DOCSLIB.ORG

Fez1/Lzts1 Alterations in Gastric Carcinoma1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Fez1/Lzts1 Alterations in Gastric Carcinoma1 1546 Vol. 7, 1546–1552, June 2001 Clinical Cancer Research Advances in Brief Fez1/Lzts1 Alterations in Gastric Carcinoma1 Andrea Vecchione,2 Hideshi Ishii,2 tected in one case that did not express Fez1/Lzts1. Hyper- Yih-Horng Shiao, Francesco Trapasso, methylation of the CpG island flanking the Fez1/Lzts1 pro- Massimo Rugge, Joseph F. Tamburrino, moter was evident in six of the eight cell lines examined as well as in the normal control. Yoshiki Murakumo, Hansjuerg Alder, 3 Conclusions: Our findings support FEZ1/LZTS1 as a Carlo M. Croce, and Raffaele Baffa candidate tumor suppressor gene at 8p in a subtype of Kimmel Cancer Center, Jefferson Medical College of Thomas gastric cancer and suggest that its inactivation is attributa- Jefferson University, Philadelphia, Pennsylvania 19107 [A. V., H. I., F. T., J. F. T., Y. M., H. A., C. M. C., R. B.]; Laboratory of ble to several factors including genomic deletion and meth- Comparative Carcinogenesis, National Cancer Institute, Frederick ylation. Cancer Research and Development Center, NIH, Frederick, Maryland 21702 [Y-H. S.]; and Department of Pathology, University of Padova, Padova 35126, Italy [M. R.]. Introduction Gastric cancer is the second most common malignant tu- Abstract mor worldwide, with a much higher incidence in Asian than in 4 Purpose: Loss of heterozygosity (LOH) involving the Western countries (1). The international TNM classification (2) short arm of chromosome 8 (8p) is a common feature of the and Lauren’s system (3) classify gastric cancer into two distinct malignant progression of human tumors, including gastric histological types: intestinal (well differentiated) and diffuse cancer. We have cloned and mapped a candidate tumor (poorly differentiated). Genetic differences have been observed suppressor gene, FEZ1/LZTS1, to 8p22. Here we have ana- in intestinal and diffuse gastric cancer, suggesting two different lyzed whether FEZ1/LZTS1 alterations play a role in the pathways of carcinogenesis (4). Allelotyping studies of solid development and progression of gastric carcinoma. tumors, determined by LOH, have shown genomic alterations in Experimental Design: We examined Fez1/Lzts1 expres- gastric cancer at specific chromosomal regions, including sion in 8 gastric carcinoma cell lines by Western blot, and in 3p14–21, 8p21–23, 11p11–21, and 17p11–21 (5–9). Recently, 88 primary gastric carcinomas by immunohistochemistry. we have cloned a novel candidate tumor suppressor gene, FEZ1/ Twenty-six of these 88 primary gastric carcinomas were also LZTS1 (hereafter called FEZ1), on chromosome 8p22 (10). The microdissected and tested for LOH at the FEZ1/LZTS1 locus FEZ1 gene encodes a putative Mr 67,000 leucine-zipper protein and for mutation of the FEZ1/LZTS1 gene. Furthermore, we with similarities to the cAMP-responsive Atf-5 DNA binding studied the FEZ1/LZTS1 gene regulation and transcrip- protein (11). Immunohistochemistry has been a valuable tool in ؅ tional control and the methylation status of the 5 region of evaluating the expression of different tumor suppressor genes, the gene in all 8 gastric carcinoma cell lines. such as p53 and FHIT, in gastric carcinoma (12, 13). In this Results: Fez1/Lzts1 protein was barely detectable in all report, we raise anti-Fez1 polyclonal antibody and analyze 88 of the gastric cancer cell lines tested and was absent or cases of gastric adenocarcinoma to assess Fez1 expression. significantly reduced in 39 of the 88 (44.3%) gastric carci- Results indicate that loss of Fez1 protein is a frequent event in nomas analyzed by immunohistochemistry, with a signifi- gastric cancer, and reduction of its expression significantly cant correlation (P < 0.001) to diffuse histotype. DNA al- lelotyping analysis showed allelic loss in 3 of 17 (18%) and correlates with diffuse gastric carcinoma. A somatic missense microsatellite instability in 4 of 17 (23.5%) cases