raina et al. 1995; Rouviere et al. 1995).

2.10.1 RpoH Regulon

Under normal conditions, RpoH levels in the cell are kept low (Schumann 2016). In the absence of thermal stress, three different mechanisms ensure low levels of RpoH. In the 5’ end of the rpoH mRNA, an RNA thermometer, a temperature-dependent secondary structure, prevents translation at low temperature by sequestering the RBS (Yura 2019). The RpoH protein is produced at a basal level under normal conditions, has a short half-life, and is kept inactive by chaperones such as DnaKJ/GrpE and GroEL/ES (Gamer et al. 1992; Liberek et al. 1992; Gamer et al. 1996; Guisbert et al. 2004). Once bound to the chaperones, RpoH will be degraded by two proteases, FtsH and ClpXP (Herman et al. 1995; Tomoyasu et al. 1995; Kanemori et al. 1997;

Lim et al. 2013; Xu et al. 2015; Bittner et al. 2017). The increase in temperature removes the secondary structure blocking the RBS, thus freeing the RBS and allowing translation, resulting in an increase in the number of RpoH proteins (Schumann 2016). During thermal stress, the chaperones are occupied with the increase misfolded proteins, therefore relieving the inhibition imposed on RpoH (Tilly et al. 1983; Straus et al. 1987; Straus et al. 1990). The accumulation of misfolded proteins in a way sequester the chaperones that inhibit RpoH when it is not needed.

When RpoH is not bound by chaperones, it does not get degraded, and its half-life increases

(Bittner et al. 2017). RpoH binds to the core RNA polymerase to initiate transcription of genes required to survive the stress, and this binding of RpoH to the core RNA polymerase further protects it from degradation (Bittner et al. 2017).The increased production of RpoH leads to a rapid synthesis of chaperones that will help clear the misfolded proteins caused by the elevation

77 in temperature (Grossman et al. 1984; Grossman et al. 1987; Kamath-Loeb and Gross 1991).

Once the bacteria are not under thermal stress anymore, the chaperones run out of misfolded proteins to bind, and are therefore free to bind RpoH and reduce its activity (Yura 2019).

2.10.2 RpoE Regulon

RseA (regulation of sigma E) is an antisigma factor of RpoE. In normal conditions, it binds to RpoE and RseB, the co-antisigma factor, and prevents RpoE from interacting with the core RNA polymerase (Schumann 2016). During cell envelope stress, three different proteases will degrade RseA, releasing RpoE. Once free in the cytoplasm, RpoE will interact with the core

RNA polymerase, leading to the expression of genes in the RpoE regulon (Schumann 2016).

Outer membrane proteins (OMPs) lead to the degradation of RseA. In presence of misfolded or unassembled OMPs, the DegS protease cleaves RseA, which is further cleaved by the RseP protease and one of the various cytoplasmic proteases such as ClpXP, ClpAP, Lon, or HslUV

(Mecsas et al. 1993; Kanehara et al. 2002; Kanehara et al. 2003; Walsh et al. 2003; Chaba et al.

2007). Once the envelope stress is dealt with, DegS will become inactive and new RseA will not be cleaved and will be able to sequester RpoE.

2.11 Protein Misfolding

Protein homoeostasis, also called proteostasis, is the cellular state where the proteome is stable and functional (Balch et al. 2008). This is the result of a balance between protein synthesis, folding, trafficking, aggregation, disaggregation, and degradation (Balch et al. 2008).

Proteostasis changes along with changes in the environment (Schramm et al. 2020). Proteases play an important role in proteostasis by degrading damaged proteins and proteins that are not

78 required (Schramm et al. 2020). As mentioned in the previous section, thermal stress causes misfolded proteins. The accumulation of misfolded proteins affects a variety of phenotypes, such as pathogenicity (Lee et al. 2016). The effect of misfolded proteins on the cellular function will be discussed below.

2.11.1 Protein Aggregation

The native folding of a protein is very sensitive to environmental conditions such as temperature and pH (Schramm et al. 2020). Intra-molecular forces keep proteins folded into their secondary and tertiary structure (Schramm et al. 2020). As the temperature increases, these weak forces are disrupted, and proteins become unfolded (Schramm et al. 2020). As the hydrophobic amino acids are exposed during protein denaturation, these hydrophobic residues tend to bind together, resulting in aggregates (Schramm et al. 2020). The degree of thermal stress will dictate the effect on the proteome. A small increase in temperature will lead to a few denatured proteins while a higher increase will cause a widespread misfolding of proteins, resulting in extensive protein aggregation (Schramm et al. 2020).

Misfolded proteins tend to accumulate in stationary phase in E. coli, which could be the result of low ATP concentrations (Pu et al. 2019). ATP is important in solubilizing proteins in the intracellular environment but is also used as a source of energy by protein chaperones that will ensure proper protein folding during protein synthesis or during refolding of denatured proteins (Patel et al. 2017; Pu et al. 2019). ATP can solubilize proteins independently of ATP hydrolysis. ATP interacts with proteins through its charge and hydrophobic moieties, disrupting the electrostatic interactions and solubilizing the protein (Patel et al. 2017; Sridharan et al. 2019).

79 2.11.2 Chaperones

The chaperone Hsp70 (DnaK) and its cochaperone Hsp40 (DnaJ) are constitutively expressed to ensure proper folding of newly synthesized proteins (Schramm et al. 2020). The chaperone Hsp60 (GroEL) and its cochaperone Hsp10 (GroES), the chaperone Hsp90 (HtpG) and the ribosome-associated trigger factor (TF) are also involved in proper protein folding of newly synthesized proteins (Schramm et al. 2020). The chaperones will bind hydrophobic residues and prevent them from forming aggregates (Balchin et al. 2016). With the exception of

TF, these chaperones are ATP-dependent (Schramm et al. 2020).

During the thermal stress response, bacteria will direct their resources to repair damaged proteins, remove irreversibly damaged proteins and aggregates, as well as prevent further protein misfolding (Schramm et al. 2020). The major chaperones that are constitutively expressed are upregulated during the thermal stress response (Richter et al. 2010). In E. coli, GroES/GroEL and DnaK/DnaJ are upregulated to prevent widespread protein aggregation by refolding misfolded proteins (Tomoyasu et al. 2001; Mogk et al. 2003; Chapman et al. 2006). The Lon protease in E. coli is important for degrading misfolded proteins during non-optimal growth conditions (Tomoyasu et al. 2001; Gur and Sauer 2008).

Some chaperones and proteases are only induced in response to certain stresses. Hsp33 and CnoX are ATP-independent chaperones that are produced in response to oxidative stress as this type of stress usually inactivates ATP-dependent chaperones (Dahl et al. 2015; Goemans et al. 2018).

80 2.11.2.1 Protein Quality Control

The protein quality control system consists of proteases and chaperones (Bednarska et al.

2013). This system will prevent protein aggregation as well as repair misfolded proteins and protein aggregates (Schramm et al. 2020). Chaperones will bind to the exposed hydrophobic residues to prevent protein aggregation and attempt to refold them (Rousseau et al. 2006).

However, if refolding is unsuccessful, the misfolded proteins will be degraded (Bednarska et al.

2013).

2.11.2.1.1 ClpB-DnaK-DnaJ

The complex of three chaperones, ClpB-DnaK-DnaJ, is the major system required to deal with misfolded proteins and protein aggregates that occur during thermal stress in E. coli

(Tomoyasu et al. 2001). This complex is able to dissolve protein aggregates, which will eventually lead to their refolding (Schramm et al. 2020). However, ClpB is unable to prevent protein aggregates from occurring and does not interact with peptidases (Mogk et al. 2018;

Schramm et al. 2020). ClpB is upregulated during thermal stress and a clpB mutant is unable to survive thermal stress (Schramm et al. 2020). The aggregation of a protein inside the cell can lead to the aggregation of other unrelated proteins, such as when the chaperones required for the proper folding of de novo synthesized proteins are tittered by the protein aggregates, causing the newly synthesized proteins to be misfolded (Bence et al. 2001).

The ClpB-DnaK-DnaJ complex works in the following way. DnaK/DnaJ bind to the protein aggregates and untangles the polypeptides and transfers them to ClpB, which will further untangle them in order for them to refold spontaneously or with the assistance of other chaperones (Liberek et al. 2008).

81 2.11.2.1.2 Trigger Factor

Ribosome-associated chaperones, such as trigger factor, are responsible for protein folding of newly synthesized proteins and will bind their target as they are released from the ribosome (Bednarska et al. 2013).

If misfolded proteins and protein aggregates are not dealt with and the bacteria replicates, they will be passed down to the daughter cells (Schramm et al. 2020). Inheriting aggregated proteins caused by thermal stress often leads to a reduced growth rate of the daughter cells

(Winkler et al. 2010). In Mycobacterium smegmatis, a large inheritance of protein aggregates can lead to cell death (Vaubourgeix et al. 2015).

2.11.3 Toxicity of Protein Aggregates

Misfolded and/or unfolded proteins tend to cluster together, forming protein aggregates that are not functional (Schramm et al. 2020). The size of protein aggregates and their impact on cellular functions and viability is determined by the duration and the intensity of the stress

(Schramm et al. 2020). Accumulation of protein aggregates overwhelms the repair mechanism, which can be detrimental to growth and can even be fatal (Schramm et al. 2020). This is caused by binding between protein aggregates and important functional proteins, rendering them non- functional (Balchin et al. 2016; Mogk et al. 2018). Proteins that tend to become denatured are usually involved in carbon metabolism, oxidative phosphorylation, translation, and DNA replication and repair (Schramm et al. 2020). If a majority of these proteins are affected, it could lead to growth arrest.

Additionally, aggregation of misfolded proteins can lead to carbonylation or oxidation of proteins, reduced membrane permeability, and the rearrangement of the membrane’s lipid

82 content (Bednarska et al. 2013). Peroxidation and/or rearrangement of membrane lipids can cause the overexpression of membrane proteins, porins, and ion pumps which can result in calcium ion leakage and pore formation (Bednarska et al. 2013).

2.12 Tail-Specific Proteases

Tail-specific proteases (Tsp) are a group of proteases found in bacteria, archaea, eukaryotes, viruses, and organelles such as chloroplasts (Bandara et al. 2005; Feldman et al.

2006; Carroll et al. 2014) . This group of proteases degrade proteins by recognizing a series of hydrophobic residues on the C-terminal end of the target protein (Beebe et al. 2000). Tsps are usually found in the periplasm, but some are located in the cytoplasm or secreted in the extracellular environment (Hoge et al. 2011).

There are four characteristics that determine substrate specificity of Tsp (Keiler and

Sauer 2002): 1) the C-terminal residues, 2) the presence of a free -carboxyl group, 3) the thermodynamic stability of the native structure, 4) the presence of the suitable cleavage site.

The first bacterial Tsp was identified in E. coli as a protease able to process the penicillin-binding protein 3 (Hara et al. 1991). Further studies have identified roles for Tsps in resisting thermal stress and in virulence. Below I will provide a few examples of well- characterized Tsps.

2.12.1 Tsp in Pseudomonas aeruginosa

The Pseudomonas aeruginosa type 3 secretion system (T3SS) is important for its virulence during an acute infection (Seo and Darwin 2013). P. aeruginosa also causes chronic lung infections, which usually requires the switch to a mucoid state (Seo and Darwin 2013). The

83 mucoid phenotype is caused by the overproduction of alginate, an exopolysaccharide whose biosynthesis is regulated by the AlgU/T sigma factor (Sautter et al. 2012; Seo and Darwin 2013).

AlgU/T is negatively regulated by the anti-sigma factor MucA (Seo and Darwin 2013). A mutation in the C-terminal end inactivates MucA and is the main reason P. aeruginosa progress to mucoidy (Reiling et al. 2005; Sautter et al. 2012; Seo and Darwin 2013).

P. aeruginosa codes for two C-terminal proteases named Prc and CtpA (Hoge et al. 2011;

Seo and Darwin 2013). Prc is implicated in the degradation of a mutant form of MucA and helps prevent the development of mucoidy (Reiling et al. 2005; Sautter et al. 2012; Seo and Darwin

2013). CtpA is located in the periplasm and is important for the function of the T3SS, for cytotoxicity in cultured cells and for virulence in the animal model of acute pneumonia (Hoge et al. 2011; Seo and Darwin 2013). Unlike what has been observed in other bacteria, the ctpA mutant in P. aeruginosa does not display increased sensitivity to antibiotics, low-salt media or heat (Seo and Darwin 2013).

2.12.2 Tsp in Staphylococcus aureus

Staphylococcus aureus produces a Tsp called CtpA that is important in maintaining cell wall stability, tolerating thermal stress, surviving components of the human serum, and for virulence in THP-1 cultured macrophages and in a murine model (Carroll et al. 2014). The expression of ctpA reaches peak level during infection (Carroll et al. 2014).

2.12.3 Tsp in Chlamydia trachomatis

Chlamydia trachomatis, an obligate intracellular bacterium, codes for two Tsps, CT441 and CPAF (CT858), both targeting host proteins (Lad et al. 2007). These two Tsps are secreted

84 into the cytoplasm of the host cell in order to cleave host proteins (Zhong et al. 2001; Borth et al.

2010; Zhong 2011). CT441 is able to cleave the p65 protein, a major regulator of the NF-B pathway (Lad et al. 2007). CPAF degrades the regulatory factor X5 (RFX5) and the upstream stimulation factor 1 (USF-1), both being transcription factors for the expression of the major histocompatibility complex (Lad et al. 2007). The action of CT441 and CPAF leads to the suppression of the host immune response against the pathogen (Lad et al. 2007).

2.12.4 Tsp in Salmonella

Tsp in Salmonella Typhimurium is important for survival in murine macrophages as well as in mice (Baumler et al. 1994). Bile-sensitive Salmonella strains who lose a functional Tsp become bile-resistant, similar to a WT Salmonella (Hernandez et al. 2013). Salmonella’s Tsp processes the penicillin binding protein 3, similar to what is observed in E. coli (Hernandez et al.

2013).

2.12.5 Tsps and Outer Membrane Proteins

Outer membrane proteins (OMP) are important for bacterial interaction with host cells

(Huang et al. 2020). OMPs are a target of Tsps in various bacteria, such as E. coli, Borrelia burgdorferi, Brucella suis, and Burkholderia mallei.

2.12.5.1 Escherichia coli

The outer membrane protein Spr is a peptidoglycan hydrolase required for maintaining the stability of the peptidoglycan layer and overexpression of Spr negatively affects peptidoglycan synthesis by decreasing the peptidoglycan crosslinkage with the outer membrane,

85 destabilizing the bacterial envelope (Singh et al. 2012; Schwechheimer et al. 2015). Spr is a substrate of E. coli’s Tsp, and this outer membrane protein accumulates in a tsp mutant resulting in the strain’s inability to grow at 42 C under low osmolarity (Singh et al. 2015).

Tsp of extraintestinal pathogenic Escherichia coli (ExPEC) strains is required for virulence as a tsp mutant is sensitive to killing by the complement and does not survive in the bloodstream (Wang et al. 2012). In ExPEC strains, Tsp is important for processing outer membrane proteins and a tsp mutant has an altered outer membrane protein profile (Wang et al.

2012; He et al. 2015; Huang et al. 2020). Absence of Tsp in ExPEC leads to a downregulation of the flagella, resulting in decreased motility (Huang et al. 2020). The reduced motility coupled with a different outer membrane profile seems to prevent the tsp mutant from colonizing the urinary tract (Huang et al. 2020).

2.12.5.2 Borrelia burgdorferi, Brucella suis, and Burkholderia mallei

CtpA of B. burgdorferi targets the outer membrane proteins P13 and OspC, which play a role in virulence of mammalian hosts (Noppa et al. 2001; Kumru et al. 2011). In B. suis, the lack of outer membrane processing in a cptA mutant led to an altered cell morphology as well as the inability of the ctpA mutant to survive in macrophages and the mouse model (Bandara et al.

2005). A ctpA mutant in B. mallei also displays an altered cell morphology and is defective for infection of murine macrophages (Bandara et al. 2008). However, CtpA is dispensable for in vivo infection of mice (Bandara et al. 2008).

86 Connecting Text Chapter 3

RpoS is a major regulator in Legionella. As described in the introduction, preliminary data suggest that the Lpr10 sRNA is expressed in water and is regulated by RpoS, and hence could have a role in surviving in water (Appendix Table 1). We therefore decided to investigate its role.

The manuscript was published in the journal Molecular Microbiology.

87 The small regulatory RNA Lpr10 regulates the expression of

RpoS in Legionella pneumophila

Running title: Lpr10 regulates RpoS expression

Joseph Saoud1,2, Marie-Claude Carrier3, Éric Massé3, and Sébastien P. Faucher1,2

1) Department of Natural Resource Sciences, McGill University, Sainte-Anne-de-Bellevue,

Québec, Canada

2) Centre de Recherche en Infectiologie Porcine et Avicole (CRIPA), Université de Montréal,

Faculté de Médecine Vétérinaire, Saint-Hyacinthe, Québec, Canada, J2S 2M2

3) Department of Biochemistry and Functional Genomics, RNA Group, Université de

Sherbrooke, Sherbrooke, Québec, Canada

Correspondence and requests for materials should be addressed to Sébastien P. Faucher (email: [email protected])

Keywords (5): Legionella pneumophila; small regulatory RNA; RpoS; water; transcriptional regulation

Conflict of Interest Statement: The authors do not have any conflict of interest to disclose.

88 3.1 ABSTRACT

Legionella pneumophila (Lp) is a waterborne bacterium able to infect human alveolar macrophages, causing Legionnaires’ disease. Lp can survive for several months in water, while searching for host cells to grow in, such as ciliates and amoeba. In Lp, the sigma factor RpoS is essential for survival in water. A previous transcriptomic study showed that RpoS positively regulates the small regulatory RNA Lpr10. In the present study, deletion of lpr10 results in an increased survival of Lp in water. Microarray analysis and RT-qPCR revealed that Lpr10 negatively regulates the expression of RpoS in the post-exponential phase. Electrophoretic mobility shift assay and in-line probing showed that Lpr10 binds to a region upstream of the previously identified transcription start sites (TSS) of rpoS. A third putative transcription start site was identified by primer extension analysis, upstream of the Lpr10 binding site. In addition, nlpD TSS produces a polycistronic mRNA including the downstream gene rpoS, indicating a fourth TSS for rpoS. Our results suggest that the transcripts from the third and fourth TSS are negatively regulated by the Lpr10 sRNA. Therefore, we propose that Lpr10 is involved in a negative regulatory feedback loop to maintain expression of RpoS to an optimal level.

89 3.2 INTRODUCTION:

Legionella pneumophila (Lp) is a Gram-negative, strictly aerobic bacterium that causes

Legionnaire’s disease (LD) in humans, a severe form of pneumonia and an important cause of nosocomial and community-acquired pneumonia (Liu and Shin 2019). The number of LD cases in North America and Europe has been on the rise (Centers for Disease and Prevention 2011;

ECDC 2018). For example, the number of legionellosis cases has increased by 286% from 2000 to 2014 in the USA (Garrison et al. 2016). Similarly, a 30% increase in LD cases was observed in Europe in 2017 compared to the previous year, and the mortality rate reached 8% of confirmed cases (ECDC 2019).

Lp is found in natural and man-made aquatic environments, such as cooling towers and plumbing infrastructures, where it replicates inside phagocytic protozoa, such as Acanthamoeba castellanii and Vermamoeba vermiformis (formerly Hartmannella vermiformis) (Wadowsky et al. 1991; Taylor et al. 2009). Modern water systems help in the transmission of Lp by generating aerosols (World Health Organization. 2003), which inhalation results in the infection of human alveolar macrophages (von Baum et al. 2008; Allegra et al. 2016). During intracellular infection,

Lp exhibits a biphasic life cycle where it alternates between the replicative phase and the transmissive phase (Byrne and Swanson 1998; Swanson and Hammer 2000; Molofsky and

Swanson 2004; Mondino et al. 2020). These phases are mimicked in vitro by the exponential growth phase (E phase) and the post-exponential growth phase (PE phase), respectively (Byrne and Swanson 1998; Swanson and Hammer 2000; Molofsky and Swanson 2004; Mondino et al.

2020).

The most important genetic determinant of intracellular multiplication is the Icm/Dot type IVb secretion system, which injects more than 330 proteins, called effectors, into the

90 cytoplasm of host cells (Ensminger 2016). Deletion of a single effector rarely leads to a phenotype due to functional redundancy of the effectors or host specific substrates (Qiu and Luo

2013). These effectors efficiently stop the phagolysosome maturation process and highjack host cell functions to the bacteria’s benefit, allowing them to grow inside the host cell (Ensminger

2016).

Small regulatory RNAs (sRNA) are short RNA molecules that generally act as post- transcriptional regulators of various processes inside bacteria, including virulence and stress response (Apura et al. 2019; Desgranges et al. 2020). Base-pairing sRNAs are the most common type of sRNAs and affect gene expression by hybridizing to target mRNAs (Holmqvist and

Wagner 2017). This family can be divided into two groups, depending on their position within the genome (Holmqvist and Wagner 2017). Cis-encoded sRNAs are encoded on the complementary strand of their target and form a perfect base pairing with the target mRNA due to perfect sequence complementarity (Apura et al. 2019). Trans-encoded sRNAs are encoded within their own loci and form an imperfect base pairing with their target mRNAs due to limited homology (Apura et al. 2019). While more than 700 small RNA transcripts have been identified in Lp, only a few of them have been studied and characterized, which are reviewed briefly below

(Faucher et al. 2010; Weissenmayer et al. 2011; Sahr et al. 2012).

The 6S RNA is a ubiquitous protein-binding RNA that regulates transcription by binding to the sigma factor of RNA polymerase (Wassarman 2007). In Lp, the 6S sRNA is required for intracellular multiplication in amoeba and macrophages (Faucher et al. 2010). It induces the expression of 127 genes in PE phase, including genes coding for Icm/Dot effectors, stress response genes, and genes responsible for nutrient acquisition (Faucher et al. 2010; Trigui et al.

2013).

91 Lp encodes a complete CsrA-dependent regulatory system initially characterized in

Escherichia coli (Romeo et al. 1993; Molofsky and Swanson 2003; Forsbach-Birk et al. 2004).

In Lp, the system is composed of CsrA, the two-component system LetA/S, as well as the three sRNAs RsmX, RsmY, and RsmZ (Kulkarni et al. 2006; Rasis and Segal 2009; Sahr et al. 2009;

Sahr et al. 2012). In the replicative phase, CsrA binds to and blocks translation of mRNAs coding for transmissive phase traits. The expression of the three sRNAs is directly regulated by the LetA/S two-component system and indirectly regulated by RpoS, which regulates the expression of LetS (Hovel-Miner et al. 2009; Rasis and Segal 2009; Sahr et al. 2009). RsmX/Y/Z are expressed in the transmissive phase and act by blocking the action of CsrA which is necessary for full virulence (Rasis and Segal 2009; Sahr et al. 2009; Sahr et al. 2012).

RocR is a Legionella-specific and highly conserved trans-encoded sRNA that regulates natural transformation in Lp (Attaiech and Charpentier 2017; Durieux et al. 2019). In the exponential phase, RocR, with the help of the mRNA chaperone RocC, prevents expression of genes encoding the DNA uptake system by hindering translation and inducing mRNA degradation (Attaiech and Charpentier 2017).

Hfq is a protein required for post-transcriptional regulation in some bacteria. Its main role is to stabilize sRNAs and promote interaction with mRNA targets (Geissmann and Touati 2004;

Gottesman 2004). In Lp, the cis-encoded sRNA Anti-Hfq negatively regulates expression of the

RNA chaperone Hfq during the exponential phase (Oliva et al. 2017).

Many transcription factors are involved in the regulation of virulence factors, such as the sigma factor RpoS, RelA and SpoT involved in the stringent response, and the two-component systems LetA/S, PmrA/B, LqsR/S, and CpxR/A (Zusman et al. 2007; Altman and Segal 2008).

92 These regulators are key players of the transition between the replicative and the transmissive phase of growth and consequently, stress response and virulence (Oliva et al. 2018).

The RpoS protein has been extensively characterized in E. coli in which it is a main regulator of stress response and virulence (Landini et al. 2014). In Lp, rpoS mRNA levels are highest in replicative phase, but the protein levels are highest in the transmissive phase (Hales and Shuman 1999). CsrA is responsible for restricting translation of rpoS in the replicative phase

(Sahr et al. 2017). Nevertheless, RpoS is crucial to survive osmotic shock in E phase (Hales and

Shuman 1999). During E phase, RpoS downregulates the transcription of virulence genes in order to repress motility, infectivity, and cytotoxicity, allowing strong replication (Bachman and

Swanson 2001; Bachman and Swanson 2004). When cells enter the post-exponential phase,

RpoS upregulates genes required for the transmissive phase (Bachman and Swanson 2004).

These genes include virulence factors such as Mip, required for invasion and replication in amoeba and macrophages, ProA, a secreted protease that is cytotoxic to macrophages and important for the virulence in the guinea pig model, and FlaA, required for motility (Dong and

Schellhorn 2010). RpoS does not play a major role in the expression of Icm/Dot structural genes.

However, it is crucial for the full expression of many Icm/Dot effectors (Zusman et al. 2002;

Hovel-Miner et al. 2009). Moreover, RpoS, together with LetA/S, are crucial for the survival of

Lp in water (Trigui et al. 2015; Mendis et al. 2018). A transcriptomic analysis showed that RpoS significantly affects the expression of 668 genes in water, of which 75% are downregulated

(Trigui et al. 2015). These genes are mainly involved in replication, transcription, and translation

(Trigui et al. 2015). RpoS also decreases intracellular levels of SpoT, the protein responsible for the degradation of the signalling alarmone ppGpp produced during starvation (Trigui et al.

2015). In turn, the reduced expression of SpoT ensures that a high level of ppGpp is maintained,

93 allowing maximal starvation response (Trigui et al. 2015). Therefore, RpoS is crucial to the survival of Legionella within hosts and between hosts.

Previous studies have identified several putative trans-encoded sRNAs in Lp strain

Philadelphia-1 potentially involved in the transition between the replicative and transmissive phase (Faucher et al. 2010; Weissenmayer et al. 2011). Lpr10 is a trans-encoded sRNA that is expressed in the post-exponential phase (Weissenmayer et al. 2011). Transcriptomic analysis of the rpoS mutant exposed to water revealed that the sRNA Lpr10 is downregulated in the mutant compared to the WT strain (Trigui et al. 2015). Furthermore, a transcriptomic analysis of the WT strain exposed to water showed that Lpr10 is upregulated in the WT at 2 hours in water, and its expression increases further at 6 hours in water (Li et al. 2015). Given that the sigma factor RpoS is required to survive various stresses, including survival in water, and necessary for the switch from the replicative phase to the transmissive phase (Hales and Shuman 1999; Bachman and

Swanson 2004; Trigui et al. 2015), we hypothesized that this sRNA could be part of the RpoS regulatory cascade and important to regulate genes involved in the transmissive phase as well as genes involved in survival in water. Lp’s ability to survive in water for a prolonged period of time impacts its ability to colonize water systems as it can persist until it encounters hosts permissive for its growth (Li et al. 2015). Here, we propose that Lpr10 regulates the expression of rpoS mRNA and explore the physiological relevance of this regulation.

94 3.3 RESULTS

3.3.1 Lpr10 is expressed in PE phase

Lpr10 is encoded between lpg0286, a gene of unknown function, and efp, coding for the elongation factor P (Figure 1A). Basic Local Alignment Search Tool (BLAST) (Altschul et al.

1990) was used to determine if lpr10 is conserved amongst Legionella. lpr10 seems conserved in

Lp as various strains, including Paris, Lens, Corby, Alcoy, and LPE509, possess the gene with

100 % identity. The Lp strains Sudbury and Mississauga, however, do not encode lpr10.

Moreover, the sRNA seems to be absent in non-pneumophila species of Legionella as L. longbeachae and L. quinlivanii do not encode lpr10. The transcription start site (TSS) and termination site of Lpr10 were confirmed by RACE. One fragment was amplified by 5’ RACE following treatment with RppH and cloned (data not shown). Six clones were sent for sequencing and all six fragments mapped to the coordinate 341 267 (NC_002942.5). One fragment was amplified by 3’ RACE, cloned, and sent for sequencing (data not shown). Three clones sent for sequencing had a termination site at position 341 438 (NC_002942.5). The genomic position of Lpr10 determined by RACE is presented in Figure 1A.

Previous data suggested that lpr10, initially named lpr0010, was expressed in PE phase and regulated by RpoS (Weissenmayer et al. 2011; Trigui et al. 2015). Lpr10 is known as

Lppn0103 in strain Paris and is expressed in PE phase but not in E phase (Sahr et al. 2012).

Additionally, the promoter region of lpr10 contains the sequence CTATTAT preceded by AT- rich regions, which is consistent with the consensus sequence of RpoS binding sites described previously (Sahr et al. 2012). To confirm this, a lpr10 mutant strain (lpr10) and lpr10 complemented strain were constructed and Northern blot was performed to measure expression

95 of Lpr10 in the wild-type strain, the lpr10 mutant, and the lpr10 complemented strain (lpr10 + plpr10) in the exponential phase (E) and post-exponential phase (PE). As previously reported,

Lpr10 is expressed only in the PE phase in the WT strain (Figure 1B). Lpr10 is not detectable in the lpr10 strain, as expected, confirming the mutation and the specificity of the probe. The complemented strain regains ability to express the sRNA, albeit to a higher level than the WT, which is likely due to the copy number of the plasmid used for complementation (Figure 1B).

Northern blot was then used to assess the expression of the Lpr10 sRNA in the rpoS mutant

(rpoS) and the rpoS complemented strain (rpoS + prpoS) in E and PE phase (Figure 1C). No difference of Lpr10 levels was observed in E phase between the strains, where it was expressed at very low levels. The higher expression of Lpr10 in E phase in panel C compared to panel B might be due to slight difference in the OD600 of the cultures. As expected, Lpr10 is downregulated in the rpoS mutant in PE phase, but reached wild-type level of expression when the RpoS gene is expressed from the plasmid by addition of IPTG (ON). Our results confirm that

RpoS is required for the optimal expression of Lpr10.

96

Figure 1: Lpr10 is expressed in PE phase and is regulated by RpoS. A) Lpr10 is encoded between lpg0286 and efp. The coordinates of Lpr10 in the Philadelphia-1 genome are indicated

(NC_002942.5). The region in red indicates the portion of the small RNA that was replaced with a kanamycin resistance cassette in the lpr10 mutant (lpr10). B) The expression of Lpr10 was investigated by Northern blot in the WT, lpr10 mutant (lpr10), and complemented strain

(lpr10 + plpr10) grown to exponential phase (E) and post-exponential phase (PE). C) The regulation of Lpr10 by RpoS was investigated by Northern blot analysis of the WT, rpoS mutant

(rpoS), and complemented strain grown without (rpoS + prpoS OFF) and with 0.1 mM IPTG

(rpoS + prpoS ON) to induce the expression of rpoS from the Ptac promoter. The strains were grown to exponential (E) and post-exponential (PE) phase in AYE broth. 5S rRNA was used as a

97 loading control. Densitometry analysis was performed with ImageJ and presented as the ratio between the Lpr10 band intensity and the 5S rRNA band intensity.

3.3.2 rpoS and several other genes are upregulated in the Lpr10 mutant

DNA microarrays were used to identify genes regulated by Lpr10 in PE phase. The transcriptome of the WT strain, the lpr10 mutant, and the lpr10 complemented strain were compared (Figure 2A and 2B). To determine genes that were differentially expressed in the lpr10 mutant, the transcriptome of the lpr10 mutant was compared to that of the WT and the complemented strain. Only genes differentially expressed in the lpr10 mutant compared to the

WT and in the lpr10 mutant compared to the complemented strain, but not differentially expressed in the complemented strain compared to the WT were considered to be affected by deletion of lpr10. A total of 90 genes are differentially expressed in the absence of Lpr10: 75 genes are up-regulated in the mutant and 15 genes down-regulated in the mutant (Supplementary

Table S1). It is noteworthy that regulation of these genes by Lpr10 could be direct or indirect.

Icm/Dot structural genes dotC and dotD, the vipA Icm/Dot effector, and genes involved in synthesis and assembly of the flagella were upregulated in the mutant (Table 1). Other Icm/Dot effectors were downregulated in the mutant (Table 1). The expression of three upregulated genes

(dotD, flgB, rpoS) and two genes downregulated in the lpr10 mutant (pilE3 and sidH) were confirmed by RT-qPCR (Figure 2C). Of note, both microarray and RT-qPCR indicate that rpoS is strongly upregulated in the lpr10 mutant (Figure 2B and Figure 2C, red bars).

98

Figure 2: The rpoS mRNA is negatively regulated by Lpr10. A) Genes differentially regulated in PE phase between the WT, lpr10 mutant (lpr10), and complemented strain (lpr10

+ plpr10) were identified by microarray and the data is presented as a heat map. Genes are arranged in genomic order. Downregulated genes are represented in green, upregulated genes are shown in red, and genes in black are unchanged. Lane 1: lpr10 / WT. Lane 2: lpr10 + plpr10 /

WT. Lane 3: lpr10 / lpr10 + plpr10. The expression value from the microarray data of three upregulated genes (flgB, rpoS, dotD) and two downregulated genes (pilE3, sidH) are shown (B).

Expression of these genes was confirmed by RT-qPCR (C). The data represent average of three biological replicates with standard deviation. For RT-qPCR, a One Sample t Test was used to

99 determine if the values are statistically different than the hypothetical value of 0 (no change in expression). * P-value < 0.05.

Table 1: Selected genes differentially regulated in the lpr10 deletion mutant.

Gene Gene Description Fold change (log2)

name

lpr10 vs lpr10 + lpr10 vs WT plpr10 lpr10 + vs WT plpr10

lpg0390 vipA Icm/dot effector. Causes actin 2.61 0.98 1.91 polymerization in host cell to help form early phagosome

lpg0627 pilE3 Type IV pilin -3.27 -1.44 -1.82

lpg0657 ompA Outer membrane protein 2.48 0.16 2.50

lpg0927 pilM Type IV pilus biogenesis protein 2.53 0.83 2.08

lpg1216 flgB Flagellar basal body rod protein 4.45 0.88 3.57

lpg1217 flgC Flagellar basal body rod protein 3.98 0.62 3.79

lpg1218 flgD Flagellar basal body rod 3.96 0.44 3.63 modification protein

lpg1219 flgE Flagellar hook protein 3.38 -0.42 2.60

lpg1220 flgF Flagellar basal body rod protein 3.01 -0.22 1.85

lpg1221 flgG Flagellar basal body rod protein 4.22 -1.07 4.55

100 lpg1222 flgH Flagellar L-ring protein 2.76 -0.48 1.74

lpg1225 flgK Flagellar hook associated protein 1.97 -1.85 1.31 1

lpg1284 rpoS Stationary phase specific sigma 3.13 0.62 3.86 factor (RNA polymerase sigma factor RpoS)

lpg1784 flhF Flagellar GTP-binding protein 2.95 0.57 1.32

lpg1792 fliM Flagellar motor switch protein 4.40 1.33 2.67

lpg1835 metQ 29KDa immunogenic lipoprotein 1.51 0.36 1.67

lpg2674 dotD Icm/Dot subcomplex component 2.50 0.31 2.30

lpg2675 dotC Icm/Dot subcomplex component 2.25 0.12 3.12

lpg2829 sidH Icm/Dot effector -3.39 -1.21 -2.18

lpg2960 mompS Major outer membrane protein 2.65 0.15 2.30

3.3.3 Deletion of Lpr10 improves survival in water

Our results indicate that lpr10 is positively regulated by RpoS (Figure 1C) and rpoS is negatively regulated by Lpr10 (Figure 2B and 2C). These results, taken together, suggest a regulatory feedback loop between lpr10 and rpoS. Since RpoS is essential for survival in water, we hypothesized that Lpr10 could also be involved in regulating survival in water. First, the expression of lpr10 in water was investigated. The WT strain was grown to E phase, to ensure no prior expression of lpr10, and then transferred to Fraquil, an artificial freshwater medium (Morel et al. 1975). Samples for RNA analysis were taken before the transfer, and at 2 h, 4 h, 6 h, and 24 h after inoculation in water. These time points were chosen according to our previous study of the transcriptome of Lp in water (Li et al. 2015). Adaptation of Lp to water occurs within 24

101 hours and transcriptional activity decreases drastically after that period. Northern blot revealed that the expression of Lpr10 increases with time and is strongest after a 24-hour incubation

(Figure 3A). Since Lpr10 is expressed in water, the survival of the mutant in water was explored.

Over a period of 24 weeks, the lpr10 mutant survives better in water compared to the WT

(Figure 3B). After 21 weeks, the culturability of the WT and complemented strain dropped by

10,000-fold, while the mutant suffered only a 10-fold reduction. These results are consistent with the upregulation of rpoS in the lpr10 mutant, since RpoS is essential for survival in water (Trigui et al. 2015). This is confirmed by the rapid decline in CFU count of the rpoS mutant.

Presumably, overexpression of rpoS results in a higher capability to sustain long-term starvation.

Deletion of lpr10 does not affect intracellular growth in Acanthamoeba castellanii, Vermamoeba vermiformis or THP-1 human cultured cells (Supplementary Figure 1).

Figure 3: Lpr10 is expressed in water and the lpr10 mutant survives longer in water compared to the WT. A) Northern blot analysis of Lpr10 in the WT strain grown in water. The

WT was grown in AYE medium until it reached E phase and then transferred to water. A sample

102 was taken before transfer to water and at multiple time points following exposure to water (2h,

4h, 6h, and 24h). Densitometry analysis was performed with ImageJ and presented as the ratio between the Lpr10 band intensity and the 5S rRNA band intensity. B) Long-term survival in water of the WT (black), lpr10 mutant (lpr10, red), and complemented strain (lpr10 + plpr10, blue) was tested. The strains were suspended in Fraquil and CFU counts were performed weekly.

The data is represented as average ± standard deviation. The rpoS mutant (rpoS, brown) is used as a negative control.

3.3.4 Lpr10 pairs to the 5’ region of rpoS mRNA

Our results indicate that Lpr10 regulates the rpoS transcript, which could be mediated by direct binding of the sRNA to the rpoS transcript. We used RNApredator to find putative binding sites (Eggenhofer et al. 2011). One was found 72 nucleotides upstream of the second known TSS of rpoS (TSS2) (Sahr et al. 2012). Nucleotides 56-77 of Lpr10 were predicted to pair with the mRNA (Supplementary Figure S2). This binding site is located in the gene upstream of rpoS, nlpD (Figure 4A). To validate that both RNAs interact directly, we first performed electrophoretic mobility shift assays (EMSA) using a 5’-end radiolabelled 5’rpoS RNA (γ-

5’rpoS) which includes nucleotides -153 to +101 relative to rpoS TSS2 (+1). In the presence of increasing concentration of Lpr10 sRNA, a clear shift of γ-5’rpoS electrophoretic mobility is observed, suggesting a direct interaction between the two partners (Figure 4B). Addition of unlabelled 5’rpoS competed with γ-5’rpoS (Figure 4C), but not addition of an unlabelled unrelated RNA (E. coli MicF) (Figure 4D), demonstrating the specificity of the interaction. Next, we determined the specific nucleotides of rpoS involved in the interaction with Lpr10 using in- line probing. This assay revealed a protection of the 5’rpoS RNA fragment between nucleotides -

103 106 and -93, in relation to rpoS TSS2, in the presence of Lpr10 (Figure 4E), suggesting that the sRNA interacts with the mRNA through at least 14 consecutive paired nucleotides (Figure 4F).

The pairing site identified in vitro corresponds to the putative base-pairing site predicted in silico, albeit it is less extensive than anticipated (Figure 4F). In-line probing also highlights three specific nucleotides, one upstream and two downstream of Lpr10 pairing site, that become highly accessible to cleavage in presence of Lpr10 (Figure 4E and 4F), a strong indication of structural changes in the mRNA following base pairing with the sRNA.

Using the RNAfold WebServer (Lorenz et al. 2011), we predicted the secondary structure of Lpr10 sRNA, which presents itself as a long, bulged-out stem-loop for which double-stranded region are mostly G-C rich (Supplementary Figure S3). Interestingly, Lpr10 nucleotides 64 to 77, putatively involved in the base-pairing to 5’rpoS, are in stem 4, which appears to be the weakest stem of Lpr10.

104

Figure 4: Lpr10 pairs in the coding sequence of nlpD, upstream of rpoS TSS2. A) Three genes are located upstream of rpoS: lpg1281, surE, and nlpD. The two known rpoS transcription start sites (TSS1-2) are indicated. The putative Lpr10 binding site is indicated in red. B) EMSA of γ-32P-radiolabelled 5’rpoS (20 nM) incubated with increasing concentrations of Lpr10 (0 –

105 2000 nM). C) EMSA of γ-32P-radiolabelled 5’rpoS (20 nM) first incubated with 200 nM Lpr10 before the addition of increasing concentrations of unlabelled 5’rpoS (0 – 2000 nM). D) EMSA of γ-32P-radiolabelled 5’rpoS (20 nM) first incubated with 200 nM Lpr10 before the addition of increasing concentrations of unlabelled unrelated competitor (E. coli MicF, 0 – 2000 nM). E) In- line probing of the region upstream of nlpD (5’rpoS) with Lpr10. 5’end-radiolabelled 5’rpoS was incubated with or without Lpr10. The region protected in presence of Lpr10 is indicated by a bracket. Ctrl, non-reacted controls (lanes 1-2); OH, alkaline ladder (lane 3); T1, RNase T1 ladder

(lane 4). F) Schematic representation of the pairing between 5’rpoS and Lpr10. Nucleotide position is given in relation to rpoS TSS2. Bold characters represent the in silico predicted base- pairing site using RNA predator tool (Supplementary Figure S2). Green dots indicate nucleotides more accessible to cleavage in presence of Lpr10.

3.3.5 A putative third and fourth rpoS TSS are located upstream of Lpr10 binding site

The confirmed pairing of Lpr10 far upstream of rpoS indicates that the sRNA would not interact with a rpoS mRNA originating from the known TSS1 or TSS2 (Figure 4A).

Nevertheless, we demonstrated that Lpr10 regulates rpoS expression by using microarrays and

RT-qPCR (Figure 2B, 2C). We therefore hypothesized that at least one other TSS must drive transcription of the rpoS gene, yielding a longer transcript with a 5’UTR harbouring the Lpr10 pairing site (Figure 5A). To verify this possibility, we used primer extension assay to investigate the presence of other rpoS TSS (Figure 5B). Focusing on the region upstream of Lpr10 pairing site, we identified a putative TSS (TSS3) 573 nucleotides upstream of rpoS’ ATG at genomic position 1,411,443. The putative TSS3 is located 44 nucleotides upstream of Lpr10 base-pairing site. The primer extension also presents unmappable bands upstream of the putative TSS3,

106 suggesting the presence of yet another TSS (Figure 5B). A polycistronic transcript encompassing nlpD and rpoS could originate from the TSS of nlpD (called TSS4 here), located 600 nucleotides upstream of Lpr10 base-pairing site, at position 1,410,887, 1,129 nucleotides upstream rpoS’

ATG. Both TSS3 and TSS4 would produce a rpoS mRNA that could be targeted by Lpr10.

RT-PCR was used to confirm the presence of mRNA originating from TSS3 and TSS4 in

PE phase. A reverse primer (rpoS_R) was designed to bind downstream of the ATG of rpoS

(Figure 5A) and was used as the reverse primer for all RT-PCRs mentioned below. Primer nlpD_F binds downstream of TSS2 to detect the known rpoS transcripts, which serves as a control. As expected, a strong band is produced with this primer (Figure 5C, lane 1). A primer binding in lpg1281 (lpg1281_F) shows that lpg1281 is not transcribed with rpoS as part of a longer polycistronic mRNA in PE phase (Figure 5C, lane 5). Primer nlpD_TSS3-BS_F binds between the putative TSS3 and the Lpr10 pairing site, allowing the detection of transcripts originating from TSS3 and TSS4. Using this primer, a faint but detectable band is produced in the lpr10 mutant (Figure 5D, lane 5), supporting the notion of a rpoS transcript initiated at TSS3

(Figure 5D). The higher expression of this transcript in the lpr10 mutant supports the downregulation of the expression of RpoS by Lpr10 from the putative TSS3. Primer nlpD_F2 binds upstream of the TSS3. A faint band is produced in the WT, lpr10 mutant, and the complemented strain (Figure 5E lane 1, 5, and 9, respectively), indicating that a transcript originates upstream of the putative TSS3. Primer surE_F binds between nlpD’s TSS and its

ATG. A faint band is produced in the lpr10 mutant (Figure 5F, lane 5), suggesting the transcript originates from the nlpD TSS and that nlpD and rpoS are transcribed as part of a polycistronic mRNA. The higher expression observed in the lpr10 mutant (Figure 5F, lane 5) suggests that

Lpr10 regulates this transcript as well. The lower signal obtained with primer surE_F compared

107 to primer nlpd_F2 may be the result of processing of the transcript originating from TSS4 or the presence of another TSS between these two primers.

108

Figure 5. rpoS can be transcribed from two additional TSS located upstream of the Lpr10 binding site. A) The location of the primers used for reverse transcription and the position of the four TSS are shown. The two novel TSS are colored in blue. Lpr10 binding site is shown in red.

109 B) Primer extension analysis of the region upstream of Lpr10 binding site. Lane 1-4; sequencing ladder, lane 5; RT reaction. Complementary sequence is presented on the left. Putative new

TSS3 is indicated with an arrow. C) RT-PCR analysis of RNA extracted from the WT strain in

PE phase using primers nlpd_F and rpoS_R and lpg1281_F and rpoS_R. D-F) RT-PCR analysis of RNA extracted from the WT, lpr10 mutant (lpr10), and the complemented strain (lpr10 + plpr10) in PE phase. Primer pairs used were nlpD_TSS3-BS_F and rpoS_R (D), nlpD_F2 and rpoS_R (E), and surE_F and rpoS_R (F). The position of each primer is depicted in panel A. In each of the RT-PCR, two negative controls were used: RNA not reverse transcribed (no RT) and without nucleic acid (only water). Genomic DNA (gDNA) from the WT was used as a positive control.

