DOCSLIB.ORG

Redalyc.Development of EPIC-PCR Markers for Lutjanus Purpureus (Lutjanidae-Perciformes) and Their Potential Applicability In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Redalyc.Development of EPIC-PCR Markers for Lutjanus Purpureus (Lutjanidae-Perciformes) and Their Potential Applicability In Anais da Academia Brasileira de Ciências ISSN: 0001-3765 [email protected] Academia Brasileira de Ciências Brasil DA SILVA, RAIMUNDO; SILVA, DANILLO; VENEZA, IVANA; SAMPAIO, IRACILDA; SCHNEIDER, HORACIO; GOMES, GRAZIELLE Development of EPIC-PCR Markers for Lutjanus purpureus (Lutjanidae-Perciformes) and their Potential Applicability in Population Analyses Anais da Academia Brasileira de Ciências, vol. 89, núm. 3, 2017, pp. 2095-2100 Academia Brasileira de Ciências Rio de Janeiro, Brasil Available in: http://www.redalyc.org/articulo.oa?id=32753602012 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative Anais da Academia Brasileira de Ciências (2017) 89(3 Suppl.): 2095-2100 (Annals of the Brazilian Academy of Sciences) Printed version ISSN 0001-3765 / Online version ISSN 1678-2690 http://dx.doi.org/10.1590/0001-3765201720150476 www.scielo.br/aabc | www.fb.com/aabcjournal Development of EPIC-PCR Markers for Lutjanus purpureus (Lutjanidae- Perciformes) and their Potential Applicability in Population Analyses RAIMUNDO DA SILVA1, DANILLO SILVA1, IVANA VENEZA1, IRACILDA SAMPAIO2, HORACIO SCHNEIDER2 and GRAZIELLE GOMES1 1Laboratório de Genética Aplicada, Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus Bragança, Alameda Leandro Ribeiro, s/n, Aldeia, 68600-000 Bragança, PA, Brazil 2Laboratório de Genética e Biologia Molecular, Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus Bragança, Alameda Leandro Ribeiro, s/n, Aldeia, 68600-000 Bragança, PA, Brazil Manuscript received on July 9, 2015; accepted for publication on May 25, 2016. ABSTRACT In the present study, a novel set of eight EPIC primers were developed for Lutjanus purpureus and assayed in five other marine teleosts including three lutjanids, one scianid and one anablepid. Most of the genomic regions used in this study presented genetic diversity indexes equal or greater than the intragenic regions commonly used in population genetics studies. Moreover, six out of eight markers showed cross- amplification with other taxa. Thus, the primers described here may be used to elucidate questions at the intraspecific level for a large number of taxa. Key words: EPIC-PCR, intron, Lutjanus, Southern Red Snapper. INTRODUCTION level of polymorphism (Zhang and Hewitt 2003) and generally reflect population dynamics that Advances in DNA sequencing technology have have occurred in recent periods (see Morin et al. provided access to information of a large number 2004, Guichoux et al. 2011). of loci in non-model organisms, and have promoted Another class of markers that has been widely great significant advances in population genetics used at the population level is the single-copy and related fields. On the other hand, approaches nuclear DNA sequences (e.g., introns). Introns that employ a limited number of independent and are untranslated intragenic regions of the nuclear variable genomic regions are useful for describing genome that may include polymorphism capable evolutionary processes that act on a given of revealing information regarding the population taxonomic group (Bowen et al. 2014). structure of taxa. Thus, introns are suitable for use Microsatellites are the most commonly used in population genetics and phylogeography studies molecular markers in intraspecific studies, and for (Zhang and Hewitt 2003). population-level analyses because they have a high Moreover, it has been postulated that DNA Correspondence to: Grazielle Gomes sequence-based markers provide more accurate E-mail: [email protected] descriptions of historical demographic processes An Acad Bras Cienc (2017) 89 (3 Suppl.) 