DOCSLIB.ORG

Number 2 February 2020 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Number 2 February 2020 Atlas of Genetics and Cytogenetics in Oncology and Haematology Volume 1 - Number 1 May - September 1997 Volume 24 - Number 2 February 2020 Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Scope The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It is made for and by: clinicians and researchers in cytogenetics, molecular biology, oncology, haematology, and pathology. One main scope of the Atlas is to conjugate the scientific information provided by cytogenetics/molecular genetics to the clinical setting (diagnostics, prognostics and therapeutic design), another is to provide an encyclopedic knowledge in cancer genetics. The Atlas deals with cancer research and genomics. It is at the crossroads of research, virtual medical university (university and post-university e-learning), and telemedicine. It contributes to "meta-medicine", this mediation, using information technology, between the increasing amount of knowledge and the individual, having to use the information. Towards a personalized medicine of cancer. It presents structured review articles ("cards") on: 1- Genes, 2- Leukemias, 3- Solid tumors, 4- Cancer-prone diseases, and also 5- "Deep insights": more traditional review articles on the above subjects and on surrounding topics. It also present 6- Case reports in hematology and 7- Educational items in the various related topics for students in Medicine and in Sciences. The Atlas of Genetics and Cytogenetics in Oncology and Haematology does not publish research articles. See also: http://documents.irevues.inist.fr/bitstream/handle/2042/56067/Scope.pdf Editorial correspondance Jean-Loup Huret, MD, PhD, [email protected] Editor, Editorial Board and Publisher See:http://documents.irevues.inist.fr/bitstream/handle/2042/48485/Editor-editorial-board-and-publisher.pdf The Atlas of Genetics and Cytogenetics in Oncology and Haematology is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008. The Atlas is hosted by INIST-CNRS (http://www.inist.fr) Staff: Vanessa Le Berre Philippe Dessen is the Database Directorof the on-line version (Gustave Roussy Institute – Villejuif – France). Publisher Contact: INIST-CNRS Mailing Address: Catherine Morel, 2,Allée du Parc de Brabois, CS 10130, 54519 Vandoeuvre-lès-Nancy France. Email Address:[email protected] Articles of the ATLAS are free in PDF format, and metadata are available on the web in Dublin Core XML format and freely harvestable.A Digital object identifier (DOI®), recorded at the International Agency CrossRefhttp://www.crossref.org/ is assigned to each article. http://AtlasGeneticsOncology.org © ATLAS - ISSN 1768-3262 The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Editors-in-Chief Jesús María Hernández Rivas (Salamanca, Spain) Paola Dal Cin (Boston, Massachusetts) Jean-Loup Huret (Poitiers, France) Hematology Section Editor Ana E. Rodríguez, Teresa Gonzalez (Salamanca, Spain) Bone Tumors Section Editor Judith Bovee (Leiden, Netherlands) Head and Neck Tumors Section Editor Cécile Badoual (Paris, France) Urinary Tumors Section Editor Paola Dal Cin (Boston, Massachusetts) Pediatric Tumors Section Editor Frederic G. Barr (Bethesda, Maryland) Cancer Prone Diseases Section Editor Gaia Roversi (Milano, Italy) Cell Cycle Section Editor João Agostinho Machado-Neto (São Paulo, Brazil) DNA Repair Section Editor Godefridus Peters (Amsterdam, Netherlands) Epigenetics Section Editor Roberto Piergentili (Rome, Italy) Hematopoeisis Section Editor Olga Weinberg (Boston, Massachusetts) Hormones and Growth factors Section Editor Gajanan V. Sherbet (Newcastle upon Tyne, UK) Mitosis Section Editor Patrizia Lavia (Rome, Italy) Oxidative stress Section Editor Thierry Soussi (Stockholm, Sweden/Paris, France) WNT pathway Section Editor Alessandro Beghini (Milano, Italy) B-cell activation Section Editors Anette Gjörloff Wingren, Barnabas Nyesiga (Malmö, Sweden) Board Members Sreeparna Banerjee Department of Biological Sciences, Middle East Technical University, Ankara, Turkey; [email protected] Alessandro Beghini Department of