Cloning and Characterization of the Scarlet Gene of Drosophila Melanogaster

Cloning and Characterizationof the scarlet Gene of Drosophila melanogaster

Richard G. Tearle,*.’John M. Belote,t’2Michael McKeown,t” Bruce S. and Antony J. Howells* *Department of Biochemistry, Faculty of Science, Australian National University, Canberra, ACT, Australia and tDepartmentof Biology B-022, University of Calijornia at SunDiego, La Jolla, Calijornia 92093 Manuscript received November 30, 1988 Accepted for publication March 13, 1989

ABSTRACT DNA from the scarlet (st) region of Drosophilamelanogaster has been cloned by chromosome walking, using the breakpoints of a new X-ray-induced third chromosome inversion (Zn(3LR)st-a27) which breaks in the scarlet (73A3.4) and rosy (87D13-14) regions. Two spontaneous mutants of st(st’ and st’p) contain insertions of non-st DNA located within 3.0 kb of the site of the inversion breakpoint used to isolate the gene, and a second scarlet inversion breaks within 6.5 kb of this site. However no changes detectable by Southern blotting were found in 5 X-ray-induced st mutants with cytologically normal third chromosomes. A 2.3-kb transcript arising from the st gene region (as defined by mutant analysis and DNA transformation) has been detected. This transcript is present throughout development at low levels, with a peak level during theearly to mid-pupal stage. The size and amountof this transcript is altered in st’, and its amount is drastically reduced in stSP. Flies carrying the white’ mutation show normal levels of expression of the st transcript, suggesting that the w+ gene does not regulate transcription of the st’ gene. Nucleotide homology between sequences from the st transcription unit and a fragment carrying coding information from the white gene has been detected. This suggests that the st and w proteins are related; they appear to belong to a family of membrane- spanning, ATP-binding proteinsinvolved in the transportof pigment precursors into cells.

HE normal red-brown eye color of Drosophila adult (BEADLEand EPHRUSSI1937), where they per- T melanogaster is due to thepresence of two types turb the ability of these tissues to take up, transport, of light screening pigments, a brown ommochrome or storexanthommatin precursors (SULLIVANand (xanthommatin) anda series of red pteridines (drosop- SULLIVAN1975; HOWELLSand RYALL1975). In ad- terins) (PHILLIPSand FORREST1980; SUMMERS,HOW- dition, analysis of temperature-sensitive alleles of the ELLS and PYLIOTIS1982). The biosynthetic pathways two loci reveal a similar temporal requirement for the leading to these two pigments are completely differ- two geneproducts during development, 24-48 hr ent, xanthommatin being derivedfrom tryptophan after pupariation (EPHRUSSI1942; HOWELLS1979). w and the drosopterins fromguanosine triphosphate. and st differ in that w blocks the formation of both Four eye color genes-vermilion (v), cinnabar (cn), types of pigments whereas st affects just xanthomma- scarlet (st), and white (w)-encode products that are tin accumulation. We are undertaking an analysis of absolutely required forbiosynthesis of xanthommatin. st and w to establish whether there is a common basis Two of these genes code for pathway enzymes, v for for their similar effects on ommochrome synthesis. tryptophan oxygenase (BAGLIONI 1960; TARTOF Here we report our initial characterization of the st 1969; BAILLIEand CHOVNICK1971) and cn for kyn- gene. It was isolated by chromosome jumping, using urenine-3-hydroxylase (GHOSH and FORREST1967; an inversion whose breakpoints lie in salivary chro- SULLIVAN,KITOS and SULLIVAN1973). While the roles mosome region 73A3.4 (thecytological location of st) and 87D13-14(within the rosy-Ace chromosomal walk of st and w have not yet been satisfactorily explained, of BENDER,SPIERER and HOGNESS1983). We have these genes do exhibit similarities in their expression. uncovered gross alterations in the DNA of several st Mutations in w and st affect the expression of the mutants which we assume to be associated with the st pathway in the same organs: the Malpighian tubules lesions. A developmentalprofile of the st gene expres- of the larva and the compound eyes and ocelli of the sion has also been established and we have shown that ’ Present address: Department of Biochemistry, University of Adelaide, lesionsin the w gene do notaffect the level of st S.A. 5000, Australia. transcripts. Nucleotide similarity between coding re- Present address: Department of Biology, Biological Research Laborato- ries, Syracuse University, Syracuse, New York 13244. gions of the st and w genes has been detected, sug- ’ Present address: Molecular Biology and Virology Laboratories, The Salk gesting that the similarity in mutant phenotypes re- Institute, P.O. Box 85800, San Diego, California 92138. Present address: Department of Biological Sciences, Stanford University, flects a common biochemical function for the w and Stanford, California 94305. st gene products.