2096 RAIMUNDO DA SILVA et al. compared with those obtained using microsatellites primers design using as main criteria of choice (Brumfield et al. 2003). Thus, the combination the information about the position of introns and of microsatellite markers and introns is of great exons (Table I), with intron fragments ranging from importance for understanding the evolutionary 200-1000 bp. The primers were designed using the history of species in different historical periods software FastPCR (Kalendar et al. 2009) using the (Zhang and Hewitt 2003). default parameters. In the present study, we used the exon- The primers developed in the present study primed intron-crossing (EPIC-PCR) (Lessa 1992) (Table I) were initially used on specimens of L. technique to develop a set of novel nuclear markers purpureus collected along the coast of the state of for Lutjanus purpureus that are amplifiable across Pará (North of Brazil), to characterize the levels the Lutjanidae family and other marine teleosts. of polymorphism. For North coast of Brazil, there EPIC is based on the design of primers anchored is a single stock, with elevated levels of variation in the adjacent exons, in order to amplify and (Sousa-Júnior et al. 2002, Gomes et al. 2008, 2012). sequence the intron (Li et al. 2010). Given the With the aim to demonstrate that these markers could high rate of substitution for the majority of introns, be used in different groups and phylogenetically EPIC-PCR has been used to investigate patterns distant taxa, cross-amplification was tested in five of intraspecific genetic variation in many taxa, other marine teleosts (two indvidual per species) including teleosts (Gaither et al. 2010, 2011, Li including other lutjanids (Lutjanus synagris, et al. 2010, Silva-Oliveira et al. 2012, Chow and Rhomboplites aurorubens, Ocyurus chrysurus), Yanagimoto 2016). Lutjanidae and several other a Sciaenidae (Cynoscion jamaicensis), and groups of marine teleosts are organisms that have Anablepidae (Anableps anableps). All individuals wide geographic distributions, which make them used in the present analysis were purchased in good models for phylogeographic and population municipal markets of the north coast of Brazil, genetic analyses. In addition, isolation and marketed dead. The DNA was isolated using the phenol- characterization of microsatellite markers has chloroform protocol (Sambrook et al. 1989). frequently been performed in Lutjanidae (Pinsky The amplicons were amplified by PCR using the and Palumbi 2014). However, a limited number primers described in Table I. We also amplified of population analyses have been conducted six genomic regions previously used in lutjanids using introns (i.e., Gaither et al. 2010). Moreover, (Table II) for comparisons purpose. The PCR snappers are important fishery resources; therefore, reactions were standardized to a final volume studies aimed at their genetic characterization are of 15 μL, which contained 200 µM of dNTPs, 1 fundamental for delimitation and management of x of buffer (200 mM Tris-HCl- pH 8.0, 500 mM stocks. KCl) , 3 mM of MgCl2, 5 mM of each primer, MATERIALS AND METHODS approximately 50 ng of DNA template, 0.5 U Taq Polymerase and water up to the reaction final Primers were developed through the EPIC-PCR volume. The amplification conditions were: 95°C technique, based on sequences available in the for 3 minutes followed by 35 cycles at 95°C for 35 GenBank (http://www.ncbi.nlm.nih.gov/genbank/). seconds, 45 seconds (see Table I for Annealing), We made a manual search in GenBank for nuclear 80 seconds at 72°C, and a final cycle of 3 minutes sequences of Lutjanidae and model species of at 72°C. Positive PCRs were sequenced using the closely taxa in order to find potential regions for dideoxy method (Sanger et al. 1977) and the ABI An Acad Bras Cienc (2017) 89 (3 Suppl.) DEVELOPMENT OF INTRAGENIC MARKERS FOR LUTJANIDS 2097 TABLE I Description for the markers developed in the present study. Annealing Locus (Abbreviation) Primers Sequence 5’-3’ GenBank Access Code (◦C) Delta 6 desaturase - Intron Sparus aurata Delt6 F8 TTACTACCTTCGCTACCTGTGCT 64 8 (Delta 8) (AF525692) Delt6 R8 AGTCACCCACACAAACCAGTKAC Delta 6 desaturase- Intron Sparus aurata Delt6 F10 GTTCAGCGGACACCTCAACT 50 10 (Delta 10) (AF525692) Delt6 F10 CACACAGTGCGTGGACAAG Myostatin - Intron1 Lates calcarifer Myo 1F ATGAGCATGCCATCACAGAG 64 (Myo 1) (EF672685) Lutjanus russellii Myo 1R ATGCGATTGGCTTGAAACTT (JQ068866) Myostatin - Intron2 Lates calcarifer Myo 2F GCATCGAGATTAACGCCTTC 64 (Myo 2) (EF672685) Lutjanus russellii Myo 2R GGCCCTCTGAGATCTTCACC (JQ068866) Trypsin - Intron1 Lutjanus fulvus Try 2F CCTGATCTCCAGCACCTGGGTK 60 (Try 1) (AB738891) Try 2R GATGTCATTGTYCAGGTTGCSGCT LWSCO - Intron1 Lutjanus johnii LWSCO 1F GCTGATCTGGGAGAGACAGTTT 60 (LWSCO 1) (FJ824756) LWSCO 1R CATTTGGCATCAAACTTGACAT Insulin-like Growth Factor Dicentrarchus labrax FC-F1 AGCGCTCTTTCCTTTCAGTG 59 (IGF 1) (GQ924783) FC-R1 CRCACAGCAGTAGTGAGAGG Interferon - Intron2 Dicentrarchus labrax Int 2F GTACAGMCAGGCGTCCAAAGCAT 64 (Int 2) (AM946400) Sparus aurata Int 2R GTTCTCCTCCCATGATGCMGAG (FM882244) 3500 XL automatic sequencer. All DNA sequences et al. 2001), implemented in the DNAsp v. 5.10. are available in Genbank under the accession codes (Librado and Rozas 2009), based on 1,000 burn-in KT869380 to KT869495 and in Figshare: (http:// iterations, 1,000 main iterations, thinning interval dx.doi.org/10.6084/m9.figshare.1564736;http:// of 1 and using a threshold of 0.6. In certain cases, dx.doi.org/10.6084/m9.figshare.1564735). haplotypes returning with a probability lower than The sequences were edited with the BioEdit 0.6 were resolved by the Clark’s method (Clark software (Hall 1999), and
Load more

Recommended publications
  • Molecular Authentication of Pargo Fillets Lutjanus Purpureus (Perciformes: Lutjanidae) by DNA Barcoding Reveals Commercial Fraud
    Neotropical Ichthyology, 16(1): e170068, 2018 Journal homepage: www.scielo.br/ni DOI: 10.1590/1982-0224-20170068 Published online: 26 March 2018 (ISSN 1982-0224) Copyright © 2018 Sociedade Brasileira de Ictiologia Printed: 31 March 2018 (ISSN 1679-6225) Original article Molecular authentication of Pargo fillets Lutjanus purpureus (Perciformes: Lutjanidae) by DNA barcoding reveals commercial fraud Ivana Veneza1, Raimundo Silva1, Leilane Freitas1, Sâmia Silva1, Kely Martins1, Iracilda Sampaio2, Horacio Schneider2 and Grazielle Gomes1,2 The Caribbean Red Snapper (Pargo) Lutjanus purpureus is the most economically important snapper in Brazil, which is sold, among other forms, as frozen fillets. During the process of transformation into fillets there is the removal of the distinctive morphological traits, being able to favor the substitution by less valued species. In addition, there is no national legislation requiring the insertion of the specific name on the product label. However, according to a Normative Instruction (IN N ° 29/2015 MAPA) that correlates the common and specific names of the products destined to the national trade, in Brazil only L. purpureus and L. campechanus can be denominated “Pargo”. Thus, the DNA barcode tool was used to identify the fillets sold in north of Brazil, labeled “Pargo”, with the aid of sequences from the public and control databases. The results showed that among 142 fillets examined, 78% was identified as L. purpureus and 22% as Rhomboplites aurorubens, a snapper with low commercial value in the country, revealing commercial fraud. The molecular identification method successfully used in this study to authenticate fillets snappers may also be used by surveillance authorities in the quality control of processed fish products, towards ensuring consumer rights.