Health Sciences, University of Milan, Italy; [email protected] Judith Bovée 2300 RC Leiden, The Netherlands; [email protected] Antonio Cuneo Dipartimento di ScienzeMediche, Sezione di Ematologia e Reumatologia Via Aldo Moro 8, 44124 - Ferrara, Italy; [email protected] Paola Dal Cin Department of Pathology, Brigham, Women's Hospital, 75 Francis Street, Boston, MA 02115, USA; [email protected] IRBA, Departement Effets Biologiques des Rayonnements, Laboratoire de Dosimetrie Biologique des Irradiations, Dewoitine C212, 91223 François Desangles Bretigny-sur-Orge, France; [email protected] Molecular and Population Genetics Laboratory, Wellcome Trust Centre for Human Genetics, Roosevelt Dr. Oxford, OX37BN, UK Enric Domingo [email protected] Ayse Elif Erson- Department of Biological Sciences, Middle East Technical University, Ankara, Turkey; [email protected] Bensan Ad Geurts van Department of Human Genetics, Radboud University Medical Center, Radboud Institute for Molecular Life Sciences, 6500 HB Nijmegen, Kessel The Netherlands; [email protected] Department of Pediatrics and Adolescent Medicine, St. Anna Children's Hospital, Medical University Vienna, Children's Cancer Research Oskar A. Haas Institute Vienna, Vienna, Austria. [email protected] Anne Hagemeijer Center for Human Genetics, University Hospital Leuven and KU Leuven, Leuven, Belgium; [email protected] Department of Pathology, The Ohio State University, 129 Hamilton Hall, 1645 Neil Ave, Columbus, OH 43210, USA; Nyla Heerema [email protected] Sakari Knuutila Hartmann Institute and HUSLab, University of Helsinki, Department of Pathology, Helsinki, Finland; [email protected] Lidia Larizza Lab Centro di Ricerche e TecnologieBiomedicheIRCCS-IstitutoAuxologico Italiano Milano, Italy; l.larizza@auxologico Department of Human, Animal Cell Lines, Leibniz-Institute DSMZ-German Collection of Microorganisms, Cell Cultures, Braunschweig, Roderick Mc Leod Germany; [email protected] Cristina Mecucci Hematology University of Perugia, University Hospital S.Mariadella Misericordia, Perugia, Italy; [email protected] Department of Clinical Genetics, University and Regional Laboratories, Lund University, SE-221 85 Lund, Sweden; Fredrik Mertens [email protected] Konstantin Miller Institute of Human Genetics, Hannover Medical School, 30623 Hannover, Germany; [email protected] Department of Clinical Genetics, University and Regional Laboratories, Lund University, SE-221 85 Lund, Sweden; Felix Mitelman [email protected] Hossain Mossafa Laboratoire CERBA, 95066 Cergy-Pontoise cedex 9, France; [email protected] Department of Human, Animal Cell Lines, Leibniz-Institute DSMZ-German Collection of Microorganisms, Cell Cultures, Braunschweig, Stefan Nagel Germany; [email protected] Florence Pedeutour Laboratory of Solid Tumors Genetics, Nice University Hospital, CNRSUMR 7284/INSERMU1081, France; [email protected] Department of Pathology, St. Jude Children's Research Hospital, 262 Danny Thomas Place, Mail Stop 250, Memphis, Tennessee 38105- Susana Raimondi 3678, USA; [email protected] Clelia Tiziana Department of Biology, University of Bari, Bari, Italy; [email protected] Storlazzi Sabine Strehl CCRI, Children's Cancer Research Institute, St. Anna Kinderkrebsforschunge.V., Vienna, Austria; [email protected] Nancy Uhrhammer Laboratoire Diagnostic Génétique et Moléculaire, Centre Jean Perrin, Clermont-Ferrand, France; [email protected] Dan L. Van Dyke Mayo Clinic Cytogenetics Laboratory, 200 First St SW, Rochester MN 55905, USA; [email protected] Roberta Vanni Universita di Cagliari, Dipartimento di ScienzeBiomediche(DiSB), CittadellaUniversitaria, 09042 Monserrato (CA) - Italy; [email protected] Atlas Genet Cytogenet Oncol Haematol. 2020; 24(2) Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Volume 24, Number 2, February 2020 Table of contents Gene Section SOHLH2 (spermatogenesis and oogenesis specific basic helix-loop-helix 2) 54 Flavia R Mangone, Ana Carolina Pavanelli, Maria A. Nagai EEF1G (Eukaryotic translation elongation factor 1 gamma) 58 Luigi Cristiano PPP6R3 (protein phosphatase 6 regulatory subunit 3) 69 Luigi Cristiano KLK6 (kallikrein-related peptidase 6) 79 Paraskevi Karousi, Christos K. Kontos, Andreas Scorilas Leukaemia Section Cutaneous mastocytosis 83 Karen M. Chisholm t(2;11)(p23;q12.3) EEF1G/ALK 87 Luigi Cristiano Solid Tumour Section Bone and Soft Tissue: Ewing sarcoma 91 Kelly M Bailey, Sarangarajan Ranganathan Cancer Prone Disease Section Retinoblastoma (hereditary
