DOCSLIB.ORG

Contribution of Brain Pericytes in Blood–Brain Barrier Formation And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Contribution of Brain Pericytes in Blood–Brain Barrier Formation And Heymans et al. Fluids Barriers CNS (2020) 17:48 https://doi.org/10.1186/s12987-020-00208-1 Fluids and Barriers of the CNS RESEARCH Open Access Contribution of brain pericytes in blood– brain barrier formation and maintenance: a transcriptomic study of cocultured human endothelial cells derived from hematopoietic stem cells Marjolein Heymans1, Ricardo Figueiredo2,3, Lucie Dehouck1, David Francisco4, Yasuteru Sano5, Fumitaka Shimizu5, Takashi Kanda5, Rémy Bruggmann4, Britta Engelhardt6, Peter Winter2, Fabien Gosselet1 and Maxime Culot1* Abstract Formation, maintenance, and repair of the blood–brain barrier (BBB) are critical for central nervous system homeo- stasis. The interaction of endothelial cells (ECs) with brain pericytes is known to induce BBB characteristics in brain ECs during embryogenesis and can be used to diferentiate human ECs from stem cell source in in vitro BBB models. However, the molecular events involved in BBB maturation are not fully understood. To this end, human ECs derived from hematopoietic stem cells were cultivated with either primary bovine or cell line-derived human brain pericytes to induce BBB formation. Subsequently, the transcriptomic profles of solocultured vs. cocultured ECs were analysed over time by Massive Analysis of cDNA Ends (MACE) technology. This RNA sequencing method is a 3′-end targeted, tag-based, reduced representation transcriptome profling technique, that can reliably quantify all polyadenylated transcripts including those with low expression. By analysing the generated transcriptomic profles, we can explore the molecular processes responsible for the functional changes observed in ECs in coculture with brain pericytes (e.g. barrier tightening, changes in the expression of transporters and receptors). Our results identifed several up- and downregulated genes and signaling pathways that provide a valuable data source to further delineate complex molecular processes that are involved in BBB formation and BBB maintenance. In addition, this data provides a source to identify novel targets for central nervous system drug delivery strategies. Keywords: Blood–brain barrier1, Transcriptome2, BBB formation3, In vitro4, Central nervous system5, Brain endothelial cells6, Human hematopoietic stem cells7, Brain pericytes8 Background Brain capillary endothelial cells (ECs) display unique characteristics when compared to ECs from peripheral vasculature, e.g. tight junctions, low pinocytic activity, expression of metabolic enzymes, transporters, receptors *Correspondence: [email protected] 1 Laboratoire de la Barrière Hémato-Encéphalique (LBHE), Univ. Artois, UR and efux pumps [24]. Tese characteristics are known to 2465, 62300 Lens, France be the blood-brain barrier (BBB) phenotype which con- Full list of author information is available at the end of the article stitute the BBB [2, 11]. Te BBB is the interface between © The Author(s) 2020. This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creat iveco mmons .org/licen ses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creat iveco mmons .org/publi cdoma in/ zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Heymans et al. Fluids Barriers CNS (2020) 17:48 Page 2 of 28 the systemic circulation and the central nervous system system using the Massive Analysis of cDNA Ends and is essential to maintain brain homeostasis, thereby (MACE) technology. Tis RNA sequencing method is a restricting the entry of many pathogens, toxins and com- 3′-end targeted, tag-based, reduced representation tran- pounds into the brain [1]. Several of these brain capillary scriptome profling technique, that can reliably quantify EC characteristics mentioned above are demonstrated all polyadenylated transcripts including those with low not to be intrinsic to brain ECs, however, they result from expression. By analysing the generated transcriptomic the regulation of cellular and non-cellular factors pro- profles, we can explore the molecular processes respon- duced by diferent cell types of the neurovascular unit sible for the functional changes observed in ECs in cocul- (NVU), e.g. astrocytes, pericytes, neurons, neuroglia and ture with brain pericytes. peripheral immune cells [9, 11, 30]. Te specifc cross- To specifcally focus on the pericyte-EC interaction, talk between brain ECs