    [Show full text]
  • Seafood Watch Seafood Report
    Seafood Watch Seafood Report Commercially Important Gulf of Mexico/South Atlantic Snappers Red snapper, Lutjanus campechanus Vermilion snapper, Rhomboplites aurorubens Yellowtail snapper, Ocyurus chrysurus With minor reference to: Gray snapper, Lutjanus griseus Mutton snapper, Lutjanus analis Lane snapper, Lutjanus synagris Lutjanus campechanus Illustration ©Monterey Bay Aquarium Original Report dated April 20, 2004 Last updated February 4, 2009 Melissa M Stevens Fisheries Research Analyst Monterey Bay Aquarium Seafood Watch® Gulf of Mexico/South Atlantic Snappers Report February 4, 2009 About Seafood Watch® and the Seafood Reports Monterey Bay Aquarium’s Seafood Watch® program evaluates the ecological sustainability of wild-caught and farmed seafood commonly found in the United States marketplace. Seafood Watch® defines sustainable seafood as originating from sources, whether wild-caught or farmed, which can maintain or increase production in the long-term without jeopardizing the structure or function of affected ecosystems. Seafood Watch® makes its science-based recommendations available to the public in the form of regional pocket guides that can be downloaded from the Internet (seafoodwatch.org) or obtained from the Seafood Watch® program by emailing [email protected]. The program’s goals are to raise awareness of important ocean conservation issues and empower seafood consumers and businesses to make choices for healthy oceans. Each sustainability recommendation on the regional pocket guides is supported by a Seafood Report. Each report synthesizes and analyzes the most current ecological, fisheries and ecosystem science on a species, then evaluates this information against the program’s conservation ethic to arrive at a recommendation of “Best Choices”, “Good Alternatives” or “Avoid.” The detailed evaluation methodology is available upon request.
    [Show full text]
  • Red Snapper, Vermilion Snapper, Yellowtail Snapper Gulf of Mexico
    Red Snapper, Vermilion Snapper, Yellowtail Snapper Lutjanus campechanus, Rhomboplites aurorubens, Ocyurus chrysurus ©Monterey Bay Aquarium Gulf of Mexico/South Atlantic Vertical Line: Hydraulic/Electric Reel, Rod and Reel, Hand Line January 9, 2013 Rachelle Fisher, Consulting Researcher Disclaimer Seafood Watch® strives to ensure all our Seafood Reports and the recommendations contained therein are accurate and reflect the most up-to-date evidence available at time of publication. All our reports are peer- reviewed for accuracy and completeness by external scientists with expertise in ecology, fisheries science or aquaculture. Scientific review, however, does not constitute an endorsement of the Seafood Watch program or its recommendations on the part of the reviewing scientists. Seafood Watch is solely responsible for the conclusions reached in this report. We always welcome additional or updated data that can be used for the next revision. Seafood Watch and Seafood Reports are made possible through a grant from the David and Lucile Packard Foundation. 2 Final Seafood Recommendation Although there are many snappers caught in the U.S., only the three most commercially important species relative to landed weight and value (red snapper (Lutjanus campechanus), vermilion snapper (Rhomboplites aurorubens), and yellowtail snapper (Ocyurus chrysurus) are discussed here. This report discusses snapper caught in the South Atlantic (SA) and Gulf of Mexico (GOM) by vertical gear types including hydraulic/electric reel, rod and reel, and handline. Snapper caught by bottom longline in the GOM and SA will not be discussed since it makes up a statistically insignificant proportion of the total snapper catch in the GOM and in the SA bottom longline fishing in waters shallower than 50 fathoms, where snapper are generally caught, is prohibited.