Load more

Recommended publications
  • Differential Expression of FEZ1/LZTS1 Gene in Lung Cancers and Their Cell Cultures1
    2292 Vol. 8, 2292–2297, July 2002 Clinical Cancer Research Differential Expression of FEZ1/LZTS1 Gene in Lung Cancers and Their Cell Cultures1 Shinichi Toyooka, Yasuro Fukuyama, NSCLC cell lines, it was strongly correlated to D8S261 Ignacio I. Wistuba, Melvyn S. Tockman, and LPL loci in SCLC cell lines. No mutation was found John D. Minna, and Adi F. Gazdar2 within cording region of FEZ1 by PCR-single-strand con- formational polymorphism. Hamon Center for Therapeutic Oncology Research [S. T., Y. F., Conclusions: We found differential FEZ1 expression in J. D. M., A. F. G.], and Departments of Pathology [A. F. G.], Internal Medicine [J. D. M.], and Pharmacology [J. D. M.], University of NSCLC and SCLC cell lines, and the absent expression in 3 Texas Southwestern Medical Center, Dallas, Texas 75390-8593; of 6 short-term cultures of NSCLC tumors. FEZ1 may be Department of Pathology, Pontificia Universidad Catolica de Chile, related to tumorigenesis of lung cancer. Santiago, Chile [I. I. W.]; and Molecular Screening Laboratory, H. Lee Moffitt Cancer Center and Research Institute, University of South Florida, Tampa, Florida 33612-9497 [M .S. T.] INTRODUCTION Lung cancer is the most common cause of cancer deaths in the United States (1) and on clinicopathological grounds is ABSTRACT divided into two major types, NSCLCs and SCLCs. The mo- Purpose: The FEZ1/LZTS1 (FEZ1) gene, located on lecular genetic changes in these two types of lung cancer are chromosome 8p22 (8p22), was identified recently as a can- very different, including specific patterns of allelic loss (2–5). didate tumor suppressor gene.
    [Show full text]
  • 8P22 MTUS1 Gene Product ATIP3 Is a Novel Anti-Mitotic Protein Underexpressed in Invasive Breast Carcinoma of Poor Prognosis
    8p22 MTUS1 Gene Product ATIP3 Is a Novel Anti-Mitotic Protein Underexpressed in Invasive Breast Carcinoma of Poor Prognosis Sylvie Rodrigues-Ferreira1, Anne Di Tommaso1, Ariane Dimitrov2, Sylvie Cazaubon1, Nade`ge Gruel3,4, He´le`ne Colasson1, Andre´ Nicolas5, Nathalie Chaverot1, Vincent Molinie´ 6, Fabien Reyal2, Brigitte Sigal-Zafrani4,5, Benoit Terris7, Olivier Delattre3,4, Franc¸ois Radvanyi2, Franck Perez2, Anne Vincent-Salomon4,5, Clara Nahmias1* 1 Institut Cochin, Universite´ Paris Descartes, Inserm U567, CNRS UMR8104, Paris, France, 2 CNRS UMR144, Institut Curie, Paris, France, 3 Inserm U830, Institut Curie, Paris, France, 4 Translational Research Department, Institut Curie, Paris, France, 5 Pathology Department, Hopital Curie, Paris, France, 6 Pathology Department, Hopital St. Joseph, Paris, France, 7 Pathology Department, Hopital Cochin, Paris, France Abstract Background: Breast cancer is a heterogeneous disease that is not totally eradicated by current therapies. The classification of breast tumors into distinct molecular subtypes by gene profiling and immunodetection of surrogate markers has proven useful for tumor prognosis and prediction of effective targeted treatments. The challenge now is to identify molecular biomarkers that may be of functional relevance for personalized therapy of breast tumors with poor outcome that do not respond to available treatments. The Mitochondrial Tumor Suppressor (MTUS1) gene is an interesting candidate whose expression is reduced in colon, pancreas, ovary and oral cancers. The present study investigates the expression and functional effects of MTUS1 gene products in breast cancer. Methods and Findings: By means of gene array analysis, real-time RT-PCR and immunohistochemistry, we show here that MTUS1/ATIP3 is significantly down-regulated in a series of 151 infiltrating breast cancer carcinomas as compared to normal breast tissue.