informative mutation in a FEZ1 allele has been found in a case negative for for D8S261 at the FEZ1/LZTS1 locus. When we compared Fez1 expression. To gain insight into FEZ1 gene regulation and the presence of LOH with Fez1/Lzts1 expression, we found transcriptional control, we examined the genomic organization, loss of protein expression in all three of the tumors with identified a transcriptional start site, and analyzed a positive allelic imbalance at D8S261. A missense mutation was de- regulatory region of FEZ1 transcription. In addition, we ana- lyzed the methylation status of the region flanking the FEZ1 promoter in gastric cancer cells. Our data suggest that altered Fez1 expression plays a role in the progression of a subset of carcinomas of the stomach, and that many factors, including Received 11/28/00; revised 2/23/01; accepted 2/28/01. The costs of publication of this article were defrayed in part by the DNA deletion, point mutations, and methylation seem to be payment of page charges. This article must therefore be hereby marked involved in switching off Fez1 expression. advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported partially by USPHS Grant CA83698-01A1 from the National Cancer Institute. 2 A. V. and H. I. contributed equally to this study. 3 To whom requests for reprints should be addressed, at Kimmel Cancer 4 The abbreviations used are: TNM, Tumor-Node-Metastasis; LOH, loss Center, 1015 Walnut Street, Suite 1102A, Philadelphia, PA 19107. of heterozygosity; LZTS1, leucine zipper putative tumor suppressor gene Phone: (215) 955-9072; Fax: (215) 923-1884; E-mail: R_Baffa@lac. 1; MI, microsatellite instability; BAC, bacterial artificial chromosome; jci.tju.edu. TSS, transcriptional start site. Downloaded from clincancerres.aacrjournals.org on September 24, 2021. © 2001 American Association for Cancer Research. Clinical Cancer Research 1547 Materials and Methods controls. Sections were reacted with biotinylated antirabbit an- Cell Lines and Tissue Samples. Eight human gastric tibody and streptavidin-biotin-peroxidase (Histostain-SP kit; carcinoma derived cell lines (Ags, KATO III, NCI-N87, RF1, Zymed Laboratories, San Francisco, CA). Diaminobenzidine RF48, SNU1, SNU5, and SNU16), transformed human kidney 293 was used as a chromogen substrate. Finally, sections were cells, and cervical cancer HeLaS3 cells were obtained from the washed in distilled water and weakly counterstained with Har- American Type Culture Collection and maintained in the recom- ry’s modified hematoxylin. All sections were examined inde- mended medium. FEZ1 cDNA was ligated in a pcDNA vector pendently by three investigators (A. V., R. B., and M. R.), and (InVitrogen, Carlsbad, CA), and after confirming the DNA se- complete agreement was reached for Fez1 positivity and nega- quence, DNA transfection was performed with the Gene Porter tivity. Any positive reaction was semiquantified into four ϩ ϩ Ϫ reagent (Gene Therapy, Inc., San Francisco, CA) according to the groups: , 96–100% Fez1-positive cells; / , 51–95% Fez1- positive cells; Ϫ/ϩ, 2–50% Fez1-positive cells; and Ϫ, the manufacturer’s instructions. Eighty-eight formalin-fixed, paraffin- tumors in which Ͼ98% of cells did not express Fez1. Associ- embedded specimens of primary adenocarcinomas of the stomach, ations of Fez1 expression with clinicopathological parameters including 47 diffuse-type, 23 intestinal-type, and 18 unclassified were computed using a two-tailed ␹2 statistic or Fisher’s exact tumors were obtained from patients who underwent radical and test where appropriate. Probability of Ͻ0.05 was considered partial gastrectomy as described previously (14). The tumors were statistically significant. classified histologically and staged according to Lauren’s classifi- Microdissection and DNA Extraction. We were able to cation (3) and to the TNM classification of malignant tumors (2), process 26 of the 88 primary tumors for DNA analysis. Serial respectively. 