    [Show full text]
  • 1 RED SNAPPER – Lutjanus Spp. Depending on Language And
    RED SNAPPER – Lutjanus spp. Depending on language and location, the name Red Snapper applies to a number of fish species across the globe within the Lutjanidae family, and refers to those snappers that exhibit a red coloration as adults. Species falling under the title “red snapper” include: • Lutjanus campechanus (Northern red snapper; found in the Western Atlantic from the Gulf of Mexico and southeastern USA to the northern coast of South America) • Lutjanus argentimaculatus (Mangrove red snapper; found in the Indo-West Pacific from East Africa to Southeast Asia and south to the northern coasts of Australia) • Lutjanus purpureus (Southern red snapper; found in the Caribbean Sea to the northeast coast of South America) • Lutjanus buccanella (Blackfin snapper; found in the Western Atlantic from the Gulf of Mexico and southeastern USA to the northern coast of South America) • Lutjanus bohar (Two-spot red snapper; found in the Indo-Pacific from East Africa to the Pacific islands south to Australia. • Lutjanus erhrytropterus (Crimson red snapper; found in the Western Pacific and Indian Oceans, from the Gulf of Oman to Japan and northern Australia) • Lutjanus malabaricus (Malabar blood snapper; found in the Western Pacific, where it is found east to Fiji and Japan, and Indian Ocean, where it occurs west to the Persian Gulf and Arabian Sea). Snappers are an extremely important fishery resource in the geographies where they are found, contributing to production for both local consumption as well as export markets. Red snappers are one of the most valuable and widely recognized members among the Lutjanidae, although the common name “red snapper” pertains to, and are sometimes used indistinctively for, several distinct species.
    [Show full text]
  • Lutjanus Vivanus (Cuvier, 1828) LTJ Frequent Synonyms / Misidentifications: None / Lutjanus Campechanus (Poey, 1860), Lutjanus Purpureus (Poey, 1866)
    click for previous page Perciformes: Percoidei: Lutjanidae 1499 Lutjanus vivanus (Cuvier, 1828) LTJ Frequent synonyms / misidentifications: None / Lutjanus campechanus (Poey, 1860), Lutjanus purpureus (Poey, 1866). FAO names: En - Silk snapper; Fr - Vivaneau soie; Sp - Pargo de lo alto. Diagnostic characters: Vomer and palatines with teeth, those on vomer in anchor-shaped patch with posterior extension on median line; no teeth on ectopterygoids. Maxilla without scales. Gill rakers on first arch 6 to 9 on upper limb and 16 or 17on lower limb, total 22 to 25. Dorsal fin single, spinous portion of fin not deeply incised at its junction with soft portion. Last soft ray of both dorsal and anal fins not elongated. Anal fin angulated in specimens more than about 6 cm standard length. Caudal fin lunate. Dorsal fin with 10 spines and 14, occasionally 13, soft rays. Anal fin with 3 spines and 8, rarely 7, soft rays.Pectoral fin with 16 to 18, usually 17, rays. Membranes of soft dorsal and anal fins with scales. Tubed scales in lateral line 47 to 50. Rows of lateral scales 50 to 53, most frequently 51; scales above lateral line 10 to 12; scales below lateral line 20 to 24; sum of rows of lateral scales and scales above and below lateral line 82 to 87, rarely 81 or 88. Colour: back and upper sides red to pink;lower sides and belly lighter;body sometimes with alter- nating red and white bars; iris of eye bright yellow; dark spot below anterior part of soft dorsal fin (per- sisting to about 20 to 25 cm standard length), spot usually black, occasionally red; fins mostly reddish, dorsal and anal fins with some yellow, posterior margin of caudal fin sometimes deep red or dusky, pectoral fins pale yellow.