Genetics 122: 595-606 (July, 1989) 596 R. G. Tearle et al. MATERIALS AND METHODS carried out as described in REEDand MANN(1985). Hybrid- izations were performed in solutions of 1.5 X SSPE, 1% Sources of stocks: Many of the st mutants used in these SDS, 0.5% BLOTTO (Diploma skim milk power), 500 rg/ experiments were uncovered in themutant screens de- ml salmon sperm DNA and (for genomic Southern analyses) scribed below; these (and others) are listed in Table l. For 10%dextran sulfate at68" for 16-24 hr. Filters were the additional stocks used: st82C3 was obtained from M. M. probed with recombinantphage or plasmidDNAs nick GREEN;st' and st@ were obtained from the Bowling Green translated using ["PIdCTP (Amersham, 3000 Ci/mmol) to stock center. Of the wild-type strains, Amherst M56i was 1-2 X IO8 cpm/pg at a final concentration of 2-20 ng/mI, established by G. LEFEVRE,while Canberra has been main- and washed (twice) in 0.1 X SSC, 1% SDS at 42-50" for 30 tained in one of our laboratories (A. J. H.) for 16 yr. min. Mutagenesis and cytogenetic analysis: Flies were raised Transcript analyses: Animals were collected at specific at 25 O ona cornmeal-molasses-agar-yeast-propionic acid stages of development as described in RYALLand HOWELLS medium seeded withlive yeast. For descriptions of the (1974)and stored at-45". RNA was prepared by the mutants used, see LINDSLEYand GRELL(1 968), LINDSLEY methods of CHIRCWINet al. (1982) orBINGHAM and ZACHAR and ZIMM (1986, 1987), or theindicated references. (1985). Poly(A+)RNA was prepared from total RNA using To induce mutations in the st region with X-rays, adult oligo-dT cellulose as described in MANIATIS,FRITSCH and males were collected from a Ki roe pP isogenic third chro- SAMBROOK982) (1 orby the use of Messenger Affinity Paper mosome line and aged for 2-7 days prior to irradiation. (Hybond-mAP) as described by the supplier (Amersham). They were then subjected to an X-ray dose of 4000 r Samples of RNA were glyoxylated and run on0.8% or 1.5% (Torrex 150 X-ray Inspection System, 120 kV, 5 mA, 0.5- agarose gels with circulating 10 mM Na-phosphate buffer, mm plexiglass filter). Groups of 25 males were then placed pH 7.0 (THOMAS1983). Transfer to nylon membrane was in quarter pint bottles containing fresh media and about40 carried out in 10 mM Na phosphate (pH 7.0) and the RNA dZc3evirgin females. After 2-3 days, the flies were trans- fixed to themembrane by exposure to UV irradiation. Blots ferred tofresh bottles for another2-3 days. The F1progeny were hybridized in solutions of 50% formamide, 1.5 X SSPE, from both sets of bottles were subsequently examined and 1% SDS, 0.5% BLOTTO, 10% dextransulfate and 500 rg/ those exhibiting the st phenotype were singly mated to ml salmon sperm DNA at 60°, andprobed with riboprobes Df(3L)st8'h'72/TM6B,Hu Tb e ca flies in order to confirm the synthesized from the T7 promoter of pGEM-1 or pGEM-2 existence of a new st allele or st region deficiency, and to essentially as described in the protocol provided by Promega make the irradiated chromosome heterozygous over TMBB, Biotec., using 20 PCi "P-UTP (Amersham, 800 Ci/mmol) thus establishing a balanced stock. per reaction. Filters were washed once in 0.1 X SSC, 0.1% For cytological analyses, flies carrying the chromosome SDS and once in 0.1 X SSC, 1.0% SDS; both washes at 60" of interest were crossed to Canton S flies, and the larvae for15 min. Filters were sometimes subsequently treated rearedat 18" in uncrowded, well-yeastedvials. Salivary with ribonuclease (1 pg/ml ribonuclease A in 2 X SSC for glands from late 3rd instar larvae were dissected in 0.7% 15 min at 20")in order toreduce the level of nonspecifically saline, fixed for 45 sec in 45% acetic acid, and transferred bound probe. to a drop of lacto-acetic orcein stain on a coverslip. After DNA sequencing and sequence analysis: Restriction 5-8min a microscope slide was applied andthe glands fragments for sequencing were ligated into M 13 sequencing squashed. Chromosome spreads were observed under phase- vectors (mp8, mpl8 or mp19) and single-stranded DNA contrast optics using a Zeiss Universal microscope. The prepared as described by MESSING(1 983). All sequencing chromosomal rearrangements listed in Table 1 areour was carried out by the dideoxynucleotide chain-termination determinations; some of these are not in agreement with method developed by SANGER,NICKLEN and COULSEN previously published breakpoints. (1977). Sequence data was analyzed using the DNA Inspec- Construction of the EMBL3-Zn(3LR)st-a27 library and tor I1 programs in a Macintosh Plus microcomputer. chromosome walk A genomic library was prepared from flies homozygous for the Zn(3LR)st-a27 chromosome. Ge- RESULTS nomic DNA was partially digested with MboI, size-fraction- ated and then ligated into the BamHI sites of the phage cloning vector EMBL3A (FRISCHAUFet al. 1983). Prepara- Cytological localization of the scarlet gene: In tion of fly and bacteriophage DNAs, DNA fragment isola- order to help identify the location of the st gene, we tion, Southern blot analyses, identification of recombinant carriedout an X-raymutagenesis experiment de- clones, and enzymatic reactions (e.g., restriction digests, signedto induce and recover new st mutants(see ligations, and nick translations) were carried out using the MATERIALS AND METHODS). Approximately 40,000 FI protocols described in MANIATIS,FRITSCH and SAMBROOK individuals were scored for the bright color (1 982), orthe references therein. red eye In situ hybridization: Recombinant DNA was biotinyl- phenotype characteristic of st. This screen resulted in ated by nick translation using DNA polymerase I and Bio- the isolation of2 1 new st- mutants (Table1). A subset 16-UTP (ENZO Biochemicals). Hybridization was carried of these mutants had chromosome rearrangements out as described in LANCER-SAFER,LEVINE and WARD involving the 73A region of chromosome 3 (2 inver- (1982). Thehybridization signal was visualized using strep- sions, deficiencies, and complex rearrangements tavidin-biotinylated horseradish peroxidase as described by 9 2 the supplier (ENZO Biochemicals). that involved deletions of the 73A region).In addition Southern blot analyses of fly DNA: Genomic DNA was tothese, twelve chromosome deficiencies obtained isolated from adult flies as described in MIKLOSet al. (1984) from other sources (see Table 1) were examined cy- or by a modification of themethod described in COEN, tologically and retested for complementation withst' THODAYand DOVER(1 982). Restriction digestion and elec- and/or st82c3alleles. The 22 deficiencies that remove trophoresis of DNA were carried out as described in WALKER,HOWELLS and TEARLE(1986). Transfer of di- the distal half of the chromosome doublet 73A3.4 are gested DNA to nylon membrane (Zetaprobe, Biorad) was st-, whereas Df(3L)tra, which removes the proximal Cloning and Cloning Characterization of scarlet 597 TABLE 1 and Zn(3)st-k21, are broken in the middle of the Mutant alleles and chromosome rearrangementsused in the 73A3.4 doublet. These results are in agreement with characterization of the st locus those of ASHBURNERet al. (1981), who also mapped the st locus to 73A3.4. I. Mutant alleles not associated with chromosome rearrangements: In addition to these chromosome rearrangements