5-␮m, formalin-fixed, paraffin-embedded sections from these Immunoblot Analysis, Immunoprecipitation, and Re- 26 primary gastric cancers and matched normal tissues were combinant Proteins. Protein extraction and immunoblot subjected to microdissection. This was followed by deparaf- analyses were performed as described (15). Briefly, the protein finization and DNA extraction as described previously (14). concentration was measured with the Protein Assay reagent DNA was quantified in a fluorometer using Pico green dsDNA (Bio-Rad Laboratories, Melville, NY). For immunoblot analy- quantitation reagent (Molecular Probes, Eugene, OR). ␮ sis, 50–100 g of proteins were subjected to SDS-PAGE and LOH Study and Mutation Analysis. PCR amplifica- transferred to a nitrocellulose membrane. After blocking with tions using 5Ј fluorescence-labeled primers for microsatellite 5% nonfat dry milk, the membrane was incubated with a 1:1000 loci (Research Genetics, Huntsville, AL) with tumor and normal dilution of rabbit anti-Fez1 polyclonal antibody. The anti-Fez1 template DNAs were performed as reported (10). MI was inter- antibody was raised in rabbits against glutathione S-transferase- preted when a tumor sample showed a novel abnormal peak fusion Fez1 protein corresponding with nucleotides 1–1128, when compared with the corresponding normal control DNA which was expressed in Escherichia coli and purified with a (8). Mutation was analyzed by direct sequencing of PCR frag- glutathione column (Amersham Pharmacia, Piscataway, NJ). ments with microdissected DNA as a template. Thirteen sets of Mouse monoclonal anti-V5 antibody (InVitrogen) was also primers covering the entire open reading frame (exons 1–3) used. After incubation with horseradish peroxidase-conjugated were used for PCR in a 20-␮l reaction on a 96-well plate with secondary antibodies, membranes were subjected to the chemi- a cycle of 94°C for 2 min; followed by 35 cycles of 94°C for luminescence detection system (Amersham Pharmacia) with 20 s, 62°C for 15 s, and 72°C for 1 min; and a cycle of 72°C for X-ray film. After stripping, the blots were reprobed with anti 1 min. The primer sequences are available upon request. The ␤-actin (Sigma Chemical Co.-Aldrich, St. Louis, MO), followed PCR products were purified with the QIAquick 96 PCR purifi- by incubation with antimouse secondary antibody.
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Differential Expression of FEZ1/LZTS1 Gene in Lung Cancers and Their Cell Cultures1
    2292 Vol. 8, 2292–2297, July 2002 Clinical Cancer Research Differential Expression of FEZ1/LZTS1 Gene in Lung Cancers and Their Cell Cultures1 Shinichi Toyooka, Yasuro Fukuyama, NSCLC cell lines, it was strongly correlated to D8S261 Ignacio I. Wistuba, Melvyn S. Tockman, and LPL loci in SCLC cell lines. No mutation was found John D. Minna, and Adi F. Gazdar2 within cording region of FEZ1 by PCR-single-strand con- formational polymorphism. Hamon Center for Therapeutic Oncology Research [S. T., Y. F., Conclusions: We found differential FEZ1 expression in J. D. M., A. F. G.], and Departments of Pathology [A. F. G.], Internal Medicine [J. D. M.], and Pharmacology [J. D. M.], University of NSCLC and SCLC cell lines, and the absent expression in 3 Texas Southwestern Medical Center, Dallas, Texas 75390-8593; of 6 short-term cultures of NSCLC tumors. FEZ1 may be Department of Pathology, Pontificia Universidad Catolica de Chile, related to tumorigenesis of lung cancer. Santiago, Chile [I. I. W.]; and Molecular Screening Laboratory, H. Lee Moffitt Cancer Center and Research Institute, University of South Florida, Tampa, Florida 33612-9497 [M .S. T.] INTRODUCTION Lung cancer is the most common cause of cancer deaths in the United States (1) and on clinicopathological grounds is ABSTRACT divided into two major types, NSCLCs and SCLCs. The mo- Purpose: The FEZ1/LZTS1 (FEZ1) gene, located on lecular genetic changes in these two types of lung cancer are chromosome 8p22 (8p22), was identified recently as a can- very different, including specific patterns of allelic loss (2–5). didate tumor suppressor gene.