and brain pericytes is known to we decomposed the model in either solo- or cocultured induce BBB characteristics (e.g. expression and func- ECs. Human ECs were cultivated (in a non-contact set- tionality of tight junction proteins, decreasing leukocyte up) with either human pericytes (CHP) or with bovine adhesion molecule expression, decreasing transcytosis brain pericytes (CBP). In both coculture conditions, the and induction of the basement membrane) in ECs dur- ECs display BBB characteristics like restrictive tight junc- ing embryogenesis in vivo [11, 30]. Pericytes are a type tions, low paracellular permeability to integrity mark- of vascular cells embedded in the basement membrane, ers and functional expression of polarized uptake and thereby they wrap the cerebral capillary walls, with a efux transporters [7]. We subsequently compared the pericyte coverage being the highest in neural tissue [30]. transcriptomic profle of cocultured ECs to the tran- Te latter implicates the importance of pericytes for scriptomic profle of solocultured ECs to delineate the BBB functioning, which is as well indicated by studies transcriptional changes occurring in the ECs during bar- that relate pericytes to barrier function and regulation rier establishment. Besides the transcriptomic data, BBB of infammatory responses [9, 22]. Te pericyte-brain EC functions were assessed by drug accumulation and per- interaction is also used to diferentiate ECs from stem cell meability studies to preliminary validate the physiological source to human brain-like ECs which are used in in vitro relevance of the used in vitro model. BBB models [7, 21, 23, 36]. Tese in vitro models should Transcriptomic profling was done using high-through- display barrier tightening, i.e. induced by coculture, in put mRNA sequencing in combination with the digital order to be of use for pharmaceutical screening. How- gene expression profling technique of GenXPro (Frank- ever, the underlying molecular events involved in devel- furt am Main, Germany), the MACE technology. MACE opment, maturation and maintenance of BBB features, performs gene expression profling by sequencing part of are not fully understood and difcult to study in vivo, the 3′-end of mRNA transcripts. Since each sequenced especially in humans. In particular, the BBB regulation read represents one single mRNA molecule, the MACE related to the communication between pericytes and technique can accurately quantify polyadenylated tran- brain ECs remains largely unknown [5, 15, 22]. scripts using a considerably lower sequencing depth than In the present study, we make use of a human in vitro that of standard RNA-sequencing protocols, for which BBB model developed by Cecchelli et al. [7] consisting in the number of fragments per transcript depends on the ECs derived from hematopoietic stem cells which are co- length of the transcript. cultivated with brain pericytes. After 5 days of coculture Our results provide a transcriptomic landscape of with brain pericytes, the ECs were shown to display fea- human brain-like ECs in solo- or coculture with brain tures of the BBB which were absent when the cells were pericytes that was used to identify interesting gene pro- cultivated alone: the co-cultivated ECs display a continu- fles over time, soloculture enriched transcripts, cocul- ous expression of ZO-1, occludin, JAM-A, claudin-1 and ture enriched transcripts, etc., which might prove to be claudin-5 at cell–cell contacts resulting in a lower perme- valuable in the further delineation of complex molecular ability to non-permeant marker than when the cells were processes involved in BBB formation and regulation. Te solocultivated. Tese cocultivated ECs also express sev- transcriptomic profle could also be used as a source for eral transporters typically observed in brain endothelium novel targets for central nervous system drug delivery in vivo (e.g. ABCB1 and ABCG2) [7]. strategies. To study the molecular processes responsible for the observed changes in ECs (i.e. barrier tightening, changes Materials and methods in the expression of transporters and receptors) in cocul- Compounds −1 ture with brain pericytes of ECs derived from hematopoi- Te compounds lucifer yellow (LY; Mw = 457.25 g mol ), −1 etic stem cells cultivated with brain pericytes from either rhodamine 123 (R123; Mw = 380.82 g mol ) and −1 primary bovine or cell line human origin in a Transwell
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Chromosome Level Genome of Astyanax Mexicanus Surface Fish for Comparing Population