Allele Source Reference Source Allele involving the st locus, we recovered eightnew st “point mutants.” Here the term “point mutant”is not meant st I Spontaneous 1 to imply thatthese arethe result of single base StSP Spontaneous 1 stazk Spontaneous 2 changes, but rather it refers to mutants that are cy- st“7J< EMS-induced 3 tologically normal, and thatcomplement mutations in stazd MR-induced 4 the genes flanking st (1(3)7jAband I (3)7?Ac-g).Seven stZ4’ X-ray-induced 5 of these st alleles have phenotypes that are indistin- staZ4 X-ray-induced 5 guishable fromthe original st’ mutant, while one st”” X-ray-induced 5 st b22 X-ray-induced 5 mutant, stz4’ is a hypomorph. The eye color of newly stgZOZ X-ray-induced 5 emerged ~~~~;st’/st~~’adults is light yellow, in con- X-ray-induced 5 trast to the purewhite eyes of wBwx;stlflies. All of the stkZ9 X-ray-induced 5 st “point mutants,” aswell as the two st inversions are X-ray-induced 5 completely viable over a deficiency for st, confirming 11. Deficiencies, inversions, duplication: that the st+ gene performs no function essential for Rearrangement Cytology Reference Cytology Rearrangement viability. Df(3L)st4 72D7-11;73B7-C11 6, 7 Among the chromosome aberrationsisolated in this Df(3L)st6 72E1.2;73A3.4 7,8 screen is a rearrangement, Dp(?;?)st+-g18, involving Df(3L)st7 73A3.4;74A3 7, 8 atandem duplication plus an inversion of region Df(?L)stlO3 73A2-3;74B3-5 7, 9 72E1.2 to 74F4-75A1. This st+ duplication chromo- 72E3;73A3.4 Df(?L)st106 7, 9 some was recovered from an F1 germline mosaic that Df(?L)st100.62 72F3-7373B3 1 Df(3L)st7P 73A1.2;73A7-9 7, 10 also carried the complementary deficiency chromo- Of (3L)st8P 72E4;73B4 7, 10 some, Df(3L)st-g18, which is deletedfor this same Df(?L)st-klO 73A3.4;72D1.2 4, 7 region (BELOTEand MCKEOWN1985). Flies homozy- Df(3L)st-k7 73A3.4;74E1.2 497 gous for Dp(?;?)st+-g18 and therefore carrying four Df (3L)st 72D7;74A3 11,12 Df(3L)st-aZO 73A3;73A4 5, 7 doses of st+ exhibit an eye color that is indistinguish- Df(3L)st-bB 72D5-11;74B2 5, 7 able from flies with a single dose of st+. Df(3L)st-bI I 72D10.11;73D1.2 5, 7 Cloning the scarlet region: The Zn(3LR)st-a27 in- Df(3L)st-e4 72D5-10;73A5 5, 7 version chromosome allowed us to “jump” into the Df(3L)st-eS 72E5-F1173A2;72F1.2173C1.2 5,7 (deficient for 73A2 to 73C1.2) 73A3.4 band at, or near, the st locus from the previ- Df(3L)st-f13 72Cl-D1;73A3.4 5, 7 ously cloned rosy (ry) gene region at 87D (BENDER, Df(3L)st-g24 72D1.2;73A9-10 5, 7 SPIERERand HOGNESS1983). The cytological break- Df(?L)st-g82 72D2-11;73B1.2(associated with 5, 7 point of Zn(?LR)st-a27 is located in 87D13-14. DNA Tp(3;l)st-g82) blotting (Figure 1A) shows that Zn(?LR)st-a27 is al- Df(3L)st-j7 73A1.2;73B1.2 5, 7 Df(?L)st-jll 72E2;73E1.2 5, 7 tered within the 4.1-kb EcoRI fragment from the ry Df(?L)st-glB 72E2;74F4-75A1.2 13 region recombinant phage R2387 (provided by W. Df(3L)tra 73A4;74A1.2 14 BENDER,Harvard University). Noother alterations In(3LR)st-a27 73A3.4i87D13-14 5 were detected in the region around this putative In(?)st-k21 73A3.4;centric heterochromatin 5 Dp(3;3)st+-gl8 72E1.2174F4-72E2174F4- 13 breakpoint. The results seen with respect to theEcoRI 72E2175Al (duplicated for and BamHI digests are consistent with the expectation 72E1.2;74F4-75Al) that Zn(?LR)st-a27 is the result of a 3imple inversion T(K3)st Y170A1.2-74A4.5162B3-3Ltip 15 event with one of the breakpoints lying within the 3.4- The references are: (1) LINDSLEYand GRELL (1968), (2) R. G. kb BamHI fragment of XR2387. The HindIII diges- TEARLE(unpublished data), (3) HOWELU(1979), (4) M. M. GREEN tion pattern is more complicated and suggests that the (unpublished data), (5) this report, (6)ASHBURNER et al. (1981), (7) LINDSLEYand ZIMM (1987), (8) VELISSARIOUand ASHBURNER inverted chromosome also contains a small deletion (1 98 l),(9) ASHBURNERet al. (1 980), (10)J. J. BONNER(unpublished that removes DNA containing the HindIII site at or data), (1 1) T. C. KAUFMAN,(unpublished data), (12) BAKERand near the inversion breakpoint (see below, Figure RIDGE (1980), (1 3)BELOTE and MCKEOWN(1985), (1 4) B.S. BAKER 1B). (unpublished data), (1 5) J. KENNISON(unpublished data). We constructed a recombinant DNA phage library containing DNA isolated from Zn(3LR)st-a27 flies (see MATERIALS AND METHODS). Weused the 4.1 -kb EcoRI edge but not the distal two-thirds of this darkly stain- fragmentfrom XR2387 asa probe to screen this ing band, is st+. The two st inversions, Zn(?LR)st-a27 library for phage that contain the In(?LR)st-a27 re- 598 R. G. Tearle et al. A. B. HindIII BumHI ECORI R H RSRH RBR BSBH RB H I I Ill I II I II II h -" v 87D13-14 Region + g+ ::+" """ - 3R Distal

R H R BSB sta27-2 9- .nr c*

4- Y -

2.5- r. RRHH BH R I "I - - - 73A3.4 Region t t

- 2 Kb 3L Distal

FIGURE1 .-Inversion breakpoints of ln(3LR)st-a27.(A) Southern blot analysis of genomic DNA isolated from Ki roe pp(lanes labeled +) and In(3LR)st-a27 (lanes labeledstaZ7), probed with the 4.1-kb EcoRl fragment from the rosy region clone XR2387 of BENDER, SPIERER and HCJGNFSS(1983). (B)Restriction maps of recombinantphage Xsta27-1 and Xsta27-2 with comparisons to the87D13-14 and 73A3.4 chromosomal regions. B = BamHI, H = Hindlll, R = EcoRI, S = Sall. The 87D13-14 map is taken from Figure 3 of BENDER, SPIERER and HOGNFSS(1983). The region shown corresponds to -168 to -152 on their map. The 73A3.4map is derived from our chromosome walk in a Canton S strain; the arrows below the map show the endpoints of a recombinant phage XstR4 which carries DNA from this region. arrangementregion. Two recombinant phage DNA fragments from XstR4 were used as probes to (Xsta27-1 and Xsta27-2) that hybridized to this probe isolate overlapping recombinant phagefrom the Can- were isolated. Their maps are shown in Figure 1B. ton S library, and the chromosomal walk was contin- Comparison of their restriction maps with the map of ued in both directions until about 200 kb of contig- the 87D13-I4 region, as determined by BENDER,SPI- uous DNA was cloned. An additional 50 kb distal to ERER and HOGNESS(1983), suggests that these two our walk was provided to us by DEBORAHANDREW, phage represent each of the inversion breakpoints of who had initiated a chromosomewalk in salivarygland the In(3LR)st-a27chromosome. Xsta27-1 contains the chromosome region 73192-3 (D. ANDREW andB. S. distal region of 73A3.4 fused to the proximal region BAKER,unpublished data). A detailed description of of 87D13-14, and Xsta27-2 contains the proximal the genetic and molecular characterization of this region of 73A3.4 fused to thedistal portion of 87D13- region are presented elsewhere (MCKEOWN, BELOTE 14. The restriction maps of these phage are consistent and BAKER 1987;J. M. BELOTE,F. M. HOFFMAN,M. with our expectations based on the results shown in MCKEOWNand B. S. BAKER,in preparation). Another Figure 1A. Canton S genomic DNA library (WALKER,HOWELLS Given the aboveassumptions, the 4.5-kb EcoRI-Sal1 and TEARLE1986) was also screened with st region fragments of Xsta27-2 (the Sal1 site is at the junction subclones and a restriction map of st region phage of the insert and the vector arm) should represent from both libraries is shown in Figure 2. DNA from the 73A3.4 region. Thisfragment was Southernblot analyses of wild-typestrains: In used to probe thewild-type Canton S library of MAN- order to characterize restriction site andfragment IATIS et at. (1978) for phage containing DNA from length polymorphisms compatible withwild type st 73A3.4 and the endpoints of the DNA of one such function, we examined the DNA of several wild-type phage, XstR4, are shown on the map in Figure 1B. A strains by DNA blotting. The blots were probed ini- comparison of the maps of XstR4 and XR2387 to the tially with either XstR4, Xst4 or Xst25, thus covering maps of thebreakpoint-containing phage, Xsta27-1 a region of 29 kb (-1 1.2 to +17.9), and then with and Xsta27-2, suggests that In(3LR)st-a27 also con- plasmid subclones to map theregion more accurately. tains a deletion of 1 kb from region 87D13-14. This For convenience, restrictionfragments are given is consistent with the blotting data of Figure 1. In situ codes indicating the restriction sites that define them hybridization confirms that XstR4 DNA is derived and their length,e.g., H/Rl.4 for the 1.4 kb HindIIIl from region 73A3.4 (data not shown). EcoRI fragment (co-ordinates 0.0 to 1.4). Figure 3A Cloning and Characterizationof scarlet 599 1JB8A stR4 st13 - ) st4 2JB8B

3JB10

R H RHHXRXR H XXB H R X H XHBH B XRH R BRS 1 I Ill I II I I IIII I I I I Ill I II I I II I I -15 -10 -5 5 10 15 20 Kb

I In(3bFtk21 -I qIn(3LRwa27

S PP st'