3.4 DISCUSSION

RpoS is a key regulator of Lp required for optimal intracellular multiplication and survival in water (Bachman and Swanson 2001). The results presented here suggest that the sRNA Lpr10 is necessary for the fine-tuning of rpoS expression through a negative feedback loop. From a physiological perspective, the downregulation of rpoS by Lpr10 seems counter- intuitive since RpoS plays beneficial roles for Lp’s survival in water. So why would it be controlled this way? Presumably, there is a trade-off between survival in water over a longer term and optimal regulation of transcriptional program in other conditions, such as intracellular growth. However, while the rpoS mutant has a growth defect within amoeba and primary macrophages (Bachman and Swanson 2001), the lpr10 mutant is not different than the wild-type despite overexpressing rpoS. Possibly, the higher level of rpoS transcript seen in the lpr10 mutant is insufficient to translate into a phenotype in the assays performed. Nevertheless,

110 accumulating evidence points to the necessity of a tight control of rpoS expression for Lp to thrive. Precise control of the expression of plasmid-borne rpoS is necessary to avoid overexpression and to effectively complement the rpoS mutant (Hales and Shuman 1999;

Bachman and Swanson 2001; Trigui et al. 2015). This suggests that precise coordination of rpoS expression is essential to ensure optimal fitness of Lp in various conditions, likely a result of the regulatory interplay between RpoS, CsrA, and the stringent response (Oliva et al. 2018). In the replicative stage (E phase), CsrA is active and negatively regulates translation of rpoS as well as genes necessary for the transmissive phase (Sahr et al. 2017). When the replicative stage ends, and Lp becomes starved, accumulation of ppGpp favours expression of RpoS (Hammer and

Swanson 1999). In turn, RpoS influences the expression of the sRNAs rsmXYZ by positively regulating letS (Hovel-Miner et al. 2009). These three sRNAs sequester CsrA, alleviating the repression of rpoS and inducing a positive feedback loop leading to strong expression of the genes involved in the transmissive phase (Rasis and Segal 2009; Sahr et al. 2009; Sahr et al.

2012). In addition, RpoS reduces expression of the ppGpp hydrolase SpoT in condition of starvation (Trigui, 2015). Non-physiological overexpression of RpoS leads to reduced expression of SpoT and increased production of ppGpp (Trigui et al. 2015). Therefore, overexpression of

RpoS results in the misregulation of key regulatory systems in Legionella. This demonstrates the importance of tightly controlling the levels of RpoS in the cell to obtain the required response to specific stresses and growth stage, and why its regulation at the transcriptional, translational, and protein level is important (Landini et al. 2014). The Lpr10-rpoS regulatory feedback adds yet another layer to the fine and complex regulation of rpoS.

The microarray analysis identified 90 genes differentially expressed in the absence of

Lpr10 but rpoS was the only one for which a Lpr10 binding site was predicted. It is likely that

111 many of the down-regulated genes are indirectly affected by Lpr10 through its effect on rpoS. To test this hypothesis, we compared the transcriptome of the lpr10 mutant to that of the rpoS mutant (Hovel-Miner et al. 2009). Only 14 genes were differentially expressed in both transcriptomes. Most had opposite expression in the lpr10 mutant and in the rpoS mutant: 10 genes were downregulated in the rpoS mutant but upregulated in the lpr10 mutant (lpg0165, flgD, flgG, lpg1526, lpg1648, flhF, lpg1933, lpg2121, lpg2837 and lpg2953) and two genes upregulated in the rpoS mutant were downregulated in the lpr10 mutant (lpg1981 and lpg2943).

These results suggest that at least 12 genes differentially expressed in the lpr10 mutant are likely indirectly controlled through the upregulation of rpoS. Finally, the last two genes (lpg1751 and lpg2618) were upregulated in both the rpoS mutant and lpr10 mutant, suggesting that they are under more complex regulation.

Our results indicate that transcription of rpoS could be driven by two additional TSS,

TSS3 and TSS4. One possibility is also that the putative TSS3 is a processing site rather than a

TSS. In any case, the resulting transcripts yield rpoS mRNAs with longer 5’UTRs, encompassing the Lpr10 binding site, as we showed by RT-PCR (Figure 5). On the contrary, transcription from the two previously characterized TSS, TSS1 and TSS2, gives rise to rpoS with short 5’UTRs, devoid of the Lpr10 binding site and unaffected by it. This is reminiscent of the multiple promoters controlling RpoS expression in E. coli. In this bacterium, RpoS is the master regulator of general stress response, such as resistance to oxidative stress, heat stress, acid stress, osmotic stress, starvation, DNA damage, virulence and biofilm formation (Sledjeski et al. 1996;

Majdalani et al. 2001; Dong and Schellhorn 2010; Battesti et al. 2011; Landini et al. 2014). This broad and central role of RpoS in E. coli is reflected by its regulation at the level of transcription, translation, protein activity, and protein degradation (Landini et al. 2014). At the transcriptional

112 level, the rpoS gene in E. coli is produced from several distinct promoters (Landini et al. 2014).

First, a polycistronic nlpD-rpoS mRNA originates from the two nlpD TSS. Transcriptions from these TSS is responsible for the low amount of rpoS transcripts during the exponential phase in

E. coli (Landini et al. 2014). Second, monocistronic rpoS mRNAs are produced from a TSS located in the nlpD coding sequence (Lange et al. 1995). This promoter is responsible for the transcription of rpoS during stationary phase and during stress (Lange et al. 1995; Landini et al.

2014). Later on, four additional TSS have been identified for the rpoS gene in E. coli, rpoSp1-p4

(Mendoza-Vargas et al. 2009). Our study uncovers a similar situation in Lp. As mentioned previously, two transcription start sites were initially characterized in Lp, TSS1 and TSS2 (Sahr et al. 2012). Both are located downstream of the Lpr10 binding site. TSS1 is at position -52 from the ATG and is between nlpD and rpoS, while TSS2 is at position -356 from the ATG and is located in nlpD (Sahr et al. 2012). Since seven transcription start sites have been identified in E. coli (Lange and Hengge-Aronis 1994; Takayanagi et al. 1994; Lange et al. 1995; Mendoza-

Vargas et al. 2009), it is not be surprising that a third and fourth TSS exist in Lp. Similarly, nlpD and rpoS are also transcribed as a polycistronic mRNA in Lp. For the moment, it is unclear what is the role of each promoter in the expression of rpoS in Lp. Further work is needed to elucidate the role of each promoter and to pinpoint the conditions during which downregulation of rpoS by

Lpr10 is important.

In many bacteria, the nlpD gene is upstream of the rpoS gene, and transcription of rpoS occurs through a promoter found upstream of nlpD (Battesti et al. 2011). However, in E. coli, the majority of the rpoS transcript originate from a promoter found within nlpD, 567 nucleotides upstream of rpoS’s ATG (Battesti et al. 2011). It is tempting to speculate that the TSS3 of Lp is the major promoter since it is located at a similar distance (573 nucleotides). Nevertheless, this

113 transcript seems to be under strong post transcriptional regulation. It was shown in E. coli that this long 5’ UTR is important for translational regulation as it folds into a stem-loop that sequesters the RBS, hindering translation initiation (Battesti et al. 2011). DsrA, RprA, and ArcZ are three sRNAs that positively regulate rpoS translation by binding the 5’ UTR and opening the hairpin, allowing the recognition of the RBS (Sledjeski et al. 1996; Majdalani et al. 2001;

Mandin and Gottesman 2010). All three sRNA are dependent on the chaperone Hfq, which stabilizes the sRNA and promotes pairing with the rpoS mRNA (Battesti et al. 2011). OxyS is a sRNA expressed during oxidative stress that negatively impacts translation of rpoS, most likely by titrating Hfq, and allows the OxyR-mediated oxidative stress response rather than the RpoS- mediated oxidative stress response (Zhang et al. 1998). Nevertheless, a higher level of rpoS translation is observed in a mutant for all 3 sRNAs compared to an hfq mutant, suggesting the presence of at least one other yet unknown Hfq-dependent sRNA that positively regulate rpoS translation in E. coli (Battesti et al. 2011). Evidence points to a missing sRNA in E. coli’s translational regulation of rpoS. It would be interesting to search for a Lpr10 homolog in this model bacterium.

The proposed mechanism of regulation by Lpr10 is illustrated in Figure 6. The model is based on the results presented here and previous studies, in particular Hales and Shuman (1999) and Bachman and Swanson (2004), showing that RpoS mRNA level is higher in E phase while the protein level is higher in PE phase. In summary, when RpoS concentration decreases, the concentration of Lpr10 also decreases, and Lpr10 repression of the rpoS expression from TSS3 and TSS4 is relieved, resulting in an increase of rpoS transcripts. When RpoS concentration is high, Lpr10 is expressed and Lpr10 binds to the longer TSS3-rpoS and TSS4-rpoS transcripts, limiting RpoS production to the transcripts generated from TSS1 and TSS2. This Lpr10-

114 mediated downregulation of RpoS during PE phase might be necessary to prevent overexpression of RpoS as it can be detrimental to the bacteria in other conditions. It is unclear what is the contribution of each TSS on the overall expression of RpoS. Detailed analysis of the architecture of rpoS transcription will be necessary to fully appreciate the role of Lpr10.

Figure 6: Proposed regulation loop between RpoS and Lpr10. At low levels of RpoS (left panel), transcription of lpr10 is low and the transcripts originating from TSS3 and TSS4 are not repressed. RpoS can be synthesized from transcripts originating from all promoters, rapidly helping replenish the pool of RpoS. When RpoS levels increase, RpoS activates transcription of lpr10 (right panel). Lpr10 interacts with TSS3-rpoS and TSS4-rpoS at the Lpr10 binding site and inhibits translation from these mRNAs resulting in an optimal level of RpoS.

115 3.5 EXPERIMENTAL PROCEDURES

3.5.1 Bacterial strains and media

The bacterial strains used in this study are described in Table 2. The Lp strain KS79 is a

comR mutant of the JR32 strain, rendering the strain constitutively competent (de Felipe et al.

2008). JR32 is a salt-sensitive, streptomycin-resistant, restriction negative mutant of Lp strain

Philadelphia 1 (Sadosky et al. 1993). The rpoS transposon mutant was constructed in the JR32 strain, and JR32 is used as the WT in this case (Hales and Shuman 1999). Lp strains were grown on CYE agar (ACES-buffered charcoal yeast extract) supplemented with 0.25 mg ml-1 of L- cysteine and 0.4 mg ml-1 of ferric pyrophosphate (Feeley et al. 1979). Liquid cultures were grown in AYE broth, which is CYE without charcoal and agar. When needed, media were supplemented with 5 g ml-1 of chloramphenicol, 25 g ml-1 of kanamycin or 0.1 mM of IPTG

(Feeley et al. 1979).

116 Table 2: Strains used in this study

Strain name Relevant Genotype Source or Reference JR32 Philadelphia-1 derivative; (Sadosky et al. 1993) SmR; r-; m+ KS79 JR32 comR (de Felipe et al. 2008) dotA- JR32 dotA::Tn903dIIlacZ (Sadosky et al. 1993) rpoS JR32 rpoS::Tn903dGent; (Hales and Shuman 1999) GmR rpoS + prpoS rpoS + pMMB207c Ptac- (Trigui et al. 2015) rpoS; GmR, CmR lpr10 (SPF347) KS79 lpr10::Km; KmR This study lpr10 + plpr10 (SPF362) lpr10 + pXDC39-lpr10; This study KmR, CmR Plasmids pSF6 pGEMT-easy-rrnb (Faucher et al. 2011) pMMB207c RSF1010 derivative; IncQ, (Chen et al. 2004) lacIq, CmR, Ptac, oriT, mobA pXDC39 pMMB207c Ptac, lacIq, Xavier Charpentier CmR plpr10 (pSF104) pXDC39-lpr10 This study prpoS pMMB207c-rpoS (Trigui et al. 2015)

3.5.2 Survival in water

Lp strains were grown on CYE agar for 3 days at 37 C and then suspended in the artificial freshwater medium Fraquil (Mendis et al. 2015) at an OD600 of 1.0. One ml of this suspension was added to 4 ml of Fraquil and the strains were incubated at 25 C in a 25 cm2 cell culture flask (Sarstedt). Weekly CFU counts on CYE agar were used to evaluate the survival of the strains.

117 3.5.3 Deletion of lpr10 and complementation of the mutant

The Lpr10 deletion mutant strain was constructed by allelic exchange where the gene coding the Lpr10 sRNA was replaced with a kanamycin resistance cassette as previously described (Hovel-Miner et al. 2009). PCR primers are described in Table 3. A 1-kb fragment upstream of Lpr10 was amplified using primers Lpr10-UF and Lpr10-UR. A 1-kb fragment downstream of Lpr10 was amplified using primers Lpr10-DF and Lpr10-DR. A kanamycin cassette was amplified from the pSF6 plasmid (Faucher et al. 2011) using primers Lpr10-KmF and Lpr10-KmR. Each fragment was purified using a gel extraction kit (Qiagen). The three 1-kb fragments were ligated by PCR using primers Lpr10-UF and Lpr10-DR, and the resulting 3-kb fragment was purified using a gel extraction kit (Qiagen). The purified fragment was introduced into KS79 by natural transformation (Sexton and Vogel 2004) and recombinants were selected for kanamycin resistance. The allelic exchange was confirmed by PCR, resulting in the mutated strain SPF347. The mutation was complemented in trans by amplifying the lpr10 gene along with its native promoter from the KS79 WT strain using primers Lpr10-co-F and Lpr10-co-R.

The amplicon was cloned in the pXDC39 plasmid using the restriction enzymes EcoRI (New

England Biolabs) and BamHI (New England Biolabs). The resulting ligation product was transformed into E. coli DH5 and transformants were selected on LB media supplemented with chloramphenicol. The cloning of the fragment was confirmed by PCR using Lpr10-co-F and pXDC39-Scr-R. The recombinant plasmid (plpr10) was extracted and electroporated into the

lpr10 mutant strain and transformants were selected on CYE supplemented with chloramphenicol. Colonies were patched on CYE supplemented with kanamycin and chloramphenicol and screened by PCR using primers Lpr10-co-F and pXDC39-scr-R. The

118 complemented strain is SPF362. The deletion of the sRNA and the complementation were confirmed by Northern blot.

119 Table 3: Primers used in this study

Primers Sequence (5’ → 3’) Source or Reference Lpr10-UF CAAGTTCTGGTTCGATTTAACG This study Lpr10-UR CAGTCTAGCTATCGCCATGTAACACACCACCCTCCAAA This study ACGACC Lpr10-KmF GGTCGTTTTGGAGGGTGGTGTGTTACATGGCGATAGCT This study AGACTG Lpr10-KmR CAGGCAACGACTTCCCGGTTTCACCCAACTGATCTTCA This study GCATC Lpr10-DF GATGCTGAAGATCAGTTGGGTGAAACCGGGAAGTCGTT This study GCCTG Lpr10-DR GGCATTTTATGGTTCCAGATACG This study Lpr10-co-F GAAAGGCAGAATTCCATCAGGTGAATAATTGTGC This study Lpr10-co-R CATTTTTGGATCCGCGATTGTGGGTTTGTCTATG This study pXDC39-scr- AAACAGCCAAGCTTGCATGC This study R Lpr10- GCAACGACTTCCCGGTTTCTG This study 5’RACE- gsOuterPrime r Lpr10- GCCGCAACTGAAAGACACTG This study 5’RACE- gsInnerPrime r Lpr10- GGGTAGGAAACCTGAAGCTC This study 3’RACE- gsOuterPrime r Lpr10- CCACAGTGTCTTTCAGTTGC This study 3’RACE- gsInnerPrime r 5’RACE- GCTGATGGCGATGAATGAACACTG This study OuterPrimer 5’RACE- CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG This study InnerPrimer 3’RACE- GCGAGCACAGAATTAATACGACT This study OuterPrimer 3’RACE- CGCGGATCCGAATTAATACGACTCACTATAGG This study InnerPrimer 5’RACE- GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCU This study Adapter UUGAUGAAA polydT GCGAGCACAGAATTAATACGACTCACTATAGGT12VN This study

120 flgB-qPCR-F CAAGGCGTTGATTGCAAGAG This study flgB-qPCR-R TGGCTGTTACCGGCCATAGTTGC This study rpoS-qPCR-F TGACCCCAAGCGAGGATTCC This study rpoS-qPCR- GCGTCAATTGCCTTGCCGCTC This study R dotD-qPCR- GAAGCTGCCGTTTCAGTCAG This study F dotD-qPCR- GCTGCTTTGGCGATACGTGC This study R pilE3-qPCR- CGTTGTGGCTGTCAGGTTTG This study F pilE3-qPCR- TGCTCACGCCACATTGACAC This study R sidH-qPCR-F GGTACGGCTGAATTTCCTTG This study sidH-qPCR- TGATGTCAATGCGCCAACGC This study R 16s_QF AGAGATGCATTAGTGCCTTCGGG (Trigui et al. 2015) 16s_QR ACTAAGGATAAGGGTTGCGCTCGT (Trigui et al. 2015) lpg1281_F GGCTTTGCAGGAGGTTATTG This study surE_F AGATGCTGGTGCTGGTACTG This study nlpD_F GAAGGACAGCGCGTTAATGC This study nlpD_F2 TGCGATCAACAATCACCTAAGG This study nlpD_TSS3- CATCGTGCCAAAATCAAATC This study BS rpoS-R CATCTGGCTCAGACCATTCC This study T7-micF-(F) TGTAATACGACTCACTATAGGGCTATCATCATTAACTTT This study ATTTATTACCG micF-R AAAAAAAACCGAATGCGAGGCATCCGG This study EM4717 TGTAATACGACTCACTATAGGGGGCATCGTGCCAAAAT This study CAAATC EM4718 CTGCCAGCATAAGCCACAACTC This study EM4719 TGTAATACGACTCACTATAGGGTATAGGTGATGACTGA This study TCCTGGCTG EM4720 TTTAAGTACAGGCAACGACTTCC This study EM4900 GGCTTATGGGTAATATGTAAG This study EM4902 GTGCTGCTGGTTGTGGGACAAG This study EM4903 GTTTCATCATCAGTAAACTCTGG This study

121 3.5.4 RNA extraction

RNA was extracted from bacteria using TRIzol (ThermoFisher Scientific) according to the manufacturer’s protocol. Briefly, 200 l of chloroform (ThermoFisher Scientific) was added to the bacteria suspended in TRIzol, vigorously shaken, and incubated at room temperature for 3 minutes. The sample was transferred to a Phase Lock Gel Heavy 2 ml tube (VWR) and centrifuged at 12,000 × g for 15 minutes at room temperature. The supernatant (approximately

600 l) was transferred to a microtube containing 600 l of 100 % isopropanol (ThermoFisher

Scientific) and 5 g of glycogen (ThermoFisher Scientific) and incubated for 10 minutes at room temperature. The tubes were centrifuged at 17,000 × g for 10 minutes at 4 C, the supernatant removed, and 1 ml of 75 % ice-cold ethanol (Greenfield Global) was added. The sample was centrifuged at 17,000 × g for 10 minutes at 4 C, the supernatant removed, and the pellet was air dried. Once dry, the pellet was resuspended in nuclease-free water (ThermoFisher Scientific) and the RNA was quantified with a UV spectrophotometer (ThermoFisher Scientific).

3.5.5 Northern Blotting

Northern Blot was used to evaluate the expression of the sRNA as described previously

(Mendis et al. 2018). Lp strains were grown on CYE agar at 37 C for 3 days and inoculated in

AYE broth with necessary antibiotics and IPTG if required and grown at 37 C with shaking at

250 rpm. 10 ml of exponential phase culture (OD600 0.5-1.0) and 5 ml of PE phase culture (OD600

>3) were centrifuged for 10 minutes at 4000 × g , the supernatant decanted, and the pellet suspended in 1 ml of TRIzol reagent (ThermoFisher Scientific). RNA was extracted as mentioned above. 10 g of RNA was loaded on a 6 % Tris-borate-EDTA-urea polyacrylamide gel and the samples were migrated at 180 V. The RNA was transferred onto a positively charged

122 nylon membrane (ThermoFisher Scientific) using a semidry gel blotting system (Biorad) for 20 minutes at 200 mA. The membrane was prehybridized in ULTRAhyb-Oligo Hybridization

Buffer (ThermoFisher Scientific) at 37 C for 1 hour in a rotating chamber. A final concentration of 5 nM of 5’ biotinylated Lpr10 probe (Integrated DNA Technologies) was added and the incubation was continued overnight at 37 C. The membranes were washed twice with 2X SSC

(0.15 M NaCl and 0.015 M sodium citrate) and 0.5 % SDS (MP Biomedicals) for 30 minutes at

37 C. The Chemiluminescent Nucleic Acid Detection Module (ThermoFisher Scientific) was used for detection of probes. Densitometry analysis was performed using ImageJ according to standard protocols (Rasband 1997-2018).

3.5.6 5’ RACE

RNA from the WT strain cultured to PE phase in AYE was extracted as mentioned above and treated with TURBO DNase (ThermoFisher Scientific). 1 g of RNA was treated with RppH

(New England Biolabs) before ligating the 5’ RACE adapter using T4 RNA ligase (New England

Biolabs). A sample not treated with RppH was used as a control for the experiment. The RNA was reverse transcribed with random hexamers using SuperScript 3 (ThermoFisher Scientific).

The cDNA was used as a template for a first PCR reaction with primers 5’RACE-Outer and

Lpr10-5’RACE-gsOuter, which served as a template for a second PCR reaction with primers

5’RACE-Inner and Lpr10-5’RACE-gsInner. The PCR reaction was analyzed on a 2 % agarose gel and a fragment present only in the RppH-treated sample was extracted using a gel extraction kit (Qiagen), cloned in the vector pGEM-T Easy (Promega), and sequenced (Genomic Analysis

Platform of Université Laval).

123 3.5.7 3’ RACE

RNA from the WT strain cultured to PE phase in AYE was extracted as mentioned above and treated with DNase (ThermoFisher Scientific). A poly-A tail was added to 1 g of RNA using PAP (New England Biolabs) and the RNA was purified by phenol-chloroform. The RNA was reverse transcribed using SuperScript 3 (ThermoFisher Scientific) and a polydT primer. The cDNA was used as a template for a first PCR reaction with primers 3’RACE-Outer and Lpr10-

3’RACE-gsOuter, which served as a template for a second PCR reaction with primers 3’RACE-

Inner and Lpr10-3’RACE-gsInner. The PCR fragment was purified using a gel extraction kit

(Qiagen), cloned in the vector pGEM-T Easy (Promega), and sent for sequencing (Genomic

Analysis Platform of Université Laval).

3.5.8 DNA microarray

DNA microarray analysis was performed as previously described (Faucher and Shuman

2013). The microarray design (GPL19458) has been described previously. The WT, lpr10 mutant, and the complemented strain (lpr10 + plpr10) were grown on CYE agar for 3 days at

37 C and then inoculated in AYE broth and grown to PE phase. 5 ml of the culture was centrifuged for 10 minutes at 4000 × g, the pellet resuspended in 1 ml of TRIzol reagent

(ThermoFisher Scientific), and RNA was extracted as described. The RNA was treated with

TURBO DNase (ThermoFisher Scientific) and quantified using a UV spectrophotometer

(ThermoFisher Scientific). 15 g of RNA was labelled with aminoallyl-dUTP (Sigma) during reverse transcription with Protoscript II (New England Biolabs). cDNA was coupled with

AlexaFluor 647 succinimidyl ester fluorescent dye (Life Technologies) according to the manufacturer’s protocol. Hybridization, data acquisition, and data analysis were done as

124 previously described (Li et al. 2015). Unpaired one-tailed Student’s t-test was used for statistical analysis. Genes were considered differentially expressed if they had a ratio-to-control value of 

2-fold with a P value < 0.05. Three biological replicates per strain were used. Each set of replicates were grown on a different day. The microarray data are available from the Gene

Expression Omnibus, accession number GSE151162.

3.5.9 Quantitative PCR

RT-qPCR was performed on the RNA extraction used for microarray analysis. Reverse transcription was performed with Protoscript II (New England Biolabs) using 1 µg of RNA and random hexamer (ThermoFisher Scientific). A no reverse transcriptase (no RT) control was included for each sample, where the reverse transcriptase was replaced by an equal volume of nuclease-free water. qPCR was performed using iTaq Universal SYBR Green supermix (Bio

Rad) according to the manufacturer’s protocol. The primers used are described in Table 3. The efficiency of the primer pairs was determined using dilution series of gDNA. Ct values were normalized to the 16S rRNA as described previously (Livak and Schmittgen 2001).

3.5.10 Exposure to water

The KS79 WT was grown on CYE agar for 3 days at 37 C. The strain was inoculated in

AYE broth and grown at 37 C with shaking at 250 rpm until it reached E phase (OD600 of 0.5-

1.0). 5 ml of E phase culture was collected for RNA extraction as mentioned above. The remaining culture was centrifuged at 4000 × g for 10 minutes, washed three times in Fraquil, resuspended in an equal volume of Fraquil and incubated in a 25 cm2 cell culture flask (Sarstedt)

125 at 25 C. 5 ml samples for RNA extraction were collected at 2 hours, 4 hours, 6 hours, and 24 hours after incubation in Fraquil. 1 g of RNA was analyzed by Northern Blot.

3.5.11 RT-PCR

PE phase RNA from KS79 WT was treated with TURBO DNase (ThermoFisher

Scientific). 1 g of RNA was reverse transcribed with Protoscript II (New England Biolabs). A no reverse transcriptase (no RT) control was included for each sample, where the reverse transcriptase was replaced by an equal volume of nuclease-free water. PCR was performed on cDNA, no RT control, gDNA and a no template control (water) using primers described in Table

3.

3.5.12 Primer extension

Total RNA was extracted from strain KS79 through the classic hot phenol protocol (Aiba et al. 1981). Primer extension was then performed following a previously described procedure

(Prevost et al. 2007). 20 μg of total RNA was incubated at 65 °C for 5 minutes in presence of the radiolabelled primer EM4900 and dNTPs, followed by a cooling time of 1 minute on ice. Porcine

RNase Inhibitor (in house) and ProtoScript II (New England Biolabs) were added to the reaction and RT was carried for 1 hour at 42 °C before inactivation of the enzyme at 90 °C, 10 minutes.

Complementary DNA was precipitated and, following resuspension, was migrated on 8 % acrylamide, 8 M urea gels. The sequencing ladder was generated by PCR from a DNA matrix

(EM4902-EM4903) with radiolabelled primer EM4900. Gels were dried and exposed to phosphor screens before images were acquired using a Typhoon Trio (GE Healthcare).

126 3.5.13 In vitro transcription and radiolabelling

DNA templates containing a T7 RNA polymerase promoter sequence were synthesized by PCR using oligonucleotide pairs EM4717-EM4718 for 5’-rpoS and EM4719-EM4720 for lpr10 (Table 3). In vitro transcription was performed as described before, with some modifications (Desnoyers and Masse 2012). Briefly, DNA templates were transcribed for 4 hours with 10 μg purified T7 RNA polymerase in presence of 5 mM NTPs, 40 U porcine RNase

Inhibitor (in house) and 1 μg pyrophosphatase (Roche). Sample were treated with 2 U Turbo

DNase (Ambion). RNAs were extracted using phenol-chloroform:isolamyl, precipitated in EtOH and purified on a 6 % acrylamide, 8 M urea gel (Desnoyers and Masse 2012). 5’rpoS RNA was dephosphorylated using Calf Intestinal Phosphatase (New England Biolabs) and 5’end- radiolabelled by ligation of γ-32P using T4 polynucleotide kinase (New England Biolabs).

Radiolabelled 5’rpoS RNA was purified on a 6 % acrylamide, 8 M urea gel.

3.5.14 EMSA

EMSA was performed as described by Aiba and colleagues in 2012 (Morita et al. 2012) with slight modifications. Briefly, 20 nM of radiolabelled 5’rpoS RNA was mixed with specific concentrations of unlabelled Lpr10 RNA (0 – 2000 nM) in Binding Buffer I (10 nM Tris-HCl pH

8.0, 1 mM DTT, 1 mM MgCl2, 20 mM KCl, 10 mM Na2HPO4-NaH2PO4 pH 8.0). Samples were heated at 75 °C for 5 minutes and then slowly cooled down to 37 °C, at which point the incubation carried on for 20 minutes at 37 °C. For competition assays, the unlabelled competitor

(5’rpoS or E. coli MicF RNA) was added and incubation was carried on for 20 minutes.

Reactions were stopped by addition of 1 μl of non-denaturing buffer (1X TBE, 50 % glycerol,

0.1 % bromophenol blue, 0.1 % xylene cyanol) and samples were migrated at 50 V on a native 5

127 % polyacrylamide gel, at 4 °C. Following migration, gels were dried and exposed to phosphor screens before images were acquired using a Typhoon Trio (GE Healthcare).

3.5.15 In line probing

In line probing was performed as described before (Regulski and Breaker 2008;

Wakeman and Winkler 2009). Radiolabelled 5’rpoS RNA (0.1 μM) was incubated with Lpr10

RNA (1 μM) or H2O (control) for 40 hours at 25 °C in in-line probing buffer (50 mM Tris-Cl pH

8.0, 100 mM KCl, 325mM MgCl2). Reactions were stopped by addition of Loading Buffer II (95

% formamide, 18 mM EDTA, 0.025 % SDS) and samples were denatured at 90 °C for 2 minutes prior to migration on 8 % acrylamide, 8 M urea sequencing gels. Following migration, gels were dried and exposed to phosphor screens. Images were acquired using a Typhoon Trio (GE

Healthcare).

3.6 ACKNOWLEDGMENTS

The pXDC39 plasmid was a kind gift from Dr. Xavier Charpentier. This study was supported by CIHR Open Operating Grant #142208 to SPF and EM. JS was supported by a

FRQNT Doctoral scholarship and a CRIPA scholarship supported by the Fonds de recherche du

Québec - Nature et technologies n°RS-170946. We thank the Service de Purification de Protéines de l’Université de Sherbrooke (SPP) for the purification of the Porcine RNase Inhibitor.

128 3.7 AUTHOR CONTRIBUTIONS

JS, MCC, EM and SPF designed the study. JS and MCC performed the experiments. JS,

MCC, EM and SPF analyzed the results. JS wrote the first draft of the manuscript. JS, MCC, EM and SPF edited the manuscript.

129 3.8 SUPPLEMENTARY EXPERIMENTAL PROCEDURES

3.8.1 Acanthamoeba castellanii culture

A. castellanii was grown in PYG medium pH 6.5 (1L: 20 g proteose peptone, 18 g glucose, 2 g yeast extract, 1 g sodium citrate dihydrate, 0.98 g MgSO4 * 7 H2O, 0.355 g

2 Na2HPO4 * 7 H2O, 0.34 g KH2PO4, 0.02 Fe(NH4)2(SO4)2 * 6 H2O) at 30 C in 75 cm cell culture flasks (Sarstedt). The cells were passaged at confluence. The day of the infection, cells were centrifuged at 200 × g for 10 minutes and resuspended in A. castellanii buffer (PYG without proteose peptone, glucose, and yeast extract) at a concentration of 5.0*105 cells/ml and 1 ml of cells were seeded in a 24-well plate and incubated at 30 C for 2 hours prior to infection. Each well was then infected with Lp as described below. Infection was carried at 30 C.

3.8.2 Vermamoeba vermiformis culture

V. vermiformis was grown in modified PYNFH medium (ATCC medium 1034) in 75 cm2 cell culture flask (Sarstedt) at room temperature. The cells were passaged when they have reached confluence. Three days before infection, cells were centrifuged at 200 × g for 10 minutes, resuspended in fresh modified PYNFH medium, and incubated further for 3 days. On the day of infection, cells were centrifuged at 200 × g for 10 minutes, resuspended in modified PYNFH without FBS and without buffer solution at a concentration of 5.0*105 cells/ml and 1 ml of cells were added to each well of a 24-well plate (Sarstedt). The infection was carried at 37 C.

3.8.3 THP-1 culture

Cells were grown in 75 cm2 cell culture flask (Sarstedt) in Advanced RPMI 1640 medium (Thermofisher Scientific) supplemented with 10 % FBS (ThermoFisher Scientific) and 2 mM of

L-glutamine (Life Technologies) at 37 C under a modified atmosphere containing 5 % CO2. Three days prior to infection, cells were harvested by centrifuging at 200 × g for 10 minutes and cells resuspended in supplemented Advanced RPMI 1640 medium with 100 ng of phorbol 12- myristate-13-acetate (PMA) (Thermofisher Scientific) at a concentration of 5*105 cells/ml and 1 ml of cells per well was seeded in a 24-well plate (Sarstedt). 1 hour prior to infection, the media

130 was replaced with fresh 37 C RPMI supplemented with 10% FBS and 2 mM of L-glutamine.

Infection was performed at 37 C under a modified atmosphere containing 5 % CO2.

3.8.4 Infections

The strains used were grown on CYE agar, with antibiotics if necessary, for 3 days at 37

C. The bacteria were suspended in Fraquil at an OD600 of 0.1 and further diluted 1:10 in Fraquil. Cells were infected in triplicate at a MOI of 0.1. Temperature of infection for each cell type is mentioned in the culture section. CFU counts were performed daily.

131 3.9 Supplementary Figures

Supplementary Figure S1: No growth defect was observed with the lpr10 mutant during infection of various host cells. The host cells tested were A) Vermamoeba vermiformis, B)

Acanthamoeba castellanii, and C) THP-1 human monocyte cell line. Infections were carried with the WT, lpr10 mutant (lpr10), complemented strain (lpr10 + plpr10), and dotA-. The dotA- strain served as a negative control as it is unable to replicate inside host cells.

132

Supplementary Figure S2: Predicted base pairing between Lpr10 and the nlpD coding sequence. rpoS TSS1 and TSS2 are indicated in blue. ORFs are underlined. The nucleotides are numbered starting from rpoS TSS2.

133

Supplementary Figure S3: Schematic view of Lpr10 sRNA secondary structure predicted using the RNAfold software (Lorenz et al. 2011). Colors indicate base-pairing probability. For single-stranded regions, colors indicate the probability of the nucleotide being unpaired. Stems were numbered 1-4 and black arrows indicate nucleotides involved in the interaction with rpoS

(see Figure 4C and D).

134 3.10 References

Aiba, H., S. Adhya and B. de Crombrugghe (1981). "Evidence for two functional gal promoters in intact Escherichia coli cells." J Biol Chem 256(22): 11905-11910.

Allegra, S., L. Leclerc, P. A. Massard, F. Girardot, S. Riffard and J. Pourchez (2016). "Characterization of aerosols containing Legionella generated upon nebulization." Sci Rep 6: 33998.

Altman, E. and G. Segal (2008). "The response regulator CpxR directly regulates expression of several Legionella pneumophila icm/dot components as well as new translocated substrates." J Bacteriol 190(6): 1985-1996.

Altschul, S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman (1990). "Basic local alignment search tool." J Mol Biol 215(3): 403-410.

Apura, P., S. Domingues, S. C. Viegas and C. M. Arraiano (2019). "Reprogramming bacteria with RNA regulators." Biochem Soc Trans 47(5): 1279-1289.

Attaiech, L. and X. Charpentier (2017). "Silently transformable: the many ways bacteria conceal their built-in capacity of genetic exchange." Curr Genet 63(3): 451-455.

Bachman, M. A. and M. S. Swanson (2001). "RpoS co-operates with other factors to induce Legionella pneumophila virulence in the stationary phase." Mol Microbiol 40(5): 1201-1214.

Bachman, M. A. and M. S. Swanson (2004). "Genetic evidence that Legionella pneumophila RpoS modulates expression of the transmission phenotype in both the exponential phase and the stationary phase." Infect Immun 72(5): 2468-2476.

Battesti, A., N. Majdalani and S. Gottesman (2011). "The RpoS-mediated general stress response in Escherichia coli." Annu Rev Microbiol 65: 189-213.

Byrne, B. and M. S. Swanson (1998). "Expression of Legionella pneumophila virulence traits in response to growth conditions." Infect Immun 66(7): 3029-3034.

Centers for Disease, C. and Prevention (2011). "Legionellosis --- United States, 2000-2009." MMWR Morb Mortal Wkly Rep 60(32): 1083-1086.

Chen, J., K. S. de Felipe, M. Clarke, H. Lu, O. R. Anderson, G. Segal and H. A. Shuman (2004). "Legionella Effectors That Promote Nonlytic Release from Protozoa." Science 303(5662): 1358- 1361. de Felipe, K. S., R. T. Glover, X. Charpentier, O. R. Anderson, M. Reyes, C. D. Pericone and H. A. Shuman (2008). "Legionella eukaryotic-like type IV substrates interfere with organelle trafficking." PLoS Pathog 4(8): e1000117.

135 Desgranges, E., I. Caldelari, S. Marzi and D. Lalaouna (2020). "Navigation through the twists and turns of RNA sequencing technologies: Application to bacterial regulatory RNAs." Biochim Biophys Acta Gene Regul Mech 1863(3): 194506.

Desnoyers, G. and E. Masse (2012). "Noncanonical repression of translation initiation through small RNA recruitment of the RNA chaperone Hfq." Genes Dev 26(7): 726-739.

Dong, T. and H. E. Schellhorn (2010). "Role of RpoS in virulence of pathogens." Infect Immun 78(3): 887-897.

Durieux, I., C. Ginevra, L. Attaiech, K. Picq, P. A. Juan, S. Jarraud and X. Charpentier (2019). "Diverse conjugative elements silence natural transformation in Legionella species." Proc Natl Acad Sci U S A 116(37): 18613-18618.

ECDC (2018). European Centre for Disease Prevention and Control. Legionnaires’ disease. In: ECDC. Annual epidemiological report for 2016. Stockholm: ECDC; 2018.

ECDC (2019). European Centre for Disease Prevention and Control. Legionnaires’ disease. In: ECDC. Annual epidemiological report for 2017. Stockholm: ECDC; 2019.

Eggenhofer, F., H. Tafer, P. F. Stadler and I. L. Hofacker (2011). "RNApredator: fast accessibility-based prediction of sRNA targets." Nucleic Acids Res 39(Web Server issue): W149-154.

Ensminger, A. W. (2016). "Legionella pneumophila, armed to the hilt: justifying the largest arsenal of effectors in the bacterial world." Curr Opin Microbiol 29: 74-80.

Faucher, S. P., G. Friedlander, J. Livny, H. Margalit and H. A. Shuman (2010). "Legionella pneumophila 6S RNA optimizes intracellular multiplication." Proc Natl Acad Sci U S A 107(16): 7533-7538.

Faucher, S. P., C. A. Mueller and H. A. Shuman (2011). "Legionella Pneumophila Transcriptome during Intracellular Multiplication in Human Macrophages." Front Microbiol 2: 60.

Faucher, S. P. and H. A. Shuman (2013). "Methods to study legionella transcriptome in vitro and in vivo." Methods Mol Biol 954: 567-582.

Feeley, J. C., R. J. Gibson, G. W. Gorman, N. C. Langford, J. K. Rasheed, D. C. Mackel and W. B. Baine (1979). "Charcoal-yeast extract agar: primary isolation medium for Legionella pneumophila." J Clin Microbiol 10(4): 437-441.

Forsbach-Birk, V., T. McNealy, C. Shi, D. Lynch and R. Marre (2004). "Reduced expression of the global regulator protein CsrA in Legionella pneumophila affects virulence-associated regulators and growth in Acanthamoeba castellanii." Int J Med Microbiol 294(1): 15-25.

Garrison, L. E., J. M. Kunz, L. A. Cooley, M. R. Moore, C. Lucas, S. Schrag, J. Sarisky and C. G. Whitney (2016). "Vital Signs: Deficiencies in Environmental Control Identified in Outbreaks

136 of Legionnaires' Disease - North America, 2000-2014." MMWR Morb Mortal Wkly Rep 65(22): 576-584.

Geissmann, T. A. and D. Touati (2004). "Hfq, a new chaperoning role: binding to messenger RNA determines access for small RNA regulator." EMBO J 23(2): 396-405.

Gottesman, S. (2004). "The small RNA regulators of Escherichia coli: roles and mechanisms." Annu Rev Microbiol 58: 303-328.

Hales, L. M. and H. A. Shuman (1999). "The Legionella pneumophila rpoS gene is required for growth within Acanthamoeba castellanii." J Bacteriol 181(16): 4879-4889.

Hammer, B. K. and M. S. Swanson (1999). "Co-ordination of Legionella pneumophila virulence with entry into stationary phase by ppGpp." Mol Microbiol 33(4): 721-731.

Holmqvist, E. and E. G. H. Wagner (2017). "Impact of bacterial sRNAs in stress responses." Biochem Soc Trans 45(6): 1203-1212.

Hovel-Miner, G., S. Pampou, S. P. Faucher, M. Clarke, I. Morozova, P. Morozov, J. J. Russo, H. A. Shuman and S. Kalachikov (2009). "SigmaS controls multiple pathways associated with intracellular multiplication of Legionella pneumophila." J Bacteriol 191(8): 2461-2473.

Kulkarni, P. R., X. Cui, J. W. Williams, A. M. Stevens and R. V. Kulkarni (2006). "Prediction of CsrA-regulating small RNAs in bacteria and their experimental verification in Vibrio fischeri." Nucleic Acids Res 34(11): 3361-3369.

Landini, P., T. Egli, J. Wolf and S. Lacour (2014). "sigmaS, a major player in the response to environmental stresses in Escherichia coli: role, regulation and mechanisms of promoter recognition." Environ Microbiol Rep 6(1): 1-13.

Lange, R., D. Fischer and R. Hengge-Aronis (1995). "Identification of transcriptional start sites and the role of ppGpp in the expression of rpoS, the structural gene for the sigma S subunit of RNA polymerase in Escherichia coli." J Bacteriol 177(16): 4676-4680.

Lange, R. and R. Hengge-Aronis (1994). "The nlpD gene is located in an operon with rpoS on the Escherichia coli chromosome and encodes a novel lipoprotein with a potential function in cell wall formation." Mol Microbiol 13(4): 733-743.

Li, L., N. Mendis, H. Trigui and S. P. Faucher (2015). "Transcriptomic changes of Legionella pneumophila in water." BMC Genomics 16: 637.

Liu, X. and S. Shin (2019). "Viewing Legionella pneumophila pathogenesis through an immunological lens." Journal of Molecular Biology 431(21): 4321-4344.

Livak, K. J. and T. D. Schmittgen (2001). "Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method." Methods 25(4): 402-408.

137 Lorenz, R., S. H. Bernhart, C. Höner zu Siederdissen, H. Tafer, C. Flamm, P. F. Stadler and I. L. Hofacker (2011). "ViennaRNA Package 2.0." Algorithms for Molecular Biology 6(1): 26.

Majdalani, N., S. Chen, J. Murrow, K. St John and S. Gottesman (2001). "Regulation of RpoS by a novel small RNA: the characterization of RprA." Mol Microbiol 39(5): 1382-1394.

Mandin, P. and S. Gottesman (2010). "Integrating anaerobic/aerobic sensing and the general stress response through the ArcZ small RNA." EMBO J 29(18): 3094-3107.

Mendis, N., P. McBride and S. P. Faucher (2015). "Short-Term and Long-Term Survival and Virulence of Legionella pneumophila in the Defined Freshwater Medium Fraquil." PLoS One 10(9): e0139277.

Mendis, N., P. McBride, J. Saoud, T. Mani and S. P. Faucher (2018). "The LetA/S two- component system regulates transcriptomic changes that are essential for the culturability of Legionella pneumophila in water." Sci Rep 8(1): 6764.

Mendoza-Vargas, A., L. Olvera, M. Olvera, R. Grande, L. Vega-Alvarado, B. Taboada, V. Jimenez-Jacinto, H. Salgado, K. Juarez, B. Contreras-Moreira, A. M. Huerta, J. Collado-Vides and E. Morett (2009). "Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli." PLoS One 4(10): e7526.

Molofsky, A. B. and M. S. Swanson (2003). "Legionella pneumophila CsrA is a pivotal repressor of transmission traits and activator of replication." Mol Microbiol 50(2): 445-461.

Molofsky, A. B. and M. S. Swanson (2004). "Differentiate to thrive: lessons from the Legionella pneumophila life cycle." Mol Microbiol 53(1): 29-40.

Mondino, S., S. Schmidt, M. Rolando, P. Escoll, L. Gomez-Valero and C. Buchrieser (2020). "Legionnaires' Disease: State of the Art Knowledge of Pathogenesis Mechanisms of Legionella." Annu Rev Pathol 15: 439-466.

Morel, F. M. M., J. C. Westall, J. G. Rueter and C. JP (1975). Description of the algal growth media "Aquil" and "Fraquil", R.M. Parsons Laboratory for Water Resources and Hydrodynamics, Massachusetts Institute of Technology, Cambridge, MA.

Morita, T., K. Maki and H. Aiba (2012). "Detection of sRNA-mRNA interactions by electrophoretic mobility shift assay." Methods Mol Biol 905: 235-244.

Oliva, G., T. Sahr and C. Buchrieser (2018). "The Life Cycle of L. pneumophila: Cellular Differentiation Is Linked to Virulence and Metabolism." Front Cell Infect Microbiol 8: 3.

Oliva, G., T. Sahr, M. Rolando, M. Knoth and C. Buchrieser (2017). "A Unique cis-Encoded Small Noncoding RNA Is Regulating Legionella pneumophila Hfq Expression in a Life Cycle- Dependent Manner." MBio 8(1).

138 Prevost, K., H. Salvail, G. Desnoyers, J. F. Jacques, E. Phaneuf and E. Masse (2007). "The small RNA RyhB activates the translation of shiA mRNA encoding a permease of shikimate, a compound involved in siderophore synthesis." Mol Microbiol 64(5): 1260-1273.

Qiu, J. and Z. Q. Luo (2013). "Effector translocation by the Legionella Dot/Icm type IV secretion system." Curr Top Microbiol Immunol 376: 103-115.

Rasband, W. S. (1997-2018). "ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, ." 2020, from https://imagej.nih.gov/ij/.

Rasis, M. and G. Segal (2009). "The LetA-RsmYZ-CsrA regulatory cascade, together with RpoS and PmrA, post-transcriptionally regulates stationary phase activation of Legionella pneumophila Icm/Dot effectors." Mol Microbiol 72(4): 995-1010.

Regulski, E. E. and R. R. Breaker (2008). "In-line probing analysis of riboswitches." Methods Mol Biol 419: 53-67.

Romeo, T., M. Gong, M. Y. Liu and A. M. Brun-Zinkernagel (1993). "Identification and molecular characterization of csrA, a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties." J Bacteriol 175(15): 4744-4755.

Sadosky, A. B., L. A. Wiater and H. A. Shuman (1993). "Identification of Legionella pneumophila genes required for growth within and killing of human macrophages." Infect Immun 61(12): 5361-5373.

Sahr, T., H. Bruggemann, M. Jules, M. Lomma, C. Albert-Weissenberger, C. Cazalet and C. Buchrieser (2009). "Two small ncRNAs jointly govern virulence and transmission in Legionella pneumophila." Mol Microbiol 72(3): 741-762.

Sahr, T., C. Rusniok, D. Dervins-Ravault, O. Sismeiro, J. Y. Coppee and C. Buchrieser (2012). "Deep sequencing defines the transcriptional map of L. pneumophila and identifies growth phase-dependent regulated ncRNAs implicated in virulence." RNA Biol 9(4): 503-519.

Sahr, T., C. Rusniok, F. Impens, G. Oliva, O. Sismeiro, J. Y. Coppee and C. Buchrieser (2017). "The Legionella pneumophila genome evolved to accommodate multiple regulatory mechanisms controlled by the CsrA-system." PLoS Genet 13(2): e1006629.

Sexton, J. A. and J. P. Vogel (2004). "Regulation of hypercompetence in Legionella pneumophila." J Bacteriol 186(12): 3814-3825.

Sledjeski, D. D., A. Gupta and S. Gottesman (1996). "The small RNA, DsrA, is essential for the low temperature expression of RpoS during exponential growth in Escherichia coli." EMBO J 15(15): 3993-4000.