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.06.189654; this version posted July 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title 2 A chromosome level genome of Astyanax mexicanus surface fish for comparing population- 3 specific genetic differences contributing to trait evolution. 4 5 Authors 6 Wesley C. Warren1, Tyler E. Boggs2, Richard Borowsky3, Brian M. Carlson4, Estephany 7 Ferrufino5, Joshua B. Gross2, LaDeana Hillier6, Zhilian Hu7, Alex C. Keene8, Alexander Kenzior9, 8 Johanna E. Kowalko5, Chad Tomlinson10, Milinn Kremitzki10, Madeleine E. Lemieux11, Tina 9 Graves-Lindsay10, Suzanne E. McGaugh12, Jeff T. Miller12, Mathilda Mommersteeg7, Rachel L. 10 Moran12, Robert Peuß9, Edward Rice1, Misty R. Riddle13, Itzel Sifuentes-Romero5, Bethany A. 11 Stanhope5,8, Clifford J. Tabin13, Sunishka Thakur5, Yamamoto Yoshiyuki14, Nicolas Rohner9,15 12 13 Authors for correspondence: Wesley C. Warren ([email protected]), Nicolas Rohner 14 ([email protected]) 15 16 Affiliation 17 1Department of Animal Sciences, Department of Surgery, Institute for Data Science and 18 Informatics, University of Missouri, Bond Life Sciences Center, Columbia, MO 19 2 Department of Biological Sciences, University of Cincinnati, Cincinnati, OH 20 3 Department of Biology, New York University, New York, NY 21 4 Department of Biology, The College of Wooster, Wooster, OH 22 5 Harriet L. Wilkes Honors College, Florida Atlantic University, Jupiter FL 23 6 Department of Genome Sciences, University of Washington, Seattle, WA 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.06.189654; this version posted July 6, 2020.
    [Show full text]
  • WO 2014/210448 Al 31 December 2014 (31.12.2014) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2014/210448 Al 31 December 2014 (31.12.2014) P O P C T (51) International Patent Classification: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, A61K 45/00 (2006.01) C12N 15/09 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, A61K 48/00 (2006.01) HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2014/044554 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, 27 June 2014 (27.06.2014) TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, 61/840,21 1 27 June 2013 (27.06.2013) US UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, (71) Applicant: THE BOARD OF REGENTS OF THE UNI¬ EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, VERSITY OF TEXAS SYSTEM [US/US]; 201 W.
    [Show full text]
  • The Kinesin Spindle Protein Inhibitor Filanesib Enhances the Activity of Pomalidomide and Dexamethasone in Multiple Myeloma
    Plasma Cell Disorders SUPPLEMENTARY APPENDIX The kinesin spindle protein inhibitor filanesib enhances the activity of pomalidomide and dexamethasone in multiple myeloma Susana Hernández-García, 1 Laura San-Segundo, 1 Lorena González-Méndez, 1 Luis A. Corchete, 1 Irena Misiewicz- Krzeminska, 1,2 Montserrat Martín-Sánchez, 1 Ana-Alicia López-Iglesias, 1 Esperanza Macarena Algarín, 1 Pedro Mogollón, 1 Andrea Díaz-Tejedor, 1 Teresa Paíno, 1 Brian Tunquist, 3 María-Victoria Mateos, 1 Norma C Gutiérrez, 1 Elena Díaz- Rodriguez, 1 Mercedes Garayoa 1* and Enrique M Ocio 1* 1Centro Investigación del Cáncer-IBMCC (CSIC-USAL) and Hospital Universitario-IBSAL, Salamanca, Spain; 2National Medicines Insti - tute, Warsaw, Poland and 3Array BioPharma, Boulder, Colorado, USA *MG and EMO contributed equally to this work ©2017 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2017.168666 Received: March 13, 2017. Accepted: August 29, 2017. Pre-published: August 31, 2017. Correspondence: [email protected] MATERIAL AND METHODS Reagents and drugs. Filanesib (F) was provided by Array BioPharma Inc. (Boulder, CO, USA). Thalidomide (T), lenalidomide (L) and pomalidomide (P) were purchased from Selleckchem (Houston, TX, USA), dexamethasone (D) from Sigma-Aldrich (St Louis, MO, USA) and bortezomib from LC Laboratories (Woburn, MA, USA). Generic chemicals were acquired from Sigma Chemical Co., Roche Biochemicals (Mannheim, Germany), Merck & Co., Inc. (Darmstadt, Germany). MM cell lines, patient samples and cultures. Origin, authentication and in vitro growth conditions of human MM cell lines have already been characterized (17, 18). The study of drug activity in the presence of IL-6, IGF-1 or in co-culture with primary bone marrow mesenchymal stromal cells (BMSCs) or the human mesenchymal stromal cell line (hMSC–TERT) was performed as described previously (19, 20).