    [Show full text]
  • An Integrated Platform to Systematically Identify Causal Variants 2 and Genes for Polygenic Human Traits
    bioRxiv preprint doi: https://doi.org/10.1101/813618; this version posted January 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 An integrated platform to systematically identify causal variants 2 and genes for polygenic human traits. 3 Damien J. Downes1, Ron Schwessinger1,2,*, Stephanie J. Hill1,*, Lea Nussbaum1,*, Caroline 4 Scott1, Matthew E. Gosden1, Priscila P. Hirschfeld1, Jelena M. Telenius1,2, Chris Q. 5 Eijsbouts1,3,4, Simon J. McGowan2, Antony J. Cutler4,5, Jon Kerry1, Jessica L. Davies6, 6 Calliope A. Dendrou4,6, Jamie R.J. Inshaw5, Martin S.C. Larke1, A. Marieke Oudelaar1,2, 7 Yavor Bozhilov1, Andrew J. King1, Richard C. Brown2, Maria C. Suciu1, James O.J. Davies1, 8 Philip Hublitz7, Chris Fisher1, Ryo Kurita8, Yukio Nakamura9, Gerton Lunter2, Stephen 9 Taylor2, Veronica J. Buckle1, John A. Todd5, Douglas R. Higgs1, & Jim R. Hughes1,2,†. 10 11 * These authors contributed equally: Ron Schwessinger, Stephanie J. Hill, Lea Nussbaum. 12 13 † Corresponding author: [email protected] 14 15 Affiliations: 16 1 MRC Molecular Haematology Unit, MRC Weatherall Institute of Molecular Medicine, 17 Radcliffe Department of Medicine, University of Oxford, Oxford, UK 18 2 MRC WIMM Centre for Computational Biology, MRC Weatherall Institute of 19 Molecular Medicine, Radcliffe Department of Medicine, University of Oxford, Oxford, 20 UK
    [Show full text]
  • Mir-285–Yki/Mask Double-Negative Feedback Loop Mediates Blood
    miR-285–Yki/Mask double-negative feedback loop PNAS PLUS mediates blood–brain barrier integrity in Drosophila Dong Lia,b, Yanling Liua,b, Chunli Peic,d, Peng Zhangc,d, Linqing Pana,b, Jing Xiaoe, Songshu Mengb, Zengqiang Yuanc,d,1, and Xiaolin Bia,b,1 aDepartment of Biological Sciences, College of Basic Medical Sciences, Dalian Medical University, Dalian 116044, China; bInstitute of Cancer Stem Cell, Cancer Center, Dalian Medical University, Dalian 116044, China; cThe Brain Science Center, Beijing Institute of Basic Medical Sciences, Beijing 100850, China; dCenter of Alzheimer’s Disease, Beijing Institute for Brain Disorders, Beijing 100069, China; and eDepartment of Oral Basic Science, College of Stomatology, Dalian Medical University, Dalian 116044, China Edited by Norbert Perrimon, Harvard Medical School/HHMI, Boston, MA, and approved February 10, 2017 (received for review August 9, 2016) The Hippo signaling pathway is highly conserved from Drosophila to in size to maintain integrity of the BBB (7). Although an increased cell mammals and plays a central role in maintaining organ size and tissue size can be achieved through the accumulation of cell mass during the homeostasis. The blood–brain barrier (BBB) physiologically isolates growth of diploid cells, cell size is often correlated with the ploidy of the brain from circulating blood or the hemolymph system, and its DNA content and is increased via polyploidy during development, integrity is strictly maintained to perform sophisticated neuronal characteristics that are important for organogenesis, such as proper functions. Until now, the underlying mechanisms of subperineurial organ size, structure, and function (8–10). SPG cells have been shown glia (SPG) growth and BBB maintenance during development are to maintain the integrity of the BBB during development by increased not clear.