Swanson, M. S. and B. K. Hammer (2000). "Legionella pneumophila pathogesesis: a fateful journey from amoebae to macrophages." Annu Rev Microbiol 54: 567-613.

139 Takayanagi, Y., K. Tanaka and H. Takahashi (1994). "Structure of the 5' upstream region and the regulation of the rpoS gene of Escherichia coli." Mol Gen Genet 243(5): 525-531.

Taylor, M., K. Ross and R. Bentham (2009). "Legionella, protozoa, and biofilms: interactions within complex microbial systems." Microb Ecol 58(3): 538-547.

Trigui, H., P. Dudyk, J. Oh, J. I. Hong and S. P. Faucher (2015). "A regulatory feedback loop between RpoS and SpoT supports the survival of Legionella pneumophila in water." Appl Environ Microbiol 81(3): 918-928.

Trigui, H., N. Mendis, L. Li, M. Saad and S. P. Faucher (2013). "Facets of small RNA-mediated regulation in Legionella pneumophila." Curr Top Microbiol Immunol 376: 53-80. von Baum, H., S. Ewig, R. Marre, N. Suttorp, S. Gonschior, T. Welte, C. Luck and G. Competence Network for Community Acquired Pneumonia Study (2008). "Community-acquired Legionella pneumonia: new insights from the German competence network for community acquired pneumonia." Clin Infect Dis 46(9): 1356-1364.

Wadowsky, R. M., T. M. Wilson, N. J. Kapp, A. J. West, J. M. Kuchta, S. J. States, J. N. Dowling and R. B. Yee (1991). "Multiplication of Legionella spp. in tap water containing Hartmannella vermiformis." Appl Environ Microbiol 57(7): 1950-1955.

Wakeman, C. A. and W. C. Winkler (2009). "Analysis of the RNA backbone: structural analysis of riboswitches by in-line probing and selective 2'-hydroxyl acylation and primer extension." Methods Mol Biol 540: 173-191.

Wassarman, K. M. (2007). "6S RNA: a regulator of transcription." Mol Microbiol 65(6): 1425- 1431.

Weissenmayer, B. A., J. G. Prendergast, A. J. Lohan and B. J. Loftus (2011). "Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs." PLoS One 6(3): e17570.

World Health Organization. (2003). Emerging issues in water and infectious disease. Geneva, World Health Organization.

Zhang, A., S. Altuvia, A. Tiwari, L. Argaman, R. Hengge-Aronis and G. Storz (1998). "The OxyS regulatory RNA represses rpoS translation and binds the Hfq (HF-I) protein." EMBO J 17(20): 6061-6068.

Zusman, T., G. Aloni, E. Halperin, H. Kotzer, E. Degtyar, M. Feldman and G. Segal (2007). "The response regulator PmrA is a major regulator of the icm/dot type IV secretion system in Legionella pneumophila and Coxiella burnetii." Mol Microbiol 63(5): 1508-1523.

Zusman, T., O. Gal-Mor and G. Segal (2002). "Characterization of a Legionella pneumophila relA insertion mutant and toles of RelA and RpoS in virulence gene expression." J Bacteriol 184(1): 67-75.

140 Connecting Text Chapter 4

Legionella is found in hot water distribution systems where heat treatment is applied to limit its proliferation. Tail-specific proteases have been identified in other bacteria and are important for surviving thermal stress. The Lpr17 sRNA is coded on the complementary strand of a gene coding a tail-specific protease. This tail-specific protease might play a role in surviving thermal stress, which Legionella often encounters. We therefore decided to investigate the role of the tail-specific protease and how it is regulated by Lpr17.

The manuscript has been submitted to the journal Applied and Environmental

Microbiology.

141 Legionella pneumophila’s Tsp is important for surviving thermal

stress in water and inside amoeba

Joseph Saoud1,2, Thangadurai Mani1,2, and Sébastien P. Faucher1,2,*

1) Department of Natural Resource Sciences, McGill University, Sainte-Anne-de-Bellevue,

Québec, Canada

2) Centre de Recherche en Infectiologie Porcine et Avicole (CRIPA), Université de Montréal,

Faculté de Médecine Vétérinaire, Saint-Hyacinthe, Québec, Canada, J2S 2M2

* Correspondence and requests for materials should be addressed to Sébastien P. Faucher (email: [email protected])

Running title: Tsp required for heat shock response.

142 4.1 ABSTRACT

Legionella pneumophila (Lp) is an inhabitant of natural and man-made water systems where it replicates within amoebae and ciliates and survives within biofilms. When Lp- contaminated aerosols are breathed in, Lp will enter the lungs and infect human alveolar macrophages, causing a severe pneumonia known as Legionnaires Disease. Lp is often found in hot water distribution systems (HWDS), which are linked to nosocomial outbreaks. Heat treatment is used to disinfect HWDS and reduce the concentration of Lp. However, Lp is often able to recolonize these water systems, indicating an efficient heat-shock response. Tail-specific proteases (Tsp) are typically periplasmic proteases implicated in degrading aberrant proteins in the periplasm and important for surviving thermal stress. In this paper, we show that Tsp, encoded by the lpg0499 gene in Lp Philadelphia-1, is important for surviving thermal stress in water and for optimal infection of amoeba when a shift in temperature occurs during intracellular growth. Tsp is expressed in the post-exponential phase and repressed in the exponential phase.

The cis-encoded small regulatory RNA Lpr17 shows opposite expression, suggesting that it represses translation of tsp. In addition, tsp is regulated by CpxR, a major regulator in Lp, in a

Lpr17-independent manner. Deletion of CpxR also reduced the ability of Lp to survive heat shock. In conclusion, this study shows that Tsp is an important factor for the survival and growth of Lp in water systems.

Keywords: Legionella pneumophila; tail-specific protease; small regulatory RNA; thermal stress; cis-encoded sRNA; Legionnaires disease; amoeba; CpxR

143 4.2 IMPORTANCE

Legionella pneumophila (Lp) is a major cause of nosocomial and community-acquired pneumonia. Lp is found in water systems including hot water distribution systems. Heat treatment is a method of disinfection often used to limit Lp’s presence in such systems; however, the benefit is usually short term as Lp is able to quickly recolonize these systems. Presumably,

Lp respond efficiently to thermal stress, but so far not much is known about the genes involved.

In this paper, we show that the Tail-specific protease (Tsp) is required for resistance to heat shock, when Lp is free in water and when it is inside host cells. Our study identifies critical systems for the survival of Lp in its natural environment under thermal stress.

144 4.3 INTRODUCTION

Legionnaires’ disease (LD) is a severe form of pneumonia in human caused by the Gram- negative bacterium Legionella pneumophila (Lp) (Swanson and Hammer 2000). Lp is often responsible for nosocomial and community-acquired pneumonia (Swanson and Hammer 2000).

In the environment, Lp can be found in natural and man-made aquatic environments, such as cooling towers and water distribution systems, where it can replicate within phagocytic protozoa

(Wadowsky et al. 1991; Storey et al. 2004; Taylor et al. 2009). Notably, Lp replicates within

Vermamoeba vermiformis (formerly Hartmannella vermiformis), a thermotolerant amoeba commonly found in both natural and man-made water systems (Kuchta et al. 1993; Delafont et al. 2018). V. vermiformis protects Lp from predation, competition, and various disinfection methods such as heat treatments, potentially contributing to nosocomial infections (Kuchta et al.

1993; Storey et al. 2004; Delafont et al. 2018). In addition, intracellular growth of Lp within amoeba increases its pathogenicity and facilitates the establishment of an infection in humans

(Storey et al. 2004). The main virulence factor of Lp is the Type IVb Secretion System called

Icm/Dot, which translocate more than 300 effectors inside the host cells (Ensminger 2016).

These effectors are responsible for stopping the maturation of the phagosome and creating a specialized vacuole where Lp can grow (Ensminger 2016).

The preferred growth temperature of Lp is between 25 C and 42 C, though it has been found in water systems at temperatures below 20 C or above 60 C (Bedard et al. 2015). Its ability to live in a wide range of temperature allows Lp to colonize hot water distribution systems

(HWDS) (Borella et al. 2005). The higher temperature found within HWDS also reduces the microbial diversity, therefore making it easier for Lp to compete in these environments (Henne et al. 2013; Lesnik et al. 2016). A method used to limit the proliferation of Lp in water systems is to

145 maintain the temperature at the outlet above 55 C (Borella et al. 2005; Bedard et al. 2015).

When a system is heavily colonized by Lp, it can be treated by superheat and flush, also referred to as pasteurization, consisting of increasing the temperature at the heater to about 75 C in order to provide a temperature of at least 65 °C at the outlets (Whiley et al. 2017).

An increase in temperature, even by a few degrees, can cause proteins to unfold which leads to protein aggregates that can be lethal as these aggregates accumulate in the cells (Richter et al. 2010; Schumann 2016). Protein misfolding and aggregation results in an imbalance of protein homeostasis, which triggers the heat shock response (Schumann 2016). The canonical heat shock response is composed of two heat shock regulons, the H and E heat shock regulons

(Schumann 2016). This response results in the production of chaperones and proteases to refold or destroy misfolded proteins and aggregates (Schumann 2016). In Lp, the two-component

LetA/S is the only regulatory system known to be important for surviving thermal stress (Mendis et al. 2018).

Protein degradation by proteases is an important cellular function as it allows the removal of aberrant proteins, the regulation of intracellular protein concentration, produce active molecules from precursors such as the -toxin from Staphylococcus aureus or the heat-stable toxin produced by enterotoxigenic Escherichia coli (ETEC), and allows the cell to recycle amino acids during starvation (Schmitt et al. 1999; Beebe et al. 2000). Carboxyl-terminal proteases

(CTPs) are serine proteases conserved in most Gram-negative bacteria (Rawlings et al. 2010;

Hoge et al. 2011; Carroll et al. 2014). They can also be found in archaea, Gram-positive bacteria, eukaryotes, viruses, as well as in organelles such as chloroplasts (Bandara et al. 2005; Feldman et al. 2006; Carroll et al. 2014). CTPs are mostly located in the periplasm though some are located in the cytoplasm, while others are secreted in the extracellular environment (Hoge et al.

146 2011). CTP proteases are involved in several different processes in Gram-negative bacteria. E. coli’s CTP, called tail-specific protease (Tsp) and sometimes Prc, was the first bacterial CTP characterized and is involved in regulating peptidoglycan assembly (Hoge et al. 2011). The assembly of the peptidoglycan layer play a role in the bacteria’s size and shape (Silhavy et al.

2010). This important process is dependent on penicillin-binding proteins (PBP) (Waxman and

Strominger 1983; Carroll et al. 2014). Tsp recognizes a sequence of amino acids located on the

C-terminal end of the precursor of PBP-3, resulting in its activation (Hara et al. 1991; Keiler et al. 1996). As a result, the E. coli’s tsp mutant is sensitive to various antibiotics, thermal and osmotic stress, and displays a filamentous morphology (Hara et al. 1991; Seoane et al. 1992).

Overproduction of Tsp is detrimental to cell growth (Hara et al. 1991). The susceptibility to thermal stress is dependent on the osmolarity. These phenotypes are attributed to an increased permeability of the outer membrane in the tsp mutant (Hara et al. 1991; Wang et al. 2012). The tsp mutant and the WT expressed similar levels of GroEL and DnaK, two heat shock proteins, when exposed to thermal stress in high osmolarity buffer (Hara et al. 1991). However, when the strains were in low osmolarity buffer and exposed to thermal stress, the tsp mutant showed decreased expression of DnaK and almost no expression of GroEL (Hara et al. 1991). E. coli’s

Tsp also targets MepS, a peptidoglycan hydrolase which cleaves peptide cross-links between the glycan chains of the peptidoglycan layer (Singh et al. 2012; Singh et al. 2015). Tsp is also able to degrade misfolded proteins in the periplasm, suggesting a role in maintaining protein homeostasis in the periplasm (Silber et al. 1992; Keiler et al. 1995; Keiler et al. 1996).

Pseudomonas aeruginosa codes for two CTPs, called Prc and CtpA (Hoge et al. 2011;

Seo and Darwin 2013). Prc is a homologue of E. coli’s Tsp and has been shown to degrade a mutant form of the anti-sigma factor MucA, preventing development of mucoidy (Reiling et al.

147 2005; Sautter et al. 2012; Seo and Darwin 2013). CtpA is involved in the proper function of the type 3 secretion system (T3SS), for cytotoxicity in cultured cells and for virulence in the animal model of acute pneumonia (Hoge et al. 2011; Seo and Darwin 2013). The activity of CtpA is dependent on LcbA, an outer membrane lipoprotein with tetratricopeptide repeat (TPR) motifs

(Srivastava et al. 2018). CtpA degrades four peptidoglycan hydrolases: MepM and PA4404, belonging to the M23 peptidase family, and PA1198 and PA1199, belonging to the NlpC/P60 peptidase family (Srivastava et al. 2018).

The lpg0499 gene in Lp encodes one CTP protease named Tsp, most homologous to the

P. aeruginosa CtpA (Lawrence et al. 2014). The tsp gene is upregulated 54-fold in the post- exponential phase compared to the exponential phase (Bruggemann et al. 2006). The tsp gene was also strongly upregulated during infection of Acanthamoeba castellanii and THP-1

(Bruggemann et al. 2006; Faucher et al. 2010). tsp is regulated by the Legionella quorum sensing system, an important activator of genes required in the transmissive phase (Tiaden et al. 2008). A transcriptomic analysis of a letS mutant in water revealed that tsp is downregulated in the mutant

(Mendis et al. 2018). In addition, the expression of tsp was downregulated in a cpxR mutant grown to PE phase, suggesting CpxR is also required for expression of tsp in PE phase (Tanner et al. 2016). CpxR regulates the expression of several Icm/Dot effectors and is required for growth in A. castellanii (Gal-Mor and Segal 2003a; Altman and Segal 2008; Feldheim et al.

2016; Tanner et al. 2016). A previous study showed that a tsp mutant in the Lp serogroup 1 strain

130b did not have a growth defect in Acanthamoeba castellanii, in THP-1 macrophages or in low-salt chemically defined media at 42°C (Lawrence et al. 2014). A small regulatory RNA

(sRNA) named Lpr17 (Lppnc0140 in strain Paris) is encoded complementary to lpg0499

(Weissenmayer et al. 2011; Sahr et al. 2012). sRNA are short RNA molecules involved in post-

148 transcriptional regulation of genes required for virulence and response to various conditions such as sugar metabolism, iron homeostasis, and biofilm formation (Apura et al. 2019; Desgranges et al. 2020). Base-pairing sRNAs are the most common type of sRNA and they act by hybridising to their target mRNA. Lpr17 is a cis-encoded sRNA. Such sRNA pair perfectly with their target due to them being encoded on the complementary strand of their target (Apura et al. 2019).

Lpr17 is therefore likely to control tsp expression.

In this paper, we have investigated the role of Lp’s Tsp in the resistance to thermal stress in water and during infection of amoeba. In addition, we have studied the regulatory function of the cis-encoded sRNA Lpr17 as well as confirmed the role of CpxR in the regulation of Tsp.

149 4.4 RESULTS

4.4.1 Tsp is important for L. pneumophila to survive thermal stress

Since Tail-specific proteases have been implicated in managing thermal stress in other bacteria, the importance of Tsp for the survival of Lp after a heat shock at 55 C was tested

(Figure 1). The strains were suspended in Fraquil, an artificial freshwater medium, and incubated for 24 hours at room temperature prior to the temperature stress. After 15 minutes at 55 C, the

CFU count of the tsp mutant decreased by 10,000-fold while the CFU count of the WT and the complemented strain decreases by only 10-fold. 30 minutes after thermal stress, the CFU count of the tsp mutant was 100 times lower than the CFU count of the WT and complemented strain.

However, the difference between the mutant and the WT was considered statistically significant only at 15 minutes.

Figure 1: Tsp is required for Lp to survive a thermal stress in water. The WT, tsp mutant

(tsp), and the complemented strain (tsp + ptsp) were suspended in Fraquil for 24 hours and then subjected to thermal stress at 55 C. The survival of the strains was measured by CFU counts every 15 minutes from 0 to 60 minutes. The data shown represent the average of three

150 independent biological replicates with standard deviation. A two-way ANOVA was used to determine statistical difference (****: P-value < 0.0001).

4.4.2 Tsp is important for intracellular multiplication in V. vermiformis following a

temperature shift.

Given the inability of the tsp mutant to survive a heat treatment, we hypothesized that the ability of the mutant to grow inside amoeba could be compromised if a temperature shift occurs, which is likely to happen in a HWDS. The ability of the tsp mutant to replicate within

V. vermiformis was then investigated (Figure 2). The infection was therefore carried out at 3 different temperatures in parallel: room temperature for 5 days, 37 C for 5 days, and room temperature for 2 days followed by 37 C for 3 days (referred to in this manuscript as a temperature shift). The temperature shift would simulate the change in temperature encountered in HWDS, albeit to a lower degree, and would test the importance of Tsp for survival under these conditions. At room temperature, none of the strains tested were able to replicate intracellularly

(Figure 2A). At 37 C, all strains were able to replicate intracellularly, with the exception of dotA-, the negative control (Figure 2C), confirming what was previously reported (Lawrence et al. 2014). However, when the temperature was shifted from 25 °C to 37 °C two days after the start of the infection, the tsp mutant had a severe growth defect within amoeba compared to the

WT (Figure 2B). At the end of the experiment, the mutant showed significantly less intracellular growth than the WT and complemented strain when a temperature shift occurs.

151

Figure 2: Tsp is required for intracellular multiplication in V. vermiformis during a temperature shift. Infection of the host cell V. vermiformis was carried out at room temperature for 5 days (A), at room temperature for 2 days then at 37 C for 3 days (B), and at 37 C for 5 days (C). Host cells were infected with the WT, tsp mutant (tsp), complemented strain (tsp + ptsp), and dotA-, a negative control. The dotted line in panel b represents the day on which the shift in temperature occurred. The data represent average and standard deviation of 6 biological replicates. A two-way ANOVA with with a Tukey correction for multiple comparison was used to determine if the results were statistically different. The statistical difference shown in Figure 2 compares the WT and tsp mutant (*, P-value < 0.05; ****, P-value < 0.0001).

152 4.4.3 Lpr17 is expressed in E phase

Next, we sought to investigate the regulation of Tsp. The small regulatory RNA Lpr17 is encoded antisense to the 5’ end and promoter region of the tsp gene and the 3’ end of lpg0500, which codes for a peptidase of the M23/M37 family (Figure 3A). Cis-encoded sRNAs tend to regulate the gene encoded on the complementary stand (Apura et al. 2019). Therefore, the expression of the Lpr17 sRNA was analyzed by northern blot in the WT, tsp mutant (tsp), and complemented strain (tsp + ptsp) (Figure 3B). To make the mutant, the tsp gene was replaced with a kanamycin resistance cassette, and, in the process, a section of Lpr17 coding region including its transcription start site (TSS) was also removed. The complementation in trans was done by cloning the full-length tsp with 441 bp upstream of the ATG, to include the putative promoter on a plasmid. This fragment also contains the full length lpr17 gene. Lpr17 was only detected in E phase by northern blot. The expression of Lpr17 is stronger in the complemented strain, probably caused by the copy number of the plasmid used for complementation. In the complemented strain, Lpr17 was also expressed in PE phase, although much less than in E phase.

4.4.4 tsp is transcribed in E and PE phase

RT-PCR was used to investigate when the tsp gene is transcribed and if the tsp and lpg0500 genes are transcribed as part of a polycistronic mRNA (Figure 3C). Amplification with a forward primer (499-R) and a reverse primer (499-F) within the tsp gene revealed that the gene is transcribed in both E and PE phase. The 499-R primer along with a forward primer within lpg0500 (500-F) showed that the 2 genes are not expressed as a polycistronic mRNA. Our RT-

PCR results suggest that tsp is slightly more expressed in PE phase and E phase. Using RT- qPCR, tsp is 4.3 fold more expressed in PE phase than E phase (Figure 3D).

153

Figure 3: The cis-encoded Lpr17 sRNA is expressed in E phase while tsp is expressed in both E and PE phase. A) tsp is encoded downstream of lpg0500 and the Lpr17 sRNA is encoded on the complementary strand of tsp overlapping with its TSS and the promoter region.

The coordinates of tsp and lpr17 in the Philadelphia-1 genome are indicated. The dotted line indicates the portion of the genome that was replaced with a kanamycin resistance cassette in the

tsp mutant. B) Northern blotting was used to investigate the expression of Lpr17 in the WT, tsp mutant (tsp), and complemented strain (tsp + ptsp) grown to exponential phase (E) and post- exponential phase (PE) in AYE broth. 5S rRNA was used as a loading control. C) An RT-PCR was performed on cDNA from the WT strain grown to E and PE phase in AYE broth to determine if tsp is encoded on a polycistronic operon with the upstream gene lpg0500. RNA from E and PE phase that was not reverse transcribed (No RT) as well as water were used as a negative control, genomic DNA (gDNA) of the WT strain served as a positive control. D) RT-

154 qPCR was used to investigate the expression of tsp in the WT grown to E and PE phase in AYE broth. An unpaired t-test was used to access statistical significance (*, P <0.05).

4.4.5 Tsp is expressed in PE phase

In order to detect the expression of Tsp, the protein was tagged with a hexahistidine tag and cloned onto pXDC39, a derivative of pMMB207c lacking the Ptac promoter and lacIq (Frey et al. 1992). This plasmid also encodes for a full-length copy of lpr17. The expression of Tsp and

Lpr17 was investigated by western blot and northern blot, respectively, in the WT and the tsp mutant harbouring the Tsp-his construct (ptsp-his) in E and PE phase (Figure 4). The WT and the

tsp mutant containing an empty vector served as controls. As expected, the Lpr17 sRNA is more expressed in E phase than PE phase (Figure 4A), similarly to what was seen in the complemented strain (Figure 3B). In contrast, the Tsp protein is only detected in PE phase

(Figure 4A).

155

Figure 4: Tsp is expressed in PE phase. Tsp was tagged with a polyhistidine tag and cloned in plasmid pXDC39 under its own promoter and transferred to the WT (WT + ptsp-his) and tsp

mutant (tsp + ptsp-his) strains. The strains were grown to E and PE phase in AYE broth, and

expression of the Lpr17 was analyzed by northern blot (A) while the expression of the Tsp was analyzed by western blot (B). The strains with the empty vector (WT + empty vector; tsp + empty vector) served as negative controls. 5S rRNA and IcdH serve as the loading control for northern blot and western blot, respectively.

4.4.6 Lpr17 is repressed during thermal stress

Lpr17 is expressed in an opposite manner to Tsp: the sRNA is expressed in E phase while the protein is expressed only in PE phase (Figure 4). However, tsp seems to be transcribed in

both E and PE phase (Figure 3C) and the relatively small increase in expression between E and

PE phase is insufficient to explain this observation. This suggest that Lpr17 blocks expression of

156 Tsp. Since Tsp is important for survival at 55 C, we hypothesize that Lpr17 should be repressed in this condition. Therefore, the expression of Lpr17 during thermal stress was analyzed by northern blot (Figure 5). The strains were grown to E phase in order to induced expression of

Lpr17, and then subjected to a thermal stress at 55 C. As seen in figure 5, Lpr17 sRNA was strongly repressed after 15 minutes at 55 C in the WT and complemented strains. Lpr17 is repressed whenever Tsp is produced or needed and support the hypothesis that Lpr17 blocks translation of Tsp. Further experiments will be needed to confirm this possibility.

Figure 5: Lpr17 is repressed following thermal stress. The WT, tsp mutant (tsp), and complemented strain (tsp + ptsp) were grown to E phase in AYE broth and then subjected to heat shock at 55 C for 15 minutes. Samples for RNA extraction were taken before (E phase) and after thermal stress for northern blot analysis.

4.4.7 CpxR regulates tsp independently of Lpr17.

A previous transcriptomic study has identified CpxR as a potential regulator of tsp in Lp

(Tanner et al. 2016) since the tsp gene was downregulated in the cpxR mutant in the PE phase

(Tanner et al. 2016). In order to confirm that the downregulation observed also affects Tsp protein levels, the ptsp-his plasmid was electroporated in the cpxR mutant and the expression of

Tsp in the cpxR mutant was analyzed by western blot (Figure 6A). In PE phase, Tsp is not

157 expressed in the absence of CpxR. Since the Lpr17 sRNA seems to negatively regulates the expression of Tsp, we hypothesize that the deletion of CpxR may cause overexpression of Lpr17, which would inhibit Tsp expression. The expression of Lpr17 was therefore analyzed by northern blot (Figure 6B). The expression level of Lpr17 in PE phase in the cpxR mutant is similar to the WT, indicating that the regulation of Tsp by CpxR is Lpr17-independent.

Figure 6: CpxR regulates Tsp in a Lpr17-independent manner. The WT and cpxR mutant

cpxR containing ptsp-his were grown to E and PE phase and analysed by (A) western blot and

(B) northern blot. 5S rRNA and IcdH were used as a loading control for norther blot and western blot, respectively.

4.4.8 The response regulator CpxR is important for surviving thermal stress

Since the cpxR mutant produce no Tsp in PE phase, the ability of the cpxR mutant to survive thermal stress was investigated (Figure 7). The cpxR mutation was complemented in

158 trans by cloning the cpxR gene under the control of a Ptac promoter in the vector pMMB207c, since cpxR is the fourth gene in a polycistronic mRNA. The cpxR mutant is unable to survive thermal stress compared to the WT and shows a much faster death than the wild-type. Basal expression from the vector without addition of IPTG was enough to complement the mutation

(cpxR + pcpxR). To ensure the complementation of the cpxR mutant was due to the cpxR gene cloned, the cpxR mutant with the empty vector pMMB207c (cpxR + pMMB207c) was also tested and showed a similar survival defect than the cpxR mutant. The results were only significantly different after 15 minutes (P = 0.001). The CFU counts for the three replicates at the later timepoints showed large variation and the difference was not considered significantly different.

Figure 7: CpxR is required for Lp to survive a thermal stress. The WT, cpxR mutant

(cpxR), the cpxR mutant with the empty vector (cpxR + pMMB207c), and the complemented strain (cpxR + pcpxR) were suspended in Fraquil for 24 hours and then subjected to thermal stress at 55 C. The survival of the strains was measured by CFU counts every 15 minutes from 0 to 60 minutes. The data shown represent the average of three independent replicate with standard deviation. A two-way ANOVA with a Tukey correction for multiple comparison was used to

159 determine if the results were significantly different. The statistical difference shown in Figure 7 compares the WT and tsp mutant: ***, P < 0.005

4.5 DISCUSSION

Similar to tsp mutants in other species, Lp’s tsp mutant is sensitive to thermal stress. The

tsp mutant is unable to tolerate 55 C for 15 minutes (Figure 1). The tsp mutant is also sensitive to changes in temperatures. During infection of V. vermiformis, shifting the temperature from 25

C to 37 C impacts the ability of the tsp mutant to replicate (Figure 2B). The tsp mutant seems to suffer a delay in growth as well as the inability to reach the same level of growth achieved at

37 C without a temperature shift (Figure 2C). The tsp mutant replicated to the same level as the

WT if the temperature is maintained at 37 C throughout the infection (Figure 2C). Lp’s ability to replicate within V. vermiformis despite shifts in temperature is likely important for its persistence in hot water distribution systems. Sporadic use of a system is likely to generate section of lower temperature, such as in dead ends, that momentarily gets warmer when the hot water flows through the system. In addition, increasing the temperature of the system is often used to disinfect hot water distribution systems (Bedard et al. 2015). The amoeba cysts are able to survive treatments up to 80 C, and Lp’s ability to survive and replicate efficiently once the temperature decreases is important for recolonization of the water system (Storey et al. 2004).

Possibly, the absence of Tsp causes a disturbance in the cell membrane resulting in increased sensitivity to thermal stresses. This reasoning was previously suggested to explain decrease resistance to thermal stress of tsp mutants in Borrelia burgdorferi, Escherichia coli, and

Staphylococcus aureus (Hara et al. 1991; Kumru et al. 2011; Carroll et al. 2014). Alternatively, accumulation of misfolded proteins in the tsp mutant could explain the inability to cope with

160 thermal stress. It has previously been shown that Tsp degrades misfolded proteins that accumulate in the periplasm (Silber et al. 1992; Keiler et al. 1995; Keiler et al. 1996).

Degradation of misfolded proteins increases the pool of amino acids available for de novo protein synthesis. Possibly, the accumulated misfolded proteins are not degraded in the absence of Tsp, leading to a decrease of the pool of amino acids (Richter et al. 2010; Schumann 2016).

This might explain the inability of the tsp mutant to grow as well as the WT following the temperature shift.

Despite not replicating as much as when the infection is carried out at constant temperature, the tsp mutant is still able to replicate within amoeba to some extent. This suggest that in the absence of Tsp, other proteases are able to degrade misfolded proteins, thereby relieving the stress. The expression of alternate proteases could explain the delay in growth compared to the WT observed following the temperature shift. In E. coli, the DegP periplasmic protease is important for surviving elevated temperatures and is responsible for degrading misfolded proteins and aggregated proteins in the periplasm (Strauch and Beckwith 1988;

Lipinska et al. 1989; Strauch et al. 1989; Seol et al. 1991; Laskowska et al. 1996). DegQ is a homolog of DegP that is also found in the periplasm and is responsible for degrading denatured proteins (Kolmar et al. 1996; Waller and Sauer 1996; Malet et al. 2012). In Legionella, the DegP homologue is required for surviving thermal stress, but is not required for infection of amoeba

(Pedersen et al. 2001). The infection was done at a constant temperature, and therefore it is unknown if DegP plays a role during amoeba infection if a temperature change occurs (Pedersen et al. 2001). Legionella codes for a DegQ homologue, however its role in surviving thermal stress have not been investigated (Wrase et al. 2011; Schubert et al. 2015). In the absence of tsp, it is possible that these proteases also contribute to removing the aggregated and misfolded

161 proteins during the temperature that occurs during amoeba infection. However, subjecting the strain to 55 C might be too big of a stress for the other proteases to compensate the lack of tsp.

The presence of a N-terminal secretion signal in Tsp was found using two bioinformatic software, signalP and Phobius (Nielsen et al. 1997; Kall et al. 2007; Almagro Armenteros et al.

2019). This is consistent with tsp’s from other species that also have a N-terminal secretion signal required for transport to the periplasm (Hoge et al. 2011). This suggests that Lp’s Tsp is located in the periplasm and could therefore degrade misfolded and aggregated proteins in the periplasm.

P. aeruginosa’s CtpA cleaves MepM, belonging to the M23 peptidase family. It is interesting to note that tsp is encoded downstream of lpg0500, which codes for a M23/M37 family peptidase. Lp codes for two other peptidases belonging to the M23/M37 family, lpg0567 and lpg0825, the former being a homologue of P. aeruginosa’s MepM. In addition, Lp codes for at least 10 TPR repeat proteins, the same type of protein as the CtpA partner LcbA, suggesting one or some of these TPR proteins might be required for Lp’s Tsp’s activity, similarly to what has been reported in P. aeruginosa (Bandyopadhyay et al. 2012).

Cis-encoded sRNAs, such as Lpr17, typically regulate genes coded on the complementary strand (Apura et al. 2019). The expression pattern of Lpr17 and Tsp are opposite to each other, where the sRNA is only expressed in E phase (Figure 3b) while the Tsp protein is only expressed in PE phase (Figure 4b). This pattern of expression suggests a negative regulation of Tsp by Lpr17. This is further supported by the complete repression of Lpr17 during thermal stress (Figure 5). Furthermore, RT-PCR on cDNA extracted from E and PE phase (Figure 3C) shows the presence of the tsp mRNA transcript in both phases, whereas the protein is only detected in PE phase. Taken together, our results suggest that the Lpr17 sRNA inhibits

162 translation of the protein, possibly by blocking the binding of ribosome to the ribosome binding site (RBS), without initiating degradation of the transcript (Figure 3A). This is reminiscent of several cis-encoded sRNA that overlap with the 5’ untranslated region of their target gene (Ellis et al. 2015). Determining the exact mechanism would require additional experiments that are beyond the scope of the present study.

In E. coli, the CpxR/A two-component system regulates genes involved in dealing with envelope stress and misfolded proteins in the periplasm (De Wulf et al. 1999). In E. coli, CpxR upregulates the DegP periplasmic protease (Danese et al. 1995; Pogliano et al. 1997;

Dartigalongue et al. 2001). In Lp, CpxR does not regulate DegP and DegQ in E and PE phase, but seems essential for expression of Tsp (Tanner et al. 2016). Therefore, the inability of the cpxR mutant to tolerate thermal stress could rely on the absence of Tsp; however, complementation of cpxR defect by expression tsp in trans was unsuccessful, suggesting that

CpxR regulates other determinants of thermal stress resistance. It is unclear if CpxR directly binds to the promoter region or if the regulation of tsp is indirect. Additional experiments are required to investigate the exact mechanism.

In conclusion, we have demonstrated that Tsp is necessary for survival of thermal stress in water and during intracellular growth. Such situations are likely to be encountered by Lp in its normal environment, which makes Tsp a critical genetic determinant for survival and growth in water systems. Our results show that tsp is likely regulated by a complex network consisting minimally of Lpr17 and CpxR. Finally, we have determined that CpxR is an important regulator of thermal stress tolerance in Lp.

163 4.6 MATERIAL AND METHODS

4.6.1 Bacterial strains and media

Table 1 describes the bacterial strains used in this study. The WT Lp strain used in this study is KS79, a comR mutant of the JR32 strain, which allows the strain to be constitutively competent (de Felipe et al. 2008). JR32 is a Philadelphia-1 derivative that is salt-sensitive, streptomycin-resistant, and restriction negative (Sadosky et al. 1993). Lp strains were cultured on

CYE agar (ACES-buffered charcoal yeast extract) supplemented with 0.25 mg ml-1 of L-cysteine and 0.4 mg ml-1 of ferric pyrophosphate (Feeley et al. 1979). Strains were cultured in AYE broth, which is CYE lacking charcoal and agar. If required, media were supplemented with 25 g ml-1 of kanamycin and 5 g ml-1 of chloramphenicol (Feeley et al. 1979).

164 Table 1: Strains used in this study

Strain Name Relevant Genotype Source or

Reference

Legionella pneumophila Philadelphia-1

JR32 Philadelphia-1 derivative; SmR; r-; (Sadosky et al.

m+ 1993)

KS79 JR32 comR (de Felipe et al.

2008)

dotA- JR32 dotA::Tn903dIIlacZ (Sadosky et al.

1993)

tsp (SPF365) KS79 tsp::Km; KmR This study

tsp + ptsp (SPF403) KmR, CmR This study

KS79 + pXDC39 empty vector CmR This study

(SPF132)

KS79 + ptsp-his (SPF451) CmR This study

tsp + pXDC39 empty vector KmR, CmR This study

(SPF469)

tsp + ptsp-his (SPF452) KmR, CmR This study

Plasmids

pSF6 pGEMT-easy-rrnb (Faucher et al.

2011)

165 pXDC39 pMMB207c Ptac, lacIq, CmR Xavier Charpentier

ptsp (pSF113) pXDC39 containing tsp; CmR This study

ptsp-his (pSF129) pXDC39 containing tsp-his; CmR This study

4.6.2 Deletion of tsp and complementation of the mutant

The tsp gene was replaced with a kanamycin resistance cassette by allelic exchange, as previously described, to construct the deletion mutant strain (Hovel-Miner et al. 2009). PCR primers are described in Table 2. A 1-kb fragment upstream of tsp was amplified using primers

Lpg499-UF and Lpg499-UR. A 1-kb fragment downstream of tsp was amplified using primers

Lpg499-DF and Lpg499-DR. The kanamycin cassette was amplified from the pSF6 plasmid

(Faucher et al. 2011) using primers Lpg499-Km-F and Lpg499-Km-R. Each 1-kb fragment was purified using a gel extraction kit (Qiagen) and were ligated by PCR using primers Lpg499-DR and Lpg499-UF to generate a 3-kb fragment that was purified by a gel extraction kit (Qiagen).

The purified 3-kb fragment was introduced into the KS79 strain by natural transformation

(Sexton and Vogel 2004) and the recombinants were selected on CYE agar supplemented with kanamycin. PCR was used to confirm the allelic exchange and the tsp mutant strain was named

SPF365.

The tsp mutation was complemented in trans by amplifying the tsp gene with its native promoter from the KS79 WT genomic DNA using primers Lpg499-F1 and Lpg499-R1. The

Lpg499-F1 primer is located 441 nucleotides upstream of tsp’s ATG and the amplicon includes both the tsp and lpr17 genes. The amplicon was cloned in the pXDC39 plasmid vector using the restriction enzymes SacI (New England Biolabs) and XbaI (New England Biolabs). The restriction digestion was done at 37 C for 1 hour, column purified (Qiagen), and ligated for 2

166 hours at room temperature using T4 DNA ligase (New England Biolabs). The ligation product was transformed into E. coli DH5 and the transformants were selected on LB agar containing

25 g/ml of chloramphenicol. Cloning was confirmed by PCR using primers Lpg499-F1 and pXDC39-scr-R. The recombinant plasmid (ptsp) was extracted and electroporated into the tsp mutant strain. The transformants were selected on CYE agar containing 5 g/ml of chloramphenicol, then patched on CYE agar containing 25 g/ml of kanamycin and 5 g/ml of chloramphenicol. Screening was done by PCR using primers Lpg499-F1 and pXDC39-scr-R and the resulting strain was called SPF403.

4.6.3 Thermal stress

Lp strains were grown on CYE agar for 3 days at 37 C. A suspension was prepared from a few colonies in Fraquil, an artificial freshwater medium (Morel et al. 1975; Mendis et al. 2015) at an OD600 of 1.0. The suspension was washed three time with Fraquil to remove any trace of nutrients. The strains were incubated at 25 C for 24 hours in 25 cm2 cell culture flasks

(Sarstedt). The strains were then diluted 1:10 in Fraquil and 1 ml were distributed in 13-ml tubes

(Sarstedt) and incubated in a 55 C water bath. Individual tubes were used for each time point.

Tubes were removed from the water bath for CFU counts on CYE agar to determine the survival of the strains. CFU counts were done at 0, 15, 30, 45, and 60 minutes.

4.6.4 Vermamoeba vermiformis culture and infection

V. vermiformis cells were grown at room temperature in 75 cm2 cell culture flasks (Sarstedt) in modified PYNFH medium (ATCC medium 1034) and passaged when confluence was reached.

The amoebas were centrifuged at 200 g for 10 minutes, supernatant discarded, and cells were

167 resuspended in fresh modified PYNFH medium (ATCC medium 1034) and incubated for three days prior to infection. On the day the infection was to be carried, the cells were centrifuged at

200 g for 10 minutes and resuspended at a concentration of 5.0  105 cells/ml in modified

PYNFH lacking FBS and the buffer solution. Legionella is able to grow in modified PYNFH containing FBS and the buffer solution, therefore they were omitted during the infection to ensure that the growth observed is due to intracellular multiplication. 1 ml of cells were seeded in each well of the 24-well plate (Sarstedt).

Bacterial strains were grown on CYE agar with antibiotics for 3 days at 37 C. On the day of the infection, the bacteria were suspended in Fraquil at an OD600 of 0.1 and then diluted

1:10 in Fraquil. 5 l of the 1:10 dilution was added to each well in triplicate in order to have a starting MOI of 0.1. The infection was carried at room temperature for 5 days, at 37 C for 5 days, and at 25 C for 2 days and then at 37 C for an additional 3 days. CFU counts were performed on a daily basis.

168 Table 2: Primers used in this study

Primers Sequence (5’ → 3’) Source or

Reference

Lpg499-UF ATAAACGGACTGTGCTAAACCAAGAGCTG This study

Lpg499-UR GTCTAGCTATCGCCATGTAAGCGATCTCCTCAGATGC This study

Lpg499-DF GCTGAAGATCAGTTGGGTTGACCAATTAGTCACTCC This study

Lpg499-DR TATCTATGCTCCGTTTTCCAGTCATTCAGC This study

Lpg499-Km- GCATCTGAGGAGATCGCTTACATGGCGATAGCTAGA This study

F C

Lpg499-Km- GGAGTGACTAATTGGTCAACCCAACTGATCTTCAGC This study

R

Lpg499-F1 TTCGAGCTCTAATTCAAAGCGGCAAACCGTTCAC This study

Lpg499-R1 CGACTCTAGATTATCTGTTAGCTAACGCCATTCCTTC This study

C

pXDC39-scr- AAACAGCCAAGCTTGCATGC This study

R

499-F ATGCTAACCGGCCTTGATCC This study

499-R CCGCGCATTAAATTAACAGC This study

500-F TGCAAGCTCAGCAGGAAATG This study

Lpr17-5O TCCAACAAAACGAGCAAATCGC This study

Lpr17-5I TTGTCTTAAAGCTTAGCCGCTGGC This study

Lpr17-3O TGGTTTCTTCAGCCGAAAACGC This study

169 Lpr17-3I ATAGCGATCTCCTCAGATGCAAGG This study

5’RACE GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGC This study

Adapter UUUGAUGAAA

polydT GCGAGCACAGAATTAATACGACTCACTATAGGT12V This study

N

5’RACE- GCTGATGGCGATGAATGAACACTG This study

Outer

5’RACE- CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG This study

Inner

3’RACE- GCGAGCACAGAATTAATACGACT This study

Outer

3’RACE- CGCGGATCCGAATTAATACGACTCACTATAGG This study

Inner

Lpg499-his-F ATCCTCTAGAATCGCAAGTGTAGGCCATACCGGTGG This study

Lpg499-his- ATGCCTGCAGTTAATGGTGATGGTGATGGTGTCTGTT This study

R AGCTAACGCCATTCCTTCC

499-qPCR-F TCTGAAGCAGAGGCAGAACC This study

499-qPCR-R CAATGACAAGGCAGGTAAGC This study

4.6.5 RNA extraction

TRIzol (ThermoFisher Scientific) was used for RNA extraction according to the manufacturer’s protocol. Briefly, 200 l of chloroform (ThermoFisher Scientific) was added to the bacterial pellet suspended in TRIzol, shaken, and incubated for 3 minutes at room

170 temperature. The sample was added to a Phase-lock Gel Heavy 2 ml tube (VWR) and centrifuged at 12,000  g for 15 minutes at room temperature. Approximately 600 l of the supernatant was transferred to a microtube containing 600 l of 100% isopropanol

(ThermoFisher Scientific) and 5 g of glycogen (ThermoFisher Scientific). Following incubation at room temperature for 10 minutes, the tubes were centrifuged at 17,000  g for 10 minutes at 4

C. The supernatant was removed and 1 ml of 75 % ice-cold ethanol (Greenfield Global) was added to the RNA pellet. The tubes were centrifuged at 17,000  g for 10 minutes at 4 C, the supernatant removed, the pellet air dried and resuspended in nuclease-free water (ThermoFisher

Scientific). The RNA was quantified using a UV spectrophotometer (ThermoFisher Scientific).

4.6.6 Northern Blotting

The expression of the Lpr17 sRNA was examined by northern blot as previously described (Mendis et al. 2018). The strains were grown on CYE agar with required antibiotics for 3 days at 37 C, inoculated in AYE broth with required antibiotics and grown at 37 C with shaking at 250 rpm. Aliquots of 10 ml of exponential phase culture (OD600 0.5-1.0) and 5 ml of

PE phase culture (OD600 >3) were centrifuged at 4,000 g for 10 minutes, the supernatant removed, and the bacterial pellet resuspended in 1 ml of TRIzol reagent (ThermoFisher

Scientific). RNA extraction was carried out as mentioned above. 5 g of RNA was loaded on a 6

% Tris-borate-EDTA-urea polyacrylamide gel and the samples were migrated at 180 mV. The

RNA was transferred to a positively charged nylon membrane (ThermoFisher Scientific) using a semidry gel blotting system (Biorad) for 20 minutes at 200 mA. The membrane was prehybridized in ULTRAhyb-Oligo Hybridization buffer (ThermoFisher Scientific) for 1 hour at

37 C in a rotating chamber. 5 nM of 5’ biotinylated Lpr10 probe (Integrated DNA

171 Technologies) was added to the prehybridization buffer and the membrane was incubated overnight at 37 C in the rotating chamber. The membrane was twice washed with 2X SSC (0.15

M NaCl and 0.015 M sodium citrate) and 0.5 % SDS (Bio-Rad) for 30 minutes at 37 C. The probes were detected with the Chemiluminescent Nucleic Acid Detection Module (ThermoFisher

Scientific).

4.6.7 RT-PCR

RNA extracted from the KS79 WT strain grown to E and PE phase was treated with

DNase (ThermoFisher Scientific). 1 g of DNase treated RNA was reverse transcribed with

Protoscript II (New England Biolabs) and a no reverse transcriptase (no RT) was included by replacing the reverse transcriptase by nuclease-free water. The PCR was performed on cDNA, no

RT control, WT gDNA, and a no template control (water) using primers described in Table 2.

The amplicon was analysed on a 1 % agarose gel.

4.6.8 Quantitative PCR

RNA was extracted and cDNA synthesized as described above. Following cDNA synthesis, qPCR was done with primers 499-qPCR-F and 499-qPCR-R. qPCR was performed using iTaq Universal SYBR Green supermix (Bio Rad) according to the manufacturer’s protocol.

The efficiency of the primer pairs was determined using dilution series of gDNA. Ct values were normalized to the 16S rRNA as described previously (Livak and Schmittgen 2001).

172 4.6.9 Cloning of Tsp with polyhistidine tag

The polyhistidine tag was added to tsp by PCR. tsp along with its native promoter was amplified using primers Lpg499-his-F and Lpg499-his-R, the latter containing a polyhistidine tag. The amplicon was cloned in the pXDC39 plasmid vector using XbaI (New England Biolabs) and PstI (New England Biolabs). The restriction digestion was carried at 37 C for 1 hour, followed by column purification (Qiagen), and ligation at room temperature for 2 hours using T4

DNA ligase (New England Biolabs). The ligation product was transformed into E. coli DH5- and the transformants were selected on LB agar supplemented with 25 g ml-1 of chloramphenicol. The cloning was confirmed by PCR using primers Lpg499-his-F and pXDC39- scr-R. The plasmid (ptsp-his) was extracted and electroporated into KS79 and the tsp mutant and transformants were selected on CYE containing 5 g ml-1 of chloramphenicol. The KS79 ptsp- his transformants were patched on CYE containing 5 g ml-1 of chloramphenicol while the tsp mutant ptsp-his transformants were patched on CYE containing 25 g ml-1 of kanamycin and 5

g ml-1 of chloramphenicol. Screening was done by PCR using primers Lpg499-his-F and pXDC39-scr-R. The pXDC39 empty vector was also electroporated in the KS79 WT and the tsp mutant and serve as controls.

4.6.10 Western blot

Strains were grown to E and PE phase in AYE broth. Aliquots of 1.5 ml were centrifuged at 17,000 g for 3 minutes, the supernatant was decanted, and the cell pellet resuspended in 200 l of 1X sample buffer (10 % glycerol, 62.5 mM Tris-HCl pH 6.8, 2.5 % SDS, 0.002 % bromophenol blue, 5 % -mercaptoethanol). The samples were boiled for 5 minutes and sonicated for 15 minutes in an ice-cold water bath using Ultrasonic Cleaner (Cole-Palmer).