    [Show full text]
  • Lack of Spatial Subdivision for the Snapper Lutjanus Purpureus (Lutjanidae – Perciformes) from Southwest Atlantic Based on Multi-Locus Analyses
    RESEARCH ARTICLE Lack of Spatial Subdivision for the Snapper Lutjanus purpureus (Lutjanidae – Perciformes) from Southwest Atlantic Based on Multi-Locus Analyses Raimundo da Silva1☯, Iracilda Sampaio2‡, Horacio Schneider2‡, Grazielle Gomes1☯* 1 Laboratório de Genética Aplicada, Campus Bragança, Universidade Federal do Pará, Bragança, Pará, Brasil, 2 Laboratório de Genética e Biologia Molecular, Campus Bragança, Universidade Federal do Pará, Bragança, Pará, Brasil a11111 ☯ These authors contributed equally to this work. ‡ These authors also contributed equally to this work. * [email protected] Abstract OPEN ACCESS The Caribbean snapper Lutjanus purpureus is a marine species fish commonly found associ- Citation: da Silva R, Sampaio I, Schneider H, Gomes ated with rocky seabeds and is widely distributed along of Western Atlantic. Data on stock G (2016) Lack of Spatial Subdivision for the Snapper Lutjanus purpureus (Lutjanidae – Perciformes) from delineation and stock recognition are essential for establishing conservation measures for Southwest Atlantic Based on Multi-Locus Analyses. commercially fished species. However, few studies have investigated the population genetic PLoS ONE 11(8): e0161617. doi:10.1371/journal. structure of this economically valuable species, and previous studies (based on only a portion pone.0161617 of the mitochondrial DNA) provide an incomplete picture. The present study used a multi- Editor: Michael Knapp, University of Otago, NEW locus approach (12 segments of mitochondrial and nuclear DNA) to elucidate the levels of ZEALAND genetic diversity and genetic connectivity of L. purpureus populations and their demographic Received: March 7, 2016 history. L. purpureus has high levels of genetic diversity, which probably implies in high effec- Accepted: August 9, 2016 tive population sizes values for the species.
    [Show full text]
  • Check List LISTS of SPECIES Check List 11(3): 1659, May 2015 Doi: ISSN 1809-127X © 2015 Check List and Authors
    11 3 1659 the journal of biodiversity data May 2015 Check List LISTS OF SPECIES Check List 11(3): 1659, May 2015 doi: http://dx.doi.org/10.15560/11.3.1659 ISSN 1809-127X © 2015 Check List and Authors Coastal fishes of Rio Grande do Norte, northeastern Brazil, with new records José Garcia Júnior1*, Marcelo Francisco Nóbrega2 and Jorge Eduardo Lins Oliveira2 1 Instituto Federal de Educação, Ciência e Tecnologia do Rio Grande do Norte, Campus Macau, Rua das Margaridas, 300, CEP 59500-000, Macau, RN, Brazil 2 Universidade Federal do Rio Grande do Norte, Departamento de Oceanografia e Limnologia, Laboratório de Biologia Pesqueira, Praia de Mãe Luiza, s/n°, CEP 59014-100, Natal, RN, Brazil * Corresponding author. E-mail: [email protected] Abstract: An updated and reviewed checklist of coastal more continuous than northern coast, the three major fishes of the Rio Grande do Norte state, northeastern estuaries are small and without many ramifications, and coast of Brazil, is presented. Between 2003 and 2013 the reefs are more numerous but smaller and relatively the occurrence of fish species were recorded through closer to each other than northern coast. The first and collection of specimens, landing records of the artisanal only checklist of fish species that occur along the coast fleet, literature reviews and from specimens deposited of RN was produced in 1988 and comprised 190 species in ichthyological collections. A total of 459 species from (Soares 1988). This situation improved after 2000 with 2 classes, 26 orders, 102 families and 264 genera is listed, fish surveys in specific sites of the coast (e.g., Feitoza with 83 species (18% of the total number) recorded for 2001; Feitosa et al.
    [Show full text]
  • A Barcode for the Authentication of the Snappers (Lutjanidae) of the Western Atlantic: Rdna 5S Or Mitochondrial COI?