    [Show full text]
  • Identification of Genomic Targets of Krüppel-Like Factor 9 in Mouse Hippocampal
    Identification of Genomic Targets of Krüppel-like Factor 9 in Mouse Hippocampal Neurons: Evidence for a role in modulating peripheral circadian clocks by Joseph R. Knoedler A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Neuroscience) in the University of Michigan 2016 Doctoral Committee: Professor Robert J. Denver, Chair Professor Daniel Goldman Professor Diane Robins Professor Audrey Seasholtz Associate Professor Bing Ye ©Joseph R. Knoedler All Rights Reserved 2016 To my parents, who never once questioned my decision to become the other kind of doctor, And to Lucy, who has pushed me to be a better person from day one. ii Acknowledgements I have a huge number of people to thank for having made it to this point, so in no particular order: -I would like to thank my adviser, Dr. Robert J. Denver, for his guidance, encouragement, and patience over the last seven years; his mentorship has been indispensable for my growth as a scientist -I would also like to thank my committee members, Drs. Audrey Seasholtz, Dan Goldman, Diane Robins and Bing Ye, for their constructive feedback and their willingness to meet in a frequently cold, windowless room across campus from where they work -I am hugely indebted to Pia Bagamasbad and Yasuhiro Kyono for teaching me almost everything I know about molecular biology and bioinformatics, and to Arasakumar Subramani for his tireless work during the home stretch to my dissertation -I am grateful for the Neuroscience Program leadership and staff, in particular
    [Show full text]
  • Continuously Active Transcriptional Programs Are Required to Build Expansive Serotonergic Axon Architectures
    CONTINUOUSLY ACTIVE TRANSCRIPTIONAL PROGRAMS ARE REQUIRED TO BUILD EXPANSIVE SEROTONERGIC AXON ARCHITECTURES By LAUREN JANINE DONOVAN Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Advisor: Evan S. Deneris Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY January 2020 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Lauren Janine Donovan candidate for the degree of Doctor of Philosophy*. Committee Chair Jerry Silver, Ph.D. Committee Member Evan Deneris, Ph.D. Committee Member Heather Broihier, Ph.D. Committee Member Ron Conlon, Ph.D. Committee Member Pola Philippidou, Ph.D. Date of Defense August 29th, 2019 *We also certify that written approval has been obtained for any proprietary material contained therein. ii TABLE OF CONTENTS List of Figures……………………………………………………………………….….vii Abstract………………………………………….………………………………..….…1 CHAPTER 1. INTRODUCTION………………………………………………...……..3 GENERAL INTRODUCTION TO SEROTONIN………………………………….….4 Serotonin: Discovery and function………………………….……………...4 Serotonin Biosynthesis…………………………..…………………………..6 Manipulation of the serotonin system in humans……………………….6 Human mutations in 5-HT related genes………………………………….9 SEROTONIN NEURON NEUROGENESIS……………..………………………….11 5-HT neuron specification……………..………………………………...…11 Development of 5-HT neurons……………..………………………………13 NEUROANATOMY……………..……………………………………………………..13 Cytoarchitecture ……………..………………………………………………13 Adult Ascending 5-HT axon projection system ………………………..14
    [Show full text]
  • Association of Germline Variation with the Survival of Women with BRCA1/2 Pathogenic Variants and Breast Cancer ✉ Taru A