173 Samples were then centrifuged for 15 minutes at 17,000  g at 4 C. The supernatant was transferred to a new tube and stored at -20 C until it was ready to use. The protein samples were standardized by adjusting the final OD600 to 0.5 by diluting the samples with 1X sample buffer.

15 l of the standardized protein sample was loaded on a 12.5 % polyacrylamide gel and samples were migrated at 100 V. The proteins were transferred onto a PVDF membrane (Bio Rad) at 16

V for 24 hours. The membrane was blocked for 30 minutes with a 5 % milk protein solution.

Tsp-his was detected with the Anti-6X His tag antibody (ThermoFisher Scientific), which is already conjugated with HRP and does not require a secondary antibody for detection. The blot was incubated with this antibody at room temperature for 2 hours followed. The IcdH antibody

(Sigma) was used as a loading control. In this case the blot was incubated with the IcdH primary antibody at room temperature for 2 hours and with the secondary antibody (anti-rabbit HRP,

Sigma) was done at room temperature for 30 minutes. Antibodies were detected using ECL

Prime Western Blotting Detection Reagents (GE Healthcare).

4.7 ACKNOWLEDGMENTS

The pXDC39 plasmid is a kind gift from Dr. Xavier Charpentier. This study was supported by CIHR Open Operating Grant #142208 to SPF. JS was supported by a FRQNT

Doctoral scholarship and a CRIPA scholarship supported by the Fonds de recherche du Québec -

Nature et technologies n°RS-170946.

174 4.8 References

Almagro Armenteros, J. J., K. D. Tsirigos, C. K. Sonderby, T. N. Petersen, O. Winther, S. Brunak, G. von Heijne and H. Nielsen (2019). "SignalP 5.0 improves signal peptide predictions using deep neural networks." Nat Biotechnol 37(4): 420-423.

Altman, E. and G. Segal (2008). "The response regulator CpxR directly regulates expression of several Legionella pneumophila icm/dot components as well as new translocated substrates." J Bacteriol 190(6): 1985-1996.

Apura, P., S. Domingues, S. C. Viegas and C. M. Arraiano (2019). "Reprogramming bacteria with RNA regulators." Biochem Soc Trans 47(5): 1279-1289.

Bandara, A. B., N. Sriranganathan, G. G. Schurig and S. M. Boyle (2005). "Carboxyl-terminal protease regulates Brucella suis morphology in culture and persistence in macrophages and mice." J Bacteriol 187(16): 5767-5775.

Bandyopadhyay, P., E. U. Sumer, D. Jayakumar, S. Liu, H. Xiao and H. M. Steinman (2012). "Implication of proteins containing tetratricopeptide repeats in conditional virulence phenotypes of Legionella pneumophila." J Bacteriol 194(14): 3579-3588.

Bedard, E., S. Fey, D. Charron, C. Lalancette, P. Cantin, P. Dolce, C. Laferriere, E. Deziel and M. Prevost (2015). "Temperature diagnostic to identify high risk areas and optimize Legionella pneumophila surveillance in hot water distribution systems." Water Res 71: 244-256.

Beebe, K. D., J. Shin, J. Peng, C. Chaudhury, J. Khera and D. Pei (2000). "Substrate recognition through a PDZ domain in tail-specific protease." Biochemistry 39(11): 3149-3155.

Borella, P., E. Guerrieri, I. Marchesi, M. Bondi and P. Messi (2005). "Water ecology of Legionella and protozoan: environmental and public health perspectives." Biotechnol Annu Rev 11: 355-380.

Bruggemann, H., A. Hagman, M. Jules, O. Sismeiro, M. A. Dillies, C. Gouyette, F. Kunst, M. Steinert, K. Heuner, J. Y. Coppee and C. Buchrieser (2006). "Virulence strategies for infecting phagocytes deduced from the in vivo transcriptional program of Legionella pneumophila." Cell Microbiol 8(8): 1228-1240.

Carroll, R. K., F. E. Rivera, C. K. Cavaco, G. M. Johnson, D. Martin and L. N. Shaw (2014). "The lone S41 family C-terminal processing protease in Staphylococcus aureus is localized to the cell wall and contributes to virulence." Microbiology 160(Pt 8): 1737-1748.

Danese, P. N., W. B. Snyder, C. L. Cosma, L. J. Davis and T. J. Silhavy (1995). "The Cpx two- component signal transduction pathway of Escherichia coli regulates transcription of the gene specifying the stress-inducible periplasmic protease, DegP." Genes Dev 9(4): 387-398.

175 Dartigalongue, C., D. Missiakas and S. Raina (2001). "Characterization of the Escherichia coli sigma E regulon." J Biol Chem 276(24): 20866-20875. de Felipe, K. S., R. T. Glover, X. Charpentier, O. R. Anderson, M. Reyes, C. D. Pericone and H. A. Shuman (2008). "Legionella eukaryotic-like type IV substrates interfere with organelle trafficking." PLoS Pathog 4(8): e1000117.

De Wulf, P., O. Kwon and E. C. Lin (1999). "The CpxRA signal transduction system of Escherichia coli: growth-related autoactivation and control of unanticipated target operons." J Bacteriol 181(21): 6772-6778.

Delafont, V., M. H. Rodier, E. Maisonneuve and E. Cateau (2018). "Vermamoeba vermiformis: a Free-Living Amoeba of Interest." Microb Ecol 76(4): 991-1001.

Desgranges, E., I. Caldelari, S. Marzi and D. Lalaouna (2020). "Navigation through the twists and turns of RNA sequencing technologies: Application to bacterial regulatory RNAs." Biochim Biophys Acta Gene Regul Mech 1863(3): 194506.

Ellis, M. J., R. S. Trussler and D. B. Haniford (2015). "A cis-encoded sRNA, Hfq and mRNA secondary structure act independently to suppress IS200 transposition." Nucleic Acids Res 43(13): 6511-6527.

Ensminger, A. W. (2016). "Legionella pneumophila, armed to the hilt: justifying the largest arsenal of effectors in the bacterial world." Curr Opin Microbiol 29: 74-80.

Faucher, S. P., G. Friedlander, J. Livny, H. Margalit and H. A. Shuman (2010). "Legionella pneumophila 6S RNA optimizes intracellular multiplication." Proc Natl Acad Sci U S A 107(16): 7533-7538.

Faucher, S. P., C. A. Mueller and H. A. Shuman (2011). "Legionella Pneumophila Transcriptome during Intracellular Multiplication in Human Macrophages." Front Microbiol 2: 60.

Feeley, J. C., R. J. Gibson, G. W. Gorman, N. C. Langford, J. K. Rasheed, D. C. Mackel and W. B. Baine (1979). "Charcoal-yeast extract agar: primary isolation medium for Legionella pneumophila." J Clin Microbiol 10(4): 437-441.

Feldheim, Y. S., T. Zusman, Y. Speiser and G. Segal (2016). "The Legionella pneumophila CpxRA two‐component regulatory system: new insights into CpxR’s function as a dual regulator and its connection to the effectors regulatory network." Molecular Microbiology 99(6): 1059- 1079.

Feldman, A. R., J. Lee, B. Delmas and M. Paetzel (2006). "Crystal structure of a novel viral protease with a serine/lysine catalytic dyad mechanism." J Mol Biol 358(5): 1378-1389.

Frey, J., M. M. Bagdasarian and M. Bagdasarian (1992). "Replication and copy number control of the broad-host-range plasmid RSF1010." Gene 113(1): 101-106.

176 Gal-Mor, O. and G. Segal (2003a). "Identification of CpxR as a positive regulator of icm and dot virulence genes of Legionella pneumophila." J Bacteriol 185(16): 4908-4919.

Hara, H., Y. Yamamoto, A. Higashitani, H. Suzuki and Y. Nishimura (1991). "Cloning, mapping, and characterization of the Escherichia coli prc gene, which is involved in C-terminal processing of penicillin-binding protein 3." J Bacteriol 173(15): 4799-4813.

Henne, K., L. Kahlisch, M. G. Hofle and I. Brettar (2013). "Seasonal dynamics of bacterial community structure and composition in cold and hot drinking water derived from surface water reservoirs." Water Res 47(15): 5614-5630.

Hoge, R., M. Laschinski, K. E. Jaeger, S. Wilhelm and F. Rosenau (2011). "The subcellular localization of a C-terminal processing protease in Pseudomonas aeruginosa." FEMS Microbiol Lett 316(1): 23-30.

Hovel-Miner, G., S. Pampou, S. P. Faucher, M. Clarke, I. Morozova, P. Morozov, J. J. Russo, H. A. Shuman and S. Kalachikov (2009). "SigmaS controls multiple pathways associated with intracellular multiplication of Legionella pneumophila." J Bacteriol 191(8): 2461-2473.

Kall, L., A. Krogh and E. L. Sonnhammer (2007). "Advantages of combined transmembrane topology and signal peptide prediction--the Phobius web server." Nucleic Acids Res 35(Web Server issue): W429-432.

Keiler, K. C., K. R. Silber, K. M. Downard, I. A. Papayannopoulos, K. Biemann and R. T. Sauer (1995). "C-terminal specific protein degradation: activity and substrate specificity of the Tsp protease." Protein Sci 4(8): 1507-1515.

Keiler, K. C., P. R. Waller and R. T. Sauer (1996). "Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA." Science 271(5251): 990- 993.

Kolmar, H., P. R. Waller and R. T. Sauer (1996). "The DegP and DegQ periplasmic endoproteases of Escherichia coli: specificity for cleavage sites and substrate conformation." J Bacteriol 178(20): 5925-5929.

Kuchta, J. M., J. S. Navratil, M. E. Shepherd, R. M. Wadowsky, J. N. Dowling, S. J. States and R. B. Yee (1993). "Impact of Chlorine and Heat on the Survival of Hartmannella vermiformis and Subsequent Growth of Legionella pneumophila." Appl Environ Microbiol 59(12): 4096- 4100.

Kumru, O. S., I. Bunikis, I. Sorokina, S. Bergstrom and W. R. Zuckert (2011). "Specificity and role of the Borrelia burgdorferi CtpA protease in outer membrane protein processing." J Bacteriol 193(20): 5759-5765.

Laskowska, E., D. Kuczynska-Wisnik, J. Skorko-Glonek and A. Taylor (1996). "Degradation by proteases Lon, Clp and HtrA, of Escherichia coli proteins aggregated in vivo by heat shock; HtrA protease action in vivo and in vitro." Mol Microbiol 22(3): 555-571.

177 Lawrence, A., K. N. S, H. S. S and M. H. W (2014). "Characterization of the tail-specific protease (Tsp) from Legionella." J Gen Appl Microbiol 60(3): 95-100.

Lesnik, R., I. Brettar and M. G. Hofle (2016). "Legionella species diversity and dynamics from surface reservoir to tap water: from cold adaptation to thermophily." ISME J 10(5): 1064-1080.

Lipinska, B., O. Fayet, L. Baird and C. Georgopoulos (1989). "Identification, characterization, and mapping of the Escherichia coli htrA gene, whose product is essential for bacterial growth only at elevated temperatures." J Bacteriol 171(3): 1574-1584.

Livak, K. J. and T. D. Schmittgen (2001). "Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method." Methods 25(4): 402-408.

Malet, H., F. Canellas, J. Sawa, J. Yan, K. Thalassinos, M. Ehrmann, T. Clausen and H. R. Saibil (2012). "Newly folded substrates inside the molecular cage of the HtrA chaperone DegQ." Nat Struct Mol Biol 19(2): 152-157.

Mendis, N., P. McBride and S. P. Faucher (2015). "Short-Term and Long-Term Survival and Virulence of Legionella pneumophila in the Defined Freshwater Medium Fraquil." PLoS One 10(9): e0139277.

Mendis, N., P. McBride, J. Saoud, T. Mani and S. P. Faucher (2018). "The LetA/S two- component system regulates transcriptomic changes that are essential for the culturability of Legionella pneumophila in water." Sci Rep 8(1): 6764.

Morel, F. M. M., J. C. Westall, J. G. Rueter and C. JP (1975). Description of the algal growth media "Aquil" and "Fraquil", R.M. Parsons Laboratory for Water Resources and Hydrodynamics, Massachusetts Institute of Technology, Cambridge, MA.

Nielsen, H., J. Engelbrecht, S. Brunak and G. von Heijne (1997). "Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites." Protein Eng 10(1): 1-6.

Pedersen, L. L., M. Radulic, M. Doric and Y. Abu Kwaik (2001). "HtrA homologue of Legionella pneumophila: an indispensable element for intracellular infection of mammalian but not protozoan cells." Infect Immun 69(4): 2569-2579.

Pogliano, J., A. S. Lynch, D. Belin, E. C. Lin and J. Beckwith (1997). "Regulation of Escherichia coli cell envelope proteins involved in protein folding and degradation by the Cpx two-component system." Genes Dev 11(9): 1169-1182.

Rawlings, N. D., A. J. Barrett and A. Bateman (2010). "MEROPS: the peptidase database." Nucleic Acids Res 38(Database issue): D227-233.

Reiling, S. A., J. A. Jansen, B. J. Henley, S. Singh, C. Chattin, M. Chandler and D. W. Rowen (2005). "Prc protease promotes mucoidy in mucA mutants of Pseudomonas aeruginosa." Microbiology 151(Pt 7): 2251-2261.

178 Richter, K., M. Haslbeck and J. Buchner (2010). "The heat shock response: life on the verge of death." Mol Cell 40(2): 253-266.

Sadosky, A. B., L. A. Wiater and H. A. Shuman (1993). "Identification of Legionella pneumophila genes required for growth within and killing of human macrophages." Infect Immun 61(12): 5361-5373.

Sahr, T., C. Rusniok, D. Dervins-Ravault, O. Sismeiro, J. Y. Coppee and C. Buchrieser (2012). "Deep sequencing defines the transcriptional map of L. pneumophila and identifies growth phase-dependent regulated ncRNAs implicated in virulence." RNA Biol 9(4): 503-519.

Sautter, R., D. Ramos, L. Schneper, O. Ciofu, T. Wassermann, C. L. Koh, A. Heydorn, M. Hentzer, N. Hoiby, A. Kharazmi, S. Molin, C. A. Devries, D. E. Ohman and K. Mathee (2012). "A complex multilevel attack on Pseudomonas aeruginosa algT/U expression and algT/U activity results in the loss of alginate production." Gene 498(2): 242-253.

Schmitt, C. K., K. C. Meysick and A. D. O'Brien (1999). "Bacterial toxins: friends or foes?" Emerg Infect Dis 5(2): 224-234.

Schubert, A., R. Wrase, R. Hilgenfeld and G. Hansen (2015). "Structures of DegQ from Legionella pneumophila Define Distinct ON and OFF States." J Mol Biol 427(17): 2840-2851.

Schumann, W. (2016). "Regulation of bacterial heat shock stimulons." Cell Stress Chaperones 21(6): 959-968.

Seo, J. and A. J. Darwin (2013). "The Pseudomonas aeruginosa periplasmic protease CtpA can affect systems that impact its ability to mount both acute and chronic infections." Infection and immunity 81(12): 4561-4570.

Seoane, A., A. Sabbaj, L. M. McMurry and S. B. Levy (1992). "Multiple antibiotic susceptibility associated with inactivation of the prc gene." J Bacteriol 174(23): 7844-7847.

Seol, J. H., S. K. Woo, E. M. Jung, S. J. Yoo, C. S. Lee, K. J. Kim, K. Tanaka, A. Ichihara, D. B. Ha and C. H. Chung (1991). "Protease Do is essential for survival of Escherichia coli at high temperatures: its identity with the htrA gene product." Biochem Biophys Res Commun 176(2): 730-736.

Sexton, J. A. and J. P. Vogel (2004). "Regulation of hypercompetence in Legionella pneumophila." J Bacteriol 186(12): 3814-3825.

Silber, K. R., K. C. Keiler and R. T. Sauer (1992). "Tsp: a tail-specific protease that selectively degrades proteins with nonpolar C termini." Proc Natl Acad Sci U S A 89(1): 295-299.

Silhavy, T. J., D. Kahne and S. Walker (2010). "The bacterial cell envelope." Cold Spring Harb Perspect Biol 2(5): a000414.

179 Singh, S. K., S. Parveen, L. SaiSree and M. Reddy (2015). "Regulated proteolysis of a cross- link-specific peptidoglycan hydrolase contributes to bacterial morphogenesis." Proceedings of the National Academy of Sciences of the United States of America 112(35): 10956-10961.

Singh, S. K., L. SaiSree, R. N. Amrutha and M. Reddy (2012). "Three redundant murein endopeptidases catalyse an essential cleavage step in peptidoglycan synthesis of Escherichia coli K12." Molecular microbiology 86(5): 1036-1051.

Srivastava, D., J. Seo, B. Rimal, S. J. Kim, S. Zhen and A. J. Darwin (2018). "A Proteolytic Complex Targets Multiple Cell Wall Hydrolases in Pseudomonas aeruginosa." mBio 9(4).

Storey, M. V., J. Winiecka-Krusnell, N. J. Ashbolt and T. A. Stenstrom (2004). "The efficacy of heat and chlorine treatment against thermotolerant Acanthamoebae and Legionellae." Scand J Infect Dis 36(9): 656-662.

Strauch, K. L. and J. Beckwith (1988). "An Escherichia coli mutation preventing degradation of abnormal periplasmic proteins." Proc Natl Acad Sci U S A 85(5): 1576-1580.

Strauch, K. L., K. Johnson and J. Beckwith (1989). "Characterization of degP, a gene required for proteolysis in the cell envelope and essential for growth of Escherichia coli at high temperature." J Bacteriol 171(5): 2689-2696.

Swanson, M. S. and B. K. Hammer (2000). "Legionella pneumophila pathogesesis: a fateful journey from amoebae to macrophages." Annu Rev Microbiol 54: 567-613.

Tanner, J. R., L. Li, S. P. Faucher and A. K. Brassinga (2016). "The CpxRA two-component system contributes to Legionella pneumophila virulence." Mol Microbiol 100(6): 1017-1038.

Taylor, M., K. Ross and R. Bentham (2009). "Legionella, protozoa, and biofilms: interactions within complex microbial systems." Microb Ecol 58(3): 538-547.

Tiaden, A., T. Spirig, P. Carranza, H. Bruggemann, K. Riedel, L. Eberl, C. Buchrieser and H. Hilbi (2008). "Synergistic contribution of the Legionella pneumophila lqs genes to pathogen-host interactions." J Bacteriol 190(22): 7532-7547.

Wadowsky, R. M., T. M. Wilson, N. J. Kapp, A. J. West, J. M. Kuchta, S. J. States, J. N. Dowling and R. B. Yee (1991). "Multiplication of Legionella spp. in tap water containing Hartmannella vermiformis." Appl Environ Microbiol 57(7): 1950-1955.

Waller, P. R. and R. T. Sauer (1996). "Characterization of degQ and degS, Escherichia coli genes encoding homologs of the DegP protease." J Bacteriol 178(4): 1146-1153.

Wang, C. Y., S. W. Wang, W. C. Huang, K. S. Kim, N. S. Chang, Y. H. Wang, M. H. Wu and C. H. Teng (2012). "Prc contributes to Escherichia coli evasion of classical complement-mediated serum killing." Infect Immun 80(10): 3399-3409.

Waxman, D. J. and J. L. Strominger (1983). "Penicillin-binding proteins and the mechanism of action of beta-lactam antibiotics." Annu Rev Biochem 52: 825-869.

180 Weissenmayer, B. A., J. G. Prendergast, A. J. Lohan and B. J. Loftus (2011). "Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs." PLoS One 6(3): e17570.

Whiley, H., R. Bentham and M. H. Brown (2017). "Legionella Persistence in Manufactured Water Systems: Pasteurization Potentially Selecting for Thermal Tolerance." Front Microbiol 8: 1330.

Wrase, R., H. Scott, R. Hilgenfeld and G. Hansen (2011). "The Legionella HtrA homologue DegQ is a self-compartmentizing protease that forms large 12-meric assemblies." Proc Natl Acad Sci U S A 108(26): 10490-10495.

181 Connecting Text Chapter 5

In some microorganisms, tail-specific proteases are important for infecting the hosts.

Since we have shown that Lp’s Tsp is important for infecting amoeba during a change of temperature, we wanted to find out if Tsp is also important for infecting macrophages, which are the main target of Lp during human infections. This manuscript therefore presents a study of the interaction of the tsp mutant strain with macrophages.

The manuscript will be submitted to the journal Infection and Immunity.

182 Chapter 5: The Tail-Specific Protease Tsp is Required for

Legionella pneumophila Intracellular Multiplication

Joseph Saoud1, Thangadurai Mani1, Petra Rohrbach2, and Sébastien P. Faucher1

1) Department of Natural Resource Sciences, McGill University, Sainte-Anne-de-Bellevue,

Québec, Canada

2) Institute of Parasitology, McGill University, Sainte-Anne-de-Bellevue, Québec, Canada

Correspondence and requests for materials should be addressed to Sébastien P. Faucher (email: [email protected])

183 5.1 Abstract

Legionella pneumophila (Lp) is a Gram-negative bacterium found in natural and man- made water systems. In humans, once inside the lungs, Lp replicates in alveolar macrophages and causes Legionnaires’ disease, a severe pneumonia. The Icm/Dot type IV secretion system

(T4SS) is a major virulence factor required for intracellular multiplication. The Icm/Dot system allows the secretion of effectors into the cytoplasm of the host cell. These effectors modify host cell vesicular trafficking and prevent maturation of the phagosome. The innate immune response is crucial in restricting Lp’s proliferation. TNF- is one of the major cytokines involved in this process as it renders macrophages more resistant to Lp infection and induces apoptosis of Lp- infected macrophages. Tail-specific proteases (Tsp) are involved in tolerating thermal stress and in virulence. We have previously characterized the Tsp encoded by Lp, showing that it is important for surviving thermal stress and for infection of amoeba when a temperature change occurs during infection. Here, we demonstrate that Tsp is required for intracellular multiplication in macrophages. Absence of tsp is associated with higher production of TNF- by macrophages in response to Lp infection and increased cell death. This effect is independent of the Icm/Dot secretion system.

Keywords: Legionella pneumophila; intracellular multiplication; TNF- ; tail-specific protease; bone-marrow derived macrophages

184 5.2 Introduction

Legionella pneumophila (Lp) is a Gram-negative bacterium ubiquitous in water systems, both natural and man-made, where it replicates within amoebas and protozoa (Wadowsky et al.

1991; Taylor et al. 2009; Mondino et al. 2020). Following exposure to Lp-contaminated water droplets, humans will develop a severe form of pneumonia called Legionnaires’ disease or a milder form of the disease similar to the flu known as Pontiac Fever (Mondino et al. 2020). This is due to the ability of Lp to infect and replicate within alveolar macrophages (Mondino et al.

2020). The Icm/Dot type IVb secretion system is one of the most important virulence factors of

Lp as a strain defective for the expression of the system is unable to replicate inside host cells

(Berger et al. 1994; Roy et al. 1998; Franco et al. 2009). This secretion system allows the translocation of over 330 effectors into the host cell in order to modify vesicle trafficking and prevent phagolysosome fusion (Ensminger 2016). The creation of a replicative niche within the host cell called the Legionella containing vacuole (LCV) allows Lp to replicate intracellularly before exiting the host cell in search of a new one (Ensminger 2016).

Tail-specific proteases (Tsp) are a family of serine proteases conserved amongst Gram- negative bacteria, and have been found in bacteria, archaea, eukaryotes, viruses, and organelles

(Bandara et al. 2005; Feldman et al. 2006; Rawlings et al. 2010; Hoge et al. 2011; Carroll et al.

2014; Rawlings et al. 2014). In Gram-negative bacteria, Tsps can be found in the cytoplasm and periplasm, and can even be secreted in the extracellular environment (Hoge et al. 2011). Tsp was first characterized in Escherichia coli as a protease targeting the penicillin-binding protein 3

(Hara et al. 1991).

Homologues of Tsp have been implicated in virulence in other pathogens. P. aeruginosa codes for two tail-specific proteases named Prc and CtpA (Hoge et al. 2011; Seo and Darwin

185 2013). Strains lacking Prc are associated with chronic lung infections (Reiling et al. 2005;

Sautter et al. 2012; Seo and Darwin 2013). CtpA is periplasmic and important for the function of the Type 3 secretion system, for cytotoxicity in cultured cells and for virulence in the animal model of acute pneumonia (Hoge et al. 2011; Seo and Darwin 2013). Staphylococcus aureus’

CtpA is important for virulence in THP-1 cultured macrophages and in a murine model (Carroll et al. 2014). CtpA of Borrelia burgdorferi modifies outer membrane proteins required for infection of host cells (Noppa et al. 2001; Kumru et al. 2011). Chlamydia trachomatis, an obligate intracellular bacterium, codes for two Tsps, CT441 and CPAF (CT858), both secreted inside the host cells and targeting host proteins implicated in the host’s immune response (Lad et al. 2007).

We have previously characterized a tail-specific protease encoded by the tsp gene in Lp

(Saoud et al. 2020). In the exponential phase (E phase), Tsp is likely negatively regulated by

Lpr17, a cis-encoded sRNA. Tsp is expressed in the post-exponential phase (PE phase) and during thermal stress, conditions in which Lpr17 is not expressed. Tsp is also positively regulated by CpxR, a major regulator in Legionella, and this regulation is independent of Lpr17.

The tsp mutant is unable to survive a heat treatment at 55 C. This protease is also important for replication inside the amoeba Vermamoeba vermiformis when the temperature during the infection is increased (Saoud et al. 2020). tsp is upregulated in the post-exponential phase and during infection of amoebas and macrophages (Bruggemann et al. 2006; Faucher et al. 2010).

This suggests that tsp could also have a role during infection of mammalian host cells.

Innate immunity is the first barrier microorganisms encounter once they are inside the host, and phagocytic cells, such as macrophages, play an important role in this early response of the host immune system (Amer 2010). Phagocytes are able to distinguish between host cells and

186 invading microorganisms via their pattern recognition receptors (PRR) which detect pathogen- associated molecular patterns (PAMPs) that are only expressed by the invading microorganisms

(Amer 2010). There are two types of PRRs, the Toll-like receptors (TLR) and the Nod-like receptors (NLR). TLRs detect molecules on the surface of cells or on the surface of vacuoles within the cell, such as the phagosome or lysosome (Akira et al. 2006). NLRs, on the other hand, detect substrates that are in the cytoplasm of the cell (Akira et al. 2006).

Innate immunity against Lp infection is characterized by the production of TNF-, IFN,

IL-1, IL-6, IL-8, and IL-12 with the purpose of regulating the immune system to limit Lp’s growth (Kragsbjerg et al. 1995; Tateda et al. 1998; Friedman et al. 2002). Various components of

Lp’s cell surface induce the production of cytokines. LPS will stimulate the production of TNF- by macrophages while the flagella and fimbriae will induce the production of TNF-, IL-1, and granulocyte-macrophage colony-stimulating factor (GM-CSF) (Friedman et al. 2002). TNF- is particularly important as it increases the ability of macrophages to kill intracellular bacteria as well as protecting cells from infections by intracellular pathogens (Friedman et al. 2002).

Different cells of the immune system, including macrophages and neutrophils, are able to secrete TNF- during an infection, and its role is especially important when dealing with intracellular pathogens such as Lp (Skerrett et al. 1997; Lacy and Stow 2011). TNF- is important to prevent Lp proliferation and infection in vitro and in vivo, and the absence of TNF-

 in response to Lp infection can be lethal to mice (Brieland et al. 1994; Skerrett and Martin

1996; Fujita et al. 2008; Ziltener et al. 2016; Kawamoto et al. 2017). TNF- will inhibit Lp growth within macrophages as well as induce cell death of Lp-infected macrophages (Kawamoto et al. 2017). Cell death in Lp-infected macrophages can occur through apoptosis and pyroptosis

(Kawamoto et al. 2017). Macrophages and alveolar epithelial cells start undergoing apoptosis a

187 few hours post-infection, before Lp starts replicating (Gao and Kwaik 1999). However, macrophage apoptosis is delayed by Lp effectors until the late stages of infection and the infected host cell is resistant to apoptosis induced by extracellular molecules (Amer 2010). TNF- also acts on neutrophils and macrophages to increase phagocytosis and oxidative burst (Friedman et al. 2002; Robinson et al. 2019; Virag et al. 2019).

Most mice are restrictive to Legionella infection. Only one strain of mice, the A/J strain, is permissive to Lp infection (Brown et al. 2013). When infected intratracheally the A/J mice develop an acute pneumonia similar to humans within 48 hours post-infection (Brieland et al.

1994). Macrophages derived from the A/J strain are permissive to Lp replication (Yamamoto et al. 1988). In contrast, the C57BL/6 and BALB/c mice are resistant to the infection and their macrophages are resistant to intracellular growth by Lp (Yoshida and Mizuguchi 1986;

Yamamoto et al. 1988). The difference is caused by the lgn1 locus (Yoshida et al. 1991; Beckers et al. 1995; Dietrich et al. 1995). This locus codes for the neuronal apoptosis-inhibitory protein 5

(NAIP5), also known as baculoviral inhibitor of apoptosis repeat-containing 1e (Birc1e), a member of the nucleotide-binding and oligomerization domain (NOD)-like receptor (NLR) family of immune receptors (Diez et al. 2000; Diez et al. 2003; Wright et al. 2003; Lamkanfi and

Dixit 2009; Newton et al. 2010; Brown et al. 2013). NAIP5 recognizes intracellular bacterial flagellin in the cytosol, leading to the activation of the inflammasome and caspase-1 in order to limit the extent of the infection (Lamkanfi and Dixit 2009; Brown et al. 2013; Liu and Shin

2019). Once activated, caspase-1 will cleave the pro-interleukins IL-1 and IL-18 to produce active form of the interleukins that will initiate pyroptosis, a form of proinflammatory cell death

(Brown et al. 2013). Fourteen polymorphisms in the NAIP5 gene prevent A/J mice from detecting intracellular flagellin, allowing Lp to grow intracellularly (Diez et al. 2003; Wright et

188 al. 2003; Lamkanfi and Dixit 2009; Newton et al. 2010). Consistently, a flagellin-deficient Lp mutant is able to replicate in the resistant C57BL/6 mice strain as well as the WT in A/J mice

(Molofsky et al. 2006; Ren et al. 2006).

In this paper, we have investigated the role of Tsp in the infection of macrophages. We found that Tsp is important for infection of cultured cell-line macrophages as well as primary macrophages. Macrophages exhibited a higher degree of cell death when infected with the tsp mutant, which seems to be linked with a higher production of TNF-alpha by macrophages in response to infection by the tsp mutant.

5.3 Material and Methods

5.3.1 Bacterial Strains

Strains used are presented in Table 1. The Lp strain JR32 is a salt-sensitive, streptomycin resistant, restriction negative mutant of Lp strain Philadelphia-1 (Sadosky et al. 1993). The KS79 is a comR mutant of JR32 that is constitutively competent (de Felipe et al. 2008). The Lp strains were grown on CYE agar (ACES-buffered charcoal yeast extract) supplemented with 0.25 mg/ml of L-cysteine and 0.4 mg/ml of ferric pyrophosphate (Feeley et al. 1979). AYE broth was used to grow liquid cultures. It consists of the same component as CYE except for charcoal and agar. If required, the media was supplemented with 5 g/ml of chloramphenicol or 25 g/ml of kanamycin (Feeley et al. 1979).

189 Table 1: Strains used in this study

Strain Name Relevant Genotype Source or Reference

Legionella pneumophila Philadelphia-1

JR32 Philadelphia-1 derivative; SmR; r-; m+ (Sadosky et al.

1993)

KS79 JR32 comR (de Felipe et al.

2008)

dotA- JR32 dotA::Tn903dIIlacZ (Sadosky et al.

1993)

tsp (SPF365) KS79 tsp::Km; KmR (Saoud et al. 2020)

tsp + ptsp (SPF403) tsp + pXDC39-tsp; KmR, CmR (Saoud et al. 2020)

WT pTEM-ralF KS79 + pTEM-ralF (Charpentier et al.

(SPF49) 2009)

WT pTEM-lepA KS79 + pTEM-lepA (Charpentier et al.

(SPF50) 2009)

WT pTEM-fabI KS79 + pTEM-fabI (Charpentier et al.

(SPF48) 2009)

dotA- pTEM-ralF dotA- + pTEM-ralF (Charpentier et al.

(SPF56) 2009)

dotA- pTEM-lepA dotA- + pTEM-lepA (Charpentier et al.

(SPF57) 2009)

190 dotA- pTEM-fabI dotA- + pTEM-fabI (Charpentier et al.

(SPF55) 2009)

tsp pTEM-ralF tsp + pTEM-ralF This study

(SPF386)

tsp pTEM-lepA tsp + pTEM-lepA This study

(SPF387)

tsp pTEM-fabI tsp + pTEM-fabI This study

(SPF385)

Plasmids

pMMB207c RSF1010 derivative; IncQ, lacIq, CmR, Ptac, (Chen et al. 2004)

oriT, mobA

pXDC39 pMMB207c Ptac, lacIq, CmR Xavier Charpentier

ptsp (pSF113) pXDC39-tsp (Saoud et al. 2020)

pXDC61 pMMB207c blaM (de Felipe et al.

2008)

pTEM-ralF pXDC61-TEM-ralF (Charpentier et al.

2009)

pTEM-lepA pXDC61-TEM-lepA (Charpentier et al.

2009)

pTEM-fabI pXDC61-TEM-fabI (Charpentier et al.

2009)

191 5.3.2 THP-1 Culture

THP-1 cells were cultured in 75 cm2 cell culture flasks (Sarstedt) in Advanced RPMI

1640 medium (Thermofisher Scientific) supplemented with 2 mM of L-glutamine (Life

Technologies) and incubated at 37 C in a modified atmosphere containing 5 % CO2. Three days before infection, the cells were centrifuged at 200 g for 10 minutes and resuspended at a concentration of 5*105 cells/ml in 37 C Advanced RPMI 1640 medium supplemented with 2 mM of L-glutamine and 100 ng of phorbol 12-myristate-13-acetate (PMA) (Thermofisher

Scientific). A 24-well plate (Sarstedt) was seeded with 1 ml of cells and incubated at 37 C in a modified atmosphere of 5 % CO2. 1 hour prior to infection, the media was replaced with fresh 37

C RPMI containing 2 mM of L-glutamine. The infection was carried out at 37 C in an atmosphere containing 5 % CO2.

5.3.3 Ethics Statement

This study was performed in accordance with the strict guidelines of the Canadian

Council on Animal Care. The protocols were approved by the ethics committee of McGill

University (protocol 7712).

5.3.4 Bone-Marrow Derived Macrophages Isolation

Bone-marrow derived macrophages were isolated as previously described (Fortier et al.

2011). A/J mice were purchased from Jackson Laboratory. Standard operating procedures were used for animal husbandry and breeding. Mice were euthanized using carbon dioxide inhalation followed by cervical dislocation. Every effort was made to minimize animal suffering. The femur was harvested from mice and flushed with ice-cold DMEM (Life Technologies)

192 supplemented with 100 U/ml of penicillin (GE Healthcare Life Sciences) and 100 g/ml of streptomycin (GE Healthcare Life Sciences). Cells were collected by centrifugation at 200 g for

10 minutes and resuspended in pre-warmed DMEM (Life Technologies) supplemented with 10

% FBS (Life Technologies), 20 % LCCM (L-cell conditioned media) (Fortier et al. 2011), 100

U/ml of penicillin (GE Healthcare Life Sciences) and 100 g/ml of streptomycin (GE Healthcare

Life Sciences). Cells were placed in 150 mm Petri dishes at a concentration of 1 x 107 cells/Petri dish and incubated at 37 C in a modified atmosphere containing 5 % CO2. Four days after harvesting cells from femur, 2.5 ml of LCCM was added to each Petri dish and incubated further.

Three days later, each Petri dish was washed once with 10 ml of 37 C PBS. 10 ml of 37 C PBS supplemented with 0.6 % citrate was added and the cells were incubated at 37 C and 5 % CO2 for 5 minutes. Cells were transferred to a 50 ml conical flask (VWR), centrifuged at 200 g for 10 minutes, resuspended in 37 C DMEM + 10 % FBS at a concentration of 1 x 106 cells/ml, seeded in a 24-well plate at a concentration of 1 x 106 cells/ml, and incubated at 37 C in a modified atmosphere containing 5 % CO2 for 1 day. 1 hour prior to any of these experiments, the media was replaced with 37 C DMEM + 10 % FBS. Infection was carried at 37 C in a modified atmosphere containing 5 % CO2.

5.3.5 Infections

The bacterial strains were grown on CYE agar for 3 days at 37 C. The day of the infection, the strains were suspended in Fraquil, an artificial freshwater medium, (Morel et al.

1975; Mendis et al. 2015) at an OD600 of 0.1 and then diluted 1:10 in Fraquil. The infection was done at a multiplicity of infection (MOI) of 0.1 in triplicate. CFU counts were performed on a daily basis on CYE agar.

193 5.3.6 MTT Viability Assay

For the viability assay, 200 l of macrophages at a concentration of 5 x 105 cells/ml in

DMEM + 10 % FBS were seeded in a 96-well plate (Sarstedt) and incubated at 37 C in a modified atmosphere containing 5 % CO2 for 1 day. 1 hour prior to the assay, the media was replaced with 190 l of fresh DMEM + 10 % FBS and incubated at 37 C with 5 % CO2. The bacterial strains were grown on CYE agar at 37 C for 3 days. On the day of the assay, the bacteria were suspended in Fraquil at an OD600 of 1. The cells were infected at a MOI of 1 and

100, in a final volume of 10 l. The plate was incubated at 37 C and 5 % CO2 for 3 days after which 20 l of MTT (Sigma-Aldrich) at a concentration of 5 mg/ml was added to each well and further incubated at 37 C and 5 % CO2 for 4 hours. The supernatant was removed and 100 l of acidified isopropanol, composed of 100 % isopropanol (ThermoFisher Scientific) containing 40 mM HCl (ThermoFisher Scientific), was added to each well followed by 20 l of 10 % SDS (MP

Biomedicals). The optical density at 570 nm was read using a Tecan microplate reader.

5.3.7 Sodium-Sensitivity

The bacterial strains were grown on CYE for 3 days at 37 C. The bacterial strains were inoculated in AYE broth with antibiotics when necessary and grown at 37 C with shaking at

250 RPM until they reached PE phase (OD600 > 3). A serial dilution of the strains in a 96-well plate (Sarstedt) was done before plating on CYE plates with and without 100 mM of NaCl. CFUs were counted after the plates were incubated at 37 C for 3 days.

194 5.3.8 ELISA

One day before infection, the bacterial strains were inoculated in AYE, containing antibiotics if required, and incubated at 37 C with shaking at 250 RPM for 24 hours. The cells were washed 3 times in an equal volume of Fraquil and the OD600 of the strains was adjusted to

1.0. Bone-marrow derived macrophages seeded in a 24-well plate as described above, the media was changed one hour prior to the infection, and the macrophages were infected at a MOI of 10 and the plate was incubated at 37 C in a modified atmosphere containing 5 % CO2. 100 l of supernatant was taken at 4 hours and 24 hours post-infection for the ELISA assay, which was performed according to the manufacturer’s protocol (Thermofisher Scientific).

5.4 Results

5.4.1 Tsp is Important for Intracellular Multiplication in Macrophages

The ability of the tsp mutant to grow intracellularly in macrophages was investigated

(Figure 1). First, the ability of the mutant to grow within cultured THP-1 human monocyte derived macrophages was examined (Figure 1A). The CFU count of the tsp mutant decreases over time in contrast to the WT and complemented strain, whose CFU counts increase by approximately 100-fold. Immortalized macrophage cell lines, such as THP-1, are more permissive to infection due to an aberrant regulation of signaling pathways (Andreu et al. 2017;

Madhvi et al. 2019). Therefore, intracellular growth was tested in primary macrophages derived from the bone-marrow of mice from the A/J background (Figure 1B). The tsp mutant was unable to replicate inside the permissive A/J macrophages, similar to what was observed with THP-1.

195 Within 5 days, the WT strain grew by 100 fold, while the tsp mutant decreased by almost 100 fold.

Figure 1: Tsp is important for intracellular multiplication in macrophages. Infection of the

THP-1 human monocyte cell line (A) and bone-marrow derived macrophages (BMDM) isolated from A/J backgrounds (B) were carried out at 37 C. The host cells were infected at a MOI of 0.1 with the WT, tsp mutant (tsp), the complemented strain (tsp + ptsp), and dotA-, which is used as a negative control. Data shown represent the average of six replicates with standard deviation.

A two-way ANOVA was used to calculate statistical significance. **** P-value < 0.0001.

5.4.2 Macrophages Viability is Reduced Following Infection by the tsp Mutant

Given that the tsp mutant was unable to replicate inside macrophages, the viability of A/J derived macrophages following infection was assessed (Figure 2). The colorimetric MTT viability assay was used to assess the viability of macrophages 72 hours post infection at a MOI of 1 and 100. The viability of macrophages infected by the tsp mutant was significantly lower than macrophage infected by the WT at a MOI of 1 (Figure 2A). This difference in viability was more pronounced at a MOI of 100 (Figure 2B). At both MOI, this phenotype was rescued by complementation in trans.

196

Figure 2: Primary macrophages infected with the tsp mutant shows reduced viability compared to macrophage infected by the wild-type. An MTT viability assay was performed to assess the viability of A/J bone-marrow derived macrophages in response to Lp infection at a

MOI of 1 (A) and 100 (B). The cells were infected with the WT, the tsp mutant (tsp), and the complemented strain (tsp + ptsp). dotA- was used as a negative control. The viability was assessed by measuring OD at 570 nm. Data shown represent triplicates with standard deviation.

An ordinary one-way ANOVA was used to calculate statistical significance. *: P-value < 0.05;

****: P-value < 0.0001.

5.4.3 Infection of Macrophages with the tsp Mutant Induces an Increased Production

of TNF-

TNF- is one of the main cytokines produced by macrophages in response to Legionella infection (Skerrett and Martin 1996; Ziltener et al. 2016; Kawamoto et al. 2017). TNF- is

197 instrumental in inhibiting Lp growth within macrophages and inducing programmed cell death of macrophages infected with Lp (Kawamoto et al. 2017). Therefore, the production of TNF- in response to infection by the tsp mutant was investigated (Figure 3). As expected, not infected cells produce almost no TNF-, whereas cells infected by the dotA- strain, unable to control the response of the cells, produce excessive amounts. A/J derived macrophages produced significantly more TNF- in response to infection by the tsp mutant compared to the WT at 4 hours (Figure 3A). This difference was even more pronounced after 24 hours of infection (Figure

3B). In this case, macrophages infected by the wild type produced on average 39.7 pg/ml after 4 hours and 113.0 pg/ml after 24 hours. In contrast, when infected by the tsp mutant, they produced on average 102.8 pg/ml after 4 hours and 346.3 pg/ml after 24 hours. The amount of

TNF-alpha produced when infected with the complemented strain (tsp + ptsp) was similar to the WT.

198

Figure 3: Infection of macrophages with the tsp mutant induces an increased production of

TNF-. A murine TNF- ELISA assay was used to determine the amount of TNF-alpha produced in A/J bone-marrow derived macrophages 4 hours (A) and 24 hours (B) post-infection.

The cells were infected at a MOI of 10 with the WT, the tsp mutant (tsp), the complemented strain (tsp + ptsp), and the dotA- mutant. Uninfected cells (cells only) were used as negative control. The data shown represent the average of three replicates with standard deviation. An ordinary one-way ANOVA was used to calculate statistical significance. *: P-value < 0.05

5.4.4 The tsp Mutant is Competent for Icm/Dot Translocation

To determine if the defect in intracellular multiplication and the increased amount of

TNF-alpha produced by macrophages is caused by a defect in the Icm/Dot T4SS, we performed a sodium-sensitivity assay (Figure 4A). Legionella with a functional T4SS in the transmissive and

PE phase is sodium-sensitive (Vogel et al. 1996; Byrne and Swanson 1998). The WT and tsp mutant grown to PE phase showed a similar sensitivity to sodium when grown on CYE

199 containing 100 mM of NaCl. To further confirm the Icm/Dot system is functional, a translocation assay was performed (Figure 4B). RalF and LepA are two translocated effectors , while FabI, a fatty-acid biosynthetic enzyme, is not translocated (Charpentier et al. 2009). Both RalF and

LepA were translocated by the WT and the tsp mutant, indicating that the Icm/Dot system was functional. The dotA- mutant, which has a defective Icm/Dot system, was unable to translocate

RalF and LepA.

Figure 4: The Icm/Dot T4SS is functional in the tsp mutant. A) The sensitivity to sodium of the WT, the tsp mutant (tsp), the complemented strain (tsp + ptsp), and the dotA- mutant was assessed. The strains were cultured in AYE until they reached PE phase. Following serial dilutions, the strains were plated on CYE and CYE containing 100 mM of NaCl. B) To determine if the tsp mutant had a defective Icm/Dot T4SS, a translocation assay was performed.

The effectors are fused with a TEM-1 -lactamase and cloned on a plasmid. Following infection, the fluorescent -lactamase substrate CCF2(4)-AM is added. If the effector is translocated, the - lactam ring of CCF2(4)-AM is cleaved, and blue fluorescence (460 nm) is emitted. If the effector is not translocated, green fluorescence (530 nm) is emitted. Following excitation at 405 nm, emission at 460 nm and 530 nm is measured, and the ratio 460/530 is calculated. The translocation of RalF and LepA, known translocated effectors, was assessed in the WT, the tsp

200 mutant, and the dotA- mutant which served as a negative control. The FabI protein was used as negative control as it is not translocated by the Icm/Dot system. Data shown represents the average and standard deviation of three replicates.

5.5 Discussion

In this study, we showed that the Tsp protease is necessary for Lp to replicate within immortalized (Figure 1A) and primary macrophages (Figure 1B). This is consistent with what has been observed in other pathogens, such as E. coli, S. aureus, Brucella suis, Burkholderia mallei, Borrelia burgdorferi, and Salmonella (Baumler et al. 1994; Noppa et al. 2001; Bandara et al. 2005; Bandara et al. 2008; Kumru et al. 2011; Wang et al. 2012; Carroll et al. 2014). In the case of Lp, the tsp mutant shows low level of intracellular growth at earlier time points.

Typically, during Lp infection of host cells, a decrease in CFU count on day 1 resulting from the entry of Lp in the host cell is observed. Only the bacteria released in the supernatant is measured, and therefore we do not detect bacteria once they enter the host cell. This is followed by an increase in the CFU count on day 2 as the bacteria are released back into the medium. This suggests that the tsp mutant is not defective for entry in the host cell, but it is unable to replicate within the macrophages and some are released back into the media. The increase seen on day 2 is much more pronounced during the infection of THP-1 macrophages (Figure 1A) compared to the bone-marrow derived macrophages (Figure 1B). This is probably due to primary macrophages being more restrictive to intracellular growth compared to immortalized macrophages (Andreu et al. 2017; Madhvi et al. 2019). The results obtained from the MTT viability assay (Figure 2), which show that fewer macrophages are alive following infection with the tsp mutant, is consistent with the idea the tsp mutant is released back into the media. Lp is released from

201 macrophages following apoptosis, and these results support the notion that the tsp mutant is released into the supernatant following apoptosis (Eisenreich and Heuner 2016).