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Gene Section Review EEF1G (Eukaryotic translation elongation factor 1 gamma) Luigi Cristiano Aesthetic and medical biotechnologies research unit, Prestige, Terranuova Bracciolini, Italy; [email protected] Published in Atlas Database: March 2019 Online updated version : http://AtlasGeneticsOncology.org/Genes/EEF1GID54272ch11q12.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/70656/03-2019-EEF1GID54272ch11q12.pdf DOI: 10.4267/2042/70656 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2020 Atlas of Genetics and Cytogenetics in Oncology and Haematology Abstract Keywords EEF1G; Eukaryotic translation elongation factor 1 Eukaryotic translation elongation factor 1 gamma, gamma; Translation; Translation elongation factor; alias eEF1G, is a protein that plays a main function protein synthesis; cancer; oncogene; cancer marker in the elongation step of translation process but also covers numerous moonlighting roles. Considering its Identity importance in the cell it is found frequently Other names: EF1G, GIG35, PRO1608, EEF1γ, overexpressed in human cancer cells and thus this EEF1Bγ review wants to collect the state of the art about EEF1G, with insights on DNA, RNA, protein HGNC (Hugo): EEF1G encoded and the diseases where it is implicated. Location: 11q12.3 Figure. 1. Splice variants of EEF1G. The figure shows the locus on chromosome 11 of the EEF1G gene and its splicing variants (grey/blue box). The primary transcript is EEF1G-001 mRNA (green/red box), but also EEF1G-201 variant is able to codify for a protein (reworked from https://www.ncbi.nlm.nih.gov/gene/1937; http://grch37.ensembl.org; www.genecards.org) Atlas Genet Cytogenet Oncol Haematol.
    [Show full text]
  • Oncoscore: a Novel, Internet-Based Tool to Assess the Oncogenic Potential of Genes
    www.nature.com/scientificreports OPEN OncoScore: a novel, Internet- based tool to assess the oncogenic potential of genes Received: 06 July 2016 Rocco Piazza1, Daniele Ramazzotti2, Roberta Spinelli1, Alessandra Pirola3, Luca De Sano4, Accepted: 15 March 2017 Pierangelo Ferrari3, Vera Magistroni1, Nicoletta Cordani1, Nitesh Sharma5 & Published: 07 April 2017 Carlo Gambacorti-Passerini1 The complicated, evolving landscape of cancer mutations poses a formidable challenge to identify cancer genes among the large lists of mutations typically generated in NGS experiments. The ability to prioritize these variants is therefore of paramount importance. To address this issue we developed OncoScore, a text-mining tool that ranks genes according to their association with cancer, based on available biomedical literature. Receiver operating characteristic curve and the area under the curve (AUC) metrics on manually curated datasets confirmed the excellent discriminating capability of OncoScore (OncoScore cut-off threshold = 21.09; AUC = 90.3%, 95% CI: 88.1–92.5%), indicating that OncoScore provides useful results in cases where an efficient prioritization of cancer-associated genes is needed. The huge amount of data emerging from NGS projects is bringing a revolution in molecular medicine, leading to the discovery of a large number of new somatic alterations that are associated with the onset and/or progression of cancer. However, researchers are facing a formidable challenge in prioritizing cancer genes among the variants generated by NGS experiments. Despite the development of a significant number of tools devoted to cancer driver prediction, limited effort has been dedicated to tools able to generate a gene-centered Oncogenic Score based on the evidence already available in the scientific literature.