    Food Control 38 (2014) 116e123 Contents lists available at ScienceDirect Food Control journal homepage: www.elsevier.com/locate/foodcont A barcode for the authentication of the snappers (Lutjanidae) of the western Atlantic: rDNA 5S or mitochondrial COI? Ivana Veneza a, Bruna Felipe a, Joiciane Oliveira a, Raimundo Silva a, Iracilda Sampaio b, Horacio Schneider b, Grazielle Gomes a,b,* a Laboratório de Genética Aplicada, Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus Universitário de Bragança, Alameda Leandro Ribeiro s/n, Aldeia, Bragança, Pará, Brazil b Laboratório de Genética and Biologia Molecular, Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus Universitário de Bragança, Brazil article info abstract Article history: The increasing demand for fishery resources in recent years has stimulated a growth in the output of Received 5 February 2013 processed products, which has made the fraudulent substitution of species a common practice. In the Received in revised form present study two different protocols were evaluated for the molecular authentication of lutjanid species, 8 October 2013 one based on the banding pattern of the nuclear rDNA 5S gene, and the other on the sequences of the Accepted 9 October 2013 mitochondrial Cytochrome Oxidase subunit I (COI) gene. A total of 132 samples were analyzed from specimens identified previously as belonging to seven lutjanid species (Lutjanus purpureus, Lutjanus Keywords: synagris, Lutjanus vivanus, Lutjanus jocu, Lutjanus analis, Ocyurus chrysurus,andRhomboplites aurorubens), COI fi fi rDNA 5S as well as unidenti ed individuals. The results indicate the absence of a species-speci c rDNA 5S banding fi Snappers pattern in lutjanids. However, the 1131 bp fragment of the COI gene not only discriminated the identi ed Barcode lutjanid species systematically, but also defined the species of the unidentified specimens, identifying Lutjanids another two species from the database, Lutjanusbucanella and Lutjanuscyanopterus.
    [Show full text]
  • Lane Snapper, Mutton Snapper, Yellowtail Snapper Brazil
    Lane snapper, Mutton snapper, Yellowtail snapper Lutjanus synagris, Lutjanus analis, Ocyurus chrysurus Image © Diane Rome Peebles Brazil Trap, Handline March 11, 2016 Fabio Caltabellotta, Ludmila Damasio, Daniele Vila Nova, Independent Research Analysts Disclaimer: Seafood Watch® strives to have all Seafood Reports reviewed for accuracy and completeness by external scientists with expertise in ecology, fisheries science and aquaculture. Scientific review, however, does not constitute an endorsement of the Seafood Watch® program or its recommendations on the part of the reviewing scientists. Seafood Watch® is solely responsible for the conclusions reached in this report. 2 About Seafood Watch® Monterey Bay Aquarium’s Seafood Watch® program evaluates the ecological sustainability of wild-caught and farmed seafood commonly found in the United States marketplace. Seafood Watch® defines sustainable seafood as originating from sources, whether wild-caught or farmed, which can maintain or increase production in the long-term without jeopardizing the structure or function of affected ecosystems. Seafood Watch® makes its science-based recommendations available to the public in the form of regional pocket guides that can be downloaded from www.seafoodwatch.org. The program’s goals are to raise awareness of important ocean conservation issues and empower seafood consumers and businesses to make choices for healthy oceans. Each sustainability recommendation on the regional pocket guides is supported by a Seafood Report. Each report synthesizes and analyzes the most current ecological, fisheries and ecosystem science on a species, then evaluates this information against the program’s conservation ethic to arrive at a recommendation of “Best Choices,” “Good Alternatives” or “Avoid.” The detailed evaluation methodology is available upon request.
    [Show full text]
  • A High Proportion of Red Snapper Sold in North Carolina Is Mislabeled
    A high proportion of red snapper sold in North Carolina is mislabeled Erin T. Spencer1, Emilie Richards2, Blaire Steinwand2, Juliette Clemons2, Jessica Dahringer2, Priya Desai2, Morgan Fisher2, Sloane Fussell2, Olivia Gorman2, Diamond Jones2, Amanda Le2, Kayla Long2, Cammie McMahan2, Caitlin Moscarito2, Catherine Pelay2, Erica Price2, Anna Smith2, Allison VanSant2 and John F. Bruno2 1 Environment, Ecology, and Energy Program, University of North Carolina at Chapel Hill, Chapel Hill, NC, United States of America 2 Department of Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC, United States of America ABSTRACT Seafood mislabeling occurs when a market label is inaccurate, primarily in terms of species identity, but also regarding weight, geographic origin, or other characteristics. This widespread problem allows cheaper or illegally-caught species to be marketed as species desirable to consumers. Previous studies have identified red snapper (Lutjanus campechanus) as one of the most frequently mislabeled seafood species in the United States. To quantify how common mislabeling of red snapper is across North Carolina, the Seafood Forensics class at the University of North Carolina at Chapel Hill used DNA barcoding to analyze samples sold as ``red snapper'' from restaurants, seafood markets, and grocery stores purchased in ten counties. Of 43 samples successfully sequenced and identified, 90.7% were mislabeled. Only one grocery store chain (of four chains tested) accurately labeled red snapper. The mislabeling rate for restaurants and seafood markets was 100%. Vermilion snapper (Rhomboplites aurorubens) and tilapia (Oreochromis aureus and O. niloticus) were the species most frequently substituted for red snapper (13 of 39 mislabeled samples for both taxa, or 26 of 39 mislabeled total).