The decreased viability of macrophages observed using the MTT viability assay combined with the inability of the tsp mutant to replicate suggests that the tsp mutant is unable to prevent macrophages from undergoing apoptosis during the early stages of infection. Apoptosis is crucial for limiting Legionella proliferation (Liu and Shin 2019). Apoptosis is induced within a few hours of infection, but Lp is able to block apoptosis until the late stages of infection, when it is ready to exit the host cell (Ge et al. 2009; Losick et al. 2010; Fontana et al. 2011; Gan et al.

2018). Macrophage death when infected with the tsp mutant is much higher at a MOI of 100

(Figure 2B) compared to a MOI of 1 (Figure 2A), which is due to the higher starting inoculum.

As more macrophages are infected, there are more that have undergone apoptosis. In contrast, the difference in viability at the different MOIs when macrophages are infected with the WT is not strikingly different.

The increase in production of TNF- by macrophages in response to the tsp mutant 4 hours (Figure 3A) and 24 hours (Figure 3B) post-infection is consistent with the higher cell death observed. The higher concentration of TNF- in response to infection by the tsp mutant is likely to trigger apoptosis by macrophages, since TNF- is required to limit Lp infection by inducing cell death. Lp tracheal infection of A/J mice results in a 10-fold increase of the bacterial load within two days, and an IFN and TNF- dependent immune response helps clear the infection by day 7 post-infection (Brieland et al. 1994; Brieland et al. 1995). Treating Lp-infected cells with TNF- leads to a decrease in Lp CFU counts in a TNF- dose-dependent manner

(Kawamoto et al. 2017). In parallel, cell death by apoptosis of Lp-infected macrophages increases when the Lp-infected host cells are treated with TNF- (Kawamoto et al. 2017). This is

202 due to an increase in the amount of activated caspase-3/7 (Kawamoto et al. 2017). It is possible the cell death observed here is related to activation of caspase-3/7. Further investigation is needed to confirm the mechanism involved.

Since the Icm/Dot system is necessary for intracellular multiplication, we first hypothesize that this system is somewhat affected by deletion of Tsp. However, we confirmed that the Icm/Dot T4SS secretion system translocation of effectors is not affected by deletion of tsp (Figure 4). Alternatively, Tsp could be a substrate of the Icm/Dot system; however, Tsp seems to have an N-terminal peptide signal for translocation to the periplasm (Saoud et al. 2020), suggesting that it is unlikely that Tsp is translocated using the Icm/Dot system. Tsps are usually periplasmic proteases (Hoge et al. 2011). Bioinformatics search identified a N-terminal signal peptide in Lp’s Tsp, suggesting it is translocated to the periplasm. However, C. trachomatis encodes two tail-specific proteases that alter the host immune response, CPAF and CT441 (Lad et al. 2007). CPAF was confirmed to be translocated to the periplasm using a Sec transport system and then transported from the periplasm to the host cell via a type II secretion system

(T2SS) (Snavely et al. 2014). CPAF degrades transcription factors required for the expression of the major histocompatibility complex (Lad et al. 2007). CT441 degrades p65, a major regulator of the NF-B involved in apoptosis (Lad et al. 2007). Legionella codes for a T2SS important for virulence (Hales and Shuman 1999; Buck et al. 2004; Rossier et al. 2004; Buck et al. 2005;

Rossier and Cianciotto 2005). It is therefore possible that Tsp is a substrate of T2SS and modifies host proteins involved in regulating apoptosis. Future experiments could look into the transport of Tsp in a strain lacking the T2SS.

On the other hand, it is possible that Tsp is necessary to maintain outer membrane integrity and normal function. Gram-negative bacteria secrete OMVs that allow the transport of

203 virulence factors such as toxins, enzymes, and LPS (Jung et al. 2016). OMVs secreted by Lp induces the secretion of various pro-inflammatory molecules, including TNF- and IL-1, by macrophages (Jung et al. 2016). Pre-treatment of macrophages with OMVs inhibits the expression of TNF-, IL-1, and IL-6 by macrophages, rendering them more permissive to Lp infection (Jung et al. 2016). We had previously shown that Tsp is important for dealing with thermal stress (Saoud et al. 2020). This seems to be in contradiction with the hypothesis that Tsp is a T2SS effector. It is possible that Tsp modifies properties of OMVs, such as their protein content. In the absence of Tsp, these proteins are not transported to the host cell and Lp is unable to inhibit the immune response. This hypothesis will be tested in a follow-up study.

In conclusion, we have demonstrated that tsp is required for intracellular multiplication in macrophages. Tsp allows Lp’s replication by directly or indirectly limiting the amount of TNF- produced by macrophages in response to Lp infection and consequently prevent macrophages from undergoing apoptosis prior to Lp’s replication. The inability of the tsp mutant to replicate within macrophages is independent of the Icm/Dot T4SS.

5.6 Acknowledgments

The pXDC39 plasmid is a kind gift from Dr Xavier Charpentier. This study was supported by CIHR Open Operating Grant to SPF and PR. JS was supported by a FRQNT

Doctoral scholarship and a CRIPA scholarship supported by the Fonds de recherche du Québec -

Nature et technologies n°RS-170946.

204 5.7 References

Akira, S., S. Uematsu and O. Takeuchi (2006). "Pathogen recognition and innate immunity." Cell 124(4): 783-801.

Amer, A. O. (2010). "Modulation of caspases and their non-apoptotic functions by Legionella pneumophila." Cell Microbiol 12(2): 140-147.

Andreu, N., J. Phelan, P. F. d. Sessions, J. M. Cliff, T. G. Clark and M. L. Hibberd (2017). "Primary macrophages and J774 cells respond differently to infection with Mycobacterium tuberculosis." Scientific reports 7(1): 42225.

Bandara, A. B., D. DeShazer, T. J. Inzana, N. Sriranganathan, G. G. Schurig and S. M. Boyle (2008). "A disruption of ctpA encoding carboxy-terminal protease attenuates Burkholderia mallei and induces partial protection in CD1 mice." Microb Pathog 45(3): 207-216.

Bandara, A. B., N. Sriranganathan, G. G. Schurig and S. M. Boyle (2005). "Carboxyl-terminal protease regulates Brucella suis morphology in culture and persistence in macrophages and mice." J Bacteriol 187(16): 5767-5775.

Baumler, A. J., J. G. Kusters, I. Stojiljkovic and F. Heffron (1994). "Salmonella typhimurium loci involved in survival within macrophages." Infect Immun 62(5): 1623-1630.

Beckers, M. C., S. i. Yoshida, K. Morgan, E. Skamene and P. Gros (1995). "Natural resistance to infection with Legionella pneumophila: chromosomal localization of the Lgn1 susceptibility gene." Mammalian Genome 6(8): 540-545.

Berger, K. H., J. J. Merriam and R. R. Isberg (1994). "Altered intracellular targeting properties associated with mutations in the Legionella pneumophila dotA gene." Molecular Microbiology 14(4): 809-822.

Brieland, J., P. Freeman, R. Kunkel, C. Chrisp, M. Hurley, J. Fantone and C. Engleberg (1994). "Replicative Legionella pneumophila lung infection in intratracheally inoculated A/J mice. A murine model of human Legionnaires' disease." Am J Pathol 145(6): 1537-1546.

Brieland, J. K., D. G. Remick, P. T. Freeman, M. C. Hurley, J. C. Fantone and N. C. Engleberg (1995). "In vivo regulation of replicative Legionella pneumophila lung infection by endogenous tumor necrosis factor alpha and nitric oxide." Infect Immun 63(9): 3253-3258.

Brown, A. S., I. R. van Driel and E. L. Hartland (2013). "Mouse models of Legionnaires' disease." Curr Top Microbiol Immunol 376: 271-291.

Bruggemann, H., A. Hagman, M. Jules, O. Sismeiro, M. A. Dillies, C. Gouyette, F. Kunst, M. Steinert, K. Heuner, J. Y. Coppee and C. Buchrieser (2006). "Virulence strategies for infecting phagocytes deduced from the in vivo transcriptional program of Legionella pneumophila." Cell Microbiol 8(8): 1228-1240.

205 Buck, E. D., I. Lebeau, L. Maes, N. Geukens, E. Meyen, L. V. Mellaert, J. Anné and E. Lammertyn (2004). "A putative twin-arginine translocation pathway in Legionella pneumophila." Biochemical and Biophysical Research Communications 317(2): 654-661.

Buck, E. D., L. Maes, E. Meyen, L. V. Mellaert, N. Geukens, J. Anné and E. Lammertyn (2005). "Legionella pneumophila Philadelphia-1 tatB and tatC affect intracellular replication and biofilm formation." Biochemical and Biophysical Research Communications 331(4): 1413-1420.

Byrne, B. and M. S. Swanson (1998). "Expression of Legionella pneumophila virulence traits in response to growth conditions." Infect Immun 66(7): 3029-3034.

Carroll, R. K., F. E. Rivera, C. K. Cavaco, G. M. Johnson, D. Martin and L. N. Shaw (2014). "The lone S41 family C-terminal processing protease in Staphylococcus aureus is localized to the cell wall and contributes to virulence." Microbiology 160(Pt 8): 1737-1748.

Charpentier, X., J. E. Gabay, M. Reyes, J. W. Zhu, A. Weiss and H. A. Shuman (2009). "Chemical genetics reveals bacterial and host cell functions critical for type IV effector translocation by Legionella pneumophila." PLoS Pathog 5(7): e1000501.

Chen, J., K. S. de Felipe, M. Clarke, H. Lu, O. R. Anderson, G. Segal and H. A. Shuman (2004). "Legionella Effectors That Promote Nonlytic Release from Protozoa." Science 303(5662): 1358- 1361. de Felipe, K. S., R. T. Glover, X. Charpentier, O. R. Anderson, M. Reyes, C. D. Pericone and H. A. Shuman (2008). "Legionella eukaryotic-like type IV substrates interfere with organelle trafficking." PLoS Pathog 4(8): e1000117.

Dietrich, W. F., D. M. Damron, R. R. Isberg, E. S. Lander and M. S. Swanson (1995). "Lgn1, a gene that determines susceptibility to Legionella pneumophila, maps to mouse chromosome 13." Genomics 26(3): 443-450.

Diez, E., S. H. Lee, S. Gauthier, Z. Yaraghi, M. Tremblay, S. Vidal and P. Gros (2003). "Birc1e is the gene within the Lgn1 locus associated with resistance to Legionella pneumophila." Nat Genet 33(1): 55-60.

Diez, E., Z. Yaraghi, A. MacKenzie and P. Gros (2000). "The Neuronal Apoptosis Inhibitory Protein (Naip) Is Expressed in Macrophages and Is Modulated After Phagocytosis and During Intracellular Infection with Legionella pneumophila." The Journal of Immunology 164(3): 1470- 1477.

Eisenreich, W. and K. Heuner (2016). "The life stage-specific pathometabolism of Legionella pneumophila." FEBS Lett 590(21): 3868-3886.

Ensminger, A. W. (2016). "Legionella pneumophila, armed to the hilt: justifying the largest arsenal of effectors in the bacterial world." Curr Opin Microbiol 29: 74-80.

206 Faucher, S. P., G. Friedlander, J. Livny, H. Margalit and H. A. Shuman (2010). "Legionella pneumophila 6S RNA optimizes intracellular multiplication." Proc Natl Acad Sci U S A 107(16): 7533-7538.

Feeley, J. C., R. J. Gibson, G. W. Gorman, N. C. Langford, J. K. Rasheed, D. C. Mackel and W. B. Baine (1979). "Charcoal-yeast extract agar: primary isolation medium for Legionella pneumophila." J Clin Microbiol 10(4): 437-441.

Feldman, A. R., J. Lee, B. Delmas and M. Paetzel (2006). "Crystal structure of a novel viral protease with a serine/lysine catalytic dyad mechanism." J Mol Biol 358(5): 1378-1389.

Fontana, M. F., S. Banga, K. C. Barry, X. Shen, Y. Tan, Z.-Q. Luo and R. E. Vance (2011). "Secreted bacterial effectors that inhibit host protein synthesis are critical for induction of the innate immune response to virulent Legionella pneumophila." PLoS pathogens 7(2): e1001289.

Fortier, A., S. P. Faucher, K. Diallo and P. Gros (2011). "Global cellular changes induced by Legionella pneumophila infection of bone marrow-derived macrophages." Immunobiology 216(12): 1274-1285.

Franco, I. S., H. A. Shuman and X. Charpentier (2009). "The perplexing functions and surprising origins of Legionella pneumophila type IV secretion effectors." Cell Microbiol 11(10): 1435- 1443.

Friedman, H., Y. Yamamoto and T. W. Klein (2002). "Legionella pneumophila pathogenesis and immunity." Seminars in Pediatric Infectious Diseases 13(4): 273-279.

Fujita, M., S. Ikegame, E. Harada, H. Ouchi, I. Inoshima, K. Watanabe, S. Yoshida and Y. Nakanishi (2008). "TNF receptor 1 and 2 contribute in different ways to resistance to Legionella pneumophila-induced mortality in mice." Cytokine 44(2): 298-303.

Gan, N., E. S. Nakayasu, P. J. Hollenbeck and Z.-Q. Luo (2018). "Legionella pneumophila inhibits immune signalling via MavC-mediated transglutaminase-induced ubiquitination of UBE2N." Nature microbiology 4(1): 134-143.

Gao, L.-Y. and Y. A. Kwaik (1999). "Apoptosis in Macrophages and Alveolar Epithelial Cells during Early Stages of Infection by Legionella pneumophila and Its Role in Cytopathogenicity." Infection and Immunity 67(2): 862-870.

Ge, J., H. Xu, T. Li, Y. Zhou, Z. Zhang, S. Li, L. Liu and F. Shao (2009). "A Legionella type IV effector activates the NF-kappaB pathway by phosphorylating the IkappaB family of inhibitors." Proceedings of the National Academy of Sciences of the United States of America 106(33): 13725-13730.

Hales, L. M. and H. A. Shuman (1999). "The Legionella pneumophila rpoS gene is required for growth within Acanthamoeba castellanii." J Bacteriol 181(16): 4879-4889.

207 Hara, H., Y. Yamamoto, A. Higashitani, H. Suzuki and Y. Nishimura (1991). "Cloning, mapping, and characterization of the Escherichia coli prc gene, which is involved in C-terminal processing of penicillin-binding protein 3." J Bacteriol 173(15): 4799-4813.

Hoge, R., M. Laschinski, K. E. Jaeger, S. Wilhelm and F. Rosenau (2011). "The subcellular localization of a C-terminal processing protease in Pseudomonas aeruginosa." FEMS Microbiol Lett 316(1): 23-30.

Jung, A. L., C. Stoiber, C. E. Herkt, C. Schulz, W. Bertrams and B. Schmeck (2016). "Legionella pneumophila-Derived Outer Membrane Vesicles Promote Bacterial Replication in Macrophages." PLOS Pathogens 12(4): e1005592.

Kawamoto, Y., Y. Morinaga, Y. Kimura, N. Kaku, K. Kosai, N. Uno, H. Hasegawa and K. Yanagihara (2017). "TNF-α inhibits the growth of Legionella pneumophila in airway epithelial cells by inducing apoptosis." Journal of Infection and Chemotherapy 23(1): 51-55.

Kragsbjerg, P., I. Jones, T. Vikerfors and H. Holmberg (1995). "Diagnostic value of blood cytokine concentrations in acute pneumonia." Thorax 50(12): 1253.

Kumru, O. S., I. Bunikis, I. Sorokina, S. Bergstrom and W. R. Zuckert (2011). "Specificity and role of the Borrelia burgdorferi CtpA protease in outer membrane protein processing." J Bacteriol 193(20): 5759-5765.

Lacy, P. and J. L. Stow (2011). "Cytokine release from innate immune cells: association with diverse membrane trafficking pathways." Blood 118(1): 9-18.

Lad, S. P., G. Yang, D. A. Scott, G. Wang, P. Nair, J. Mathison, V. S. Reddy and E. Li (2007). "Chlamydial CT441 is a PDZ domain-containing tail-specific protease that interferes with the NF-kappaB pathway of immune response." J Bacteriol 189(18): 6619-6625.

Lamkanfi, M. and V. M. Dixit (2009). "Inflammasomes: guardians of cytosolic sanctity." Immunol Rev 227(1): 95-105.

Liu, X. and S. Shin (2019). "Viewing Legionella pneumophila pathogenesis through an immunological lens." Journal of Molecular Biology 431(21): 4321-4344.

Losick, V. P., E. Haenssler, M.-Y. Moy and R. R. Isberg (2010). "LnaB: a Legionella pneumophila activator of NF-kappaB." Cellular microbiology 12(8): 1083-1097.

Madhvi, A., H. Mishra, G. R. Leisching, P. Z. Mahlobo and B. Baker (2019). "Comparison of human monocyte derived macrophages and THP1-like macrophages as in vitro models for M. tuberculosis infection." Comparative immunology, microbiology and infectious diseases 67: 101355.

Mendis, N., P. McBride and S. P. Faucher (2015). "Short-Term and Long-Term Survival and Virulence of Legionella pneumophila in the Defined Freshwater Medium Fraquil." PLoS One 10(9): e0139277.

208 Molofsky, A. B., B. G. Byrne, N. N. Whitfield, C. A. Madigan, E. T. Fuse, K. Tateda and M. S. Swanson (2006). "Cytosolic recognition of flagellin by mouse macrophages restricts Legionella pneumophila infection." J Exp Med 203(4): 1093-1104.

Mondino, S., S. Schmidt, M. Rolando, P. Escoll, L. Gomez-Valero and C. Buchrieser (2020). "Legionnaires' Disease: State of the Art Knowledge of Pathogenesis Mechanisms of Legionella." Annu Rev Pathol 15: 439-466.

Morel, F. M. M., J. C. Westall, J. G. Rueter and C. JP (1975). Description of the algal growth media "Aquil" and "Fraquil", R.M. Parsons Laboratory for Water Resources and Hydrodynamics, Massachusetts Institute of Technology, Cambridge, MA.

Newton, H. J., D. K. Ang, I. R. van Driel and E. L. Hartland (2010). "Molecular pathogenesis of infections caused by Legionella pneumophila." Clin Microbiol Rev 23(2): 274-298.

Noppa, L., Y. Ostberg, M. Lavrinovicha and S. Bergstrom (2001). "P13, an integral membrane protein of Borrelia burgdorferi, is C-terminally processed and contains surface-exposed domains." Infect Immun 69(5): 3323-3334.

Rawlings, N. D., A. J. Barrett and A. Bateman (2010). "MEROPS: the peptidase database." Nucleic Acids Res 38(Database issue): D227-233.

Rawlings, N. D., M. Waller, A. J. Barrett and A. Bateman (2014). "MEROPS: the database of proteolytic enzymes, their substrates and inhibitors." Nucleic Acids Res 42(Database issue): D503-509.

Reiling, S. A., J. A. Jansen, B. J. Henley, S. Singh, C. Chattin, M. Chandler and D. W. Rowen (2005). "Prc protease promotes mucoidy in mucA mutants of Pseudomonas aeruginosa." Microbiology 151(Pt 7): 2251-2261.

Ren, T., D. S. Zamboni, C. R. Roy, W. F. Dietrich and R. E. Vance (2006). "Flagellin-Deficient Legionella Mutants Evade Caspase-1- and Naip5-Mediated Macrophage Immunity." PLoS Pathogens 2(3): e18.

Robinson, N., R. Ganesan, C. Hegedus, K. Kovacs, T. A. Kufer and L. Virag (2019). "Programmed necrotic cell death of macrophages: Focus on pyroptosis, necroptosis, and parthanatos." Redox Biol 26: 101239.

Rossier, O. and N. P. Cianciotto (2005). "The Legionella pneumophila tatB Gene Facilitates Secretion of Phospholipase C, Growth under Iron-Limiting Conditions, and Intracellular Infection." Infection and Immunity 73(4): 2020-2032.

Rossier, O., S. R. Starkenburg and N. P. Cianciotto (2004). "Legionella pneumophila Type II Protein Secretion Promotes Virulence in the A/J Mouse Model of Legionnaires' Disease Pneumonia." Infection and Immunity 72(1): 310-321.

209 Roy, C. R., K. H. Berger and R. R. Isberg (1998). "Legionella pneumophila DotA protein is required for early phagosome trafficking decisions that occur within minutes of bacterial uptake." Molecular Microbiology 28(3): 663-674.

Sadosky, A. B., L. A. Wiater and H. A. Shuman (1993). "Identification of Legionella pneumophila genes required for growth within and killing of human macrophages." Infect Immun 61(12): 5361-5373.

Saoud, J., T. Mani and S. P. Faucher (2020). "Legionella pneumophila’s Tsp is important for surviving thermal stress in water and inside amoeba." bioRxiv: 2020.2012.2008.417196.

Sautter, R., D. Ramos, L. Schneper, O. Ciofu, T. Wassermann, C. L. Koh, A. Heydorn, M. Hentzer, N. Hoiby, A. Kharazmi, S. Molin, C. A. Devries, D. E. Ohman and K. Mathee (2012). "A complex multilevel attack on Pseudomonas aeruginosa algT/U expression and algT/U activity results in the loss of alginate production." Gene 498(2): 242-253.

Seo, J. and A. J. Darwin (2013). "The Pseudomonas aeruginosa periplasmic protease CtpA can affect systems that impact its ability to mount both acute and chronic infections." Infection and immunity 81(12): 4561-4570.

Skerrett, S. J., G. J. Bagby, R. A. Schmidt and S. Nelson (1997). "Antibody‐Mediated Depletion of Tumor Necrosis Factor‐α Impairs Pulmonary Host Defenses to Legionella pneumophila." The Journal of Infectious Diseases 176(4): 1019-1028.

Skerrett, S. J. and T. R. Martin (1996). "Roles for tumor necrosis factor alpha and nitric oxide in resistance of rat alveolar macrophages to Legionella pneumophila." Infection and immunity 64(8): 3236-3243.

Snavely, E. A., M. Kokes, J. D. Dunn, H. A. Saka, B. D. Nguyen, R. J. Bastidas, D. G. McCafferty and R. H. Valdivia (2014). "Reassessing the role of the secreted protease CPAF in Chlamydia trachomatis infection through genetic approaches." Pathogens and disease 71(3): 336-351.

Tateda, K., T. Matsumoto, Y. Ishii, N. Furuya, A. Ohno, S. Miyazaki and K. Yamaguchi (1998). "Serum Cytokines in Patients with Legionella Pneumonia: Relative Predominance of Th1-Type Cytokines." Clinical Diagnostic Laboratory Immunology 5(3): 401-403.

Taylor, M., K. Ross and R. Bentham (2009). "Legionella, protozoa, and biofilms: interactions within complex microbial systems." Microb Ecol 58(3): 538-547.

Virag, L., R. I. Jaen, Z. Regdon, L. Bosca and P. Prieto (2019). "Self-defense of macrophages against oxidative injury: Fighting for their own survival." Redox Biol 26: 101261.

Vogel, J. P., C. Roy and R. R. Isberg (1996). "Use of Salt to Isolate Legionella pneumophila Mutants Unable to Replicate in Macrophages." Annals of the New York Academy of Sciences 797(1): 271-272.

210 Wadowsky, R. M., T. M. Wilson, N. J. Kapp, A. J. West, J. M. Kuchta, S. J. States, J. N. Dowling and R. B. Yee (1991). "Multiplication of Legionella spp. in tap water containing Hartmannella vermiformis." Appl Environ Microbiol 57(7): 1950-1955.

Wang, C. Y., S. W. Wang, W. C. Huang, K. S. Kim, N. S. Chang, Y. H. Wang, M. H. Wu and C. H. Teng (2012). "Prc contributes to Escherichia coli evasion of classical complement-mediated serum killing." Infect Immun 80(10): 3399-3409.

Wright, E. K., S. A. Goodart, J. D. Growney, V. Hadinoto, M. G. Endrizzi, E. M. Long, K. Sadigh, A. L. Abney, I. Bernstein-Hanley and W. F. Dietrich (2003). "Naip5 affects host susceptibility to the intracellular pathogen Legionella pneumophila." Curr Biol 13(1): 27-36.

Yamamoto, Y., T. W. Klein, C. A. Newton, R. Widen and H. Friedman (1988). "Growth of Legionella pneumophila in thioglycolate-elicited peritoneal macrophages from A/J mice." Infection and immunity 56(2): 370-375.

Yoshida, S., Y. Goto, Y. Mizuguchi, K. Nomoto and E. Skamene (1991). "Genetic control of natural resistance in mouse macrophages regulating intracellular Legionella pneumophila multiplication in vitro." Infection and Immunity 59(1): 428-432.

Yoshida, S.-I. and Y. Mizuguchi (1986). "Multiplication of Legionella pneumophila Philadelphia-1 in cultured peritoneal macrophages and its correlation to susceptibility of animals." Canadian Journal of Microbiology 32(5): 438-442.

Ziltener, P., T. Reinheckel and A. Oxenius (2016). "Neutrophil and Alveolar Macrophage- Mediated Innate Immune Control of Legionella pneumophila Lung Infection via TNF and ROS." PLOS Pathogens 12(4): e1005591.

211 General Discussion

The objective of my doctoral project was to characterize sRNAs from a list of candidate sRNAs. This list was generated from previous studies that showed these sRNAs were differentially regulated in various conditions, such as E phase, PE phase, in water, or by a major regulator, such as RpoS and CpxR. The expression of all these sRNAs was first confirmed by northern blot. The sRNAs detected by northern blot were selected for the next step. A deletion mutant of the sRNA was generated to screen for phenotypes. RACE was done on the sRNAs detected by northern blot to identify their 5’ and 3’ ends. In the end, the two sRNAs that were characterized were Lpr10 and Lpr17.

6.1 Lpr10

Lpr10 is a trans-encoded sRNA that regulates rpoS mRNAs originating from two transcription start sites that were not previously identified. The newly identified transcription start sites (TSS3 and TSS4) are upstream of the Lpr10 binding site. The regulation of rpoS by

Lpr10 does not affect the expression of RpoS from the two previously identified transcription start sites (TSS1 and TSS2) as they are located downstream of the Lpr10 binding site. Previous transcriptomic studies had shown that Lpr10 is regulated by RpoS and it is upregulated in water.

This information led to the hypothesis that Lpr10 plays a role in survival in water, helping Lp survive long term. This hypothesis was incorrect. Lpr10 is detrimental to long-term survival in water. The absence of Lpr10 allowed the mutant strain to survive much longer than the WT, likely due to the higher expression of RpoS in the lpr10 mutant, making the strain better at dealing with the stress. This potentially comes with a downside that was not identified herein but will be discussed further below.

212 6.1.1 Regulation of Sigma Factors

Sigma factors bind the core RNA polymerase to form the RNA polymerase holoenzyme which can then initiate transcription. Each sigma factor recognizes different promoters and will direct transcription accordingly (Abril et al. 2020). Since sigma factors determine which genes are transcribed, expressing the correct sigma factor during stresses is important (Abril et al.

2020). To ensure the correct sigma factor is expressed, sigma factors are regulated at various steps: transcription, translation, protein stability, and protein availability (Paget 2015). When more than one sigma factor is present, the different sigma factors are in competition with each other to bind the core RNA polymerase (Maeda et al. 2000; Mauri and Klumpp 2014; Gupta and

Chatterji 2016). Changing the concentration of a particular sigma factor alters the class of genes that will be transcribed. The competition between the sigma factors depends on the concentration of the different sigma factors as well as on the number of core RNA polymerase available.

During the exponential phase, the transcription of rRNA represents up to 75 % of all transcribed genes (Bremer and Dennis 2008; Klumpp and Hwa 2008). During the stringent response, transcription of rRNA and the housekeeping sigma factor RpoD are downregulated, which makes a large number of core RNA polymerase available to bind RpoS (Zhou and Jin 1998;

Barker et al. 2001; Durfee et al. 2008). Downregulation of rRNA transcription and sigma factor competitions are important to transcribe genes under the control of RpoS (Bernardo et al. 2006;

Costanzo et al. 2008; Mauri and Klumpp 2014).

6.1.2 Lpr10 and Sigma Factor Competition

The presence of four transcription start sites for RpoS suggests the importance of fine- tuning the expression of RpoS as a balance of the sigma factor is important for optimal growth

213 and stress survival. Overexpression of RpoS is detrimental to Lp (Trigui et al. 2015), and the extra layer of regulation by Lpr10 seems to help regulate intracellular RpoS concentrations.

Given that regulation by sRNA is rapid, this allows Lp to tweak its pool of sigma factors on a dime. If RpoS is present in high concentrations, the core RNA polymerase is not be able to interact with other sigma factors when conditions change due to competition between sigma factors. The concentration of the different sigma factors influences the binding of the sigma factor to the core RNA polymerase and in the process influences the class of genes to be transcribed. It is possible that Lp balances long-term survival in water with the ability to deal with other unknown stresses or for optimal infection of host cells. The higher levels of RpoS produced in the absence of Lpr10 could hinder the binding of other sigma factors to the core

RNA polymerase therefore preventing or delaying a response to changes in the environment.

Lpr10 could play a role in shifts during conditions by helping to switch the transcriptomic program during environmental changes. The regulation of RpoS by Lpr10 could be involved in restarting replication once nutrients become abundant. This hypothesis could be tested by incubating the strains in water over a period of ten weeks, which was the first time point where a clear difference in survival in water between the WT and lpr10 mutant was observed. Following this incubation, we could screen for various phenotypes such as infection of host cells, longer lag phase when grown in broth, and ability to tolerate thermal stress.

6.1.2.1 Other sRNAs Regulating Sigma Factors

Lpr10 is not the only sRNA involved in a regulatory feedback loop with a sigma factor.

In E. coli, RpoE induces the expression of the RyhB sRNA in response to cell envelope stress

(Thompson et al. 2007). RyhB downregulates the synthesis of outer membrane proteins which

214 reduces cell envelope stress (Thompson et al. 2007). Once the stress has passed, RyhB will downregulate rpoE, which results in downregulation of RyhB (Thompson et al. 2007). In E. coli, at least four sRNAs, ArcZ, DsrA, RprA, and OxyS control the pool of the RpoS sigma factor within the cell in response to different stress encountered (Sledjeski et al. 1996; Majdalani et al.

1998; Zhang et al. 1998; Majdalani et al. 2001; Mandin and Gottesman 2010). Lpr10 seems to fit in this group of sRNAs that target a sigma factor.

6.1.3 Detection

sRNAs can be expressed at very low concentrations or the binding of sRNAs could have very little impact on the level of the target mRNA, and the changes in transcription levels would not be detected by transcriptomic methods (Vogel and Wagner 2007; Bumgarner 2013). This would prevent the identification of targets. This was observed when studying the RyhB sRNA of

E. coli. cysE codes for a serine acetyltransferase required for cysteine biosynthesis using serine as a substrate (Salvail et al. 2010). During iron starvation, downregulation of cysE by RyhB is important as serine can now be used for the synthesis of siderophores (Salvail et al. 2010).

Despite the repression of cysE translation, microarray analysis did not identify the change in cysE mRNA as the difference in transcripts was too small to be detected (Masse et al. 2005;

Salvail et al. 2010). The same limitation may have occurred with the Lpr10 microarray. RpoS was identified as a target of Lpr10. Perhaps the phenotype observed in water was not solely due to the upregulation of rpoS in the lpr10 mutant. It is possible another gene that is differentially regulated in the lpr10 mutant contributes to the phenotype observed in water. However, the small change in transcript level has gone undetected and its role would therefore not be characterized.

215 It is sometimes difficult to find a change in phenotype following a deletion of a sRNA because the phenotype can be subtle or only present in a specific physiological condition

(Wagner and Romby 2015). This concept is exemplified by the lpr10 mutant, where determining the conditions in which the Lpr10 regulation is beneficial (i.e. the mutant is defective) was not successful. Lpr10 downregulates RpoS in water, which prevents the bacteria to survive long-term in water, but the positive impact of a lower concentration of RpoS has not been identified. I have screened for various phenotypes without success. These experiments included infection of various host cells, viability of host cells during infections, thermal stress at 55 C, osmotic stress, oxidative stress, acid stress, resistance to antibiotics, resistance to surfactants, growth in low iron conditions, and production of the pigment pyomelanin.

Furthermore, knowing the redundancy found in Lp’s genome, in particular with Icm/Dot effectors, it would not be surprising if the existence of a redundant system prevents the identification of additional roles for Lpr10. Lpr10 is the only sRNA identified that regulates rpoS. As mentioned earlier, four sRNAs regulate the expression of rpoS in E. coli. RpoS is a major regulator and it is likely that other sRNAs positively and/or negatively regulate rpoS. The presence of these redundant systems could mask the effect of the absence of Lpr10.

Coprecipitation of rpoS mRNA by MS2bs-sRNA affinity purification coupled with RNA- sequencing (MAPS) could help identify other sRNAs interacting with rpoS. This method will be further discussed below.

6.2 Lpr17 and Tsp

Lpr17 is a cis-encoded sRNA found on the complementary strand of the tsp gene, which codes for a tail-specific protease. In many bacteria, tail-specific proteases are involved in thermal

216 stress and virulence (Hara et al. 1991; Baumler et al. 1994; Noppa et al. 2001; Bandara et al.

2005; Lad et al. 2007; Bandara et al. 2008; Hoge et al. 2011; Wang et al. 2012; Seo and Darwin

2013; Carroll et al. 2014; Huang et al. 2020). Therefore, we hypothesized that Lp’s Tsp is important in dealing with thermal stress and for replication inside host cells. This hypothesis was validated in chapters 4 and 5. Usually cis-encoded sRNAs regulate genes on the complementary strand and we had no reason to believe this would be a different scenario. RT-PCR demonstrated that the tsp mRNA is expressed in both E and PE phase. However, Lpr17 is only expressed in E phase and the Tsp protein is only expressed in PE phase. This leads us to suggest that Lpr17 inhibits translation of the tsp transcript in E phase, and as Lpr17 expression decreases in PE phase or during thermal stress, Tsp is expressed.

6.2.1 Lpr17 Partly Overlaps lpg0500

Lpr17 also overlaps the 3’ end of the lpg0500 gene (chapter 4 Figure 3A). RT-PCR in E and PE phase showed that lpg0500 is not co-transcribed with tsp as part of a polycistronic mRNA. However, we cannot rule out the expression of both genes as part of a polycistronic mRNA in specific conditions, such as thermal stress. lpg0500 could be expressed in a monocistronic mRNA and still be regulated by Lpr17 in E phase. The expression of lpg0500 could be determined by RT-PCR, similarly to what was done to test for a polycistronic mRNA

(chapter 4 Figure 3). The forward and reverse primers will need to be within the lpg0500 coding region. Despite sRNAs usually regulating their target by interacting with the 5’ end, bacterial sRNAs can regulate translation by interacting with the 3’ end of their target mRNAs. Therefore, it is possible that Lpr17 regulates lpg0500 in conditions that we have not tested for. Lpr17 could induce the degradation of the lpg0500 transcript by an RNase or cause a truncated Lpg0500

217 which would be degraded by proteases. Further experiments would confirm if regulation of lpg0500 by Lpr17 occurs.

The lpg0500 gene is homologous to the periplasmic protease EnvC (also called YipB). In

E. coli, EnvC is involved in cellular division and is important for replication at 42 C, the same temperature the E. coli tsp mutant is unable to grow at (Ichimura et al. 2002; Bernhardt and de

Boer 2004; Singh et al. 2015). In Salmonella Typhi, EnvC, alongside the DegS protease, are required for the formation of OMVs, which Salmonella Typhi uses to deliver the HlyE hemolysin to the host cell (Wai et al. 2003; Nevermann et al. 2019). HlyE is important for invasion of epithelial cells (Fuentes et al. 2008). In P. aeruginosa, EnvC is induced by low iron concentrations, and is involved in the secretion of the pyoverdine siderophore (Poole et al. 1993).

Based on the role of EnvC in other pathogens, it is possible that Lpg0500 is involved in surviving thermal stress. E. coli’s Tsp is required for growth at 42 C and Lp’s Tsp is important for surviving thermal stress. Perhaps a similar correlation occurs with the EnvC homolog. Lp is known to secrete OMVs and they play a role in infection and preventing phagolysosome fusion

(Fernandez-Moreira et al. 2006; Jung et al. 2016). Lpg0500 could play a role in the secretion of these vesicles, as it was observed with Salmonella Typhi. Lp is also able to infect lung epithelial cells, and the role of Lpg0500 during infection of these cells should be investigated. Lp produces the legiobactin siderophore, important for optimal infection of lungs (Liles et al. 2000; Allard et al. 2006; Allard et al. 2009). Since EnvC in P. aeruginosa helps secrete the pyoverdine siderophore, it is possible that Lpg0500 could be involved in the secretion of legiobactin.

Lpg0500 seems a prime candidate for its involvement in Lp’s virulence or stress survival, and the expression of the gene could also be regulated by the Lpr17 sRNA. Further experiments need to

218 be completed in order to determine its role, starting with making a lpg0500 deletion mutant and screening for phenotypes such as surviving thermal stress and infection of host cells.

6.2.2 sRNAs Antisense to Tsps

Tsps are found in various bacteria, but a cis-encoded sRNA regulating them have not been reported until now. A northern blot could be used to screen for sRNAs on the complementary strand of genes coding for tsp in other bacteria. Since cis-encoded sRNA have perfect complementarity with their target, a probe can be generated using the 5’ end complementary sequence of the tsp coding gene and perform northern blot on RNA samples extracted from the exponential and stationary phase. This would allow the detection for such sRNAs. An in silico approach might not yield positive results as it will depend on the sequence similarity between the different species.

6.3 Regulation by sRNA: Simple and Complex

Regulation by sRNA has various advantages over protein regulators. It is an energy- efficient and quick way to regulate gene expression and adapt to changing environments as it has a reduced metabolic cost and a faster rate of regulation (Shimoni et al. 2007; Mehta et al. 2008).

Additionally, sRNAs can team up with protein regulators to better regulate gene expression

(Updegrove et al. 2015). Lpr10 could act with protein regulators to reduce intracellular concentrations of RpoS.

The regulation by sRNAs can be simple or complex, and this thesis shows an example of each type. Examination of the regulation by Lpr10 shows the difficulty in identifying a role and a target for some sRNAs, especially trans-encoded sRNAs as they are not encoded on the

219 complementary strand of their target and its identification is not as straightforward as for cis- encoded sRNAs. Furthermore, trans-encoded sRNAs can regulate multiple targets, making identification of all targets more challenging (Apura et al. 2019). The results obtained in chapter

3 shows the complex regulation that is bestowed on RpoS, as it is a major regulator in various bacteria. The identification of two new rpoS transcription start sites means Lp possesses at least four rpoS transcription start sites, which is two fewer than E. coli. Only two of the four transcripts is regulated by Lpr10, therefore RpoS is regulated in different ways to accommodate the bacteria’s requirement for the stress response sigma factor. The presence of four transcription start sites for the expression of rpoS suggests expression does not always occur from all transcripts. The number of transcripts used will depend on the environmental conditions. Fusion of the different transcription start sites with the lac reporter gene could allow the identification of the conditions in which expression from each transcription start site occurs.

Lpr17 is an example of a simple regulation by a sRNA. The tsp mRNA is present in both

E and PE phase and is ready to be translated into a functional protein when needed. The expression of Lpr17 seems to prevent translation of the transcript until it is needed, which is in

PE phase and during thermal stress. In those conditions, the expression of Lpr17 is quickly downregulated to allow the expression of Tsp. The mechanism of repression of Lpr17 is unknown at the moment. It could be caused by the binding of a repressor to the promoter of

Lpr17 to inhibit its transcription or the transcription factor that activates Lpr17 transcription is negatively regulated, which would result in the downregulation of Lpr17. The regulation of tsp by Lpr17 is reminiscent of a light switch, where the lightbulb (tsp mRNA) is always present, and as quickly as a switch is flipped (presence/absence of Lpr17), the lights are either on or off

(presence/absence of Tsp protein). Since the protein is important in various aspects of Lp’s life, it

220 is also regulated independently of Lpr17 via the CpxR/A two-component system, a major regulator in Lp. The regulation of tsp by Lpr17 might seem simple; however, the regulation of tsp seems complex as it is targeted by at least 2 regulators.

6.4 Limitations

The limitations of the project will be discussed below.

6.4.1 Molecular Biology Tools

One of the main hurdles encountered during the project is the limited molecular biology tools at our disposal to study Legionella, especially in comparison to the tools available when working with E. coli. There are very few plasmids that are compatible with Legionella and chromosomal insertion of genes is not yet possible. In various enterobacteria, including E. coli and Salmonella, complementation in trans is possible by inserting a single copy of the gene in the Tn7 transposon specific site (attTn7) in the chromosome (Crepin et al. 2012). The insertion at the attTn7 site is stable and does not require a selection pressure to be maintained, unlike when using a plasmid (Crepin et al. 2012). This method has not been developed for Legionella, and complementation relies on cloning the gene on a plasmid. This leads to a higher copy number of the gene compared to the chromosomal copy and can lead to aberrant phenotypes or imperfect complementation. This has been observed with the lpr10 complemented strain, as it produces a higher amount of Lpr10, and the complementation was not always perfect. A higher number of

Lpr10 transcripts in the bacteria would lead to a downregulation of rpoS which could be detrimental for growth or survival.

221 6.4.2 Redundancy and Host Specificity

Lp is able to infect a wide variety of host cells, and some of its effectors are host-specific or redundant (Mondino et al. 2020). Therefore, an ICM-related phenotype associated with a deletion of lpr10 could be missed if the infection was not done with the suitable host or if the effector is redundant. The hypothesis here is that Lpr10 could regulate a subset of effectors. In the Lpr10 microarray, the VipA effector was upregulated in the absence of Lpr10. In other words, Lpr10 downregulates the expression of vipA. VipA causes actin polymerization in the host cell to alter host vesicle trafficking and helps in the attachment and entry of epithelial cells

(Franco et al. 2012; Prashar et al. 2018). It is possible that the higher expression of VipA in the lpr10 mutant could lead to better invasion of epithelial cells by the lpr10 mutant compared to the

WT. The infection of epithelial cells was not investigated. A slight increase in attachment might not result in a detectable phenotype. However, even in the scenario where VipA would be downregulated in the lpr10 mutant, three other effectors, LegK2, Ceg14, and RavK, also modulate the host actin network and could compensate for lack of VipA (Guo et al. 2014;

Michard et al. 2015; Liu et al. 2017).

6.4.3 Identification of sRNAs by Other Groups

The candidate list of sRNA was partially based on work previously done by

Weissenmayer et al in 2011 who had identified 70 new sRNAs using RNA-sequencing done in E phase, PE phase, and during infection of amoeba (Weissenmayer et al. 2011). We did not have access to the raw data, and therefore could not determine to which degree the sRNAs were differentially expressed. If they were expressed at a low level in the conditions tested, they will be harder to detect by northern blot. Without access to the raw data, the quality of the RNA, the

222 sequencing, and the analysis of the results could not be confirmed. This does not imply wrongful analysis by Weissenmayer et al; it is simply to say that starting without the raw data leaves us with a few blind spots. The extracted RNA was not treated with a pyrophosphatase, and therefore it is not possible to distinguish between full-length transcripts and degraded transcripts. If degraded mRNAs were wrongly classified as sRNAs by Weissenmayer et al, they will not be detected by northern blot. This may have been the case for some of the sRNAs that were screened at the start of the project. However, the limitation does not solely rest on the method used by Weissenmayer et al to identify sRNAs in Lp. When attempting to detect the sRNAs by northern blot, if the correct conditions for expression of the sRNA were not met or the concentration of sRNA was too low, the sRNA will not be detected by this method.

6.4.4 Target Prediction

Identifying putative targets for Lpr10 using target prediction algorithms was not trivial.

We used a few webservers: RNAPredator, TargetRNA, and CopraRNA. One of the main targets of Lpr10 identified by RNAPredator was nlpD, which is the gene upstream of rpoS. Combining this data with the microarray data was needed in order to identify rpoS as a target. The TSS3 and

TSS4 had not been previously identified and, therefore, the binding of Lpr10 in nlpD did not make much sense without the microarray data. The top 10 putative targets identified by

RNAPredator were not differentially regulated in the microarray, including the genes upstream and downstream of the predicted target, with the exception of rpoS. One aspect that needs to be taken into consideration is that the sRNA could bind the gene upstream of the gene that is regulated, which was the case for Lpr10. Therefore, the target prediction algorithms correctly identified the binding site; however, it does not mean that the gene to which it binds is

223 necessarily the gene that is regulated. This means that we need to look further than the data provided by these algorithms, as the regulated gene could be neighbouring to the target identified. TargetRNA and CopraRNA did not identify nlpD or rpoS as a potential target of

Lpr10.

6.4.5 Northern Blot

Northern blotting is a great tool for RNA analysis as it is relatively fast, does not require enzymatic reactions, provides an approximate size of the target RNA, and it can show alternatively spliced transcripts (Streit et al. 2009; Ferrer et al. 2016). However, it only provides a relative comparison of the abundance of RNA between samples and does not provide fold change (Streit et al. 2009; Ferrer et al. 2016). Therefore, small differences in RNA expression between samples could go unnoticed. Detection of the target RNA requires its presence in high concentrations, which can be problematic for targets expressed at low levels. This could explain why some of the candidate sRNAs were not detected by northern blot. This method is also unable to measure RNA stability or the transcription rate, it only measures the levels of the target

RNA.

6.4.6 Microarray

Microarray has its own limitations. This method has a limited dynamic range as it poorly quantifies highly and lowly expressed genes (Bumgarner 2013). Microarrays provide an indirect measure of relative concentration as the amount of cDNA bound to the chip is presumed to be proportional to the concentration of the mRNA in the sample (Bumgarner 2013). However, this is not always the case. If the gene is present in high concentrations, the array will become

224 saturated and will not detect the excess DNA. On the other hand, low concentrations of a gene could lead to very low binding due to the kinetics of hybridization which, at very low DNA concentrations, favours no binding (Bumgarner 2013). RNA-sequencing does offer a better alternative to microarrays. RNA-sequencing is able to detect new transcripts since it does not require known probes bound to a chip. It is also easier to detect lowly and highly expressed genes as the latter do not cause a saturation of the system. It has a better sensitivity and specificity than microarrays (Bumgarner 2013).

6.4.7 Intracellular Multiplication

The ability of strains to successfully infect host cells is measured by CFU counts which was done by sampling the supernatant. This method is dependent on the release of the bacteria from the host cell and the timing of the sampling. If the phenotype is associated with lack of egress from the host cell, but the strain is not defective for intracellular multiplication, the results will be similar to a strain deficient for intracellular multiplication. This is because only the bacteria released into the media are enumerated. This limitation can be offset by two methods: microscopy or host cell lysis. Microscopy allows the observation of accumulation of bacteria within the host cell. Lysing the host cells would release all bacteria into the media. However, this method requires a substantial amount of material for all time points and replicates. This would also require an astronomical number of cells per experiment. This perhaps is not an issue when working with immortalized cell lines, but there is an ethical concern when it comes to primary macrophages as more mice would need to be sacrificed to complete each experiment.