7st' transcript (RNA blots) -SI+ activity (transformants) FIGURE2.-DNA from the scarlet region. A restriction map of st region DNA from wild-type (Canton S) flies is shown. Restriction enzymes are abbreviated asin Figure 1, plus X = XhoI. Position 0 is the HindIII site nearest the In(3LR)st-a27 breakpoint. The positions of recombinant phage from this region are shown above the map and those of various chromosomal rearrangements that disrupt st+ function are shown below the map. Horizontal lines below the map indicate the restriction fragments that hybridize to st RNA and also the fragment that has been tested successfully for st+ transforming ability. gives anexample of ablot, showing the results of The most useful mutants forthis purpose were the X- using XstR4 to probe Canton S and Oregon R DNA. ray-induced alleles, since they arose in a defined iso- Our Canton S strain is not isogenic forthe 3rd genic third chromosome line, Ki roe pp. Most inform- chromosome, and is polymorphic for HindIII restric- ative among the X-ray-induced mutants were the two tion sites at positions -1 1.7 and +8.8 (shown in pa- st inversions. Zn(3LR)st-a27, which was used for the rentheses in Figure 2).Thus thepresence of a HindIII isolation of the st locus, has been discussed above. It site at -11.7 in some chromosomes results in the has a chromosomal breakpoint in the region -0.8 to appearance of a minor 2.7-kb H/R band as well as the 0.0 on the molecular map. The st region breakpoint predominant 4.0-kb band (-13.0 to -9.O), while the of Zn(3)st-k2I has not been mapped with the same absence of the HindIII site at +8.8 in a minority of accuracy, and is known only to lie somewhere between chromosomes results in contiguous fragments of 0.5 -7.3 and +1.4. Five other X-ray-induced st mutants kb and 3.7 kb being replaced by a 4.2-kb H/R band (stz4',st@, stbz2, and staz4)that are not associated (+8.3 + 12.5). The st region of our Oregon R strain with cytologically visible rearrangements were exam- differs fromthat of Canton S in two respects: (1) there ined by Southern blotting and found to be indistin- is an additional HindIII site at +4.0 andwhich results guishable from the parental stock. Patterns of bands in the appearance of a 2.6-kb R/H fragment in place forthree stg22and stgZo2)are shown in Figure3, of the 4.0-kb Canton S fragment, and (2) there is a B and C; although slightly different from Canton S, restriction fragment length polymorphism that makes the patterns are identical to each other and to that the 4.0-kb H/R fragment seen in Canton S (-13.0 to obtained with DNA from Ki roe pp (theparental -9.0) about 4.5 kb in length. We interpret this to be chromosome) (data not shown). a length polymorphism rather than the lossof one In addition to these newly inducedmutants, we restriction site and thegain of another. Our Canberra examined four other cytologically normal mutant al- strain has a restriction pattern in the st region similar leles: st', stsf', st8", and(Figure 3, B and C). to that of Oregon R, while the Amherst M56i strain Unfortunately, the parental chromosomes on which has a pattern similar to Canton S. thesemutations arose are not available fordirect Southern blotanalyses of st mutant strains:As the comparisons. Three of these mutations, st', stSP, and first approach toward definingthe st+ functional unit, St82c3 are associated with changes within the same we examined several st mutantsfor DNA re- region disrupted by the st inversions. arrangements associated with the loss of st+ activity. The st' mutation is associated with the insertion of 600 R. G. Tearle et al. A. Hin dIIWco RI B. Hin dIIIEco RI

FIGUREJ."Analysis of wild-typeand mutant scarlef genes. DNA from each of the strains shown was digested with the enzymes indicated, blotted and probed with radiolabeled XstR4 DNA. Lengths (kb) of the major bands (shown beside the panels) were determined from the c. Bam HI/Xho I mobilities of marker DNA fragments (Hindlll-digested XDNA) run on each gel. CS = Canton S; OR = Oregon R.

6.4-

4.0- 3.2-

1.7-

0.9- approximately 7.6 kb of non-st DNA between -1.7 and -0.8. Thus the 0.9-kb X/B fragment in Canton S is replaced by a 1.7-kb fragment in st' (Figure 3C; lanes 1 and 2). A second new fragment also appears but is too small to be seen on this blot. The 4.8-kb H/ H fragment (-4.8 to 0.0) in Canton S is replaced by R HPC P CXPXH B CR PC X H bands of 5.5 and 2.7 kb (Figure 3B; lanes 1 and 2). I IIII I I I II I I I (Residual wild-type 0.9-kb X/B and 4.8-kb H/H bands -6 4 -2 0 2 4 seen in the st' lanes were the result of slight contami- nation of the st'stock from which this DNA was made; A they were not seen on blots involving other preparations of st' DNA.) A partial map of the st' insertion PR HB H PB (NoC, X) (Figure 4), compiled from these and other Southern FIGURE4.-Mutant st' and sfJpare associated with insertions. blots, shows no obvious similarity to published maps Partial restriction maps of the insertions in st' and sf'p. Restriction of any well-characterized Drosophila transposable ele- enzymes are abbreviated as in Figure 2, plus C = Clal, and P = Pstl. Sites within the insertions were determined from the sizes of ment. restriction fragments on Southern blots; note that a maximum of The stsP chromosome contains an insertion of ap- two sites can be determined for each enzyme since additional sites proximately 5.2kb between -3.0 and -2.1. This lying between them will not be detected. Restriction enzymes that results in the replacement of the 4.8-kb H/H band do not cut the insertions are indicated in parentheses. Map coordinates are given as in Figure 2. (-4.8 to 0.0) with fragments of 4.3 and 2.5 kb (Figure 3B; lanes 1 and 3); the 2.5-kb band is obscured by the doublet. In the XhoI/BamHI digest, the 6.4-kb X/X presence of a 2.5-kb R/H fragment, but comparison fragment (-8.5 to -2.1) is replaced by bands of ap- with neighboring lanes reveals that this band is a proximately 8.0 and 0.9 kb (Figure 3C; lanes 1 and Cloning and Characterization andCloning of scarlet 60 1