    [Show full text]
  • 8P22 MTUS1 Gene Product ATIP3 Is a Novel Anti-Mitotic Protein Underexpressed in Invasive Breast Carcinoma of Poor Prognosis
    8p22 MTUS1 Gene Product ATIP3 Is a Novel Anti-Mitotic Protein Underexpressed in Invasive Breast Carcinoma of Poor Prognosis Sylvie Rodrigues-Ferreira1, Anne Di Tommaso1, Ariane Dimitrov2, Sylvie Cazaubon1, Nade`ge Gruel3,4, He´le`ne Colasson1, Andre´ Nicolas5, Nathalie Chaverot1, Vincent Molinie´ 6, Fabien Reyal2, Brigitte Sigal-Zafrani4,5, Benoit Terris7, Olivier Delattre3,4, Franc¸ois Radvanyi2, Franck Perez2, Anne Vincent-Salomon4,5, Clara Nahmias1* 1 Institut Cochin, Universite´ Paris Descartes, Inserm U567, CNRS UMR8104, Paris, France, 2 CNRS UMR144, Institut Curie, Paris, France, 3 Inserm U830, Institut Curie, Paris, France, 4 Translational Research Department, Institut Curie, Paris, France, 5 Pathology Department, Hopital Curie, Paris, France, 6 Pathology Department, Hopital St. Joseph, Paris, France, 7 Pathology Department, Hopital Cochin, Paris, France Abstract Background: Breast cancer is a heterogeneous disease that is not totally eradicated by current therapies. The classification of breast tumors into distinct molecular subtypes by gene profiling and immunodetection of surrogate markers has proven useful for tumor prognosis and prediction of effective targeted treatments. The challenge now is to identify molecular biomarkers that may be of functional relevance for personalized therapy of breast tumors with poor outcome that do not respond to available treatments. The Mitochondrial Tumor Suppressor (MTUS1) gene is an interesting candidate whose expression is reduced in colon, pancreas, ovary and oral cancers. The present study investigates the expression and functional effects of MTUS1 gene products in breast cancer. Methods and Findings: By means of gene array analysis, real-time RT-PCR and immunohistochemistry, we show here that MTUS1/ATIP3 is significantly down-regulated in a series of 151 infiltrating breast cancer carcinomas as compared to normal breast tissue.
    [Show full text]
  • Convergent Functional Genomics of Schizophrenia: from Comprehensive Understanding to Genetic Risk Prediction
    Molecular Psychiatry (2012) 17, 887 -- 905 & 2012 Macmillan Publishers Limited All rights reserved 1359-4184/12 www.nature.com/mp IMMEDIATE COMMUNICATION Convergent functional genomics of schizophrenia: from comprehensive understanding to genetic risk prediction M Ayalew1,2,9, H Le-Niculescu1,9, DF Levey1, N Jain1, B Changala1, SD Patel1, E Winiger1, A Breier1, A Shekhar1, R Amdur3, D Koller4, JI Nurnberger1, A Corvin5, M Geyer6, MT Tsuang6, D Salomon7, NJ Schork7, AH Fanous3, MC O’Donovan8 and AB Niculescu1,2 We have used a translational convergent functional genomics (CFG) approach to identify and prioritize genes involved in schizophrenia, by gene-level integration of genome-wide association study data with other genetic and gene expression studies in humans and animal models. Using this polyevidence scoring and pathway analyses, we identify top genes (DISC1, TCF4, MBP, MOBP, NCAM1, NRCAM, NDUFV2, RAB18, as well as ADCYAP1, BDNF, CNR1, COMT, DRD2, DTNBP1, GAD1, GRIA1, GRIN2B, HTR2A, NRG1, RELN, SNAP-25, TNIK), brain development, myelination, cell adhesion, glutamate receptor signaling, G-protein-- coupled receptor signaling and cAMP-mediated signaling as key to pathophysiology and as targets for therapeutic intervention. Overall, the data are consistent with a model of disrupted connectivity in schizophrenia, resulting from the effects of neurodevelopmental environmental stress on a background of genetic vulnerability. In addition, we show how the top candidate genes identified by CFG can be used to generate a genetic risk prediction score (GRPS) to aid schizophrenia diagnostics, with predictive ability in independent cohorts. The GRPS also differentiates classic age of onset schizophrenia from early onset and late-onset disease.