225 6.5 Future Experiments

Future experiments that could improve our understanding of these two sRNAs could be undertaken. The exact mechanism of regulation of Lpr10 could be investigated. Insertion of point mutations in the Lpr10 sequence could show the nucleotides that are crucial for interaction with the rpoS mRNA. Identifying other regions of Lpr10 capable of binding to mRNAs could help in identifying other targets. The GcvB sRNA is an example of a sRNA that binds different targets using different regions of the sRNA (Lalaouna et al. 2019).

As mentioned in the discussion, long term incubation in water followed by screening for phenotypes such as infection of host cells or resistance to thermal stress could potentially explain why Legionella would rather decrease expression of RpoS in water.

Phenotypes associated with Lpr10 could be either due to a direct regulation by Lpr10 or an indirect regulation by Lpr10 through its regulation of rpoS. Identifying other targets of Lpr10 would help elucidate this question. In particular, the interaction between Lpr10 and other mRNA or protein regulators could be identified using MS2bs-sRNA affinity purification. The Lpr10 sRNA will be tagged with the MS2 bacteriophage RNA stemloop which binds the MS2 coat protein with high affinity, allowing the co-precipitation of MS2-tagged Lpr10 sRNA and its targets (Said et al. 2009; Corcoran et al. 2012b; Lalaouna et al. 2015). MS2bs-affinity purification can be coupled with RNA-sequencing to identify RNA targets and mass spectrometry to identify protein targets (Said et al. 2009; Corcoran et al. 2012b; Lalaouna et al.

2015; Carrier et al. 2016; Giambruno et al. 2018). Targets of Lpr10 identified by this method can then be investigated by northern blot for RNA targets and western blots for protein targets.

Identifying if Tsp is secreted inside the host would give an idea if its proteolytic activity is aimed at host proteins. A translocation assay similar to what was performed in chapter 5 could

226 help determine if Tsp is translocated inside the host cell. A T2SS mutant can be used as a negative control instead of an Icm/Dot mutant used in the assay mentioned in chapter 5.

Identifying the targets of Tsp would go a long way in elucidating the role of the protease in Lp’s thermal stress response, intracellular multiplication, and its involvement in limiting the secretion of TNF-alpha by macrophages. Target identification can be done using proteomic analysis such as the isobaric tag for relative and absolute quantitation (iTRAQ). If Tsp is found to be translocated to the host cell, using a yeast two-hybrid system would allow the identification of the eukaryotic targets of Tsp.

Examining the production of other cytokines by macrophages, such as IFN- and IL-1, could help determine the effect of Tsp on the host immune response. The production of cytokines can be detected using commercially available ELISA kits, similar to the approach used in chapter

5 to detect TNF-.

Microscopy can be used to determine if the tsp mutant is defective for entry in host cells and if infection of macrophages with the tsp mutant leads to a higher level of apoptosis in macrophages. This experiment can be performed by transforming Lp with a plasmid coding the green fluorescent protein (GFP).

Additionally, understanding the mechanism of regulation of tsp by CpxR could lead to a better understanding of the importance of tsp. CpxR could directly activate expression of tsp or indirectly activate expression of tsp by regulating another regulator. This would help link the

CpxR/A two-component system with Lp’s thermal stress regulon. To investigate if the inability of the cpxR mutant to tolerate thermal stress is due to the absence of Tsp, we could express Tsp in the cpxR mutant and observe if it improves its ability to tolerate a thermal stress.

227 Conclusion

This project has led to the characterization of two sRNAs in Lp, the discovery of two new transcription start sites (TSS3 and TSS4) for the stress response sigma factor RpoS, as well as the characterization of a tail-specific protease in Lp.

The trans-encoded sRNA Lpr10 downregulates rpoS transcripts originating from TSS3 and TSS4. A regulatory feedback loop between RpoS and Lpr10 allows the bacteria to maintain an optimal intracellular balance of RpoS.

The cis-encoded sRNA Lpr17 downregulates tsp in E phase probably by preventing translation of the transcript. Upon entry into PE phase or during thermal stress, the expression of

Lpr17 decreases and the inhibition on tsp is relieved. Tsp is important for surviving thermal stress, infection of macrophages, and infection of amoebae if a temperature change occurs. The

CpxR/A two-component system upregulates the expression of tsp independently from Lpr17, either directly or through a yet unknown regulator.

In conclusion, bacteria and their sRNAs are comparable to cognac and me. The sRNAs I characterized in my thesis allow the bacteria to maintain a balance of sigma factors as they reach the post-exponential phase or are in a stressful condition such as water. The sRNAs regulate a protease that potentially allow the bacteria to deal with misfolded or aggregated proteins as they reach the post-exponential phase or suffer a stress such as a change in temperature. Cognac allows me to maintain a mental balance at the end of the day. It degrades all the stress and problems that accumulated throughout the day. It helps support the pressure arising from writing a PhD thesis. Physically, bacteria and I get worse with age. Mentally, cognac and I get better with age. As my time as a potential V.S.O.PhD comes to an end, I might be turning my sights to

France. Hennessy uses a committee of tasters who will taste dozens of samples before and after blending, to ensure the quality of the final product (Hennessy 2020b). Sounds like a dream job!

229 Appendix

Table 1: Summary of candidate sRNAs of L. pneumophila. Northern blot was used to confirm the expression of each sRNA. RACE was used to identify the transcription start site and end of the sRNAs detected by northern blot. Mutant strains of the sRNAs detected by northern blot were constructed and tested for different phenotypes

sRNAs Northern blot RACE Phenotype change in

mutant

Lpr10 Detected Successful Survival in water

Lpr17 Detected Successful Thermal stress

Lpr34 Detected Successful None

Lpr38 Detected Not Successful None

Lpr45 Not Detected Not Applicable Not Applicable

Lpr46 Not Detected Not Applicable Not Applicable

Lpr56 Not Detected Not Applicable Not Applicable

Lpr59 Detected Successful None

230 Complete List of References

Abdelhady, H. and R. A. Garduño (2013). "The progeny of Legionella pneumophila in human macrophages shows unique developmental traits." FEMS microbiology letters 349(2): 99-107.

Abril, A. G., J. L. R. Rama, A. Sánchez-Pérez and T. G. Villa (2020). "Prokaryotic sigma factors and their transcriptional counterparts in Archaea and Eukarya." Applied microbiology and biotechnology 104(10): 4289-4302.

Abu Kwaik, Y. (1996). "The phagosome containing Legionella pneumophila within the protozoan Hartmannella vermiformis is surrounded by the rough endoplasmic reticulum." Appl Environ Microbiol 62(6): 2022-2028.

Abu Kwaik, Y., L. Y. Gao, O. S. Harb and B. J. Stone (1997). "Transcriptional regulation of the macrophage-induced gene (gspA) of Legionella pneumophila and phenotypic characterization of a null mutant." Mol Microbiol 24(3): 629-642.

Abu Kwaik, Y., L. Y. Gao, B. J. Stone, C. Venkataraman and O. S. Harb (1998). "Invasion of protozoa by Legionella pneumophila and its role in bacterial ecology and pathogenesis." Appl Environ Microbiol 64(9): 3127-3133.

Abu-Zant, A., R. Asare, J. E. Graham and Y. Abu Kwaik (2006). "Role for RpoS but not RelA of Legionella pneumophila in modulation of phagosome biogenesis and adaptation to the phagosomal microenvironment." Infect Immun 74(5): 3021-3026.

Adams, J. L. and R. J. McLean (1999). "Impact of rpoS deletion on Escherichia coli biofilms." Applied and environmental microbiology 65(9): 4285-4287.

Africa, L. A. A., E. R. Murphy, N. R. Egan, A. F. Wigley and H. J. Wing (2011). "The iron- responsive Fur/RyhB regulatory cascade modulates the Shigella outer membrane protease IcsP." Infection and immunity 79(11): 4543-4549.

Aiba, H., S. Adhya and B. de Crombrugghe (1981). "Evidence for two functional gal promoters in intact Escherichia coli cells." J Biol Chem 256(22): 11905-11910.

Akira, S., S. Uematsu and O. Takeuchi (2006). "Pathogen recognition and innate immunity." Cell 124(4): 783-801.

Al-Khodor, S., S. Kalachikov, I. Morozova, C. T. Price and Y. Abu Kwaik (2009). "The PmrA/PmrB two-component system of Legionella pneumophila is a global regulator required for intracellular replication within macrophages and protozoa." Infect Immun 77(1): 374-386.

Allard, K. A., J. Dao, P. Sanjeevaiah, K. McCoy-Simandle, C. H. Chatfield, D. S. Crumrine, D. Castignetti and N. P. Cianciotto (2009). "Purification of Legiobactin and importance of this siderophore in lung infection by Legionella pneumophila." Infect Immun 77(7): 2887-2895.

231 Allard, K. A., V. K. Viswanathan and N. P. Cianciotto (2006). "lbtA and lbtB are required for production of the Legionella pneumophila siderophore legiobactin." J Bacteriol 188(4): 1351- 1363.

Allegra, S., L. Leclerc, P. A. Massard, F. Girardot, S. Riffard and J. Pourchez (2016). "Characterization of aerosols containing Legionella generated upon nebulization." Sci Rep 6: 33998.

Allombert, J., J.-C. Lazzaroni, N. Baïlo, C. Gilbert, X. Charpentier, P. Doublet and A. Vianney (2013). "Three antagonistic cyclic di-GMP-catabolizing enzymes promote differential Dot/Icm effector delivery and intracellular survival at the early steps of Legionella pneumophila infection." Infection and immunity 82(3): 1222-1233.

Almagro Armenteros, J. J., K. D. Tsirigos, C. K. Sonderby, T. N. Petersen, O. Winther, S. Brunak, G. von Heijne and H. Nielsen (2019). "SignalP 5.0 improves signal peptide predictions using deep neural networks." Nat Biotechnol 37(4): 420-423.

Altman, E. and G. Segal (2008). "The response regulator CpxR directly regulates expression of several Legionella pneumophila icm/dot components as well as new translocated substrates." J Bacteriol 190(6): 1985-1996.

Altschul, S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman (1990). "Basic local alignment search tool." J Mol Biol 215(3): 403-410.

Altuvia, S., D. Weinstein-Fischer, A. Zhang, L. Postow and G. Storz (1997). "A Small, Stable RNA Induced by Oxidative Stress: Role as a Pleiotropic Regulator and Antimutator." Cell 90(1): 43-53.

Altuvia, S., A. Zhang, L. Argaman, A. Tiwari and G. Storz (1998). "The Escherichia coli OxyS regulatory RNA represses fhlA translation by blocking ribosome binding." The EMBO Journal 17(20): 6069-6075.

Amer, A. O. (2010). "Modulation of caspases and their non-apoptotic functions by Legionella pneumophila." Cell Microbiol 12(2): 140-147.

Amer, A. O. and M. S. Swanson (2005). "Autophagy is an immediate macrophage response to Legionella pneumophila." Cell Microbiol 7(6): 765-778.

Andreassen, P. R., J. S. Pettersen, M. Szczerba, P. Valentin-Hansen, J. Møller-Jensen and M. G. Jørgensen (2018). "sRNA-dependent control of curli biosynthesis in Escherichia coli: McaS directs endonucleolytic cleavage of csgD mRNA." Nucleic Acids Research 46(13): 6746-6760.

Andreeva, I., R. Belardinelli and M. V. Rodnina (2018). "Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA." Proceedings of the National Academy of Sciences of the United States of America 115(17): 4411-4416.

232 Andreu, N., J. Phelan, P. F. d. Sessions, J. M. Cliff, T. G. Clark and M. L. Hibberd (2017). "Primary macrophages and J774 cells respond differently to infection with Mycobacterium tuberculosis." Scientific reports 7(1): 42225.

Apura, P., S. Domingues, S. C. Viegas and C. M. Arraiano (2019). "Reprogramming bacteria with RNA regulators." Biochem Soc Trans 47(5): 1279-1289.

Arasaki, K., Y. Mikami, S. R. Shames, H. Inoue, Y. Wakana and M. Tagaya (2017). "Legionella effector Lpg1137 shuts down ER-mitochondria communication through cleavage of syntaxin 17." Nature Communications 8(1): 15406.

Arasaki, K. and C. R. Roy (2010). "Legionella pneumophila promotes functional interactions between plasma membrane syntaxins and Sec22b." Traffic 11(5): 587-600.

Arasaki, K., D. K. Toomre and C. R. Roy (2012). "The Legionella pneumophila effector DrrA is sufficient to stimulate SNARE-dependent membrane fusion." Cell Host Microbe 11(1): 46-57.

Argaman, L. and S. Altuvia (2000). "fhlA repression by OxyS RNA: kissing complex formation at two sites results in a stable antisense-target RNA complex11Edited by M. Gottesman." Journal of Molecular Biology 300(5): 1101-1112.

Argaman, L., R. Hershberg, J. Vogel, G. Bejerano, E. G. H. Wagner, H. Margalit and S. Altuvia (2001). "Novel small RNA-encoding genes in the intergenic regions of Escherichia coli." Current Biology 11(12): 941-950.

Arnion, H., D. N. Korkut, S. M. Gelo, S. Chabas, J. Reignier, I. Iost and F. Darfeuille (2017). "Mechanistic insights into type I toxin antitoxin systems in Helicobacter pylori: the importance of mRNA folding in controlling toxin expression." Nucleic acids research: gkw1343.

Attaiech, L., A. Boughammoura, C. Brochier-Armanet, O. Allatif, F. Peillard-Fiorente, R. A. Edwards, A. R. Omar, A. M. MacMillan, M. Glover and X. Charpentier (2016). "Silencing of natural transformation by an RNA chaperone and a multitarget small RNA." Proc Natl Acad Sci U S A 113(31): 8813-8818.

Attaiech, L. and X. Charpentier (2017). "Silently transformable: the many ways bacteria conceal their built-in capacity of genetic exchange." Curr Genet 63(3): 451-455.

Awad, P., V. Athes, M. E. Decloux, G. Ferrari, G. Snakkers, P. Raguenaud and P. Giampaoli (2017). "Evolution of Volatile Compounds during the Distillation of Cognac Spirit." J Agric Food Chem 65(35): 7736-7748.

Azam, M. S. and C. K. Vanderpool (2020). "Translation inhibition from a distance: The small RNA SgrS silences a ribosomal protein S1‐dependent enhancer." Molecular Microbiology.

Bachman, M. A. and M. S. Swanson (2001). "RpoS co-operates with other factors to induce Legionella pneumophila virulence in the stationary phase." Mol Microbiol 40(5): 1201-1214.

233 Bachman, M. A. and M. S. Swanson (2004). "Genetic evidence that Legionella pneumophila RpoS modulates expression of the transmission phenotype in both the exponential phase and the stationary phase." Infect Immun 72(5): 2468-2476.

Balch, W. E., R. I. Morimoto, A. Dillin and J. W. Kelly (2008). "Adapting proteostasis for disease intervention." Science (New York, N.Y.) 319(5865): 916-919.

Balchin, D., M. Hayer-Hartl and F. U. Hartl (2016). "In vivo aspects of protein folding and quality control." Science 353(6294): aac4354.

Ball, A. S., R. R. Chaparian and J. C. van Kessel (2017). "Quorum Sensing Gene Regulation by LuxR/HapR Master Regulators in Vibrios." J Bacteriol 199(19).

Bandara, A. B., D. DeShazer, T. J. Inzana, N. Sriranganathan, G. G. Schurig and S. M. Boyle (2008). "A disruption of ctpA encoding carboxy-terminal protease attenuates Burkholderia mallei and induces partial protection in CD1 mice." Microb Pathog 45(3): 207-216.

Bandara, A. B., N. Sriranganathan, G. G. Schurig and S. M. Boyle (2005). "Carboxyl-terminal protease regulates Brucella suis morphology in culture and persistence in macrophages and mice." J Bacteriol 187(16): 5767-5775.

Bandyopadhyay, P., E. U. Sumer, D. Jayakumar, S. Liu, H. Xiao and H. M. Steinman (2012). "Implication of proteins containing tetratricopeptide repeats in conditional virulence phenotypes of Legionella pneumophila." J Bacteriol 194(14): 3579-3588.

Bandyra, K. J. and B. F. Luisi (2018). "RNase E and the High-Fidelity Orchestration of RNA Metabolism." Microbiology spectrum 6(2): 3-18.

Bandyra, K. J., N. Said, V. Pfeiffer, M. W. Górna, J. Vogel and B. F. Luisi (2012). "The seed region of a small RNA drives the controlled destruction of the target mRNA by the endoribonuclease RNase E." Molecular cell 47(6): 943-953.

Banga, S., P. Gao, X. Shen, V. Fiscus, W. X. Zong, L. Chen and Z. Q. Luo (2007). "Legionella pneumophila inhibits macrophage apoptosis by targeting pro-death members of the Bcl2 protein family." Proc Natl Acad Sci U S A 104(12): 5121-5126.

Barker, M. M., T. Gaal and R. L. Gourse (2001). "Mechanism of regulation of transcription initiation by ppGpp. II. Models for positive control based on properties of RNAP mutants and competition for RNAP." J Mol Biol 305(4): 689-702.

Bartfeld, S., C. Engels, B. Bauer, P. Aurass, A. Flieger, H. Brüggemann and T. F. Meyer (2009). "Temporal resolution of two-tracked NF-κB activation by Legionella pneumophila." Cellular Microbiology 11(11): 1638-1651.

Baskerville, A., R. B. Fitzgeorge, M. Broster, P. Hambleton and P. J. Dennis (1981). "Experimental transmission of legionnaires' disease by exposure to aerosols of Legionella pneumophila." Lancet 2(8260-61): 1389-1390.

234 Battesti, A., N. Majdalani and S. Gottesman (2011). "The RpoS-mediated general stress response in Escherichia coli." Annu Rev Microbiol 65: 189-213.

Baumler, A. J., J. G. Kusters, I. Stojiljkovic and F. Heffron (1994). "Salmonella typhimurium loci involved in survival within macrophages." Infect Immun 62(5): 1623-1630.

Beckers, M. C., S. i. Yoshida, K. Morgan, E. Skamene and P. Gros (1995). "Natural resistance to infection with Legionella pneumophila: chromosomal localization of the Lgn1 susceptibility gene." Mammalian Genome 6(8): 540-545.

Bedard, E., S. Fey, D. Charron, C. Lalancette, P. Cantin, P. Dolce, C. Laferriere, E. Deziel and M. Prevost (2015). "Temperature diagnostic to identify high risk areas and optimize Legionella pneumophila surveillance in hot water distribution systems." Water Res 71: 244-256.

Bednarska, N. G., J. Schymkowitz, F. Rousseau and J. V. Eldere (2013). "Protein aggregation in bacteria: the thin boundary between functionality and toxicity." Microbiology 159(Pt_9): 1795- 1806.

Beebe, K. D., J. Shin, J. Peng, C. Chaudhury, J. Khera and D. Pei (2000). "Substrate recognition through a PDZ domain in tail-specific protease." Biochemistry 39(11): 3149-3155.

Bence, N. F., R. M. Sampat and R. R. Kopito (2001). "Impairment of the ubiquitin-proteasome system by protein aggregation." Science 292(5521): 1552-1555.

Bennett, T. L., S. M. Kraft, B. J. Reaves, J. Mima, K. M. O'Brien and V. J. Starai (2013). "LegC3, an effector protein from Legionella pneumophila, inhibits homotypic yeast vacuole fusion in vivo and in vitro." PLoS One 8(2): e56798.

Berger, K. H., J. J. Merriam and R. R. Isberg (1994). "Altered intracellular targeting properties associated with mutations in the Legionella pneumophila dotA gene." Molecular Microbiology 14(4): 809-822.

Berk, S. G., G. Faulkner, E. Garduño, M. C. Joy, M. A. Ortiz-Jimenez and R. A. Garduño (2008). "Packaging of live Legionella pneumophila into pellets expelled by Tetrahymena spp. does not require bacterial replication and depends on a Dot/Icm-mediated survival mechanism." Applied and environmental microbiology 74(7): 2187-2199.

Bernardo, L. M., L. U. Johansson, D. Solera, E. Skarfstad and V. Shingler (2006). "The guanosine tetraphosphate (ppGpp) alarmone, DksA and promoter affinity for RNA polymerase in regulation of sigma-dependent transcription." Mol Microbiol 60(3): 749-764.

Bernhardt, T. G. and P. A. de Boer (2004). "Screening for synthetic lethal mutants in Escherichia coli and identification of EnvC (YibP) as a periplasmic septal ring factor with murein hydrolase activity." Mol Microbiol 52(5): 1255-1269.

Bittner, L.-M., J. Arends and F. Narberhaus (2017). "When, how and why? Regulated proteolysis by the essential FtsH protease in Escherichia coli." Biological Chemistry 398(5-6): 625-635.

235 Boamah, D. K., G. Zhou, A. W. Ensminger and T. J. O'Connor (2017). "From Many Hosts, One Accidental Pathogen: The Diverse Protozoan Hosts of Legionella." Front Cell Infect Microbiol 7: 477.

Boisset, S., T. Geissmann, E. Huntzinger, P. Fechter, N. Bendridi, M. Possedko, C. Chevalier, A. C. Helfer, Y. Benito, A. Jacquier, C. Gaspin, F. Vandenesch and P. Romby (2007). "Staphylococcus aureus RNAIII coordinately represses the synthesis of virulence factors and the transcription regulator Rot by an antisense mechanism." Genes & Development 21(11): 1353- 1366.

Borella, P., E. Guerrieri, I. Marchesi, M. Bondi and P. Messi (2005). "Water ecology of Legionella and protozoan: environmental and public health perspectives." Biotechnol Annu Rev 11: 355-380.

Borth, N., J. Massier, C. Franke, K. Sachse, H.-P. Saluz and F. Hänel (2010). "Chlamydial protease CT441 interacts with SRAP1 co-activator of estrogen receptor α and partially alleviates its co-activation activity." The Journal of Steroid Biochemistry and Molecular Biology 119(1-2): 89-95.

Bouyer, S., C. Imbert, M.-H. Rodier and Y. Héchard (2007). "Long-term survival of Legionella pneumophila associated with Acanthamoeba castellanii vesicles." Environmental Microbiology 9(5): 1341-1344.

Bozue, J. A. and W. Johnson (1996). "Interaction of Legionella pneumophila with Acanthamoeba castellanii: uptake by coiling phagocytosis and inhibition of phagosome- lysosome fusion." Infection and immunity 64(2): 668-673.

Bremer, H. and P. P. Dennis (2008). "Modulation of Chemical Composition and Other Parameters of the Cell at Different Exponential Growth Rates." EcoSal Plus 3(1).

Brieland, J., P. Freeman, R. Kunkel, C. Chrisp, M. Hurley, J. Fantone and C. Engleberg (1994). "Replicative Legionella pneumophila lung infection in intratracheally inoculated A/J mice. A murine model of human Legionnaires' disease." Am J Pathol 145(6): 1537-1546.

Brieland, J. K., D. G. Remick, P. T. Freeman, M. C. Hurley, J. C. Fantone and N. C. Engleberg (1995). "In vivo regulation of replicative Legionella pneumophila lung infection by endogenous tumor necrosis factor alpha and nitric oxide." Infect Immun 63(9): 3253-3258.

Brown, A. S., I. R. van Driel and E. L. Hartland (2013). "Mouse models of Legionnaires' disease." Curr Top Microbiol Immunol 376: 271-291.

Brown, C. L., E. Garner, G. Jospin, D. A. Coil, D. O. Schwake, J. A. Eisen, B. Mukhopadhyay and A. J. Pruden (2020). "Whole genome sequence analysis reveals the broad distribution of the RtxA type 1 secretion system and four novel putative type 1 secretion systems throughout the Legionella genus." PLOS ONE 15(1): e0223033.

Bruggemann, H., A. Hagman, M. Jules, O. Sismeiro, M. A. Dillies, C. Gouyette, F. Kunst, M. Steinert, K. Heuner, J. Y. Coppee and C. Buchrieser (2006). "Virulence strategies for infecting

236 phagocytes deduced from the in vivo transcriptional program of Legionella pneumophila." Cell Microbiol 8(8): 1228-1240.

Buck, E. D., I. Lebeau, L. Maes, N. Geukens, E. Meyen, L. V. Mellaert, J. Anné and E. Lammertyn (2004). "A putative twin-arginine translocation pathway in Legionella pneumophila." Biochemical and Biophysical Research Communications 317(2): 654-661.

Buck, E. D., L. Maes, E. Meyen, L. V. Mellaert, N. Geukens, J. Anné and E. Lammertyn (2005). "Legionella pneumophila Philadelphia-1 tatB and tatC affect intracellular replication and biofilm formation." Biochemical and Biophysical Research Communications 331(4): 1413-1420.

Bumgarner, R. (2013). "Overview of DNA microarrays: types, applications, and their future." Curr Protoc Mol Biol Chapter 22: Unit 22 21.

Byrne, B. and M. S. Swanson (1998). "Expression of Legionella pneumophila virulence traits in response to growth conditions." Infect Immun 66(7): 3029-3034.

Cambronne, E. D. and C. R. Roy (2007). "The Legionella pneumophila IcmSW complex interacts with multiple Dot/Icm effectors to facilitate type IV translocation." PLoS Pathog 3(12): e188.

Capra, E. J. and M. T. Laub (2012). "Evolution of two-component signal transduction systems." Annu Rev Microbiol 66: 325-347.

Carrier, M. C., D. Lalaouna and E. Masse (2016). "A game of tag: MAPS catches up on RNA interactomes." RNA Biol 13(5): 473-476.

Carroll, R. K., F. E. Rivera, C. K. Cavaco, G. M. Johnson, D. Martin and L. N. Shaw (2014). "The lone S41 family C-terminal processing protease in Staphylococcus aureus is localized to the cell wall and contributes to virulence." Microbiology 160(Pt 8): 1737-1748.

Caswell, C. C., J. M. Gaines, P. Ciborowski, D. Smith, C. H. Borchers, C. M. Roux, K. Sayood, P. M. Dunman and R. M. Roop Ii (2012). "Identification of two small regulatory RNAs linked to virulence in Brucella abortus 2308." Mol Microbiol 85(2): 345-360.

Caterino, U. (2013). "Instability of Gait as an Extrapulmonary Sequela in Acute Legionella Pneumonia: A Case Report." The Journal of Emergency Medicine 44(1): e13-e15.

Cazalet, C., S. Jarraud, Y. Ghavi-Helm, F. Kunst, P. Glaser, J. Etienne and C. Buchrieser (2008). "Multigenome analysis identifies a worldwide distributed epidemic Legionella pneumophila clone that emerged within a highly diverse species." Genome research 18(3): 431-441.

CDC (2018). "What Owners and Managers of Buildings and Healthcare Facilities Need to Know about the Growth and Spread of Legionella."

Centers for Disease, C. and Prevention (2011). "Legionellosis --- United States, 2000-2009." MMWR Morb Mortal Wkly Rep 60(32): 1083-1086.

237 Chaba, R., I. L. Grigorova, J. M. Flynn, T. A. Baker and C. A. Gross (2007). "Design principles of the proteolytic cascade governing the SigmaE-mediated envelope stress response in Escherichia coli: keys to graded, buffered, and rapid signal transduction." Genes & Development 21(1): 124-136.

Chabelskaya, S., O. Gaillot and B. Felden (2010). "A Staphylococcus aureus small RNA is required for bacterial virulence and regulates the expression of an immune-evasion molecule." PLoS pathogens 6(6): e1000927.

Chakravarty, S. and E. Masse (2019). "RNA-Dependent Regulation of Virulence in Pathogenic Bacteria." Front Cell Infect Microbiol 9: 337.

Chapman, E., G. W. Farr, R. Usaite, K. Furtak, W. A. Fenton, T. K. Chaudhuri, E. R. Hondorp, R. G. Matthews, S. G. Wolf, J. R. Yates, M. Pypaert and A. L. Horwich (2006). "Global aggregation of newly translated proteins in an Escherichia coli strain deficient of the chaperonin GroEL." Proceedings of the National Academy of Sciences 103(43): 15800-15805.

Chareyre, S. and P. Mandin (2018). "Bacterial Iron Homeostasis Regulation by sRNAs." Microbiol Spectr 6(2).

Charpentier, X., J. E. Gabay, M. Reyes, J. W. Zhu, A. Weiss and H. A. Shuman (2009). "Chemical genetics reveals bacterial and host cell functions critical for type IV effector translocation by Legionella pneumophila." PLoS Pathog 5(7): e1000501.

Chen, J., K. S. de Felipe, M. Clarke, H. Lu, O. R. Anderson, G. Segal and H. A. Shuman (2004). "Legionella Effectors That Promote Nonlytic Release from Protozoa." Science 303(5662): 1358- 1361.

Chiaruttini, C. and M. Guillier (2019). "On the role of mRNA secondary structure in bacterial translation." Wiley interdisciplinary reviews. RNA 11(3): e1579.

Chien, M., I. Morozova, S. Shi, H. Sheng, J. Chen, S. M. Gomez, G. Asamani, K. Hill, J. Nuara, M. Feder, J. Rineer, J. J. Greenberg, V. Steshenko, S. H. Park, B. Zhao, E. Teplitskaya, J. R. Edwards, S. Pampou, A. Georghiou, I. C. Chou, W. Iannuccilli, M. E. Ulz, D. H. Kim, A. Geringer-Sameth, C. Goldsberry, P. Morozov, S. G. Fischer, G. Segal, X. Qu, A. Rzhetsky, P. Zhang, E. Cayanis, P. J. De Jong, J. Ju, S. Kalachikov, H. A. Shuman and J. J. Russo (2004). "The genomic sequence of the accidental pathogen Legionella pneumophila." Science 305(5692): 1966-1968.

Choy, A., J. Dancourt, B. Mugo, T. J. O'Connor, R. R. Isberg, T. J. Melia and C. R. Roy (2012). "The Legionella effector RavZ inhibits host autophagy through irreversible Atg8 deconjugation." Science (New York, N.Y.) 338(6110): 1072-1076.

Christiansen, J. K., J. S. Nielsen, T. Ebersbach, P. Valentin-Hansen, L. Sogaard-Andersen and B. H. Kallipolitis (2006). "Identification of small Hfq-binding RNAs in Listeria monocytogenes." RNA 12(7): 1383-1396.

238 Cianciotto, N. P. (2013). "Type II secretion and Legionella virulence." Curr Top Microbiol Immunol 376: 81-102.

Cifuentes-Goches, J. C., L. Hernández-Ancheyta, G. Guarneros, N. Oviedo and J. Hernández- Sánchez (2019). "Domains two and three of Escherichia coli ribosomal S1 protein confers 30S subunits a high affinity for downstream A/U-rich mRNAs." The Journal of Biochemistry.

Cirillo, S. L., L. E. Bermudez, S. H. El-Etr, G. E. Duhamel and J. D. Cirillo (2001). "Legionella pneumophila entry gene rtxA is involved in virulence." Infect Immun 69(1): 508-517.

Cirillo, S. L. G., L. Yan, M. Littman, M. M. Samrakandi and J. D. Cirillo (2002). "Role of the Legionella pneumophila rtxA gene in amoebae." Microbiology 148(6): 1667-1677.

Collet, A., P. Cosette, C. Beloin, J.-M. Ghigo, C. Rihouey, P. Lerouge, G.-A. Junter and T. Jouenne (2008). "Impact of rpoS Deletion on the Proteome of Escherichia coli Grown Planktonically and as Biofilm." Journal of Proteome Research 7(11): 4659-4669.

Cooper, S. and T. Ruettinger (1975). "A temperature sensitive nonsense mutation affecting the synthesis of a major protein of Escherichia coli K12." Mol Gen Genet 139(2): 167-176.

Corcoran, C. P., D. Podkaminski, K. Papenfort, J. H. Urban, J. C. D. Hinton and J. Vogel (2012a). "Superfolder GFP reporters validate diverse new mRNA targets of the classic porin regulator, MicF RNA." Molecular microbiology 84(3): 428-445.

Corcoran, C. P., R. Rieder, D. Podkaminski, B. Hofmann and J. Vogel (2012b). "Use of aptamer tagging to identify in vivo protein binding partners of small regulatory RNAs." Methods Mol Biol 905: 177-200.

Correia, A. M., J. S. Ferreira, V. Borges, A. Nunes, B. Gomes, R. Capucho, J. Goncalves, D. M. Antunes, S. Almeida, A. Mendes, M. Guerreiro, D. A. Sampaio, L. Vieira, J. Machado, M. J. Simoes, P. Goncalves and J. P. Gomes (2016). "Probable Person-to-Person Transmission of Legionnaires' Disease." N Engl J Med 374(5): 497-498.

Costanzo, A., H. Nicoloff, S. E. Barchinger, A. B. Banta, R. L. Gourse and S. E. Ades (2008). "ppGpp and DksA likely regulate the activity of the extracytoplasmic stress factor sigmaE in Escherichia coli by both direct and indirect mechanisms." Mol Microbiol 67(3): 619-632.

Creasey, E. A. and R. R. Isberg (2012). "The protein SdhA maintains the integrity of the Legionella-containing vacuole." Proceedings of the National Academy of Sciences 109(9): 3481- 3486.

Crepin, S., J. Harel and C. M. Dozois (2012). "Chromosomal complementation using Tn7 transposon vectors in Enterobacteriaceae." Appl Environ Microbiol 78(17): 6001-6008.

Dahl, J.-U., M. J. Gray and U. Jakob (2015). "Protein quality control under oxidative stress conditions." Journal of molecular biology 427(7): 1549-1563.

239 Dalebroux, Z. D., R. L. Edwards and M. S. Swanson (2009). "SpoT governs Legionella pneumophila differentiation in host macrophages." Molecular Microbiology 71(3): 640-658.

Dalebroux, Z. D., B. F. Yagi, T. Sahr, C. Buchrieser and M. S. Swanson (2010). "Distinct roles of ppGpp and DksA in Legionella pneumophila differentiation." Mol Microbiol 76(1): 200-219.

Danese, P. N., W. B. Snyder, C. L. Cosma, L. J. Davis and T. J. Silhavy (1995). "The Cpx two- component signal transduction pathway of Escherichia coli regulates transcription of the gene specifying the stress-inducible periplasmic protease, DegP." Genes Dev 9(4): 387-398.

Darfeuille, F., C. Unoson, J. Vogel and E. G. H. Wagner (2007). "An Antisense RNA Inhibits Translation by Competing with Standby Ribosomes." Molecular Cell 26(3): 381-392.

Dartigalongue, C., D. Missiakas and S. Raina (2001). "Characterization of the Escherichia coli sigma E regulon." J Biol Chem 276(24): 20866-20875.

Davies, B. W., R. W. Bogard, T. S. Young and J. J. Mekalanos (2012). "Coordinated regulation of accessory genetic elements produces cyclic di-nucleotides for V. cholerae virulence." Cell 149(2): 358-370.

Davis, B. M., M. Quinones, J. Pratt, Y. Ding and M. K. Waldor (2005). "Characterization of the Small Untranslated RNA RyhB and Its Regulon in Vibrio cholerae." Journal of Bacteriology 187(12): 4005-4014. de Felipe, K. S., R. T. Glover, X. Charpentier, O. R. Anderson, M. Reyes, C. D. Pericone and H. A. Shuman (2008). "Legionella eukaryotic-like type IV substrates interfere with organelle trafficking." PLoS Pathog 4(8): e1000117.

De Wulf, P., O. Kwon and E. C. Lin (1999). "The CpxRA signal transduction system of Escherichia coli: growth-related autoactivation and control of unanticipated target operons." J Bacteriol 181(21): 6772-6778.

DebRoy, S., M. Gebbie, A. Ramesh, J. R. Goodson, M. R. Cruz, A. v. Hoof, W. C. Winkler and D. A. Garsin (2014). "Riboswitches. A riboswitch-containing sRNA controls gene expression by sequestration of a response regulator." Science (New York, N.Y.) 345(6199): 937-940.

Deen, J., M. A. Mengel and J. D. Clemens (2020). "Epidemiology of cholera." Vaccine 38 Suppl 1: A31-A40.

Delafont, V., M. H. Rodier, E. Maisonneuve and E. Cateau (2018). "Vermamoeba vermiformis: a Free-Living Amoeba of Interest." Microb Ecol 76(4): 991-1001.

Desgranges, E., I. Caldelari, S. Marzi and D. Lalaouna (2020). "Navigation through the twists and turns of RNA sequencing technologies: Application to bacterial regulatory RNAs." Biochim Biophys Acta Gene Regul Mech 1863(3): 194506.

Desnoyers, G. and E. Masse (2012). "Noncanonical repression of translation initiation through small RNA recruitment of the RNA chaperone Hfq." Genes Dev 26(7): 726-739.

240 Devos, L., K. Clymans, N. Boon and W. Verstraete (2005). "Evaluation of nested PCR assays for the detection of Legionella pneumophila in a wide range of aquatic samples." Journal of Applied Microbiology 99(4): 916-925.

Diederen, B. M. W. (2008). "Legionella spp. and Legionnaires' disease." Journal of Infection 56(1): 1-12.

Dietrich, W. F., D. M. Damron, R. R. Isberg, E. S. Lander and M. S. Swanson (1995). "Lgn1, a gene that determines susceptibility to Legionella pneumophila, maps to mouse chromosome 13." Genomics 26(3): 443-450.

Diez, E., S. H. Lee, S. Gauthier, Z. Yaraghi, M. Tremblay, S. Vidal and P. Gros (2003). "Birc1e is the gene within the Lgn1 locus associated with resistance to Legionella pneumophila." Nat Genet 33(1): 55-60.

Diez, E., Z. Yaraghi, A. MacKenzie and P. Gros (2000). "The Neuronal Apoptosis Inhibitory Protein (Naip) Is Expressed in Macrophages and Is Modulated After Phagocytosis and During Intracellular Infection with Legionella pneumophila." The Journal of Immunology 164(3): 1470- 1477.

Dong, T. and H. E. Schellhorn (2010). "Role of RpoS in virulence of pathogens." Infect Immun 78(3): 887-897.

Durfee, T., A. M. Hansen, H. Zhi, F. R. Blattner and D. J. Jin (2008). "Transcription profiling of the stringent response in Escherichia coli." J Bacteriol 190(3): 1084-1096.

Durieux, I., C. Ginevra, L. Attaiech, K. Picq, P. A. Juan, S. Jarraud and X. Charpentier (2019). "Diverse conjugative elements silence natural transformation in Legionella species." Proc Natl Acad Sci U S A 116(37): 18613-18618.

ECDC (2018). European Centre for Disease Prevention and Control. Legionnaires’ disease. In: ECDC. Annual epidemiological report for 2016. Stockholm: ECDC; 2018.

ECDC (2019). European Centre for Disease Prevention and Control. Legionnaires’ disease. In: ECDC. Annual epidemiological report for 2017. Stockholm: ECDC; 2019.

Edelstein, P. H. (1993). "Legionnaires' Disease." Clinical Infectious Diseases 16(6): 741-749.

Edwards, R. L., M. Jules, T. Sahr, C. Buchrieser and M. S. Swanson (2010). "The Legionella pneumophila LetA/LetS two-component system exhibits rheostat-like behavior." Infection and immunity 78(6): 2571-2583.

Eggenhofer, F., H. Tafer, P. F. Stadler and I. L. Hofacker (2011). "RNApredator: fast accessibility-based prediction of sRNA targets." Nucleic Acids Res 39(Web Server issue): W149-154.

Eisenreich, W. and K. Heuner (2016). "The life stage-specific pathometabolism of Legionella pneumophila." FEBS Lett 590(21): 3868-3886.

241 Elliott, J. A. and W. C. Winn, Jr. (1986). "Treatment of alveolar macrophages with cytochalasin D inhibits uptake and subsequent growth of Legionella pneumophila." Infect Immun 51(1): 31- 36.

Ellis, M. J., R. S. Trussler and D. B. Haniford (2015). "A cis-encoded sRNA, Hfq and mRNA secondary structure act independently to suppress IS200 transposition." Nucleic Acids Res 43(13): 6511-6527.

Ensminger, A. W. (2016). "Legionella pneumophila, armed to the hilt: justifying the largest arsenal of effectors in the bacterial world." Curr Opin Microbiol 29: 74-80.

Faith, N. (2013). Cognac: The story of the world's greatest brandy, Infinite Ideas Limited.

Faith, N. (2015). Nicholas Faith's guide to cognac, Infinite Ideas Limited.

Faucher, S. P., G. Friedlander, J. Livny, H. Margalit and H. A. Shuman (2010). "Legionella pneumophila 6S RNA optimizes intracellular multiplication." Proc Natl Acad Sci U S A 107(16): 7533-7538.

Faucher, S. P., C. A. Mueller and H. A. Shuman (2011). "Legionella Pneumophila Transcriptome during Intracellular Multiplication in Human Macrophages." Front Microbiol 2: 60.

Faucher, S. P. and H. A. Shuman (2011). "Small Regulatory RNA and Legionella pneumophila." Front Microbiol 2: 98.

Faucher, S. P. and H. A. Shuman (2013). "Methods to study legionella transcriptome in vitro and in vivo." Methods Mol Biol 954: 567-582.

Faulkner, G., S. G. Berk, E. Garduño, M. A. Ortiz-Jiménez and R. A. Garduño (2008). "Passage through Tetrahymena tropicalis triggers a rapid morphological differentiation in Legionella pneumophila." Journal of bacteriology 190(23): 7728-7738.

Faulkner, G. and R. A. Garduno (2002). "Ultrastructural analysis of differentiation in Legionella pneumophila." J Bacteriol 184(24): 7025-7041.

Feeley, J. C., R. J. Gibson, G. W. Gorman, N. C. Langford, J. K. Rasheed, D. C. Mackel and W. B. Baine (1979). "Charcoal-yeast extract agar: primary isolation medium for Legionella pneumophila." J Clin Microbiol 10(4): 437-441.

Feldheim, Y. S., T. Zusman, Y. Speiser and G. Segal (2016). "The Legionella pneumophila CpxRA two‐component regulatory system: new insights into CpxR’s function as a dual regulator and its connection to the effectors regulatory network." Molecular Microbiology 99(6): 1059- 1079.

Feldman, A. R., J. Lee, B. Delmas and M. Paetzel (2006). "Crystal structure of a novel viral protease with a serine/lysine catalytic dyad mechanism." J Mol Biol 358(5): 1378-1389.

242 Feng, L., S. T. Rutherford, K. Papenfort, J. D. Bagert, J. C. van Kessel, D. A. Tirrell, N. S. Wingreen and B. L. Bassler (2015). "A qrr noncoding RNA deploys four different regulatory mechanisms to optimize quorum-sensing dynamics." Cell 160(1-2): 228-240.

Fernandez-Moreira, E., J. H. Helbig and M. S. Swanson (2006). "Membrane vesicles shed by Legionella pneumophila inhibit fusion of phagosomes with lysosomes." Infect Immun 74(6): 3285-3295.

Ferrer, M., S. Henriet, C. Chamontin, S. Laine and M. Mougel (2016). "From Cells to Virus Particles: Quantitative Methods to Monitor RNA Packaging." Viruses 8(8).

Ferrières, L., A. Thompson and D. J. Clarke (2009). "Elevated levels of σ S inhibit biofilm formation in Escherichia coli: a role for the Rcs phosphorelay." Microbiology 155(11): 3544- 3553.

Fettes, P. S., V. Forsbach-Birk, D. Lynch and R. Marre (2001). "Overexpresssion of a homologue of the regulator affects cell size, flagellation, and pigmentation." International Journal of Medical Microbiology 291(5): 353-360.

Fields, B. S., R. F. Benson and R. E. Besser (2002). "Legionella and Legionnaires' disease: 25 years of investigation." Clin Microbiol Rev 15(3): 506-526.

Finsel, I. and H. Hilbi (2015). "Formation of a pathogen vacuole according to Legionella pneumophila: how to kill one bird with many stones." Cellular Microbiology 17(7): 935-950.

Fontana, M. F., S. Banga, K. C. Barry, X. Shen, Y. Tan, Z.-Q. Luo and R. E. Vance (2011). "Secreted bacterial effectors that inhibit host protein synthesis are critical for induction of the innate immune response to virulent Legionella pneumophila." PLoS pathogens 7(2): e1001289.

Forsbach-Birk, V., T. McNealy, C. Shi, D. Lynch and R. Marre (2004). "Reduced expression of the global regulator protein CsrA in Legionella pneumophila affects virulence-associated regulators and growth in Acanthamoeba castellanii." Int J Med Microbiol 294(1): 15-25.

Fortier, A., S. P. Faucher, K. Diallo and P. Gros (2011). "Global cellular changes induced by Legionella pneumophila infection of bone marrow-derived macrophages." Immunobiology 216(12): 1274-1285.

Franco, I. S., N. Shohdy and H. A. Shuman (2012). "The Legionella pneumophila effector VipA is an actin nucleator that alters host cell organelle trafficking." PLoS Pathog 8(2): e1002546.

Franco, I. S., H. A. Shuman and X. Charpentier (2009). "The perplexing functions and surprising origins of Legionella pneumophila type IV secretion effectors." Cell Microbiol 11(10): 1435- 1443.

Franze de Fernandez, M. T., L. Eoyang and J. T. August (1968). "Factor fraction required for the synthesis of bacteriophage Qbeta-RNA." Nature 219(5154): 588-590.

243 Fraser, D. W., T. R. Tsai, W. Orenstein, W. E. Parkin, H. J. Beecham, R. G. Sharrar, J. Harris, G. F. Mallison, S. M. Martin, J. E. McDade, C. C. Shepard and P. S. Brachman (1977). "Legionnaires' disease: description of an epidemic of pneumonia." N Engl J Med 297(22): 1189- 1197.

Frey, J., M. M. Bagdasarian and M. Bagdasarian (1992). "Replication and copy number control of the broad-host-range plasmid RSF1010." Gene 113(1): 101-106.

Friedman, H., Y. Yamamoto and T. W. Klein (2002). "Legionella pneumophila pathogenesis and immunity." Seminars in Pediatric Infectious Diseases 13(4): 273-279.

Fröhlich, K. S. and K. Papenfort (2020). "Regulation outside the box: new mechanisms for small RNAs." Molecular Microbiology.

Frohlich, K. S., K. Papenfort, A. A. Berger and J. Vogel (2012). "A conserved RpoS-dependent small RNA controls the synthesis of major porin OmpD." Nucleic Acids Res 40(8): 3623-3640.

Fuche, F., A. Vianney, C. Andrea, P. Doublet and C. Gilbert (2015). "Functional Type 1 Secretion System Involved in Legionella pneumophila Virulence." Journal of Bacteriology 197(3): 563-571.

Fuentes, J. A., N. Villagra, M. Castillo-Ruiz and G. C. Mora (2008). "The Salmonella Typhi hlyE gene plays a role in invasion of cultured epithelial cells and its functional transfer to S. Typhimurium promotes deep organ infection in mice." Res Microbiol 159(4): 279-287.