3). The partial restriction mapof this insertion (Figure scripts in the same RNA samples from third instar 4) shows no obvious similarity to published restriction larvae (data not shown). maps of Drosophila transposable elements. The spot- The st' and stsP mutations involve the insertion of ted phenotype of stSP is not particularly obvious in DNA into or near the st transcription unit. The mu- wild-type backgrounds; however, when combined tations might alter the level or structure of the st with wBwx(to remove the drosopterins) stsp shows an RNA. Figure 5B shows blots of poly(A+) RNA from eye pigment pattern reminiscent of wsP alleles-a pale both st' and stSPpupae hybridized with region-specific yellow eye with spots of darker brown. probes.A faint st transcript(<5% of wildtype) is Aputative MR-induced allele, (M. M. GREEN, detected in the st"P sample using a probe covering the personal communication), is missing the BamHI site region -1.7 to -0.8; the higher level of background at -0.8. Thus,the 0.9-kb X/B fragment (-1.7 to usually associated with the probe covering the region -0.8) and the adjacent 4.0-kb B/X fragment (-0.8 to -0.8 to 0.0 prevents us from determining whether +3.2) of Canton S are replaced by a band of 4.9 kb this fragment also detects the transcript in stSP.st', on (Figure 3C; lanes 1 and 4). If the loss of the BamHI the other hand,gives rise to anRNA which is slightly site is the result of a deletion, it must be rather small, smaller and less abundant than the wild-type st tran- since we can detect no change in the size of the 1.7- script. This RNA is detected using a probe containing kb X/H fragment (-1.7 to 0.0) in the stazc3 mutant sequences to the left of the st' insertion (-1.7 to -0.8). DNA (data not shown). Although the differences in length and abundanceof All of the st- rearrangements analyzed thus far are the st' transcript relative to st+ are small, they are located between -7.3 and +1.4, suggesting that the quite reproducible. A probe lying completely to the st+ functional unit lies at least partly within this region. right of the st' insertion (-0.8 to 0.0) does not detect Recent DNA transformation studies (A. ELIZUR,R. this RNA, indicating that the st' RNA is truncated G. TEARLE,R. B. SAINTand A. J. HOWELLS,unpub- near, or within, the st' insertion. The observation that lished data) have confirmed this by showing that a the 2.3-kb RNA is affected by both of these sponta- fragment extending from -7.3 to +1.4 is capable of neous st mutations provides strong evidence that this supplying st+ function. is the st gene transcript. Transcription of scarlet: In order to characterize Developmental analyses using a temperature-sensi- the size of the st transcription unit we probed blots of tive st allele (HOWELLS 1979) indicate that the tem- poly(A+) RNA from wild type third instar larvae with perature-sensitive period for eye pigmentation is ap- riboprobes made from various restriction fragments proximately 24-48 hr after pupariation at 25 O. Other from across the region. The probes were strand spe- studies show that st+ must act in the larval Malpighian cific, with transcription being fromleft to right on the tubules. We have used RNA blotting to determine if map shown in Figure 2. Figure 5A shows a number the different developmental requirements for st+ ac- of such blots. These blots show that fragmentslocated tivity are reflected in changes in expression of the st between the PstI site at -3.0 and the EcoRI site at gene at the level of the RNA. Figure 5C shows RNA + 1.4 hybridize to a 2.3 kb transcript. The fragment from different developmental stages hybridized to a immediately to the left of -3.0 (1.5-kb P/P) fails to probe from region -0.8 to -0.0. The major st+ tran- hybridize to any transcript but the next leftward frag- script is present at all stages. The level of st+ RNA is ment (2.4-kb R/H, -4.5 to -6.9) again hybridizes to developmentally regulated such that it is present in a 2.3 kb transcript. Recent sequencing data(Y. HAUPT about 10-fold higher levels in early to mid pupae than and A. J. HOWELLS, unpublished data)suggests that at any other stage. This corresponds well to the time part of the st coding region is located in the 2.4-kb R/ at which the gene would need to be expressed for Hfragment and that the 1.5-kb P/P fragment is proper pigmentation of the eye. probably part of a relatively long intron. The frag- Since the st+ and thew+ genes appear toplay similar ment to the right of 0.0 (1.4-kb H/R, 0.0 to f1.4) roles in the pathway leading to the deposition of weakly hybridizes to a 2.3-kb transcript, as well as to xanthommatin, we wished to determine if st+ expres- transcripts of about 2.6 and 3.6 kb. We interpret the sion is regulated by w+. In otherwords, is the w+ gene latter two bands to be products of an adjacent proxi- function required for the expression of st+? We have mal transcription unit. The bands seen on these blots addressed this question by carrying out an RNA blot are resistant to ribonuclease digestion and are there- analysis of the w' mutation. The blots shown in Figure fore unlikely to be the result of spurious hybridization 5D show that the level of st+ RNA does not change by the riboprobes. The results are consistent with the drastically in the presence of wl, suggesting that w+ size of the gene inferred from our study of st- chro- does not regulate the transcription of the st+ gene. mosomal rearrangements andwith the transformation Homology between scarlet region DNA and white results mentioned above. The putative st transcript is locus sequences: Because of the similar effects of st present at substantially lower levels than white tran- and w mutants on ommochrome deposition,we wished 602 R. G. Tearle et al. A. B. (0 R HP P XPX B H R

-6 -4 -2 -4 -6 0 Kb "- 35 7 1 "- 2 46

1234567-

mm "-

C. D.

FIGURE5.-RNA expression of the scarlet gene. (A) Location of the st transcription unit. An RNA blot (10 pg poly(A+) RNA/lane) was cut into strips and the strips hybridized to riboprobes made from restriction fragments from across the st region. After hybridization and washing, the filters were autoradiographed. The autoradiographs were aligned for photography. Positions of the fragments from which the riboprobes were made are shown below the restriction map. (B)Expression of st RNA in st mutants. Poly(A+) RNA (5 pg/lane) from wild type (Canton S) or st mutant early pupae was blotted and probed with riboprobes covering either region -1.7 to -0.8 (left three lanes) or -0.8 to 0.0 (right three lanes) (probes 5 and 6 respectively) (A). The same RNA preparations were used for the blots shown in (i) and (ii) and. for each blot, all three lanes were part of the same gel and were hybridized together. (C) Developmental expression of st. Poly(A+) RNA (10 pgllane) from various developmental stages was separated by electrophoresis, blotted and probed with a riboprobe covering the region -0.8 to 0.0 (probe 6) (A). (D) Expression of st RNA in the presence and absence of the w+ gene. Poly(A+) RNA from wild-type (w*) or mutant (w') third instar larvae was blotted and probed as in (C).

to determine if there is any similarity between the Xw45A2 was digested with various restriction enzymes coding or regulatory sequences of the two cloned loci. and probed with subclones from the st region (-4.8 A clone (Xw45A2) carrying thew+ gene and surround- to +3.4). A subclone carryingthe 4.8-kb H/H st ing DNA (coordinates -5.2 to 9.2; LEVIS, BINCHAM fragment (-4.8 to 0.0) cross-hybridizes to a 1.1-kb S/ and RUBIN 1982) was isolated fromthe wild-type Xb fragmentof thew locus (-0.7 to +0.4). A subclone Canton s library of MANIATIS et al. (1978). DNA from carrying the 2.0-kb S/B fragment (-0.7 to +I .3)of w Cloning and Characterization of scarlet 603

.sL CTTTCGGCGGCGCAA---ACTCGAATTGGTAGTGGCGATGAC~GAAGGTCCTT LeuSerAlaAlaGln---ThrArgIleGlySerGlyAspAspLysLysValLeu.. .. 6 4 2 0 -2.4 LeuSerLysCysGlnHisThrIleIleGlyValProGlyArgValLysGlyLeu I 111II white frl CTCAGCAAATGTCAGCACACGATCATCGGTGTGCCCGGCAGGGTG~AGGTCTG

st TCGGGGGGAGAACGCAAACGATTGGCATTCGCCGTGGAGCTGCTGAACAATCCG SerGlyGlyGluArgLysArgLeuAlaPheAlaValGluLeuLeuAs...... snPro SerGlyGlyGluArgLysArgLeuAlaPheAlaSerGluAlaLeuTh s Pro y TCCGGCGGAGAAAGGAAGCGTCTGGCATTCGCCTCCGAGGCACTAACCGATCCG

.sL GTGATTCTATTTTGCGATGAGCCTACCACGGGACTGGACTCATACAGTGCCCAG .....