    [Show full text]
  • W J B C Biological Chemistry
    World Journal of W J B C Biological Chemistry Submit a Manuscript: https://www.f6publishing.com World J Biol Chem 2019 February 21; 10(2): 28-43 DOI: 10.4331/wjbc.v10.i2.28 ISSN 1949-8454 (online) REVIEW Fasciculation and elongation zeta proteins 1 and 2: From structural flexibility to functional diversity Mariana Bertini Teixeira, Marcos Rodrigo Alborghetti, Jörg Kobarg ORCID number: Mariana Bertini Mariana Bertini Teixeira, Jörg Kobarg, Institute of Biology, Department of Biochemistry and Teixeira (0000-0002-3431-3131); Tissue Biology, University of Campinas, Campinas 13083-862, Brazil Marcos Rodrigo Alborghetti (0000-0003-4517-5579); Jörg Kobarg Marcos Rodrigo Alborghetti, Department of Cell Biology, University of Brasilia, Brasilia (0000-0002-9419-0145). 70919-970, Brazil Author contributions: Teixeira MB, Jörg Kobarg, Faculty of Pharmaceutical Sciences, University of Campinas, Campinas 13083- Alborghetti MR and Kobarg J 862, Brazil performed the literature search, analyses and interpretation of the Corresponding author: Jörg Kobarg, PhD, Full Professor, Molecular Biologist, Faculty of data; elaborated the figures; Pharmaceutical Sciences, University of Campinas, Rua Monteiro Lobato 255, Bloco F, Sala conceived the overall idea of the 03, Campinas 13083-862, Brazil. [email protected] review, elaborated the final version Telephone: +55-19-35211443 of the text together; all the authors read, revised and approved the final version. Conflict-of-interest statement: The Abstract authors declare no conflict-of- Fasciculation and elongation zeta/zygin (FEZ) proteins are a family of hub interest. proteins and share many characteristics like high connectivity in interaction Open-Access: This article is an networks, they are involved in several cellular processes, evolve slowly and in open-access article which was general have intrinsically disordered regions.
    [Show full text]
  • FEZ1) in the Brain
    Review TheScientificWorldJOURNAL (2010) 10, 1646–1654 ISSN 1537-744X; DOI 10.1100/tsw.2010.151 Functions of Fasciculation and Elongation Protein Zeta-1 (FEZ1) in the Brain Andrés D. Maturana1,*, Toshitsugu Fujita2, and Shun’ichi Kuroda3,* 1Department of Bioengineering, Nagaoka University of Technology, Niigata, Japan; 2Research Institute for Microbial Diseases, Osaka University, Osaka, Japan; 3Graduate School of Bioagricultural Sciences, Nagoya University, Chikusa, Nagoya, Japan E-mail: [email protected]; [email protected] Received March 16, 2010; Revised June 9, 2010; Accepted June 30, 2010; Published August 17, 2010 Fasciculation and elongation protein zeta-1 (FEZ1) is a mammalian ortholog of the Caenorhabditis elegans UNC-76 protein that possesses four coiled-coil domains and a nuclear localization signal. It is mainly expressed in the brain. Suppression of FEZ1 expression in cultured embryonic neurons causes deficiency of neuronal differentiation. Recently, proteomic techniques revealed that FEZ1 interacts with various intracellular partners, such as signaling, motor, and structural proteins. FEZ1 was shown to act as an antiviral factor. The findings reported so far indicate that FEZ1 is associated with neuronal development, neuropathologies, and viral infection. Based on these accumulating evidences, we herein review the biological functions of FEZ1. KEYWORDS: FEZ1, neuronal differentiation, neuronal disorders, virus infection, organelle transport DISCOVERY OF FASCICULATION AND ELONGATION PROTEIN ZETA-1 (FEZ1) FEZ1 is a mammalian ortholog of UNC-76, a protein found in the nematode Caenorhabditis elegans. UNC-76 has been used in an attempt to elucidate the mechanisms of locomotory defects. Genetic screenings of C. elegans mutants showing locomotory defects (uncoordinated or unc mutants) allowed the identification of various genes related to deficiencies in axonal guidance.