Fujita, M., S. Ikegame, E. Harada, H. Ouchi, I. Inoshima, K. Watanabe, S. Yoshida and Y. Nakanishi (2008). "TNF receptor 1 and 2 contribute in different ways to resistance to Legionella pneumophila-induced mortality in mice." Cytokine 44(2): 298-303.

Gal-Mor, O. and G. Segal (2003a). "Identification of CpxR as a positive regulator of icm and dot virulence genes of Legionella pneumophila." J Bacteriol 185(16): 4908-4919.

Gal-Mor, O. and G. Segal (2003b). "The Legionella pneumophila GacA homolog (LetA) is involved in the regulation of icm virulence genes and is required for intracellular multiplication in Acanthamoeba castellanii." Microb Pathog 34(4): 187-194.

Gamer, J., H. Bujard and B. Bukau (1992). "Physical interaction between heat shock proteins DnaK, DnaJ, and GrpE and the bacterial heat shock transcription factor σ32." Cell 69(5): 833- 842.

Gamer, J., G. Multhaup, T. Tomoyasu, J. S. McCarty, S. Rüdiger, H. J. Schönfeld, C. Schirra, H. Bujard and B. Bukau (1996). "A cycle of binding and release of the DnaK, DnaJ and GrpE chaperones regulates activity of the Escherichia coli heat shock transcription factor sigma32." The EMBO Journal 15(3): 607-617.

Gan, N., E. S. Nakayasu, P. J. Hollenbeck and Z.-Q. Luo (2018). "Legionella pneumophila inhibits immune signalling via MavC-mediated transglutaminase-induced ubiquitination of UBE2N." Nature microbiology 4(1): 134-143.

244 Gan, N., E. S. Nakayasu, P. J. Hollenbeck and Z. Q. Luo (2019). "Legionella pneumophila inhibits immune signalling via MavC-mediated transglutaminase-induced ubiquitination of UBE2N." Nat Microbiol 4(1): 134-143.

Gao, L.-Y. and Y. A. Kwaik (1999). "Apoptosis in Macrophages and Alveolar Epithelial Cells during Early Stages of Infection by Legionella pneumophila and Its Role in Cytopathogenicity." Infection and Immunity 67(2): 862-870.

Gao, R. and A. M. Stock (2010). "Molecular strategies for phosphorylation-mediated regulation of response regulator activity." Current opinion in microbiology 13(2): 160-167.

Garduno, R. A., E. Garduno, M. Hiltz and P. S. Hoffman (2002). "Intracellular growth of Legionella pneumophila gives rise to a differentiated form dissimilar to stationary-phase forms." Infect Immun 70(11): 6273-6283.

Garrison, L. E., J. M. Kunz, L. A. Cooley, M. R. Moore, C. Lucas, S. Schrag, J. Sarisky and C. G. Whitney (2016). "Vital Signs: Deficiencies in Environmental Control Identified in Outbreaks of Legionnaires' Disease - North America, 2000-2014." MMWR Morb Mortal Wkly Rep 65(22): 576-584.

Gaspar, A. H. and M. P. Machner (2014). "VipD is a Rab5-activated phospholipase A1 that protects Legionella pneumophila from endosomal fusion." Proc Natl Acad Sci U S A 111(12): 4560-4565.

Ge, J., Y. N. Gong, Y. Xu and F. Shao (2012). "Preventing bacterial DNA release and absent in melanoma 2 inflammasome activation by a Legionella effector functioning in membrane trafficking." Proc Natl Acad Sci U S A 109(16): 6193-6198.

Ge, J., H. Xu, T. Li, Y. Zhou, Z. Zhang, S. Li, L. Liu and F. Shao (2009). "A Legionella type IV effector activates the NF-kappaB pathway by phosphorylating the IkappaB family of inhibitors." Proceedings of the National Academy of Sciences of the United States of America 106(33): 13725-13730.

Geisinger, E., R. P. Adhikari, R. Jin, H. F. Ross and R. P. Novick (2006). "Inhibition of rot translation by RNAIII, a key feature of agr function." Molecular Microbiology 61(4): 1038-1048.

Geissmann, T. A. and D. Touati (2004). "Hfq, a new chaperoning role: binding to messenger RNA determines access for small RNA regulator." EMBO J 23(2): 396-405.

Giambruno, R., M. Mihailovich and T. Bonaldi (2018). "Mass Spectrometry-Based Proteomics to Unveil the Non-coding RNA World." Front Mol Biosci 5: 90.

Giangrossi, M., G. Prosseda, C. N. Tran, A. Brandi, B. Colonna and M. Falconi (2010). "A novel antisense RNA regulates at transcriptional level the virulence gene icsA of Shigella flexneri." Nucleic acids research 38(10): 3362-3375.

245 Girard, R., T. Pedron, S. Uematsu, V. Balloy, M. Chignard, S. Akira and R. Chaby (2003). "Lipopolysaccharides from Legionella and Rhizobium stimulate mouse bone marrow granulocytes via Toll-like receptor 2." J Cell Sci 116(Pt 2): 293-302.

Goemans, C. V., D. Vertommen, R. Agrebi and J.-F. Collet (2018). "CnoX Is a Chaperedoxin: A Holdase that Protects Its Substrates from Irreversible Oxidation." Molecular cell 70(4): 614- 627.e617.

Gottesman, S. (2004). "The small RNA regulators of Escherichia coli: roles and mechanisms." Annu Rev Microbiol 58: 303-328.

Green, E. R. and J. Mecsas (2016). "Bacterial Secretion Systems: An Overview." Microbiol Spectr 4(1).

Grossman, A. D., J. W. Erickson and C. A. Gross (1984). "The htpR gene product of E. coli is a sigma factor for heat-shock promoters." Cell 38(2): 383-390.

Grossman, A. D., D. B. Straus, W. A. Walter and C. A. Gross (1987). "Sigma 32 synthesis can regulate the synthesis of heat shock proteins in Escherichia coli." Genes & Development 1(2): 179-184.

Guillier, M. and S. Gottesman (2006). "Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs." Molecular Microbiology 59(1): 231-247.

Guisbert, E., C. Herman, C. Z. Lu and C. A. Gross (2004). "A chaperone network controls the heat shock response in E. coli." Genes & Development 18(22): 2812-2821.

Guo, Z., R. Stephenson, J. Qiu, S. Zheng and Z. Q. Luo (2014). "A Legionella effector modulates host cytoskeletal structure by inhibiting actin polymerization." Microbes Infect 16(3): 225-236.

Gupta, K. R. and D. Chatterji (2016). Sigma Factor Competition in Escherichia coli: Kinetic and Thermodynamic Perspectives. Stress and Environmental Regulation of Gene Expression and Adaptation in Bacteria: 196-202.

Gur, E. and R. T. Sauer (2008). "Recognition of misfolded proteins by Lon, a AAA(+) protease." Genes & development 22(16): 2267-2277.

Hales, L. M. and H. A. Shuman (1999). "The Legionella pneumophila rpoS gene is required for growth within Acanthamoeba castellanii." J Bacteriol 181(16): 4879-4889.

Hammer, B. K. and M. S. Swanson (1999). "Co-ordination of Legionella pneumophila virulence with entry into stationary phase by ppGpp." Mol Microbiol 33(4): 721-731.

Hammer, B. K., E. S. Tateda and M. S. Swanson (2002). "A two-component regulator induces the transmission phenotype of stationary-phase Legionella pneumophila." Mol Microbiol 44(1): 107-118.

246 Hara, H., Y. Yamamoto, A. Higashitani, H. Suzuki and Y. Nishimura (1991). "Cloning, mapping, and characterization of the Escherichia coli prc gene, which is involved in C-terminal processing of penicillin-binding protein 3." J Bacteriol 173(15): 4799-4813.

Harada, T., M. Miyake and Y. Imai (2007). "Evasion of Legionella pneumophila from the bactericidal system by reactive oxygen species (ROS) in macrophages." Microbiol Immunol 51(12): 1161-1170.

He, X. L., Q. Wang, L. Peng, Y.-R. Qu, S. Puthiyakunnon, X.-L. Liu, C. Y. Hui, S. Boddu, H. Cao and S.-H. Huang (2015). "Role of uropathogenic Escherichia coli outer membrane protein T in pathogenesis of urinary tract infection." Pathogens and Disease 73(3): ftv006.

Henne, K., L. Kahlisch, M. G. Hofle and I. Brettar (2013). "Seasonal dynamics of bacterial community structure and composition in cold and hot drinking water derived from surface water reservoirs." Water Res 47(15): 5614-5630.

Hennessy, T. M. (2020a). "Hennessy from grape to bottle." Retrieved 22-08-2020, from https://www.hennessy.com/en-us/maison/from-grape-to-bottle.

Hennessy, T. M. (2020b). "Quest for excellence." Retrieved 27-08-2020, from https://www.hennessy.com/en-int/maison/quest-excellence.

Herman, C., D. Thevenet, R. D'Ari and P. Bouloc (1995). "Degradation of sigma 32, the heat shock regulator in Escherichia coli, is governed by HflB." Proc Natl Acad Sci U S A 92(8): 3516-3520.

Hernandez, S. B., J. A. Ayala, G. Rico-Perez, F. Garcia-del Portillo and J. Casadesus (2013). "Increased bile resistance in Salmonella enterica mutants lacking Prc periplasmic protease." Int Microbiol 16(2): 87-92.

Heuner, K., C. Dietrich, C. Skriwan, M. Steinert and J. Hacker (2002). "Influence of the alternative sigma(28) factor on virulence and flagellum expression of Legionella pneumophila." Infect Immun 70(3): 1604-1608.

Heuner, K. and M. Steinert (2003). "The flagellum of Legionella pneumophila and its link to the expression of the virulent phenotype." Int J Med Microbiol 293(2-3): 133-143.

Hilbi, H., G. Segal and H. A. Shuman (2001). "Icm/Dot‐dependent upregulation of phagocytosis by Legionella pneumophila." Molecular Microbiology 42(3): 603-617.

Hindre, T., H. Bruggemann, C. Buchrieser and Y. Hechard (2008). "Transcriptional profiling of Legionella pneumophila biofilm cells and the influence of iron on biofilm formation." Microbiology 154(Pt 1): 30-41.

Hiratsu, K., M. Amemura, H. Nashimoto, H. Shinagawa and K. Makino (1995). "The rpoE gene of Escherichia coli, which encodes sigma E, is essential for bacterial growth at high temperature." J Bacteriol 177(10): 2918-2922.

247 Hobbs, J. K. and A. B. Boraston (2019). "(p)ppGpp and the Stringent Response: An Emerging Threat to Antibiotic Therapy." ACS Infect Dis 5(9): 1505-1517.

Hoch, J. A. and K. I. Varughese (2001). "Keeping Signals Straight in Phosphorelay Signal Transduction." Journal of Bacteriology 183(17): 4941-4949.

Hoge, R., M. Laschinski, K. E. Jaeger, S. Wilhelm and F. Rosenau (2011). "The subcellular localization of a C-terminal processing protease in Pseudomonas aeruginosa." FEMS Microbiol Lett 316(1): 23-30.

Holmqvist, E., L. Li, T. Bischler, L. Barquist and J. Vogel (2018). "Global Maps of ProQ Binding In Vivo Reveal Target Recognition via RNA Structure and Stability Control at mRNA 3' Ends." Molecular cell 70(5): 971-982.e976.

Holmqvist, E. and E. G. H. Wagner (2017). "Impact of bacterial sRNAs in stress responses." Biochem Soc Trans 45(6): 1203-1212.

Hookey, J. V., N. A. Saunders, N. K. Fry, R. J. Birtles and T. G. Harrison (1996). "Phylogeny of Legionellaceae Based on Small-Subunit Ribosomal DNA Sequences and Proposal of Legionella lytica comb. nov. for Legionella-Like Amoebal Pathogens." International Journal of Systematic Bacteriology 46(2): 526-531.

Horwitz, M. A. (1983a). "Formation of a novel phagosome by the Legionnaires' disease bacterium (Legionella pneumophila) in human monocytes." J Exp Med 158(4): 1319-1331.

Horwitz, M. A. (1983b). "The Legionnaires' disease bacterium (Legionella pneumophila) inhibits phagosome-lysosome fusion in human monocytes." J Exp Med 158(6): 2108-2126.

Horwitz, M. A. (1984). "Phagocytosis of the Legionnaires' disease bacterium (Legionella pneumophila) occurs by a novel mechanism: engulfment within a pseudopod coil." Cell 36(1): 27-33.

Hovel-Miner, G., S. Pampou, S. P. Faucher, M. Clarke, I. Morozova, P. Morozov, J. J. Russo, H. A. Shuman and S. Kalachikov (2009). "SigmaS controls multiple pathways associated with intracellular multiplication of Legionella pneumophila." J Bacteriol 191(8): 2461-2473.

Huang, S.-H., C.-K. Wang, H.-L. Peng, C.-C. Wu, Y.-T. Chen, Y.-M. Hong and C.-T. Lin (2012). "Role of the small RNA RyhB in the Fur regulon in mediating the capsular polysaccharide biosynthesis and iron acquisition systems in Klebsiella pneumoniae." BMC microbiology 12(1): 148.

Huang, W.-C., C.-Y. Lin, M. Hashimoto, J.-J. Wu, M.-C. Wang, W.-H. Lin, C.-S. Chen and C.- H. Teng (2020). "The role of the bacterial protease Prc in the uropathogenesis of extraintestinal pathogenic Escherichia coli." Journal of Biomedical Science 27(1): 14.

Hughes, E. D., B. G. Byrne and M. S. Swanson (2019). "A Two-Component System That Modulates Cyclic di-GMP Metabolism Promotes Legionella pneumophila Differentiation and Viability in Low-Nutrient Conditions." Journal of bacteriology 201(17).

248 Hunke, S., R. Keller and V. S. Muller (2012). "Signal integration by the Cpx-envelope stress system." FEMS Microbiol Lett 326(1): 12-22.

Ichimura, T., M. Yamazoe, M. Maeda, C. Wada and S. Hiraga (2002). "Proteolytic activity of YibP protein in Escherichia coli." J Bacteriol 184(10): 2595-2602.

Ingmundson, A., A. Delprato, D. G. Lambright and C. R. Roy (2007). "Legionella pneumophila proteins that regulate Rab1 membrane cycling." Nature 450(7168): 365-369.

Jakubczyk, K., K. Dec, J. Kaldunska, D. Kawczuga, J. Kochman and K. Janda (2020). "Reactive oxygen species - sources, functions, oxidative damage." Pol Merkur Lekarski 48(284): 124-127.

Janssen, K. H., M. R. Diaz, C. J. Gode, M. C. Wolfgang and T. L. Yahr (2018). "RsmV, a Small Noncoding Regulatory RNA in Pseudomonas aeruginosa That Sequesters RsmA and RsmF from Target mRNAs." Journal of bacteriology 200(16): e00277-00218.

Janzon, L. and S. Arvidson (1990). "The role of the delta-lysin gene (hld) in the regulation of virulence genes by the accessory gene regulator (agr) in Staphylococcus aureus." The EMBO Journal 9(5): 1391-1399.

Jayakumar, D., J. V. Early and H. M. Steinman (2012). "Virulence phenotypes of Legionella pneumophila associated with noncoding RNA lpr0035." Infect Immun 80(12): 4143-4153.

Jin, Y., R. M. Watt, A. Danchin and J. D. Huang (2009). "Small noncoding RNA GcvB is a novel regulator of acid resistance in Escherichia coli." BMC Genomics 10: 165.

Joller, N., R. Spörri, H. Hilbi and A. Oxenius (2007). "Induction and protective role of antibodies in Legionella pneumophila infection." European Journal of Immunology 37(12): 3414-3423.

Jørgensen, M. G., J. S. Nielsen, A. Boysen, T. Franch, J. Møller‐Jensen and P. Valentin‐Hansen (2012). "Small regulatory RNAs control the multi‐cellular adhesive lifestyle of Escherichia coli." Molecular Microbiology 84(1): 36-50.

Jørgensen, M. G., J. S. Pettersen and B. H. Kallipolitis (2020). "sRNA-mediated control in bacteria: An increasing diversity of regulatory mechanisms." Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms 1863(5): 194504.

Jørgensen, M. G., M. K. Thomason, J. Havelund, P. Valentin-Hansen and G. Storz (2013). "Dual function of the McaS small RNA in controlling biofilm formation." Genes & development 27(10): 1132-1145.

Jousselin, A., L. Metzinger and B. Felden (2009). "On the facultative requirement of the bacterial RNA chaperone, Hfq." Trends Microbiol 17(9): 399-405.

Jung, A. L., C. Stoiber, C. E. Herkt, C. Schulz, W. Bertrams and B. Schmeck (2016). "Legionella pneumophila-Derived Outer Membrane Vesicles Promote Bacterial Replication in Macrophages." PLOS Pathogens 12(4): e1005592.

249 Kall, L., A. Krogh and E. L. Sonnhammer (2007). "Advantages of combined transmembrane topology and signal peptide prediction--the Phobius web server." Nucleic Acids Res 35(Web Server issue): W429-432.

Kamath-Loeb, A. S. and C. A. Gross (1991). "Translational regulation of sigma 32 synthesis: requirement for an internal control element." Journal of Bacteriology 173(12): 3904-3906.

Kandror, O., A. DeLeon and A. L. Goldberg (2002). "Trehalose synthesis is induced upon exposure of Escherichia coli to cold and is essential for viability at low temperatures." Proceedings of the National Academy of Sciences 99(15): 9727-9732.

Kanehara, K., K. Ito and Y. Akiyama (2002). "YaeL (EcfE) activates the sigma E pathway of stress response through a site-2 cleavage of anti-sigma E, RseA." Genes & Development 16(16): 2147-2155.

Kanehara, K., K. Ito and Y. Akiyama (2003). "YaeL proteolysis of RseA is controlled by the PDZ domain of YaeL and a Gln-rich region of RseA." The EMBO Journal 22(23): 6389-6398.

Kanemori, M., K. Nishihara, H. Yanagi and T. Yura (1997). "Synergistic roles of HslVU and other ATP-dependent proteases in controlling in vivo turnover of sigma32 and abnormal proteins in Escherichia coli." J Bacteriol 179(23): 7219-7225.

Kantor, H. S., B. Temples and W. V. Shaw (1972). "Staphylococcal delta hemolysin: Purification and characterization." Archives of Biochemistry and Biophysics 151(1): 142-156.

Kawamoto, Y., Y. Morinaga, Y. Kimura, N. Kaku, K. Kosai, N. Uno, H. Hasegawa and K. Yanagihara (2017). "TNF-α inhibits the growth of Legionella pneumophila in airway epithelial cells by inducing apoptosis." Journal of Infection and Chemotherapy 23(1): 51-55.

Keiler, K. C. and R. T. Sauer (2002). "13 Tsp and Related Tail-Specific Proteases." The Enzymes 22: 373-386.

Keiler, K. C., K. R. Silber, K. M. Downard, I. A. Papayannopoulos, K. Biemann and R. T. Sauer (1995). "C-terminal specific protein degradation: activity and substrate specificity of the Tsp protease." Protein Sci 4(8): 1507-1515.

Keiler, K. C., P. R. Waller and R. T. Sauer (1996). "Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA." Science 271(5251): 990- 993.

Kessler, A., U. Schell, T. Sahr, A. Tiaden, C. Harrison, C. Buchrieser and H. Hilbi (2013). "The Legionella pneumophila orphan sensor kinase LqsT regulates competence and pathogen-host interactions as a component of the LAI-1 circuit." Environ Microbiol 15(2): 646-662.

Khandige, S., T. Kronborg, B. E. Uhlin and J. Moller-Jensen (2015). "sRNA-Mediated Regulation of P-Fimbriae Phase Variation in Uropathogenic Escherichia coli." PLoS Pathog 11(8): e1005109.

250 King, N. P., P. Newton, R. Schuelein, D. L. Brown, M. Petru, V. Zarsky, P. Dolezal, L. Luo, A. Bugarcic, A. C. Stanley, R. Z. Murray, B. M. Collins, R. D. Teasdale, E. L. Hartland and J. L. Stow (2015). "Soluble NSF attachment protein receptor molecular mimicry by a Legionella pneumophila Dot/Icm effector." Cell Microbiol 17(6): 767-784.

Klumpp, S. and T. Hwa (2008). "Growth-rate-dependent partitioning of RNA polymerases in bacteria." Proc Natl Acad Sci U S A 105(51): 20245-20250.

Kofoed, E. M. and R. E. Vance (2011). "Innate immune recognition of bacterial ligands by NAIPs determines inflammasome specificity." Nature 477(7366): 592-595.

Kolmar, H., P. R. Waller and R. T. Sauer (1996). "The DegP and DegQ periplasmic endoproteases of Escherichia coli: specificity for cleavage sites and substrate conformation." J Bacteriol 178(20): 5925-5929.

Kortmann, J., S. W. Brubaker and D. M. Monack (2015). "Cutting Edge: Inflammasome Activation in Primary Human Macrophages Is Dependent on Flagellin." J Immunol 195(3): 815- 819.

Koubar, M., M. H. Rodier, R. A. Garduno and J. Frere (2011). "Passage through Tetrahymena tropicalis enhances the resistance to stress and the infectivity of Legionella pneumophila." FEMS Microbiol Lett 325(1): 10-15.

Kragsbjerg, P., I. Jones, T. Vikerfors and H. Holmberg (1995). "Diagnostic value of blood cytokine concentrations in acute pneumonia." Thorax 50(12): 1253.

Kuchta, J. M., J. S. Navratil, M. E. Shepherd, R. M. Wadowsky, J. N. Dowling, S. J. States and R. B. Yee (1993). "Impact of Chlorine and Heat on the Survival of Hartmannella vermiformis and Subsequent Growth of Legionella pneumophila." Appl Environ Microbiol 59(12): 4096- 4100.

Kuhle, K. and A. Flieger (2013). "Legionella phospholipases implicated in virulence." Curr Top Microbiol Immunol 376: 175-209.

Kulkarni, P. R., X. Cui, J. W. Williams, A. M. Stevens and R. V. Kulkarni (2006). "Prediction of CsrA-regulating small RNAs in bacteria and their experimental verification in Vibrio fischeri." Nucleic Acids Res 34(11): 3361-3369.

Kumru, O. S., I. Bunikis, I. Sorokina, S. Bergstrom and W. R. Zuckert (2011). "Specificity and role of the Borrelia burgdorferi CtpA protease in outer membrane protein processing." J Bacteriol 193(20): 5759-5765.

Lacy, P. and J. L. Stow (2011). "Cytokine release from innate immune cells: association with diverse membrane trafficking pathways." Blood 118(1): 9-18.

Lad, S. P., G. Yang, D. A. Scott, G. Wang, P. Nair, J. Mathison, V. S. Reddy and E. Li (2007). "Chlamydial CT441 is a PDZ domain-containing tail-specific protease that interferes with the NF-kappaB pathway of immune response." J Bacteriol 189(18): 6619-6625.

251 Laguna, R. K., E. A. Creasey, Z. Li, N. Valtz and R. R. Isberg (2006). "A Legionella pneumophila-translocated substrate that is required for growth within macrophages and protection from host cell death." Proc Natl Acad Sci U S A 103(49): 18745-18750.

Lalaouna, D., M. C. Carrier, S. Semsey, J. S. Brouard, J. Wang, J. T. Wade and E. Masse (2015). "A 3' external transcribed spacer in a tRNA transcript acts as a sponge for small RNAs to prevent transcriptional noise." Mol Cell 58(3): 393-405.

Lalaouna, D., A. Eyraud, A. Devinck, K. Prevost and E. Masse (2019). "GcvB small RNA uses two distinct seed regions to regulate an extensive targetome." Mol Microbiol 111(2): 473-486.

Lamkanfi, M. and V. M. Dixit (2009). "Inflammasomes: guardians of cytosolic sanctity." Immunol Rev 227(1): 95-105.

Landini, P., T. Egli, J. Wolf and S. Lacour (2014). "sigmaS, a major player in the response to environmental stresses in Escherichia coli: role, regulation and mechanisms of promoter recognition." Environ Microbiol Rep 6(1): 1-13.

Lane, M. C. and H. L. T. Mobley (2007). "Role of P-fimbrial-mediated adherence in pyelonephritis and persistence of uropathogenic Escherichia coli (UPEC) in the mammalian kidney." Kidney International 72(1): 19-25.

Lange, R., D. Fischer and R. Hengge-Aronis (1995). "Identification of transcriptional start sites and the role of ppGpp in the expression of rpoS, the structural gene for the sigma S subunit of RNA polymerase in Escherichia coli." J Bacteriol 177(16): 4676-4680.

Lange, R. and R. Hengge-Aronis (1994). "The nlpD gene is located in an operon with rpoS on the Escherichia coli chromosome and encodes a novel lipoprotein with a potential function in cell wall formation." Mol Microbiol 13(4): 733-743.

Laskowska, E., D. Kuczynska-Wisnik, J. Skorko-Glonek and A. Taylor (1996). "Degradation by proteases Lon, Clp and HtrA, of Escherichia coli proteins aggregated in vivo by heat shock; HtrA protease action in vivo and in vitro." Mol Microbiol 22(3): 555-571.

Lawe, D. C., A. Chawla, E. Merithew, J. Dumas, W. Carrington, K. Fogarty, L. Lifshitz, R. Tuft, D. Lambright and S. Corvera (2002). "Sequential roles for phosphatidylinositol 3-phosphate and Rab5 in tethering and fusion of early endosomes via their interaction with EEA1." J Biol Chem 277(10): 8611-8617.

Lawrence, A., K. N. S, H. S. S and M. H. W (2014). "Characterization of the tail-specific protease (Tsp) from Legionella." J Gen Appl Microbiol 60(3): 95-100.

Lay, N. D. and S. Gottesman (2012a). "A complex network of small non‐coding RNAs regulate motility in Escherichia coli." Molecular Microbiology 86(3): 524-538.

Lay, N. D. and S. Gottesman (2012b). "RNase E finds some sRNAs stimulating." Molecular cell 47(6): 825-826.

252 Lease, R. A., M. E. Cusick and M. Belfort (1998). "Riboregulation in Escherichia coli: DsrA RNA acts by RNA:RNA interactions at multiple loci." Proc Natl Acad Sci U S A 95(21): 12456- 12461.

Lease, R. A., D. Smith, K. McDonough and M. Belfort (2004). "The Small Noncoding DsrA RNA Is an Acid Resistance Regulator in Escherichia coli." Journal of Bacteriology 186(18): 6179-6185.

Lee, C., E. Wigren, H. Lünsdorf and U. Römling (2016). "Protein homeostasis—more than resisting a hot bath." Current Opinion in Microbiology 30: 147-154.

Lenz, D. H., K. C. Mok, B. N. Lilley, R. V. Kulkarni, N. S. Wingreen and B. L. Bassler (2004). "The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae." Cell 118(1): 69-82.

Lesnik, R., I. Brettar and M. G. Hofle (2016). "Legionella species diversity and dynamics from surface reservoir to tap water: from cold adaptation to thermophily." ISME J 10(5): 1064-1080.

Levet-Paulo, M., J.-C. Lazzaroni, C. Gilbert, D. Atlan, P. Doublet and A. Vianney (2011). "The atypical two-component sensor kinase Lpl0330 from Legionella pneumophila controls the bifunctional diguanylate cyclase-phosphodiesterase Lpl0329 to modulate bis-(3'-5')-cyclic dimeric GMP synthesis." The Journal of biological chemistry 286(36): 31136-31144.

Levi, A., M. Folcher, U. Jenal and H. A. Shuman (2011). "Cyclic diguanylate signaling proteins control intracellular growth of Legionella pneumophila." mBio 2(1): e00316-00310.

Li, L., N. Mendis, H. Trigui and S. P. Faucher (2015). "Transcriptomic changes of Legionella pneumophila in water." BMC Genomics 16: 637.

Liberek, K., T. P. Galitski, M. Zylicz and C. Georgopoulos (1992). "The DnaK chaperone modulates the heat shock response of Escherichia coli by binding to the sigma 32 transcription factor." Proceedings of the National Academy of Sciences 89(8): 3516-3520.

Liberek, K., A. Lewandowska and S. Zietkiewicz (2008). "Chaperones in control of protein disaggregation." The EMBO journal 27(2): 328-335.

Liles, M. R., T. A. Scheel and N. P. Cianciotto (2000). "Discovery of a nonclassical siderophore, legiobactin, produced by strains of Legionella pneumophila." J Bacteriol 182(3): 749-757.

Lim, B., R. Miyazaki, S. Neher, D. A. Siegele, K. Ito, P. Walter, Y. Akiyama, T. Yura and C. A. Gross (2013). "Heat shock transcription factor σ32 co-opts the signal recognition particle to regulate protein homeostasis in E. coli." PLoS biology 11(12): e1001735.

Lipinska, B., O. Fayet, L. Baird and C. Georgopoulos (1989). "Identification, characterization, and mapping of the Escherichia coli htrA gene, whose product is essential for bacterial growth only at elevated temperatures." J Bacteriol 171(3): 1574-1584.

253 Liu, X. and S. Shin (2019). "Viewing Legionella pneumophila pathogenesis through an immunological lens." Journal of Molecular Biology 431(21): 4321-4344.

Liu, Y., W. Zhu, Y. Tan, E. S. Nakayasu, C. J. Staiger and Z. Q. Luo (2017). "A Legionella Effector Disrupts Host Cytoskeletal Structure by Cleaving Actin." PLoS Pathog 13(1): e1006186.

Livak, K. J. and T. D. Schmittgen (2001). "Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method." Methods 25(4): 402-408.

Loh, E., O. Dussurget, J. Gripenland, K. Vaitkevicius, T. Tiensuu, P. Mandin, F. Repoila, C. Buchrieser, P. Cossart and J. Johansson (2009). "A trans-acting riboswitch controls expression of the virulence regulator PrfA in Listeria monocytogenes." Cell 139(4): 770-779.

Lorenz, R., S. H. Bernhart, C. Höner zu Siederdissen, H. Tafer, C. Flamm, P. F. Stadler and I. L. Hofacker (2011). "ViennaRNA Package 2.0." Algorithms for Molecular Biology 6(1): 26.

Losick, V. P., E. Haenssler, M.-Y. Moy and R. R. Isberg (2010). "LnaB: a Legionella pneumophila activator of NF-kappaB." Cellular microbiology 12(8): 1083-1097.

Luciano, D. J., N. Vasilyev, J. Richards, A. Serganov and J. G. Belasco (2017). "A Novel RNA Phosphorylation State Enables 5′ End-Dependent Degradation in Escherichia coli." Molecular Cell 67(1): 44-54.e46.

Lukacs, P. (2002). "How good is cognac?".

Luo, Z. Q. (2012). "Legionella secreted effectors and innate immune responses." Cellular Microbiology 14(1): 19-27.

Machner, M. P. and R. R. Isberg (2007). "A bifunctional bacterial protein links GDI displacement to Rab1 activation." Science 318(5852): 974-977.

Madhvi, A., H. Mishra, G. R. Leisching, P. Z. Mahlobo and B. Baker (2019). "Comparison of human monocyte derived macrophages and THP1-like macrophages as in vitro models for M. tuberculosis infection." Comparative immunology, microbiology and infectious diseases 67: 101355.

Maeda, H., N. Fujita and A. Ishihama (2000). "Competition among seven Escherichia coli sigma subunits: relative binding affinities to the core RNA polymerase." Nucleic Acids Res 28(18): 3497-3503.

Majdalani, N., S. Chen, J. Murrow, K. St John and S. Gottesman (2001). "Regulation of RpoS by a novel small RNA: the characterization of RprA." Mol Microbiol 39(5): 1382-1394.

Majdalani, N., C. Cunning, D. Sledjeski, T. Elliott and S. Gottesman (1998). "DsrA RNA regulates translation of RpoS message by an anti-antisense mechanism, independent of its action as an antisilencer of transcription." Proceedings of the National Academy of Sciences 95(21): 12462-12467.

254 Majdalani, N., D. Hernandez and S. Gottesman (2002). "Regulation and mode of action of the second small RNA activator of RpoS translation, RprA: RprA regulation and mode of action." Molecular Microbiology 46(3): 813-826.

Malet, H., F. Canellas, J. Sawa, J. Yan, K. Thalassinos, M. Ehrmann, T. Clausen and H. R. Saibil (2012). "Newly folded substrates inside the molecular cage of the HtrA chaperone DegQ." Nat Struct Mol Biol 19(2): 152-157.

Mandin, P. and S. Gottesman (2010). "Integrating anaerobic/aerobic sensing and the general stress response through the ArcZ small RNA." EMBO J 29(18): 3094-3107.

Marrie, T. J., J. R. Garay and E. Weir (2010). "Legionellosis: Why should I test and report?" CMAJ 182(14): 1538.

Marutani, M., F. Taguchi, Y. Ogawa, M. M. Hossain, Y. Inagaki, K. Toyoda, T. Shiraishi and Y. Ichinose (2008). "Gac two-component system in Pseudomonas syringae pv. tabaci is required for virulence but not for hypersensitive reaction." Mol Genet Genomics 279(4): 313-322.

Mascarenhas, D. P. and D. S. Zamboni (2017). "Inflammasome biology taught by Legionella pneumophila." J Leukoc Biol 101(4): 841-849.

Massé, E. and S. Gottesman (2002). "A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli." Proceedings of the National Academy of Sciences 99(7): 4620-4625.

Masse, E., C. K. Vanderpool and S. Gottesman (2005). "Effect of RyhB small RNA on global iron use in Escherichia coli." J Bacteriol 187(20): 6962-6971.

Mauri, M. and S. Klumpp (2014). "A model for sigma factor competition in bacterial cells." PLoS Comput Biol 10(10): e1003845.

McClung, R. P., D. M. Roth, M. Vigar, V. A. Roberts, A. M. Kahler, L. A. Cooley, E. D. Hilborn, T. J. Wade, K. E. Fullerton, J. S. Yoder and V. R. Hill (2017). "Waterborne Disease Outbreaks Associated With Environmental and Undetermined Exposures to Water - United States, 2013-2014." MMWR Morb Mortal Wkly Rep 66(44): 1222-1225.

McNealy, T. L., V. Forsbach-Birk, C. Shi and R. Marre (2005). "The Hfq homolog in Legionella pneumophila demonstrates regulation by LetA and RpoS and interacts with the global regulator CsrA." J Bacteriol 187(4): 1527-1532.

Mecsas, J., P. E. Rouviere, J. W. Erickson, T. J. Donohue and C. A. Gross (1993). "The activity of sigma E, an Escherichia coli heat-inducible sigma-factor, is modulated by expression of outer membrane proteins." Genes & Development 7(12b): 2618-2628.

Mehta, P., S. Goyal and N. S. Wingreen (2008). "A quantitative comparison of sRNA-based and protein-based gene regulation." Mol Syst Biol 4: 221.

255 Mellin, J. R., S. Goswami, S. Grogan, B. Tjaden and C. A. Genco (2007). "A novel fur- and iron- regulated small RNA, NrrF, is required for indirect fur-mediated regulation of the sdhA and sdhC genes in Neisseria meningitidis." J Bacteriol 189(10): 3686-3694.

Mellin, J. R., M. Koutero, D. Dar, M.-A. Nahori, R. Sorek and P. Cossart (2014). "Riboswitches. Sequestration of a two-component response regulator by a riboswitch-regulated noncoding RNA." Science (New York, N.Y.) 345(6199): 940-943.

Mellin, J. R., R. McClure, D. Lopez, O. Green, B. Reinhard and C. Genco (2010). "Role of Hfq in iron-dependent and -independent gene regulation in Neisseria meningitidis." Microbiology 156(Pt 8): 2316-2326.

Mellin, J. R., T. Tiensuu, C. Becavin, E. Gouin, J. Johansson and P. Cossart (2013). "A riboswitch-regulated antisense RNA in Listeria monocytogenes." Proc Natl Acad Sci U S A 110(32): 13132-13137.

Mendis, N., P. McBride and S. P. Faucher (2015). "Short-Term and Long-Term Survival and Virulence of Legionella pneumophila in the Defined Freshwater Medium Fraquil." PLoS One 10(9): e0139277.

Mendis, N., P. McBride, J. Saoud, T. Mani and S. P. Faucher (2018). "The LetA/S two- component system regulates transcriptomic changes that are essential for the culturability of Legionella pneumophila in water." Sci Rep 8(1): 6764.

Mendoza-Vargas, A., L. Olvera, M. Olvera, R. Grande, L. Vega-Alvarado, B. Taboada, V. Jimenez-Jacinto, H. Salgado, K. Juarez, B. Contreras-Moreira, A. M. Huerta, J. Collado-Vides and E. Morett (2009). "Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli." PLoS One 4(10): e7526.

Mey, A. R., S. A. Craig and S. M. Payne (2005). "Characterization of Vibrio cholerae RyhB: the RyhB Regulon and Role of ryhB in Biofilm Formation." Infection and Immunity 73(9): 5706- 5719.

Meyer, M. M. (2016). "The role of mRNA structure in bacterial translational regulation." Wiley interdisciplinary reviews. RNA 8(1): e1370.

Michard, C., D. Sperandio, N. Bailo, J. Pizarro-Cerda, L. LeClaire, E. Chadeau-Argaud, I. Pombo-Gregoire, E. Hervet, A. Vianney, C. Gilbert, M. Faure, P. Cossart and P. Doublet (2015). "The Legionella Kinase LegK2 Targets the ARP2/3 Complex To Inhibit Actin Nucleation on Phagosomes and Allow Bacterial Evasion of the Late Endocytic Pathway." mBio 6(3): e00354- 00315.

Mizuno, T., M. Y. Chou and M. Inouye (1984). "A unique mechanism regulating gene expression: translational inhibition by a complementary RNA transcript (micRNA)." Proc Natl Acad Sci U S A 81(7): 1966-1970.

Mogk, A., B. Bukau and H. H. Kampinga (2018). "Cellular Handling of Protein Aggregates by Disaggregation Machines." Mol Cell 69(2): 214-226.

256 Mogk, A., E. Deuerling, S. Vorderwülbecke, E. Vierling and B. Bukau (2003). "Small heat shock proteins, ClpB and the DnaK system form a functional triade in reversing protein aggregation: sHsps, ClpB and DnaK form a functional triade." Molecular Microbiology 50(2): 585-595.

Møller, T., T. Franch, C. Udesen, K. Gerdes and P. Valentin-Hansen (2002). "Spot 42 RNA mediates discoordinate expression of the E. coli galactose operon." Genes & Development 16(13): 1696-1706.

Molmeret, M., D. M. Bitar, L. Han and Y. A. Kwaik (2004). "Disruption of the phagosomal membrane and egress of Legionella pneumophila into the cytoplasm during the last stages of intracellular infection of macrophages and Acanthamoeba polyphaga." Infect Immun 72(7): 4040-4051.

Molofsky, A. B., B. G. Byrne, N. N. Whitfield, C. A. Madigan, E. T. Fuse, K. Tateda and M. S. Swanson (2006). "Cytosolic recognition of flagellin by mouse macrophages restricts Legionella pneumophila infection." J Exp Med 203(4): 1093-1104.

Molofsky, A. B., L. M. Shetron-Rama and M. S. Swanson (2005). "Components of the Legionella pneumophila flagellar regulon contribute to multiple virulence traits, including lysosome avoidance and macrophage death." Infect Immun 73(9): 5720-5734.

Molofsky, A. B. and M. S. Swanson (2003). "Legionella pneumophila CsrA is a pivotal repressor of transmission traits and activator of replication." Mol Microbiol 50(2): 445-461.

Molofsky, A. B. and M. S. Swanson (2004). "Differentiate to thrive: lessons from the Legionella pneumophila life cycle." Mol Microbiol 53(1): 29-40.

Mondino, S., S. Schmidt, M. Rolando, P. Escoll, L. Gomez-Valero and C. Buchrieser (2020). "Legionnaires' Disease: State of the Art Knowledge of Pathogenesis Mechanisms of Legionella." Annu Rev Pathol 15: 439-466.

Monroe, K. M., S. M. McWhirter and R. E. Vance (2009). "Identification of host cytosolic sensors and bacterial factors regulating the type I interferon response to Legionella pneumophila." PLoS Pathog 5(11): e1000665.

Morel, F. M. M., J. C. Westall, J. G. Rueter and C. JP (1975). Description of the algal growth media "Aquil" and "Fraquil", R.M. Parsons Laboratory for Water Resources and Hydrodynamics, Massachusetts Institute of Technology, Cambridge, MA.

Morfeldt, E., D. Taylor, A. Gabain and S. Arvidson (1995). "Activation of alpha‐toxin translation in Staphylococcus aureus by the trans‐encoded antisense RNA, RNAIII." The EMBO Journal 14(18): 4569-4577.

Morita, T., K. Maki and H. Aiba (2012). "Detection of sRNA-mRNA interactions by electrophoretic mobility shift assay." Methods Mol Biol 905: 235-244.

257 Morita, T., Y. Mochizuki and H. Aiba (2006). "Translational repression is sufficient for gene silencing by bacterial small noncoding RNAs in the absence of mRNA destruction." Proc Natl Acad Sci U S A 103(13): 4858-4863.

Mousnier, A., G. N. Schroeder, C. A. Stoneham, E. C. So, J. A. Garnett, L. Yu, S. J. Matthews, J. S. Choudhary, E. L. Hartland and G. Frankel (2014). "A new method to determine in vivo interactomes reveals binding of the Legionella pneumophila effector PieE to multiple rab GTPases." mBio 5(4).

Mukherjee, S., X. Liu, K. Arasaki, J. McDonough, J. E. Galan and C. R. Roy (2011). "Modulation of Rab GTPase function by a protein phosphocholine transferase." Nature 477(7362): 103-106.

Murata, T., A. Delprato, A. Ingmundson, D. K. Toomre, D. G. Lambright and C. R. Roy (2006). "The Legionella pneumophila effector protein DrrA is a Rab1 guanine nucleotide-exchange factor." Nat Cell Biol 8(9): 971-977.

Murphy, E. R. and S. M. Payne (2007). "RyhB, an Iron-Responsive Small RNA Molecule, Regulates Shigella dysenteriae Virulence." Infection and Immunity 75(7): 3470-3477.

Mytnikova, R. (2019). "The guide to finding great cognac."

Nagai, H., J. C. Kagan, X. Zhu, R. A. Kahn and C. R. Roy (2002). "A bacterial guanine nucleotide exchange factor activates ARF on Legionella phagosomes." Science 295(5555): 679- 682.

Naville, M. and D. Gautheret (2010). "Transcription attenuation in bacteria: theme and variations." Briefings in Functional Genomics 9(2): 178-189.

Neunuebel, M. R., Y. Chen, A. H. Gaspar, P. S. Backlund, A. Yergey and M. P. Machner (2011). "De-AMPylation of the small GTPase Rab1 by the pathogen Legionella pneumophila." Science (New York, N.Y.) 333(6041): 453-456.

Nevermann, J., A. Silva, C. Otero, D. P. Oyarzun, B. Barrera, F. Gil, I. L. Calderon and J. A. Fuentes (2019). "Identification of Genes Involved in Biogenesis of Outer Membrane Vesicles (OMVs) in Salmonella enterica Serovar Typhi." Front Microbiol 10: 104.

Nevo, O., T. Zusman, M. Rasis, Z. Lifshitz and G. Segal (2014). "Identification of Legionella pneumophila effectors regulated by the LetAS-RsmYZ-CsrA regulatory cascade, many of which modulate vesicular trafficking." J Bacteriol 196(3): 681-692.

Newton, H. J., D. K. Ang, I. R. van Driel and E. L. Hartland (2010). "Molecular pathogenesis of infections caused by Legionella pneumophila." Clin Microbiol Rev 23(2): 274-298.

Nielsen, H., J. Engelbrecht, S. Brunak and G. von Heijne (1997). "Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites." Protein Eng 10(1): 1-6.

258 Noppa, L., Y. Ostberg, M. Lavrinovicha and S. Bergstrom (2001). "P13, an integral membrane protein of Borrelia burgdorferi, is C-terminally processed and contains surface-exposed domains." Infect Immun 69(5): 3323-3334.

Novick, R. P., H. F. Ross, S. J. Projan, J. Kornblum, B. Kreiswirth and S. Moghazeh (1993). "Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule." The EMBO Journal 12(10): 3967-3975.

Nues, R. W. v., D. Castro-Roa, Y. Yuzenkova and N. Zenkin (2015). "Ribonucleoprotein particles of bacterial small non-coding RNA IsrA (IS61 or McaS) and its interaction with RNA polymerase core may link transcription to mRNA fate." Nucleic acids research 44(6): 2577- 2592.

O'Connor, T. J., Y. Adepoju, D. Boyd and R. R. Isberg (2011). "Minimization of the Legionella pneumophila genome reveals chromosomal regions involved in host range expansion." Proc Natl Acad Sci U S A 108(36): 14733-14740.

Oglesby, A. G., J. M. Farrow, 3rd, J. H. Lee, A. P. Tomaras, E. P. Greenberg, E. C. Pesci and M. L. Vasil (2008). "The influence of iron on Pseudomonas aeruginosa physiology: a regulatory link between iron and quorum sensing." J Biol Chem 283(23): 15558-15567.

Oglesby, A. G., E. R. Murphy, V. R. Iyer and S. M. Payne (2005). "Fur regulates acid resistance in Shigella flexneri via RyhB and ydeP." Molecular Microbiology 58(5): 1354-1367.

Olejniczak, M. and G. Storz (2017). "ProQ/FinO-domain proteins: Another ubiquitous family of RNA matchmakers?" Molecular microbiology 104(6): 905-915.

Oliva, G., T. Sahr and C. Buchrieser (2018). "The Life Cycle of L. pneumophila: Cellular Differentiation Is Linked to Virulence and Metabolism." Front Cell Infect Microbiol 8: 3.

Oliva, G., T. Sahr, M. Rolando, M. Knoth and C. Buchrieser (2017). "A Unique cis-Encoded Small Noncoding RNA Is Regulating Legionella pneumophila Hfq Expression in a Life Cycle- Dependent Manner." MBio 8(1).

Opdyke, J. A., J.-G. Kang and G. Storz (2004). "GadY, a Small-RNA Regulator of Acid Response Genes in Escherichia coli." Journal of Bacteriology 186(20): 6698-6705.

Paget, M. S. (2015). "Bacterial Sigma Factors and Anti-Sigma Factors: Structure, Function and Distribution." Biomolecules 5(3): 1245-1265.

Palmer, A. C., J. B. Egan and K. E. Shearwin (2011). "Transcriptional interference by RNA polymerase pausing and dislodgement of transcription factors." Transcription 2(1): 9-14.

Papenfort, K., M. Bouvier, F. Mika, C. M. Sharma and J. Vogel (2010). "Evidence for an autonomous 5' target recognition domain in an Hfq-associated small RNA." Proc Natl Acad Sci U S A 107(47): 20435-20440.

259 Papenfort, K., K. U. Förstner, J.-P. Cong, C. M. Sharma and B. L. Bassler (2015). "Differential RNA-seq of Vibrio cholerae identifies the VqmR small RNA as a regulator of biofilm formation." Proceedings of the National Academy of Sciences of the United States of America 112(7): E766-775.