-w CCGCTTCTGATCTGCGATGAGCCCACCTCCGGACTGGACTCATTTACCGCCCAC Gels w probe st probe st CAGCTGGTGGCCACGTTGTACGAGTTGGCCCAAAAGGGGCACCACCATACTGTGC hstR4hw45A hstR4 hw45A GlnLeuValAlaThrLeuTyrGluLeuAlaGlnLysGlyThrThrIleLeuCys ...... SerValValGlnValLeuLysLysLeuSerGlnLysGlyLysThrValIleLeu frl AGCGTCGTCCAGGTGCTGAAGAAGCTGTCGCAG~GGGC~GACCGTCATCCTG

ST ACCATCCATCAGCCGAGTTCGCAGCTCTTCGATAACTTTAACAACGTAATGTTG ThrIleHisGlnProSerSerGlnLeuPheAspAsnPheAsnAsnValMetLeu ...... 7.0 ThrIleHisGlnProSerSerGluLeuPheGluLeuPheAspLysIleLeuLeu 5.6 y ACCATTCATCAGCCGTCTTCCGAGCTGTTTGAGCTCTTTGACAAGATCCTTCTG

3.5 st CTGGCCGATGGGCGAGTAGCCTTTACGGGATCACCTCAGCATGCGCTTAGTTTC LeuAlaASpGlyArgValAlaPheThrGlySerProGlnHisAlaLeuSerPhe 2.7 ...... MetAlaGluGlyArgValAlaPheLeuGlyThrProSerGluAlaValAspPhe 2.2 ATGGCCGAGGGCAGGGTAGCTTTCTTGGGCACTCCCAGCGAAGCCGTCGACTTC FIGURE7.-Sequence homology between scarlet and white. The nucleotide sequence for sf starts 28 I nucleotides downstream from 1.4 the Xhol site (coordinate -1.7): the w sequence is from O'HAREet al. (1984) (position -354 to -678). Colons between the deduced amino acids indicate identical residues; a single dot shows a con- servative substitution. The boxed region is strongly homologous to site B of the ATP-binding region of bacterial periplasmic transport proteins (AMFS 1986).