    [Show full text]
  • FISHERIES of SOUTH EAST TRINIDAD 1. Major Areas of Activity
    FISHERIES OF SOUTH EAST TRINIDAD 1. Major areas of activity The major sites of fishing activity in south east Trinidad and specifically in the immediate study area are Ortoire and Plaisance/ Mayaro on the east coast, and Guayaguayare on the south east coast. Included in the wider study area are the fishing port of Moruga on the south coast, west of Guayaguayare, and Manzanilla on the east coast, north of Ortoire, where some minimal activity occurs. (Insert map) 2. Numbers and types of vessels There are 128 vessels operating out of sites in the wider area, ie. between Manzanilla on the east coast and Moruga on the south coast, and 62 vessels operating out of sites in the study area. The vessels operating out of all sites in this region are artisanal day fishing vessels (pirogues). They are generally 7 – 12 metres in length, powered by outboard engines and the fishing gear is manually operated. In Ortoire where the majority of the fishpot vessels are based, the pirogues are generally larger 12 – 13 m. Fishing trips are made daily and the vessels carry ice to keep the fish fresh. Fishing grounds off the south coast are shared with Venezuela, under the 1997 Agreement between the Government of the Republic of Trinidad and Tobago and the Government of the Republic of Venezuela for Cooperation in the Fisheries Sector. Article II of this agreement delineates the common fishing area, the vessels permitted in this area and the conditions and obligations under which the vessels of contracting parties may operate. Under the agreement, trawlers from Trinidad and Tobago and Venezuela, are permitted to fish in a common fishing zone in the Columbus Channel, outside of two miles from the south coast of Trinidad and the coast of Venezuela.
    [Show full text]
  • Oceana Study Reveals Seafood Fraud Nationwide
    Oceana Study Reveals Seafood Fraud Nationwide February 2013 Authors: Kimberly Warner, Ph.D., Walker Timme, Beth Lowell and Michael Hirshfield, Ph.D. Executive Summary Americans are routinely urged to include more seafood in their diets as part of a healthy lifestyle. Yet consumers are often given inadequate, confusing or misleading information about the seafood they purchase. The dishonest and illegal practice of substituting one seafood species for another, or seafood fraud, has been uncovered both in the United States and abroad at levels ranging from 25 to more than 70 percent for commonly swapped species such as red snapper, wild salmon and Atlantic cod. From 2010 to 2012, Oceana conducted one of the largest seafood fraud investigations in the world to date, collecting more than 1,200 seafood samples from 674 retail outlets in 21 states to determine if they were honestly labeled. DNA testing found that one-third (33 percent) of the 1,215 samples analyzed nationwide were mislabeled, according to U.S. Food and Drug Administration (FDA) guidelines. Of the most commonly collected fish types, samples sold as snapper and tuna had the highest mislabeling rates (87 and 59 percent, respectively), with the majority of the samples identified by DNA analysis as something other than what was found on the label. In fact, only seven of the 120 samples of red snapper purchased nationwide were actually red snapper. The other 113 samples were another fish. Halibut, grouper, cod and Chilean seabass were also mislabeled between 19 and 38 percent of the time, while salmon was mislabeled 7 percent of the time.
    [Show full text]