    [Show full text]
  • Concordance of Copy Number Loss and Down-Regulation of Tumor Suppressor Genes: a Pan-Cancer Study Min Zhao1 and Zhongming Zhao2,3,4,5*
    The Author(s) BMC Genomics 2016, 17(Suppl 7):532 DOI 10.1186/s12864-016-2904-y RESEARCH Open Access Concordance of copy number loss and down-regulation of tumor suppressor genes: a pan-cancer study Min Zhao1 and Zhongming Zhao2,3,4,5* From The International Conference on Intelligent Biology and Medicine (ICIBM) 2015 Indianapolis, IN, USA. 13-15 November 2015 Abstract Background: Tumor suppressor genes (TSGs) encode the guardian molecules to control cell growth. The genomic alteration of TSGs may cause tumorigenesis and promote cancer progression. So far, investigators have mainly studied the functional effects of somatic single nucleotide variants in TSGs. Copy number variation (CNV) is another important form of genetic variation, and is often involved in cancer biology and drug treatment, but studies of CNV in TSGs are less represented in literature. In addition, there is a lack of a combinatory analysis of gene expression and CNV in this important gene set. Such a study may provide more insights into the relationship between gene dosage and tumorigenesis. To meet this demand, we performed a systematic analysis of CNVs and gene expression in TSGs to provide a systematic view of CNV and gene expression change in TSGs in pan-cancer. Results: We identified 1170 TSGs with copy number gain or loss in 5846 tumor samples. Among them, 207 TSGs tended to have copy number loss (CNL), from which fifteen CNL hotspot regions were identified. The functional enrichment analysis revealed that the 207 TSGs were enriched in cancer-related pathways such as P53 signaling pathway and the P53 interactome.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Fez1/Lzts1 Alterations in Gastric Carcinoma1
    1546 Vol. 7, 1546–1552, June 2001 Clinical Cancer Research Advances in Brief Fez1/Lzts1 Alterations in Gastric Carcinoma1 Andrea Vecchione,2 Hideshi Ishii,2 tected in one case that did not express Fez1/Lzts1. Hyper- Yih-Horng Shiao, Francesco Trapasso, methylation of the CpG island flanking the Fez1/Lzts1 pro- Massimo Rugge, Joseph F. Tamburrino, moter was evident in six of the eight cell lines examined as well as in the normal control. Yoshiki Murakumo, Hansjuerg Alder, 3 Conclusions: Our findings support FEZ1/LZTS1 as a Carlo M. Croce, and Raffaele Baffa candidate tumor suppressor gene at 8p in a subtype of Kimmel Cancer Center, Jefferson Medical College of Thomas gastric cancer and suggest that its inactivation is attributa- Jefferson University, Philadelphia, Pennsylvania 19107 [A. V., H. I., F. T., J. F. T., Y. M., H. A., C. M. C., R. B.]; Laboratory of ble to several factors including genomic deletion and meth- Comparative Carcinogenesis, National Cancer Institute, Frederick ylation. Cancer Research and Development Center, NIH, Frederick, Maryland 21702 [Y-H. S.]; and Department of Pathology, University of Padova, Padova 35126, Italy [M. R.]. Introduction Gastric cancer is the second most common malignant tu- Abstract mor worldwide, with a much higher incidence in Asian than in 4 Purpose: Loss of heterozygosity (LOH) involving the Western countries (1). The international TNM classification (2) short arm of chromosome 8 (8p) is a common feature of the and Lauren’s system (3) classify gastric cancer into two distinct malignant progression of human tumors, including gastric histological types: intestinal (well differentiated) and diffuse cancer.
    [Show full text]
  • BIOINFORMATICS ORIGINAL PAPER Doi:10.1093/Bioinformatics/Btl429
    Vol. 22 no. 20 2006, pages 2475–2479 BIOINFORMATICS ORIGINAL PAPER doi:10.1093/bioinformatics/btl429 Sequence analysis A large quantity of novel human antisense transcripts detected by LongSAGE Xijin Ge1, Qingfa Wu1, Yong-Chul Jung1, Jun Chen1 and San Ming Wang1,2,Ã 1Center for Functional Genomics, Division of Medical Genetics, Department of Medicine, ENH Research Institute and 2Robert H. Lurie Comprehensive Cancer Center, Northwestern University Feinberg School of Medicine, 1001 University Place, Evanston, IL 60201 USA Received on April 11, 2006; revised on July 5, 2006; accepted on August 1, 2006 Advance Access publication August 7, 2006 Associate Editor: Nikolaus Rajewsky ABSTRACT Lee et al., 2005). Therefore, the antisense transcripts identified from Motivation: Taking advantage of the high sensitivity and specificity of the currently known transcripts might not be comprehensive. LongSAGE tag for transcript detection and genome mapping, we ana- Exploring various transcript resources could identify more antisense lyzed the 632 813 unique human LongSAGE tags deposited in public transcripts present at low abundant levels. One of these transcript databases to identify novel human antisense transcripts. resources is the SAGE (serial analysis of gene expression; Results: Our study identified 45 321 tags that match the antisense Velculescu et al., 1995) data. SAGE collects short tags near the strand of 9804 known mRNA sequences, 6606 of which contain anti- 30 end of transcripts. The orientation of the detected transcript is sense ESTs and 3198 are mapped only by SAGE tags. Quantitative preserved in the SAGE tag sequence; therefore, SAGE tags can analysis showed that the detected antisense transcripts are present at distinguish sense and antisense transcripts.