FIGURE6.-Cross-hybridization between scarlet and white. The sequence of the homologous region from w (O'HARE top part of the figure shows restriction maps of phage clones et al. 1984), which shows that the overall homology carrying the w+ (Xw45A2) and st+ (XstR4) genes. They have been aligned so that transcription of both genes is from left to right. between the two genes in this region is 59% (identical Exons of UIare shown as black bars under the w map. The approx- residues-at both the nucleotide and derived amino imate extent of the st transcription unit is shown as a horizontal acid levels). This sequence includes one of the putative line under the st map. Restriction enzymes are abbreviated as in ATP-binding sites of the w protein (MOUNT 1987); Figure 4, plus Xb = Xbal. The major cross-hybridizing fragments are indicated by cross hatching. The bottom part of the figure the homology of the 100 nucleotides which encodes shows DNA from the st or w clones digested with the restriction this site (and its immediate surroundings) is 72%, enzymes indicated. The stained gels (on the left) were blotted and which probably accounts for the cross-hybridization probed, as indicated, with a w specific probe (-0.7 to +1.3) or a st between the two genes (as shown in Figure 6). Further specific probe (-4.8 to 0.0) to give the autoradiographs (on the DNA sequencing (A. ELIZUR,R. G. TEARLE,D. G. right). The positions of marker fragments (Accl-digested XDNA) are indicated. Hybridization conditions were as given for Southern BOYLEand A. J. HOWELLS,in preparation) has shown blots (MATERIALSAND METHODS); probes were labeled by nick that other smaller patches of homology not seen by translation. hybridization studies are present in other parts of the putative coding regions. cross-hybridizes to the 0.9-kb X/B fragment (-1.7 to -0.8) of st. This hybridization can be detected after DISCUSSION hybridization (1.5 x SSPE at 68") andwashing (0.1 X SSC at 60") under stringent conditions. The regions The evidence that XstR4 contains the st gene is of st and w cross-hybridization are indicated on the overwhelming. (1) Sequences from the clone corre- restriction maps shown in Figure 6. The region lying spond tothe non-rosy region sequences of clones downstream of the XhoI site (-1.7) of st was sequenced Xsta27-1 and Xsta27-2, which span the breakpoints of and a 320 bp region of this sequence showing the In(3LR)st-a27. This inversion chromosome, which is greatest homology to w is givenin Figure 7; this associated with a st mutant phenotype, has one break sequence contains a single open reading-frame and in 73A3.4, the cytological position of st; the corre- the derived amino acid sequence is shown under the spondence of the st mutant phenotype and the cyto- nucleotide sequence. Alsogiven in Figure7 is the logical location implies strongly that the breakpoint is 604 R. G. Tearle et al. either very close to, or within, the st gene. (2) In the not shown) indicates that the peak level of st RNA DNAof four different mutant stocks showing a st corresponds to the temperature-sensitive period for phenotype, the restriction map of the region relative the temperature-sensitive mutant (ie., 24-48 hr after to wild type is altered. (3) Successful germline trans- pupariation). As for w (LEVIS,O’HARE and RUBIN formation of st’ individuals to st+ has been achieved 1984; PIRROTTAand BROCKL1984), st RNA can be following the injection of st’ embryos with a P-element detected in adults. Whether this reflects stability of transformationvector carrying an 8.7-kb fragment the mRNA made during pupal life or continued low spanning coordinates -7.3 to +1.4 (A. ELIZUR,R. G. level transcription has not been determined. TEARLE,R. B. SAINT andA. J. HOWELLS,unpublished The transcriptional results obtained forst ’ are com- data). (4) A single 2.3-kb transcript is altered in st’ patible with the position of the non-st DNA insertion and greatly reduced in abundance in stsf’. (5)Some of in this mutant. The use of two probes covering the the sequences from within the abovetranscription -1.7 to 0.0 region was particularly informative. The unit show significant sequence similarity to the white probe covering the region -1.7 to -0.8 (which lies 5’ gene, another locus involved in ommochrome metab- to thest’ insertion) detects a transcriptwhich appears olism. to be slightly smaller than that found in wild type. The transformation experiments, together with the However a probe covering the region just 3’ to the Northern blot analysis, indicate that the st transcrip- st’ insertion fails to detect a major transcript. Thus, tion unit is confined to the region from -7.3 to +1.4. it seems likely that in st’, transcription initiates from When DNA from Canton S is analyzed by Southern thenormal st promoter(probably located between blotting using probes coveringthis region, few restric- -7.3 and -4.8) and terminates within the st’ insertion. tion site or fragment lengthpolymorphisms are found. Since the st’ transcript is polyadenylated, a polyade- In contrast, DNA sequences whichlie both distal nylation signal must be located within this insertion. (-14.1 to -9.0) and proximal (+1.4 to +12.5) to the Polyadenylated aberrant transcripts which terminate st transcription unit show considerable polymorphism. within inserted transposable elements have been The distal region is not only polymorphic in our found in several w mutants (PIRROTTAand BROCKL Canton S strain but also shows different restriction 1984; LEVIS, O’HAREand RUBIN 1984; ZACHAR, patterns in all of the different wild type strains that CHAPMAN andBINGHAM 1985; BINGHAMand CHAP- we have examined. Obviously more detailed data is MAN 1986). needed but it does seem that the regions that flank st The stsP mutation is of interest because it gives a are highly polymorphic. Such variation is not typical spotted pigment patternreminiscent of the w5p alleles. of the D. melanogaster genome in general, although This suggests that the lesion in st”P, like those in the some highly polymorphic regions, such as those con- wsP alleles, may affect regulatory rather than coding taining the zeste locus, have been found (MARIANI, sequences. The severely reduced level of the st tran- PIRROTTAand MANET 1985). script in 6-30 h stS$ pupae is consistent with this The developmental pattern of expression of the st suggestion; however, unlike the situation with the wsp gene at the RNA level agrees with biochemical and alleles, where the lesions lie 5’ to the coding region, genetic data concerning this gene. Specifically, there the insertion in stSPappears to be located within an are low levels of expression in larvae and adults and intron. This may mean that some of the regulatory an obvious peak of expression in the pupal period. sequences of the st gene arelocated within this intron; Tissue transplantation experiments (BEADLE,1937a, however it is also possible that the insertion has a cis- b) suggest that the Malpighian tubules normally re- acting inhibitory effect on the st promoter or that an quire expression of both st and w forstorage of abberant stSP transcript is unstable and is rapidly de- ommochrome pigment precursors. The presence of graded. st+ transcripts throughout larval life (albeit at a low As outlined in the Introduction, st and w mutants level) probably reflects this expression in the Malpi- show marked similarities at the genetic and biochem- ghian tubules. This has been directly demonstrated ical levels, raising the question of whether their prod- for RNAs from the w gene (FJOSEet al. 1984). ucts perform similar functions, or whether there is a Pigment deposition in the eyes commences about regulatory relationship between them. Our molecular 48 hr after pupariation (SUMMERS,HOWELLS and PY- analysis has revealed that there is considerable nucleo- LIOTIS 1982). Genetic analysis using a temperature- tide similarity between the two genes. The sequencing sensitive st allele shows that st expression is required data, which has confirmed the hybridization analysis, just prior to this time (about 24-48 hr post puparia- shows thatthe st/w homology is located in coding tion) for proper pigmentation of the eyes (HOWELLS regions of these two genes and is just as strikingly 1979). This correlates with a tenfold increase in the apparent in the derivedamino acid sequences. Al- level of st RNA early in the pupal period. Finer-scale though the functional significance of this similarity analysis of st gene expression during pupal life (data between the putative protein products of st and w Cloning and Characterization of scarlet 605 must await further analysis, it would appear that the and M.M. was supported by an NIH postdoctoral training grant, phenotypic similarity between lesions at the two loci and by a postdoctoral fellowship from the Helen Hay Whitney Foundation. reflects a common functional role for the proteins. MOUNT(1 987) has pointed out thesequence similarity LITERATURECITED between the putative w protein and a family of ATP- bindingproteins involved in bacterial periplasmic AMES,G. F.-L. 1986 Bacterial periplasmic transport systems: transport systems. As shown in Figure 7, the strongest structure, mechanism, and evolution. Annu. Rev. Biochem. 55: homology between the derived amino acid sequences 397-425. ASHBURNER,M., J. FAITHFULL,T. LITTLEWOOD,G. RICHARDS,S. of w and st includes a region thought to be involved SMITH,V. VELISSARIOU and R. WOODRUFF,1980 New mu- in ATP binding. A role for the w and st proteins in tants. Drosophila Inform. Serv. 55: 193- 195. the transport of xanthommatin precursors across the ASHBURNER,M., P. ANGEL,C. DETWILER,J. FAITHFULL,D. GUBB, plasma membrane of pigment cells was proposed by G. HARRINGTON,T. LITTLEWOOD,S. TSUBOTA,V. VELISSA- SULLIVANand SULLIVAN(1 975).The w gene is essen- RIOU and V. WALKER,1981 New mutants. Drosophila In- form. Serv. 56 186-191. tial forpteridine as well asommochrome pigment BAGLIONI,C., 1960 Genetic control of tryptophan pyrrolase in production. The phenotypicanalogue of st in the Drosophila melanogaster and Drosophila virilis. Heredity 15: 87- pteridine biosynthesis pathway appears to be thebrown 96. (bw) gene (SULLIVANet al. 1980);recent molecular BAILLIE,D. L., and A. CHOVNICK,1971 Studies on the genetic analysis of the bw gene has indicated that there is also control of tryptophan pyrrolase in Drosophilamelanogaster. Mol. Gen. Genet. 112: 341-353. strongamino acid homology between theprotein BAKER,B. S., and K. RIDGE,1980 Sex and the single cell: on the products of the w and bw genes (DREESEN,JOHNSON action of major loci affecting sex determination in Drosophila and HENIKOFF1988). As discussed by these authors, melanogaster. Genetics 94 383-423. it seems likely that the w, bw and st gene products are BEADLE,G. W., 1937a Development of eye colors in Drosophila: members of a family of membrane-spanning, ATP- Fat bodies and Malpighian tubules as sources of diffusible substances. Genetics 22 146-152. binding proteins which associate to provide the per- BEADLE,G. W., 1937b Development of eye colors in Drosophila: meases involved in the uptake of pigment precursors. Fat bodies and Malpighian tubules in relation to diffusible An alternative hypothesis concerningthe pheno- substances. Genetics 22: 587-61 1. typic similarities of lesions at st and w, that one gene BEADLE,G. W., and B. EPHRUSSI,1937 Development of eye colors regulates the expression of the other,is not supported in Drosophila: Diffusible substances and their interrelations. Genetics 22: 76-86. by the data. The levelof the st transcript in third BELOTE,J. M., and M. MCKEOWN,1985 Post-replicative repair of instar larvae is not affected by the w’ mutation (our an X-ray damaged chromosome following fertilization in Dro- data), and thelevel ofw gene expression has previously sophila melanogaster. Drosophila Inform. Serv. 61: 33-34. been shown not to be affected in st’ adults (LEVIS, BENDER,W., P. SPIERERand D. S. HOGNFSS, 1983 Chromosomal O’HAREand RUBIN1984). walking and jumping toisolate DNA from the Ace and rosy loci and the bithorax complex in D. melanogaster. J. Mol. Biol. 168: Given the similarities in the tissue-specific and tem- 17-33. poral expression of the w and st genes (see Introduc- BINGHAM,P. M., and C. H. CHAPMAN,1986 Evidence that white- tion), we consider it possiblethat conserved regulatory blood is a novel type of temperature-sensitive mutation resulting as well as structural sequences might exist between from temperature dependent effects of a transposon insertion the two genes. Such a possibility is exciting because of on formation of white transcripts. EMBO J. 5: 3343-3351. BINGHAM,P. M., and Z. ZACHAR,1985 Evidence that two muta- the implications it might have for the regulation and tions, wDzLand z’, affecting synapsis dependent genetic behavior function of the ommochrome biosynthetic pathway in of white are transcriptional regulatory mutants. Cell 40 819- particular, and for the coordinate controlof function- 825. ally related genes in eukaryotes in general. Since the CHIRGWIN,J. M., A.E. PRZYBYLA,R. J. MACDONALDand W. J. nucleotide sequence of the putative regulatory region RUTTER,1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294- upstream of w has been established (O’HAREet al. 5299. 1984) and analyzed in some detail (DAVISONet al. COEN,E. S., J. M. THODAYand G. DOVER,1982 Rate of turnover 1985; ZACHAR, CHAPMANand BINGHAM1985; PIR- of structural variants in the rDNA family of Drosophila mela- ROTTA, STELLER and BOZZETTI1985; LEVIS, HAZEL- nogaster. Nature 295: 564-568. DAVISON,D., C. H. CHAPMAN,C. WEEDENand P. M. BINGHAM, RIGG and RUBIN1986), we are now determining the 1985 Genetic and physical studies of a portion of the white nucleotide sequences of the upstream and intronic locus participating in transcriptional regulation and synapsis- regions of st in order toidentify any shared regulatory dependent interactions in Drosophila adult tissues. Genetics sequences. 110: 479-494. DREESEN,T. D., D. H. JOHNSON and S. HENIKOFF,1988 The We thank K. C. REEDand A. ELIZURfor advice about methods brown protein of Drosophila melanogaster is similar to the white and for valuable discussions. This work was supported by grants protein and tocomponents of active transport complexes. Mol. from the Australian Research Grants Scheme to A.J.H., and by Cell. Biol. 8 5206-5215. grants from the U.S. National Institutes of Health (NIH) and the EPHRUSSI,B., 1942 Analysisof eye color differentiation in Dro- National Science Foundation to B.S.B. and J.M.B. R.G.T. was sophila. Cold Spring Harbor Symp. Quant. Biol. 10: 40-48. supported by an Australian Commonwealth Postgraduate Award FJOSE, A., L. C.POLITO, U. WEBER and W. J. GEHRING, 606 R. G. Tearle et al.