    [Show full text]
  • Mir-285–Yki/Mask Double-Negative Feedback Loop Mediates Blood
    miR-285–Yki/Mask double-negative feedback loop PNAS PLUS mediates blood–brain barrier integrity in Drosophila Dong Lia,b, Yanling Liua,b, Chunli Peic,d, Peng Zhangc,d, Linqing Pana,b, Jing Xiaoe, Songshu Mengb, Zengqiang Yuanc,d,1, and Xiaolin Bia,b,1 aDepartment of Biological Sciences, College of Basic Medical Sciences, Dalian Medical University, Dalian 116044, China; bInstitute of Cancer Stem Cell, Cancer Center, Dalian Medical University, Dalian 116044, China; cThe Brain Science Center, Beijing Institute of Basic Medical Sciences, Beijing 100850, China; dCenter of Alzheimer’s Disease, Beijing Institute for Brain Disorders, Beijing 100069, China; and eDepartment of Oral Basic Science, College of Stomatology, Dalian Medical University, Dalian 116044, China Edited by Norbert Perrimon, Harvard Medical School/HHMI, Boston, MA, and approved February 10, 2017 (received for review August 9, 2016) The Hippo signaling pathway is highly conserved from Drosophila to in size to maintain integrity of the BBB (7). Although an increased cell mammals and plays a central role in maintaining organ size and tissue size can be achieved through the accumulation of cell mass during the homeostasis. The blood–brain barrier (BBB) physiologically isolates growth of diploid cells, cell size is often correlated with the ploidy of the brain from circulating blood or the hemolymph system, and its DNA content and is increased via polyploidy during development, integrity is strictly maintained to perform sophisticated neuronal characteristics that are important for organogenesis, such as proper functions. Until now, the underlying mechanisms of subperineurial organ size, structure, and function (8–10). SPG cells have been shown glia (SPG) growth and BBB maintenance during development are to maintain the integrity of the BBB during development by increased not clear.
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Gene Section Review EEF1G (Eukaryotic translation elongation factor 1 gamma) Luigi Cristiano Aesthetic and medical biotechnologies research unit, Prestige, Terranuova Bracciolini, Italy; [email protected] Published in Atlas Database: March 2019 Online updated version : http://AtlasGeneticsOncology.org/Genes/EEF1GID54272ch11q12.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/70656/03-2019-EEF1GID54272ch11q12.pdf DOI: 10.4267/2042/70656 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2020 Atlas of Genetics and Cytogenetics in Oncology and Haematology Abstract Keywords EEF1G; Eukaryotic translation elongation factor 1 Eukaryotic translation elongation factor 1 gamma, gamma; Translation; Translation elongation factor; alias eEF1G, is a protein that plays a main function protein synthesis; cancer; oncogene; cancer marker in the elongation step of translation process but also covers numerous moonlighting roles. Considering its Identity importance in the cell it is found frequently Other names: EF1G, GIG35, PRO1608, EEF1γ, overexpressed in human cancer cells and thus this EEF1Bγ review wants to collect the state of the art about EEF1G, with insights on DNA, RNA, protein HGNC (Hugo): EEF1G encoded and the diseases where it is implicated. Location: 11q12.3 Figure. 1. Splice variants of EEF1G. The figure shows the locus on chromosome 11 of the EEF1G gene and its splicing variants (grey/blue box). The primary transcript is EEF1G-001 mRNA (green/red box), but also EEF1G-201 variant is able to codify for a protein (reworked from https://www.ncbi.nlm.nih.gov/gene/1937; http://grch37.ensembl.org; www.genecards.org) Atlas Genet Cytogenet Oncol Haematol.
    [Show full text]
  • Phosphorylation-Regulated Axonal Dependent Transport of Syntaxin 1 Is Mediated by a Kinesin-1 Adapter
    Phosphorylation-regulated axonal dependent transport of syntaxin 1 is mediated by a Kinesin-1 adapter John Jia En Chuaa, Eugenia Butkevichb, Josephine M. Worseckc, Maike Kittelmannd, Mads Grønborga, Elmar Behrmanna, Ulrich Stelzlc, Nathan J. Pavlosa, Maciej M. Lalowskie,1, Stefan Eimerd, Erich E. Wankere, Dieter Robert Klopfensteinb,f,2, and Reinhard Jahna,2 aDepartment of Neurobiology, Max-Planck-Institute for Biophysical Chemistry, 37077 Göttingen, Germany; bGeorg-August-Universität Göttingen, Drittes Physikalisches Institut-Biophysik, 37077 Göttingen, Germany; fBiochemistry II, Georg-August-Universität Göttingen, 37073 Göttingen, Germany; cMax-Planck- Institute for Molecular Genetics, 14195 Berlin, Germany; dEuropean Neuroscience Institute Göttingen and German Research Foundation Research Center for Molecular Physiology of the Brain, 37077 Göttingen, Germany; and eMax Delbrueck Center for Molecular Medicine, 13092 Berlin-Buch, Germany Edited by Ronald D. Vale, University of California, San Francisco, CA, and approved March 5, 2012 (received for review August 22, 2011) Presynaptic nerve terminals are formed from preassembled vesicles knockouts (15), although in the latter case, a compensation by other that are delivered to the prospective synapse by kinesin-mediated Munc18 isoforms cannot be excluded. These defects were attrib- axonal transport. However, precisely how the various cargoes are uted to a need for Stx to be stabilized by Munc18 in the inactive linked to the motor proteins remains unclear. Here, we report conformation during transport to prevent it from being trapped in a transport complex linking syntaxin 1a (Stx) and Munc18, two pro- nonproductive SNARE complexes (10) but Munc18 could addi- teins functioning in synaptic vesicle exocytosis at the presynaptic tionally participate in loading Stx onto kinesin.