    [Show full text]
  • Regulatory Network of Differentially Expressed Genes in Metastatic Osteosarcoma
    2104 MOLECULAR MEDICINE REPORTS 11: 2104-2110, 2015 Regulatory network of differentially expressed genes in metastatic osteosarcoma PENG YAO1, ZHI‑BIN WANG1, YUAN-YUAN DING1, JIA-MING MA1, TAO HONG1, SHI-NONG PAN2 and JIN ZHANG3 Departments of 1Pain Management, 2Radiology, and 3Anesthesiology, Shengjing Hospital of China Medical University, Shenyang, Liaoning 110004, P.R. China Received February 13, 2014; Accepted October 31, 2014 DOI: 10.3892/mmr.2014.3009 Abstract. The present study aimed to investigate the possible differential co‑expression network, including matrix metal- molecular mechanisms underlying the pathogenesis of loproteinase 1 (MMP1), smoothened (SMO), ewing sarcoma metastatic osteosarcoma (OS), by examining the microarray breakpoint region 1 (EWSR1) and fasciculation and elonga- expression profiles of normal samples, and metastatic and tion protein ζ‑1 (FEZ1). Brain selective kinase 2 (BRSK2) and non-metastatic OS samples. The GSE9508 gene expression aldo‑keto reductase family 1 member B10 (AKRIB10) were profile was downloaded from the Gene Expression Omnibus present in the screened submodules. The results of the present database, which included 11 human metastatic OS samples, study suggest that genes, including MMP1, SMO, EWSR1, seven non‑metastatic OS samples and five normal samples. FEZ1, BRSK2 and AKRIB10, may be potential targets for the P retreatment of the data was per for med using the BioConductor diagnosis and treatment of metastatic OS. package in R language, and the differentially expressed genes (DEGs) were identified by a t‑test. Furthermore, function and Introduction pathway enrichment analyses of the DEGs were conducted using a molecule annotation system. A differential co-expres- Osteosarcomas (OS) are among the most frequently occurring sion network was also constructed, and the submodules were secondary malignancies in childhood cancer (1).
    [Show full text]
  • Comprehensive Analysis Reveals Novel Gene Signature in Head and Neck Squamous Cell Carcinoma: Predicting Is Associated with Poor Prognosis in Patients
    5892 Original Article Comprehensive analysis reveals novel gene signature in head and neck squamous cell carcinoma: predicting is associated with poor prognosis in patients Yixin Sun1,2#, Quan Zhang1,2#, Lanlin Yao2#, Shuai Wang3, Zhiming Zhang1,2 1Department of Breast Surgery, The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China; 2School of Medicine, Xiamen University, Xiamen, China; 3State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Xiamen University, Xiamen, China Contributions: (I) Conception and design: Y Sun, Q Zhang; (II) Administrative support: Z Zhang; (III) Provision of study materials or patients: Y Sun, Q Zhang; (IV) Collection and assembly of data: Y Sun, L Yao; (V) Data analysis and interpretation: Y Sun, S Wang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Zhiming Zhang. Department of Surgery, The First Affiliated Hospital of Xiamen University, Xiamen, China. Email: [email protected]. Background: Head and neck squamous cell carcinoma (HNSC) remains an important public health problem, with classic risk factors being smoking and excessive alcohol consumption and usually has a poor prognosis. Therefore, it is important to explore the underlying mechanisms of tumorigenesis and screen the genes and pathways identified from such studies and their role in pathogenesis. The purpose of this study was to identify genes or signal pathways associated with the development of HNSC. Methods: In this study, we downloaded gene expression profiles of GSE53819 from the Gene Expression Omnibus (GEO) database, including 18 HNSC tissues and 18 normal tissues.
    [Show full text]