1984 Developmental expression of the white locus of Drosoph- MOUNT,S. M., 1987 Sequence similarity. Nature 325: 487. ila melanogaster. EMBO J. 3: 2087-2094. O’HARE,K., C. MURPHY,R. LEVISand G. M. RUBIN,1984 DNA FRISCHAUF,A. M., H. LEHRACH,A. POUSTKAand N. MURRAY, sequence of the white locus of Drosophila melanogaster. J. Mol. 1983 Lambda replacement vectors carrying polylinker se- Biol. 180: 437-455. quences. J. Mol. Biol. 170: 827-842. PHILLIPS,J. P., and H. S. FORREST,1980 Ommochromes and GHOSH,D., and H. S. FORREST,1967 Enzymatic studies onthe pteridines, pp. 542-623 in The Genetics and Biology of Drosoph- hydroxylation of kynurenine in Drosophilamelanogaster. Ge- ila, Vol. 2d, edited byM. ASHBURNERand T. R. F. WRIGHT. netics 55: 423-43 l. Academic Press, New York. HOWELLS,A. J., 1979 Isolation and biochemicalanalysis of a PIRROTTA,V., and C. BROCKL,1984 Transcription of the Dro- temperature-sensitive scarlet eye colour mutant of Drosophila sophila white locus and some of its mutants. EMBO J. 3: 563- melanogaster. Biochem. Genet. 17: 149-158. 568. HOWELLS,A. J., and R. L. RYALL, 1975 A biochemical study of PIRROTTA,V., H. STELLERand M. P. BOZZETTI,1985 Multiple the scarlet eye colour of Drosophilamelanogaster. Biochem. upstream regulatory elements control the expression of the Genet. 13: 273-282. Drosophila white gene. EMBO J. 4: 3501-3508. LANGER-SAFER,P. R., M. LEVINEand D. WARD,1982 Im- REED,K. C., and D. MANN,1985 Rapid transfer ofDNA from munological method for mapping genes on Drosophila polytene agarose gels to nylon membranes. Nucleic Acids Res.13: 7207- chromosomes. Proc. Natl. Acad. Sci. USA 79: 4381-4385. 722 1. LEVIS,R., P.M. BINGHAMand G. M. RUBIN,1982 Physical map RYALL,R. L., and A. J. HOWELLS,1974 Ommochrome biosyn- of the white locus of D. melanogaster. Proc. Natl. Acad.Sci. thetic pathwayof Drosophilamelanogaster: Variations in the USA 79: 564-568. levels of enzyme activities and intermediates during adult de- LEVIS,R., K. O’HAREand G. M. RUBIN,1984 Effects of transpos- velopment. Insect Biochem. 6 135-142. able element insertions on RNA encoded by the white gene of SANGER,F., S. NICKLENand A. R. COULSEN,1977 DNA sequenc- Drosophila. Cell 38: 471-481. ing with chain-terminating inhibitors. Proc. Natl. Acad.Sci. LEVIS,R., T. HAZELRIGGand G. M. RUBIN, 1985 Separable cis- USA 74: 5463-5467. acting control elements for expression of the white gene of SULLIVAN,D. T., R. J. KITOS and M. C. SULLIVAN, Drosophila. EMBO J. 4: 3489-3499. 1973 Developmental and genetic studies on kynurenine hy- LINDSLEY,D. L.,and E. H. GRELL,1968 GeneticVariations of droxylase from Drosophila melanogaster. Genetics 75: 65 1-66 1. Drosophila melanogaster. Carnegie Inst. Wash. Publ. 627. SULLIVAN,D. T., and M. C. SULLIVAN,1975 Transport defects as LINDSLEY,D. L., and G. ZIMM, 1986 The genome of Drosophila the physiologicalbasis for eye color mutants of Drosophila melanogaster. Part 2: Lethals; maps. Drosophila Inform. Serv. melanogaster. Biochem. Genet. 13: 603-6 13. 64: 72-73. SULLIVAN,D. T., L. A. BELL,D. R. PATONand M. C. SULLIVAN, LINDSLEY,D. L., and G. ZIMM, 1987 The genome of Drosophila 1980 Genetic and functional analysis of tryptophan transport melanogaster. Part 3: Rearrangements. Drosophila Inform. inMalpighian tubules of Drosophila. Biochem. Genet. 18: Serv. 65: 48. 1109-1 130. MANIATIS,T., E. F. FRITSCHand J. SAMBROOK,1982 Molecular SUMMERS,K. M., A. J. Howmuand N. A. PYLIOTIS,1982 Biology Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, of eye pigmentation in insects. Adv. Insect Physiol. 16: 119- Cold Spring Harbor, N.Y. 166. MANIATIS,T., R. C. HARDISON,E. LACY,J. LAUER,C. O’CONNEL, TARTOF,K. D., 1969 Interacting gene systems: I. The regulation D. QUON,G. K. SIMand A. EFSTRADIATIS,1978 The isolation of tryptophan pyrrolase by the vermilion suppressor of vermilion of structural genes from libraries of eukaryotic DNA. Cell 15: system in Drosophila. Genetics 62: 781-795. 687-701. THOMAS,P. S., 1983 Hybridization of denatured RNA trans- MARIANI,C., V. PIRROTTAand E. MANET,1985 Isolation and ferred or dotted to nitrocellulose paper. Methods Enzymol. characterization of the zeste locus of Drosophila. EMBO J. 4: 100: 255-266. 204552052, VELISSARIOU,V., and M. ASHBURNER, 1981Cytogenetic and ge- MCKEOWN,M., J. M. BELOTEand B. S. BAKER, 1987 A molecular netic mapping of a salivary gland secretion protein in Drosophila analysis of transformer, a gene in Drosophila melanogaster that melanogaster. Chromosoma 84: 173-1 85. controls female sexual differentiation. Cell 48: 489-499. WALKER,A. R., A. J. HOWELLSand R. G. TEARLE,1986 Cloning MESSING,J,, 1983 New MI3 vectors for cloning. Methods En- and characterization of the vermilion gene of D. melanogaster. zymol. 101: 20-78. Mol. Gen. Genet. 202: 102-107. MIKLOS,G. L. G., M. J. HEALY,P. PAIN,A. J. HOWELLSand R. J. ZACHAR,Z., C. H. CHAPMANand P. M. BINGHAM, 1985 On the RUSSELL,1984 Molecular and genetic studies on the euchro- molecular basis of transvection effects and the regulation of transcription. Cold Spring Harbor Symp. Quant. Biol. 50337- matin-heterochromatin transition region of the X chromosome 346. of Drosophila melanogaster. I. A cloned entry point near to the uncoordinated locus. Chromosoma 89218-227. Communicating editor: V. G. FINNERTY