    [Show full text]
  • Oncoscore: a Novel, Internet-Based Tool to Assess the Oncogenic Potential of Genes
    www.nature.com/scientificreports OPEN OncoScore: a novel, Internet- based tool to assess the oncogenic potential of genes Received: 06 July 2016 Rocco Piazza1, Daniele Ramazzotti2, Roberta Spinelli1, Alessandra Pirola3, Luca De Sano4, Accepted: 15 March 2017 Pierangelo Ferrari3, Vera Magistroni1, Nicoletta Cordani1, Nitesh Sharma5 & Published: 07 April 2017 Carlo Gambacorti-Passerini1 The complicated, evolving landscape of cancer mutations poses a formidable challenge to identify cancer genes among the large lists of mutations typically generated in NGS experiments. The ability to prioritize these variants is therefore of paramount importance. To address this issue we developed OncoScore, a text-mining tool that ranks genes according to their association with cancer, based on available biomedical literature. Receiver operating characteristic curve and the area under the curve (AUC) metrics on manually curated datasets confirmed the excellent discriminating capability of OncoScore (OncoScore cut-off threshold = 21.09; AUC = 90.3%, 95% CI: 88.1–92.5%), indicating that OncoScore provides useful results in cases where an efficient prioritization of cancer-associated genes is needed. The huge amount of data emerging from NGS projects is bringing a revolution in molecular medicine, leading to the discovery of a large number of new somatic alterations that are associated with the onset and/or progression of cancer. However, researchers are facing a formidable challenge in prioritizing cancer genes among the variants generated by NGS experiments. Despite the development of a significant number of tools devoted to cancer driver prediction, limited effort has been dedicated to tools able to generate a gene-centered Oncogenic Score based on the evidence already available in the scientific literature.
    [Show full text]
  • Concordance of Copy Number Loss and Down-Regulation of Tumor Suppressor Genes: a Pan-Cancer Study Min Zhao1 and Zhongming Zhao2,3,4,5*
    The Author(s) BMC Genomics 2016, 17(Suppl 7):532 DOI 10.1186/s12864-016-2904-y RESEARCH Open Access Concordance of copy number loss and down-regulation of tumor suppressor genes: a pan-cancer study Min Zhao1 and Zhongming Zhao2,3,4,5* From The International Conference on Intelligent Biology and Medicine (ICIBM) 2015 Indianapolis, IN, USA. 13-15 November 2015 Abstract Background: Tumor suppressor genes (TSGs) encode the guardian molecules to control cell growth. The genomic alteration of TSGs may cause tumorigenesis and promote cancer progression. So far, investigators have mainly studied the functional effects of somatic single nucleotide variants in TSGs. Copy number variation (CNV) is another important form of genetic variation, and is often involved in cancer biology and drug treatment, but studies of CNV in TSGs are less represented in literature. In addition, there is a lack of a combinatory analysis of gene expression and CNV in this important gene set. Such a study may provide more insights into the relationship between gene dosage and tumorigenesis. To meet this demand, we performed a systematic analysis of CNVs and gene expression in TSGs to provide a systematic view of CNV and gene expression change in TSGs in pan-cancer. Results: We identified 1170 TSGs with copy number gain or loss in 5846 tumor samples. Among them, 207 TSGs tended to have copy number loss (CNL), from which fifteen CNL hotspot regions were identified. The functional enrichment analysis revealed that the 207 TSGs were enriched in cancer-related pathways such as P53 signaling pathway and the P53 interactome.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]