Papenfort, K., D. Podkaminski, J. C. D. Hinton and J. Vogel (2012). "The ancestral SgrS RNA discriminates horizontally acquired Salmonella mRNAs through a single G-U wobble pair." Proceedings of the National Academy of Sciences of the United States of America 109(13): E757-764.

Paranjape, K., E. Bedard, L. G. Whyte, J. Ronholm, M. Prevost and S. P. Faucher (2019). "Presence of Legionella spp. in cooling towers: the role of microbial diversity, Pseudomonas, and continuous chlorine application." Water Res 169: 115252.

Park, B., G. Park, J. Kim, S. A. Lim and K.-M. Lee (2017). "Innate immunity against Legionella pneumophila during pulmonary infections in mice." Archives of Pharmacal Research 40(2): 131- 145.

Patel, A., L. Malinovska, S. Saha, J. Wang, S. Alberti, Y. Krishnan and A. A. Hyman (2017). "ATP as a biological hydrotrope." Science 356(6339): 753-756.

Pécastaings, S., J. Allombert, B. Lajoie, P. Doublet, C. Roques and A. Vianney (2016). "New insights into Legionella pneumophila biofilm regulation by c-di-GMP signaling." Biofouling 32(8): 935-948.

Pedersen, L. L., M. Radulic, M. Doric and Y. Abu Kwaik (2001). "HtrA homologue of Legionella pneumophila: an indispensable element for intracellular infection of mammalian but not protozoan cells." Infect Immun 69(4): 2569-2579.

Peracino, B., A. Balest and S. Bozzaro (2010). "Phosphoinositides differentially regulate bacterial uptake and Nramp1-induced resistance to Legionella infection in Dictyostelium." Journal of cell science 123(Pt 23): 4039-4051.

Percival, S. L. and D. W. Williams (2014). "Microbiology of Waterborne Diseases (Second Edition)." Part Two: Bacteriology: 155-175.

Pernestig, A. K., O. Melefors and D. Georgellis (2001). "Identification of UvrY as the cognate response regulator for the BarA sensor kinase in Escherichia coli." J Biol Chem 276(1): 225- 231.

Pfeiffer, V., K. Papenfort, S. Lucchini, J. C. D. Hinton and J. Vogel (2009). "Coding sequence targeting by MicC RNA reveals bacterial mRNA silencing downstream of translational initiation." Nature Structural & Molecular Biology 16(8): 840-846.

Pogliano, J., A. S. Lynch, D. Belin, E. C. Lin and J. Beckwith (1997). "Regulation of Escherichia coli cell envelope proteins involved in protein folding and degradation by the Cpx two-component system." Genes Dev 11(9): 1169-1182.

260 Poole, K., D. E. Heinrichs and S. Neshat (1993). "Cloning and sequence analysis of an EnvCD homologue in Pseudomonas aeruginosa: regulation by iron and possible involvement in the secretion of the siderophore pyoverdine." Mol Microbiol 10(3): 529-544.

Porcheron, G., R. Habib, S. Houle, M. Caza, F. Lépine, F. Daigle, E. Massé and C. M. Dozois (2014). "The Small RNA RyhB Contributes to Siderophore Production and Virulence of Uropathogenic Escherichia coli." Infection and Immunity 82(12): 5056-5068.

Prashar, A., M. E. Ortiz, S. Lucarelli, E. Barker, Z. Tabatabeiyazdi, F. Shamoun, D. Raju, C. Antonescu, C. Guyard and M. R. Terebiznik (2018). "Small Rho GTPases and the Effector VipA Mediate the Invasion of Epithelial Cells by Filamentous Legionella pneumophila." Front Cell Infect Microbiol 8: 133.

Prevost, K., G. Desnoyers, J. F. Jacques, F. Lavoie and E. Masse (2011). "Small RNA-induced mRNA degradation achieved through both translation block and activated cleavage." Genes Dev 25(4): 385-396.

Prevost, K., H. Salvail, G. Desnoyers, J. F. Jacques, E. Phaneuf and E. Masse (2007). "The small RNA RyhB activates the translation of shiA mRNA encoding a permease of shikimate, a compound involved in siderophore synthesis." Mol Microbiol 64(5): 1260-1273.

Prévost, K., H. Salvail, G. Desnoyers, J. F. Jacques, É. Phaneuf and E. Massé (2007). "The small RNA RyhB activates the translation of shiA mRNA encoding a permease of shikimate, a compound involved in siderophore synthesis." Molecular Microbiology 64(5): 1260-1273.

Prevost, M. S., N. Pinotsis, M. Dumoux, R. D. Hayward and G. Waksman (2017). "The Legionella effector WipB is a translocated Ser/Thr phosphatase that targets the host lysosomal nutrient sensing machinery." Sci Rep 7(1): 9450.

Pu, Y., Y. Li, X. Jin, T. Tian, Q. Ma, Z. Zhao, S.-y. Lin, Z. Chen, B. Li, G. Yao, M. C. Leake, C.-J. Lo and F. Bai (2019). "ATP-Dependent Dynamic Protein Aggregation Regulates Bacterial Dormancy Depth Critical for Antibiotic Tolerance." Molecular Cell 73(1): 143-156.e144.

Qiu, J. and Z. Q. Luo (2013). "Effector translocation by the Legionella Dot/Icm type IV secretion system." Curr Top Microbiol Immunol 376: 103-115.

Quereda, J. J. and P. Cossart (2017). "Regulating Bacterial Virulence with RNA." Annu Rev Microbiol 71: 263-280.

Quereda, J. J., A. D. Ortega, M. G. Pucciarelli and F. G.-D. Portillo (2014). "The Listeria Small RNA Rli27 Regulates a Cell Wall Protein inside Eukaryotic Cells by Targeting a Long 5'-UTR Variant." PLoS genetics 10(10): e1004765.

Quereda, J. J., F. G.-D. Portillo and M. G. Pucciarelli (2016). "Listeria monocytogenes remodels the cell surface in the blood-stage." Environmental microbiology reports 8(5): 641-648.

Raina, M., A. King, C. Bianco and C. K. Vanderpool (2018). "Dual-Function RNAs." Microbiology spectrum 6(5): 471-485.

261 Raina, S., D. Missiakas and C. Georgopoulos (1995). "The rpoE gene encoding the sigma E (sigma 24) heat shock sigma factor of Escherichia coli." EMBO J 14(5): 1043-1055.

Rasband, W. S. (1997-2018). "ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, ." 2020, from https://imagej.nih.gov/ij/.

Rasis, M. and G. Segal (2009). "The LetA-RsmYZ-CsrA regulatory cascade, together with RpoS and PmrA, post-transcriptionally regulates stationary phase activation of Legionella pneumophila Icm/Dot effectors." Mol Microbiol 72(4): 995-1010.

Rawlings, N. D., A. J. Barrett and A. Bateman (2010). "MEROPS: the peptidase database." Nucleic Acids Res 38(Database issue): D227-233.

Rawlings, N. D., M. Waller, A. J. Barrett and A. Bateman (2014). "MEROPS: the database of proteolytic enzymes, their substrates and inhibitors." Nucleic Acids Res 42(Database issue): D503-509.

Rechnitzer, C. and J. Blom (1989). "Engulfment of the Philadelphia strain of Legionella pneumophila within pseudopod coils in human phagocytes. Comparison with other Legionella strains and species." APMIS 97(2): 105-114.

Regulski, E. E. and R. R. Breaker (2008). "In-line probing analysis of riboswitches." Methods Mol Biol 419: 53-67.

Reiling, S. A., J. A. Jansen, B. J. Henley, S. Singh, C. Chattin, M. Chandler and D. W. Rowen (2005). "Prc protease promotes mucoidy in mucA mutants of Pseudomonas aeruginosa." Microbiology 151(Pt 7): 2251-2261.

Reinhart, A. A., D. A. Powell, A. T. Nguyen, M. O'Neill, L. Djapgne, A. Wilks, R. K. Ernst and A. G. Oglesby-Sherrouse (2015). "The prrF-encoded small regulatory RNAs are required for iron homeostasis and virulence of Pseudomonas aeruginosa." Infect Immun 83(3): 863-875.

Ren, T., D. S. Zamboni, C. R. Roy, W. F. Dietrich and R. E. Vance (2006). "Flagellin-Deficient Legionella Mutants Evade Caspase-1- and Naip5-Mediated Macrophage Immunity." PLoS Pathogens 2(3): e18.

Reynolds, C., S. Checkley, L. Chui, S. Otto and N. F. Neumann (2020). "Evaluating the risks associated with Shiga-toxin-producing Escherichia coli (STEC) in private well waters in Canada." Can J Microbiol 66(5): 337-350.

Richard, A. L., J. H. Withey, S. Beyhan, F. Yildiz and V. J. DiRita (2010). "The Vibrio cholerae virulence regulatory cascade controls glucose uptake through activation of TarA, a small regulatory RNA." Mol Microbiol 78(5): 1171-1181.

Richter, K., M. Haslbeck and J. Buchner (2010). "The heat shock response: life on the verge of death." Mol Cell 40(2): 253-266.

262 Ridenour, D. A., S. L. Cirillo, S. Feng, M. M. Samrakandi and J. D. Cirillo (2003). "Identification of a gene that affects the efficiency of host cell infection by Legionella pneumophila in a temperature-dependent fashion." Infect Immun 71(11): 6256-6263.

Rihova, J., E. Novakova, F. Husnik and V. Hypsa (2017). "Legionella Becoming a Mutualist: Adaptive Processes Shaping the Genome of Symbiont in the Louse Polyplax serrata." Genome Biol Evol 9(11): 2946-2957.

Rink, J., E. Ghigo, Y. Kalaidzidis and M. Zerial (2005). "Rab conversion as a mechanism of progression from early to late endosomes." Cell 122(5): 735-749.

Rittig, M. G., G.-R. Burmester and A. Krause (1998). "Coiling phagocytosis: when the zipper jams, the cup is deformed." Trends in Microbiology 6(10): 384-388.

Rizzardi, K., J. Winiecka-Krusnell, M. Ramliden, E. Alm, S. Andersson and S. Byfors (2015). "Legionella norrlandica sp. nov., isolated from the biopurification systems of wood processing plants." International Journal of Systematic and Evolutionary Microbiology 65(Pt_2): 598-603.

Robinson, C. G. and C. R. Roy (2006). "Attachment and fusion of endoplasmic reticulum with vacuoles containing Legionella pneumophila." Cell Microbiol 8(5): 793-805.

Robinson, N., R. Ganesan, C. Hegedus, K. Kovacs, T. A. Kufer and L. Virag (2019). "Programmed necrotic cell death of macrophages: Focus on pyroptosis, necroptosis, and parthanatos." Redox Biol 26: 101239.

Roig, J., X. Aguilar, J. Ruiz, C. Domingo, E. Mesalles, J. Manterola and J. Morera (1991). "Comparative study of Legionella pneumophila and other nosocomial-acquired pneumonias." Chest 99(2): 344-350.

Rolando, M., P. Escoll and C. Buchrieser (2016). "Legionella pneumophila restrains autophagy by modulating the host's sphingolipid metabolism." Autophagy 12(6): 1053-1054.

Romeo, T. and P. Babitzke (2018). "Global Regulation by CsrA and Its RNA Antagonists." Microbiology spectrum 6(2): 341-354.

Romeo, T., M. Gong, M. Y. Liu and A. M. Brun-Zinkernagel (1993). "Identification and molecular characterization of csrA, a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties." J Bacteriol 175(15): 4744-4755.

Romilly, C., S. Deindl and E. G. H. Wagner (2019). "The ribosomal protein S1-dependent standby site in tisB mRNA consists of a single-stranded region and a 5' structure element." Proceedings of the National Academy of Sciences of the United States of America 116(32): 15901-15906.

Romilly, C., C. Lays, A. Tomasini, I. Caldelari, Y. Benito, P. Hammann, T. Geissmann, S. Boisset, P. Romby and F. Vandenesch (2014). "A non-coding RNA promotes bacterial

263 persistence and decreases virulence by regulating a regulator in Staphylococcus aureus." PLoS pathogens 10(3): e1003979.

Ross, J. A., M. Thorsing, E. M. S. Lillebæk, P. T. D. Santos and B. H. Kallipolitis (2019). "The LhrC sRNAs control expression of T cell-stimulating antigen TcsA in Listeria monocytogenes by decreasing tcsA mRNA stability." RNA biology 16(3): 270-281.

Rossier, O. and N. P. Cianciotto (2005). "The Legionella pneumophila tatB Gene Facilitates Secretion of Phospholipase C, Growth under Iron-Limiting Conditions, and Intracellular Infection." Infection and Immunity 73(4): 2020-2032.

Rossier, O., J. Dao and N. P. Cianciotto (2008). "The type II secretion system of Legionella pneumophila elaborates two aminopeptidases, as well as a metalloprotease that contributes to differential infection among protozoan hosts." Appl Environ Microbiol 74(3): 753-761.

Rossier, O., J. Dao and N. P. Cianciotto (2009). "A type II secreted RNase of Legionella pneumophila facilitates optimal intracellular infection of Hartmannella vermiformis." Microbiology 155(Pt 3): 882-890.

Rossier, O., S. R. Starkenburg and N. P. Cianciotto (2004). "Legionella pneumophila Type II Protein Secretion Promotes Virulence in the A/J Mouse Model of Legionnaires' Disease Pneumonia." Infection and Immunity 72(1): 310-321.

Rousseau, F., L. Serrano and J. W. H. Schymkowitz (2006). "How Evolutionary Pressure Against Protein Aggregation Shaped Chaperone Specificity." Journal of Molecular Biology 355(5): 1037-1047.

Rouviere, P. E., A. De Las Penas, J. Mecsas, C. Z. Lu, K. E. Rudd and C. A. Gross (1995). "rpoE, the gene encoding the second heat-shock sigma factor, sigma E, in Escherichia coli." EMBO J 14(5): 1032-1042.

Roy, C. R., K. H. Berger and R. R. Isberg (1998). "Legionella pneumophila DotA protein is required for early phagosome trafficking decisions that occur within minutes of bacterial uptake." Molecular Microbiology 28(3): 663-674.

Rudbeck, M., K. Mølbak and S. A. Uldum (2008). "Dynamics of Legionella antibody levels during 1 year in a healthy population." Epidemiology and infection 137(7): 1013-1018.

Sadosky, A. B., L. A. Wiater and H. A. Shuman (1993). "Identification of Legionella pneumophila genes required for growth within and killing of human macrophages." Infect Immun 61(12): 5361-5373.

Sahr, T., H. Bruggemann, M. Jules, M. Lomma, C. Albert-Weissenberger, C. Cazalet and C. Buchrieser (2009). "Two small ncRNAs jointly govern virulence and transmission in Legionella pneumophila." Mol Microbiol 72(3): 741-762.

264 Sahr, T., C. Rusniok, D. Dervins-Ravault, O. Sismeiro, J. Y. Coppee and C. Buchrieser (2012). "Deep sequencing defines the transcriptional map of L. pneumophila and identifies growth phase-dependent regulated ncRNAs implicated in virulence." RNA Biol 9(4): 503-519.

Sahr, T., C. Rusniok, F. Impens, G. Oliva, O. Sismeiro, J. Y. Coppee and C. Buchrieser (2017). "The Legionella pneumophila genome evolved to accommodate multiple regulatory mechanisms controlled by the CsrA-system." PLoS Genet 13(2): e1006629.

Said, N., R. Rieder, R. Hurwitz, J. Deckert, H. Urlaub and J. Vogel (2009). "In vivo expression and purification of aptamer-tagged small RNA regulators." Nucleic Acids Res 37(20): e133.

Salvail, H., P. Lanthier-Bourbonnais, J. M. Sobota, M. Caza, J.-A. M. Benjamin, M. E. S. Mendieta, F. Lépine, C. M. Dozois, J. Imlay and E. Massé (2010). "A small RNA promotes siderophore production through transcriptional and metabolic remodeling." Proceedings of the National Academy of Sciences of the United States of America 107(34): 15223-15228.

Santos, P. T. d., P. Menendez-Gil, D. Sabharwal, J.-H. Christensen, M. Z. Brunhede, E. M. S. Lillebæk and B. H. Kallipolitis (2018). "The Small Regulatory RNAs LhrC1–5 Contribute to the Response of Listeria monocytogenes to Heme Toxicity." Frontiers in Microbiology 9: 599.

Saoud, J., T. Mani and S. P. Faucher (2020). "Legionella pneumophila’s Tsp is important for surviving thermal stress in water and inside amoeba." bioRxiv: 2020.2012.2008.417196.

Sautter, R., D. Ramos, L. Schneper, O. Ciofu, T. Wassermann, C. L. Koh, A. Heydorn, M. Hentzer, N. Hoiby, A. Kharazmi, S. Molin, C. A. Devries, D. E. Ohman and K. Mathee (2012). "A complex multilevel attack on Pseudomonas aeruginosa algT/U expression and algT/U activity results in the loss of alginate production." Gene 498(2): 242-253.

Sayed, N., A. Jousselin and B. Felden (2011). "A cis-antisense RNA acts in trans in Staphylococcus aureus to control translation of a human cytolytic peptide." Nat Struct Mol Biol 19(1): 105-112.

Sayed, N., S. Nonin-Lecomte, S. Rety and B. Felden (2012). "Functional and structural insights of a Staphylococcus aureus apoptotic-like membrane peptide from a toxin-antitoxin module." J Biol Chem 287(52): 43454-43463.

Schachterle, J. K., Q. Zeng and G. W. Sundin (2019). "Three Hfq-dependent small RNAs regulate flagellar motility in the fire blight pathogen Erwinia amylovora." Molecular microbiology 111(6): 1476-1492.

Schmitt, C. K., K. C. Meysick and A. D. O'Brien (1999). "Bacterial toxins: friends or foes?" Emerg Infect Dis 5(2): 224-234.

Schramm, F. D., K. Schroeder and K. Jonas (2020). "Protein aggregation in bacteria." FEMS Microbiol Rev 44(1): 54-72.

Schubert, A., R. Wrase, R. Hilgenfeld and G. Hansen (2015). "Structures of DegQ from Legionella pneumophila Define Distinct ON and OFF States." J Mol Biol 427(17): 2840-2851.

265 Schulz, T., K. Rydzewski, E. Schunder, G. Holland, N. Bannert and K. Heuner (2012). "FliA expression analysis and influence of the regulatory proteins RpoN, FleQ and FliA on virulence and in vivo fitness in Legionella pneumophila." Arch Microbiol 194(12): 977-989.

Schumann, W. (2016). "Regulation of bacterial heat shock stimulons." Cell Stress Chaperones 21(6): 959-968.

Schwechheimer, C., D. L. Rodriguez and M. J. Kuehn (2015). "NlpI-mediated modulation of outer membrane vesicle production through peptidoglycan dynamics in Escherichia coli." MicrobiologyOpen 4(3): 375-389.

Sedlyarova, N., I. Shamovsky, B. K. Bharati, V. Epshtein, J. Chen, S. Gottesman, R. Schroeder and E. Nudler (2016). "sRNA-Mediated Control of Transcription Termination in E. coli." Cell 167(1): 111-121 e113.

Segal, G., J. J. Russo and H. A. Shuman (1999). "Relationships between a new type IV secretion system and the icm/dot virulence system of Legionella pneumophila." Mol Microbiol 34(4): 799- 809.

Seo, J. and A. J. Darwin (2013). "The Pseudomonas aeruginosa periplasmic protease CtpA can affect systems that impact its ability to mount both acute and chronic infections." Infection and immunity 81(12): 4561-4570.

Seoane, A., A. Sabbaj, L. M. McMurry and S. B. Levy (1992). "Multiple antibiotic susceptibility associated with inactivation of the prc gene." J Bacteriol 174(23): 7844-7847.

Seol, J. H., S. K. Woo, E. M. Jung, S. J. Yoo, C. S. Lee, K. J. Kim, K. Tanaka, A. Ichihara, D. B. Ha and C. H. Chung (1991). "Protease Do is essential for survival of Escherichia coli at high temperatures: its identity with the htrA gene product." Biochem Biophys Res Commun 176(2): 730-736.

Serganov, A. and E. Nudler (2013). "A decade of riboswitches." Cell 152(1-2): 17-24.

Sexton, J. A. and J. P. Vogel (2004). "Regulation of hypercompetence in Legionella pneumophila." J Bacteriol 186(12): 3814-3825.

Shao, Y., L. Feng, S. T. Rutherford, K. Papenfort and B. L. Bassler (2013). "Functional determinants of the quorum-sensing non-coding RNAs and their roles in target regulation." EMBO J 32(15): 2158-2171.

Sharma, C. M., F. Darfeuille, T. H. Plantinga and J. Vogel (2007). "A small RNA regulates multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome-binding sites." Genes & Development 21(21): 2804-2817.

Shearwin, K. E., B. P. Callen and J. B. Egan (2005). "Transcriptional interference--a crash course." Trends Genet 21(6): 339-345.

266 Shi, X., P. Halder, H. Yavuz, R. Jahn and H. A. Shuman (2016). "Direct targeting of membrane fusion by SNARE mimicry: Convergent evolution of Legionella effectors." Proc Natl Acad Sci U S A 113(31): 8807-8812.

Shim, H. K., J. Y. Kim, M. J. Kim, H. S. Sim, D. W. Park, J. W. Sohn and M. J. Kim (2009). "Legionella lipoprotein activates toll-like receptor 2 and induces cytokine production and expression of costimulatory molecules in peritoneal macrophages." Exp Mol Med 41(10): 687- 694.

Shimoni, Y., G. Friedlander, G. Hetzroni, G. Niv, S. Altuvia, O. Biham and H. Margalit (2007). "Regulation of gene expression by small non-coding RNAs: a quantitative view." Mol Syst Biol 3: 138.

Sievers, S., E. M. S. Lillebæk, K. Jacobsen, A. Lund, M. S. Mollerup, P. K. Nielsen and B. H. Kallipolitis (2014). "A multicopy sRNA of Listeria monocytogenes regulates expression of the virulence adhesin LapB." Nucleic Acids Research 42(14): 9383-9398.

Sievers, S., A. Lund, P. Menendez-Gil, A. Nielsen, M. S. Mollerup, S. L. Nielsen, P. B. Larsson, J. Borch-Jensen, J. Johansson and B. H. Kallipolitis (2015). "The multicopy sRNA LhrC controls expression of the oligopeptide-binding protein OppA in Listeria monocytogenes." RNA biology 12(9): 985-997.

Silber, K. R., K. C. Keiler and R. T. Sauer (1992). "Tsp: a tail-specific protease that selectively degrades proteins with nonpolar C termini." Proc Natl Acad Sci U S A 89(1): 295-299.

Silhavy, T. J., D. Kahne and S. Walker (2010). "The bacterial cell envelope." Cold Spring Harb Perspect Biol 2(5): a000414.

Singh, S. K., S. Parveen, L. SaiSree and M. Reddy (2015). "Regulated proteolysis of a cross- link-specific peptidoglycan hydrolase contributes to bacterial morphogenesis." Proceedings of the National Academy of Sciences of the United States of America 112(35): 10956-10961.

Singh, S. K., L. SaiSree, R. N. Amrutha and M. Reddy (2012). "Three redundant murein endopeptidases catalyse an essential cleavage step in peptidoglycan synthesis of Escherichia coli K12." Molecular microbiology 86(5): 1036-1051.

Skerrett, S. J., G. J. Bagby, R. A. Schmidt and S. Nelson (1997). "Antibody‐Mediated Depletion of Tumor Necrosis Factor‐α Impairs Pulmonary Host Defenses to Legionella pneumophila." The Journal of Infectious Diseases 176(4): 1019-1028.

Skerrett, S. J. and T. R. Martin (1996). "Roles for tumor necrosis factor alpha and nitric oxide in resistance of rat alveolar macrophages to Legionella pneumophila." Infection and immunity 64(8): 3236-3243.

Sledjeski, D. D., A. Gupta and S. Gottesman (1996). "The small RNA, DsrA, is essential for the low temperature expression of RpoS during exponential growth in Escherichia coli." EMBO J 15(15): 3993-4000.

267 Snavely, E. A., M. Kokes, J. D. Dunn, H. A. Saka, B. D. Nguyen, R. J. Bastidas, D. G. McCafferty and R. H. Valdivia (2014). "Reassessing the role of the secreted protease CPAF in Chlamydia trachomatis infection through genetic approaches." Pathogens and disease 71(3): 336-351.

Solans, L., J. Gonzalo-Asensio, C. Sala, A. Benjak, S. Uplekar, J. Rougemont, C. Guilhot, W. Malaga, C. Martin and S. T. Cole (2014). "The PhoP-dependent ncRNA Mcr7 modulates the TAT secretion system in Mycobacterium tuberculosis." PLoS Pathog 10(5): e1004183.

Spirig, T., A. Tiaden, P. Kiefer, C. Buchrieser, J. A. Vorholt and H. Hilbi (2008). "The Legionella autoinducer synthase LqsA produces an alpha-hydroxyketone signaling molecule." J Biol Chem 283(26): 18113-18123.

Sridharan, S., N. Kurzawa, T. Werner, I. Günthner, D. Helm, W. Huber, M. Bantscheff and M. M. Savitski (2019). "Proteome-wide solubility and thermal stability profiling reveals distinct regulatory roles for ATP." Nature Communications 10(1): 1155.

Srivastava, D., J. Seo, B. Rimal, S. J. Kim, S. Zhen and A. J. Darwin (2018). "A Proteolytic Complex Targets Multiple Cell Wall Hydrolases in Pseudomonas aeruginosa." mBio 9(4).

Stewart, C. R., D. M. Burnside and N. P. Cianciotto (2011). "The surfactant of Legionella pneumophila Is secreted in a TolC-dependent manner and is antagonistic toward other Legionella species." J Bacteriol 193(21): 5971-5984.

Storey, M. V., J. Winiecka-Krusnell, N. J. Ashbolt and T. A. Stenstrom (2004). "The efficacy of heat and chlorine treatment against thermotolerant Acanthamoebae and Legionellae." Scand J Infect Dis 36(9): 656-662.

Strauch, K. L. and J. Beckwith (1988). "An Escherichia coli mutation preventing degradation of abnormal periplasmic proteins." Proc Natl Acad Sci U S A 85(5): 1576-1580.

Strauch, K. L., K. Johnson and J. Beckwith (1989). "Characterization of degP, a gene required for proteolysis in the cell envelope and essential for growth of Escherichia coli at high temperature." J Bacteriol 171(5): 2689-2696.

Straus, D., W. Walter and C. A. Gross (1990). "DnaK, DnaJ, and GrpE heat shock proteins negatively regulate heat shock gene expression by controlling the synthesis and stability of sigma 32." Genes & Development 4(12a): 2202-2209.

Straus, D. B., W. A. Walter and C. A. Gross (1987). "The heat shock response of E. coli is regulated by changes in the concentration of σ32." Nature 329(6137): 348-351.

Streit, S., C. W. Michalski, M. Erkan, J. Kleeff and H. Friess (2009). "Northern blot analysis for detection and quantification of RNA in pancreatic cancer cells and tissues." Nat Protoc 4(1): 37- 43.

Sun, X., I. Zhulin and R. M. Wartell (2002). "Predicted structure and phyletic distribution of the RNA-binding protein Hfq." Nucleic Acids Res 30(17): 3662-3671.

268 Swanson, M. S. and B. K. Hammer (2000). "Legionella pneumophila pathogesesis: a fateful journey from amoebae to macrophages." Annu Rev Microbiol 54: 567-613.

Takahashi, S., H. Furusawa, T. Ueda and Y. Okahata (2013). "Translation enhancer improves the ribosome liberation from translation initiation." J Am Chem Soc 135(35): 13096-13106.

Takayanagi, Y., K. Tanaka and H. Takahashi (1994). "Structure of the 5' upstream region and the regulation of the rpoS gene of Escherichia coli." Mol Gen Genet 243(5): 525-531.

Tan, Y., R. J. Arnold and Z. Q. Luo (2011). "Legionella pneumophila regulates the small GTPase Rab1 activity by reversible phosphorylcholination." Proc Natl Acad Sci U S A 108(52): 21212-21217.

Tanner, J. R., L. Li, S. P. Faucher and A. K. Brassinga (2016). "The CpxRA two-component system contributes to Legionella pneumophila virulence." Mol Microbiol 100(6): 1017-1038.

Tateda, K., T. Matsumoto, Y. Ishii, N. Furuya, A. Ohno, S. Miyazaki and K. Yamaguchi (1998). "Serum Cytokines in Patients with Legionella Pneumonia: Relative Predominance of Th1-Type Cytokines." Clinical Diagnostic Laboratory Immunology 5(3): 401-403.

Tatlock, H. (1944). "A Rickettsia-like Organism Recovered from Guinea Pigs." Experimental Biology and Medicine 57(1): 95-99.

Tattersall, J., G. V. Rao, J. Runac, T. Hackstadt, S. S. Grieshaber and N. A. Grieshaber (2012). "Translation inhibition of the developmental cycle protein HctA by the small RNA IhtA is conserved across Chlamydia." PLoS One 7(10): e47439.

Taylor, M., K. Ross and R. Bentham (2009). "Legionella, protozoa, and biofilms: interactions within complex microbial systems." Microb Ecol 58(3): 538-547.

Thomason, M. K., F. Fontaine, N. D. Lay and G. Storz (2012). "A small RNA that regulates motility and biofilm formation in response to changes in nutrient availability in Escherichia coli." Molecular microbiology 84(1): 17-35.

Thompson, K. M., V. A. Rhodius and S. Gottesman (2007). "SigmaE regulates and is regulated by a small RNA in Escherichia coli." J Bacteriol 189(11): 4243-4256.

Tiaden, A., T. Spirig, P. Carranza, H. Bruggemann, K. Riedel, L. Eberl, C. Buchrieser and H. Hilbi (2008). "Synergistic contribution of the Legionella pneumophila lqs genes to pathogen-host interactions." J Bacteriol 190(22): 7532-7547.

Tiaden, A., T. Spirig, T. Sahr, M. A. Walti, K. Boucke, C. Buchrieser and H. Hilbi (2010). "The autoinducer synthase LqsA and putative sensor kinase LqsS regulate phagocyte interactions, extracellular filaments and a genomic island of Legionella pneumophila." Environ Microbiol 12(5): 1243-1259.

Tiaden, A., T. Spirig, S. S. Weber, H. Bruggemann, R. Bosshard, C. Buchrieser and H. Hilbi (2007). "The Legionella pneumophila response regulator LqsR promotes host cell interactions as

269 an element of the virulence regulatory network controlled by RpoS and LetA." Cell Microbiol 9(12): 2903-2920.

Tilly, K., N. McKittrick, M. Zylicz and C. Georgopoulos (1983). "The DnaK protein modulates the heat-shock response of Escherichia coli." Cell 34(2): 641-646.

Tilney, L. G., O. S. Harb, P. S. Connelly, C. G. Robinson and C. R. Roy (2001). "How the parasitic bacterium Legionella pneumophila modifies its phagosome and transforms it into rough ER: implications for conversion of plasma membrane to the ER membrane." Journal of cell science 114(Pt 24): 4637-4650.

Tobe, T., S. A. Beatson, H. Taniguchi, H. Abe, C. M. Bailey, A. Fivian, R. Younis, S. Matthews, O. Marches, G. Frankel, T. Hayashi and M. J. Pallen (2006). "An extensive repertoire of type III secretion effectors in Escherichia coli O157 and the role of lambdoid phages in their dissemination." Proc Natl Acad Sci U S A 103(40): 14941-14946.

Tomasini, A., K. Moreau, J. Chicher, T. Geissmann, F. Vandenesch, P. Romby, S. Marzi and I. Caldelari (2017). "The RNA targetome of Staphylococcus aureus non-coding RNA RsaA: impact on cell surface properties and defense mechanisms." Nucleic acids research 45(11): 6746- 6760.

Tomoyasu, T., J. Gamer, B. Bukau, M. Kanemori, H. Mori, A. J. Rutman, A. B. Oppenheim, T. Yura, K. Yamanaka, H. Niki and et al. (1995). "Escherichia coli FtsH is a membrane-bound, ATP-dependent protease which degrades the heat-shock transcription factor sigma 32." EMBO J 14(11): 2551-2560.

Tomoyasu, T., A. Mogk, H. Langen, P. Goloubinoff and B. Bukau (2001). "Genetic dissection of the roles of chaperones and proteases in protein folding and degradation in the Escherichia coli cytosol." Molecular Microbiology 40(2): 397-413.

Trigui, H., P. Dudyk, J. Oh, J. I. Hong and S. P. Faucher (2015). "A regulatory feedback loop between RpoS and SpoT supports the survival of Legionella pneumophila in water." Appl Environ Microbiol 81(3): 918-928.

Trigui, H., N. Mendis, L. Li, M. Saad and S. P. Faucher (2013). "Facets of small RNA-mediated regulation in Legionella pneumophila." Curr Top Microbiol Immunol 376: 53-80.

Tripathi, L., Y. Zhang and Z. Lin (2014). "Bacterial sigma factors as targets for engineered or synthetic transcriptional control." Front Bioeng Biotechnol 2: 33.

Truchan, H. K., H. D. Christman, R. C. White, N. S. Rutledge and N. P. Cianciotto (2017). "Type II Secretion Substrates of Legionella pneumophila Translocate Out of the Pathogen- Occupied Vacuole via a Semipermeable Membrane." mBio 8(3): e00870-00817.

Tyson, J. Y., M. M. Pearce, P. Vargas, S. Bagchi, B. J. Mulhern and N. P. Cianciotto (2013). "Multiple Legionella pneumophila Type II secretion substrates, including a novel protein, contribute to differential infection of the amoebae Acanthamoeba castellanii, Hartmannella vermiformis, and Naegleria lovaniensis." Infect Immun 81(5): 1399-1410.

270 Unoson, C. and E. G. H. Wagner (2007). "Dealing with stable structures at ribosome binding sites: Bacterial translation and ribosome standby." RNA Biology 4(3): 113-117.

Updegrove, T. B., S. A. Shabalina and G. Storz (2015). "How do base-pairing small RNAs evolve?" FEMS Microbiol Rev 39(3): 379-391.

Van Engelenburg, S. B. and A. E. Palmer (2010). "Imaging type-III secretion reveals dynamics and spatial segregation of Salmonella effectors." Nat Methods 7(4): 325-330. van Heijnsbergen, E., J. A. Schalk, S. M. Euser, P. S. Brandsema, J. W. den Boer and A. M. de Roda Husman (2015). "Confirmed and Potential Sources of Legionella Reviewed." Environ Sci Technol 49(8): 4797-4815.

Vanderpool, C. K. and S. Gottesman (2004). "Involvement of a novel transcriptional activator and small RNA in post-transcriptional regulation of the glucose phosphoenolpyruvate phosphotransferase system: RNA regulator of phosphosugar stress response." Molecular Microbiology 54(4): 1076-1089.

Vaubourgeix, J., G. Lin, N. Dhar, N. Chenouard, X. Jiang, H. Botella, T. Lupoli, O. Mariani, G. Yang, O. Ouerfelli, M. Unser, D. Schnappinger, J. McKinney and C. Nathan (2015). "Stressed Mycobacteria Use the Chaperone ClpB to Sequester Irreversibly Oxidized Proteins Asymmetrically Within and Between Cells." Cell Host & Microbe 17(2): 178-190.

Vecerek, B., I. Moll and U. Blasi (2007). "Control of Fur synthesis by the non-coding RNA RyhB and iron-responsive decoding." EMBO J 26(4): 965-975.

Virag, L., R. I. Jaen, Z. Regdon, L. Bosca and P. Prieto (2019). "Self-defense of macrophages against oxidative injury: Fighting for their own survival." Redox Biol 26: 101261.

Vogel, J. and E. G. Wagner (2007). "Target identification of small noncoding RNAs in bacteria." Curr Opin Microbiol 10(3): 262-270.

Vogel, J. P., C. Roy and R. R. Isberg (1996). "Use of Salt to Isolate Legionella pneumophila Mutants Unable to Replicate in Macrophages." Annals of the New York Academy of Sciences 797(1): 271-272.

Vogt, S. L. and T. L. Raivio (2012). "Just scratching the surface: an expanding view of the Cpx envelope stress response." FEMS Microbiology Letters 326(1): 2-11. von Baum, H., S. Ewig, R. Marre, N. Suttorp, S. Gonschior, T. Welte, C. Luck and G. Competence Network for Community Acquired Pneumonia Study (2008). "Community-acquired Legionella pneumonia: new insights from the German competence network for community acquired pneumonia." Clin Infect Dis 46(9): 1356-1364.

Wadler, C. S. and C. K. Vanderpool (2007). "A dual function for a bacterial small RNA: SgrS performs base pairing-dependent regulation and encodes a functional polypeptide." Proceedings of the National Academy of Sciences 104(51): 20454-20459.

271 Wadowsky, R. M., T. M. Wilson, N. J. Kapp, A. J. West, J. M. Kuchta, S. J. States, J. N. Dowling and R. B. Yee (1991). "Multiplication of Legionella spp. in tap water containing Hartmannella vermiformis." Appl Environ Microbiol 57(7): 1950-1955.

Wagner, E. G. H. (2009). "Kill the messenger: bacterial antisense RNA promotes mRNA decay." Nature structural & molecular biology 16(8): 804-806.

Wagner, E. G. H. and P. Romby (2015). "Chapter Three Small RNAs in Bacteria and Archaea Who They Are, What They Do, and How They Do It." Advances in Genetics 90: 133-208.

Wai, S. N., B. Lindmark, T. Soderblom, A. Takade, M. Westermark, J. Oscarsson, J. Jass, A. Richter-Dahlfors, Y. Mizunoe and B. E. Uhlin (2003). "Vesicle-mediated export and assembly of pore-forming oligomers of the enterobacterial ClyA cytotoxin." Cell 115(1): 25-35.

Wakeman, C. A. and W. C. Winkler (2009). "Analysis of the RNA backbone: structural analysis of riboswitches by in-line probing and selective 2'-hydroxyl acylation and primer extension." Methods Mol Biol 540: 173-191.

Waller, P. R. and R. T. Sauer (1996). "Characterization of degQ and degS, Escherichia coli genes encoding homologs of the DegP protease." J Bacteriol 178(4): 1146-1153.

Walsh, N. P., B. M. Alba, B. Bose, C. A. Gross and R. T. Sauer (2003). "OMP Peptide Signals Initiate the Envelope-Stress Response by Activating DegS Protease via Relief of Inhibition Mediated by Its PDZ Domain." Cell 113(1): 61-71.

Wang, C. Y., S. W. Wang, W. C. Huang, K. S. Kim, N. S. Chang, Y. H. Wang, M. H. Wu and C. H. Teng (2012). "Prc contributes to Escherichia coli evasion of classical complement-mediated serum killing." Infect Immun 80(10): 3399-3409.

Wang, H., M. A. Edwards, J. O. Falkinham, 3rd and A. Pruden (2013). "Probiotic approach to pathogen control in premise plumbing systems? A review." Environ Sci Technol 47(18): 10117- 10128.

Wassarman, K. M. (2007). "6S RNA: a regulator of transcription." Mol Microbiol 65(6): 1425- 1431.

Watarai, M., I. Derre, J. Kirby, J. D. Growney, W. F. Dietrich and R. R. Isberg (2001). "Legionella pneumophila Is Internalized by a Macropinocytotic Uptake Pathway Controlled by the Dot/Icm System and the Mouse Lgn1 Locus." Journal of Experimental Medicine 194(8): 1081-1096.

Waxman, D. J. and J. L. Strominger (1983). "Penicillin-binding proteins and the mechanism of action of beta-lactam antibiotics." Annu Rev Biochem 52: 825-869.

Weissenmayer, B. A., J. G. Prendergast, A. J. Lohan and B. J. Loftus (2011). "Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs." PLoS One 6(3): e17570.

272 Wen, Y., J. Feng, D. R. Scott, E. A. Marcus and G. Sachs (2011). "A cis-encoded antisense small RNA regulated by the HP0165-HP0166 two-component system controls expression of ureB in Helicobacter pylori." J Bacteriol 193(1): 40-51.

Westermann, A. J. (2018). "Regulatory RNAs in Virulence and Host-Microbe Interactions." Microbiology spectrum 6(4): 305-337.

Whiley, H., R. Bentham and M. H. Brown (2017). "Legionella Persistence in Manufactured Water Systems: Pasteurization Potentially Selecting for Thermal Tolerance." Front Microbiol 8: 1330.

Wilderman, P. J., N. A. Sowa, D. J. FitzGerald, P. C. FitzGerald, S. Gottesman, U. A. Ochsner and M. L. Vasil (2004). "Identification of tandem duplicate regulatory small RNAs in Pseudomonas aeruginosa involved in iron homeostasis." Proceedings of the National Academy of Sciences of the United States of America 101(26): 9792-9797.

Williams, R. E. O. and G. J. Harper (1947). "Staphylococcal haemolysins on sheep-blood agar with evidence for a fourth haemolysin." The Journal of pathology and bacteriology 59(1-2): 69- 78.

Winkler, J., A. Seybert, L. Konig, S. Pruggnaller, U. Haselmann, V. Sourjik, M. Weiss, A. S. Frangakis, A. Mogk and B. Bukau (2010). "Quantitative and spatio-temporal features of protein aggregation in Escherichia coli and consequences on protein quality control and cellular ageing." EMBO J 29(5): 910-923.

Winn, W. C., Jr. (1988). "Legionnaires disease: historical perspective." Clin Microbiol Rev 1(1): 60-81.

Wolfe, A. J. (2010). "Physiologically relevant small phosphodonors link metabolism to signal transduction." Curr Opin Microbiol 13(2): 204-209.

World Health Organization. (2003). Emerging issues in water and infectious disease. Geneva, World Health Organization.

Wrase, R., H. Scott, R. Hilgenfeld and G. Hansen (2011). "The Legionella HtrA homologue DegQ is a self-compartmentizing protease that forms large 12-meric assemblies." Proc Natl Acad Sci U S A 108(26): 10490-10495.

Wright, E. K., S. A. Goodart, J. D. Growney, V. Hadinoto, M. G. Endrizzi, E. M. Long, K. Sadigh, A. L. Abney, I. Bernstein-Hanley and W. F. Dietrich (2003). "Naip5 affects host susceptibility to the intracellular pathogen Legionella pneumophila." Curr Biol 13(1): 27-36.

Xu, L., X. Shen, A. Bryan, S. Banga, M. S. Swanson and Z. Q. Luo (2010). "Inhibition of host vacuolar H+-ATPase activity by a Legionella pneumophila effector." PLoS Pathog 6(3): e1000822.

273 Xu, X., Y. Niu, K. Liang, J. Wang, X. Li and Y. Yang (2015). "Heat shock transcription factor δ³² is targeted for degradation via an ubiquitin-like protein ThiS in Escherichia coli." Biochemical and biophysical research communications 459(2): 240-245.

Yakhnin, A. V., C. S. Baker, C. A. Vakulskas, H. Yakhnin, I. Berezin, T. Romeo and P. Babitzke (2013). "CsrA activates flhDC expression by protecting flhDC mRNA from RNase E-mediated cleavage." Molecular microbiology 87(4): 851-866.

Yamamoto, Y., T. W. Klein, C. A. Newton, R. Widen and H. Friedman (1988). "Growth of Legionella pneumophila in thioglycolate-elicited peritoneal macrophages from A/J mice." Infection and immunity 56(2): 370-375.

Yang, J., Y. Zhao, J. Shi and F. Shao (2013). "Human NAIP and mouse NAIP1 recognize bacterial type III secretion needle protein for inflammasome activation." Proc Natl Acad Sci U S A 110(35): 14408-14413.

Yang, Q., N. Figueroa-Bossi and L. Bossi (2014). "Translation enhancing ACA motifs and their silencing by a bacterial small regulatory RNA." PLoS genetics 10(1): e1004026.

Yoshida, S., Y. Goto, Y. Mizuguchi, K. Nomoto and E. Skamene (1991). "Genetic control of natural resistance in mouse macrophages regulating intracellular Legionella pneumophila multiplication in vitro." Infection and Immunity 59(1): 428-432.

Yoshida, S.-I. and Y. Mizuguchi (1986). "Multiplication of Legionella pneumophila Philadelphia-1 in cultured peritoneal macrophages and its correlation to susceptibility of animals." Canadian Journal of Microbiology 32(5): 438-442.

Yura, T. (2019). "Regulation of the heat shock response in Escherichia coli: history and perspectives." Genes & Genetic Systems 94(3): 103-108.

Zahringer, U., Y. A. Knirel, B. Lindner, J. H. Helbig, A. Sonesson, R. Marre and E. T. Rietschel (1995). "The lipopolysaccharide of Legionella pneumophila serogroup 1 (strain Philadelphia 1): chemical structure and biological significance." Prog Clin Biol Res 392: 113-139.

Zhang, A., S. Altuvia, A. Tiwari, L. Argaman, R. Hengge-Aronis and G. Storz (1998). "The OxyS regulatory RNA represses rpoS translation and binds the Hfq (HF-I) protein." EMBO J 17(20): 6061-6068.

Zhao, Y., J. Yang, J. Shi, Y.-N. Gong, Q. Lu, H. Xu, L. Liu and F. Shao (2011). "The NLRC4 inflammasome receptors for bacterial flagellin and type III secretion apparatus." Nature 477(7366): 596-600.

Zhong, G. (2011). "Chlamydia trachomatis secretion of proteases for manipulating host signaling pathways." Frontiers in microbiology 2: 14.

Zhong, G., P. Fan, H. Ji, F. Dong and Y. Huang (2001). "Identification of a Chlamydial Protease–Like Activity Factor Responsible for the Degradation of Host Transcription Factors." The Journal of Experimental Medicine 193(8): 935-942.

274 Zhou, Y. N. and D. J. Jin (1998). "The rpoB mutants destabilizing initiation complexes at stringently controlled promoters behave like "stringent" RNA polymerases in Escherichia coli." Proc Natl Acad Sci U S A 95(6): 2908-2913.

Zhu, M., Y. Pan and X. Dai (2019). "(p)ppGpp: the magic governor of bacterial growth economy." Curr Genet 65(5): 1121-1125.

Zhu, W., L. A. Hammad, F. Hsu, Y. Mao and Z.-Q. Luo (2013). "Induction of caspase 3 activation by multiple Legionella pneumophila Dot/Icm substrates." Cellular microbiology 15(11): 1783-1795.

Ziltener, P., T. Reinheckel and A. Oxenius (2016). "Neutrophil and Alveolar Macrophage- Mediated Innate Immune Control of Legionella pneumophila Lung Infection via TNF and ROS." PLOS Pathogens 12(4): e1005591.

Zusman, T., G. Aloni, E. Halperin, H. Kotzer, E. Degtyar, M. Feldman and G. Segal (2007). "The response regulator PmrA is a major regulator of the icm/dot type IV secretion system in Legionella pneumophila and Coxiella burnetii." Mol Microbiol 63(5): 1508-1523.

Zusman, T., O. Gal-Mor and G. Segal (2002). "Characterization of a Legionella pneumophila relA insertion mutant and toles of RelA and RpoS in virulence gene expression." J Bacteriol 184(1): 67-75.

275