    www.nature.com/npjbcancer ARTICLE OPEN Association of germline variation with the survival of women with BRCA1/2 pathogenic variants and breast cancer ✉ Taru A. Muranen 1 ,Sofia Khan1,2, Rainer Fagerholm1, Kristiina Aittomäki3, Julie M. Cunningham 4, Joe Dennis 5, Goska Leslie 5, Lesley McGuffog5, Michael T. Parsons 6, Jacques Simard 7, Susan Slager8, Penny Soucy7, Douglas F. Easton 5,9, Marc Tischkowitz10,11, Amanda B. Spurdle 6, kConFab Investigators*, Rita K. Schmutzler12,13, Barbara Wappenschmidt12,13, Eric Hahnen12,13, Maartje J. Hooning14, HEBON Investigators*, Christian F. Singer15, Gabriel Wagner15, Mads Thomassen16, Inge Sokilde Pedersen 17,18, Susan M. Domchek19, Katherine L. Nathanson 19, Conxi Lazaro 20, Caroline Maria Rossing21, Irene L. Andrulis 22,23, Manuel R. Teixeira 24,25, Paul James 26,27, Judy Garber28, Jeffrey N. Weitzel 29, SWE-BRCA Investigators*, Anna Jakubowska 30,31, Drakoulis Yannoukakos 32, Esther M. John33, Melissa C. Southey34,35, Marjanka K. Schmidt 36,37, Antonis C. Antoniou5, Georgia Chenevix-Trench6, Carl Blomqvist38,39 and Heli Nevanlinna 1 Germline genetic variation has been suggested to influence the survival of breast cancer patients independently of tumor pathology. We have studied survival associations of genetic variants in two etiologically unique groups of breast cancer patients, the carriers of germline pathogenic variants in BRCA1 or BRCA2 genes. We found that rs57025206 was significantly associated with the overall survival, predicting higher mortality of BRCA1 carrier patients with estrogen receptor-negative breast cancer, with a hazard ratio 4.37 (95% confidence interval 3.03–6.30, P = 3.1 × 10−9). Multivariable analysis adjusted for tumor characteristics suggested that rs57025206 was an independent survival marker.
    [Show full text]
  • Myoblast Fusion Confusion: the Resolution Begins Srihari C
    Sampath et al. Skeletal Muscle (2018) 8:3 DOI 10.1186/s13395-017-0149-3 REVIEW Open Access Myoblast fusion confusion: the resolution begins Srihari C. Sampath1,2*, Srinath C. Sampath1,2* and Douglas P. Millay3,4* Abstract The fusion of muscle precursor cells is a required event for proper skeletal muscle development and regeneration. Numerous proteins have been implicated to function in myoblast fusion; however, the majority are expressed in diverse tissues and regulate numerous cellular processes. How myoblast fusion is triggered and coordinated in a muscle-specific manner has remained a mystery for decades. Through the discovery of two muscle-specific fusion proteins, Myomaker and Myomerger–Minion, we are now primed to make significant advances in our knowledge of myoblast fusion. This article reviews the latest findings regarding the biology of Myomaker and Minion–Myomerger, places these findings in the context of known pathways in mammalian myoblast fusion, and highlights areas that require further investigation. As our understanding of myoblast fusion matures so does our potential ability to manipulate cell fusion for therapeutic purposes. Keywords: Myoblast fusion, Myomaker, Myomerger, Minion, Muscle development Background and therefore, methods to dominantly reconstitute fusion Muscle formation occurs during several stages of an organ- and dissect its mechanisms were nonexistent. ism’s life, including embryonic development, and growth Plasma membrane fusion is a complex process that re- and regeneration in the adult. Proper myogenesis begins quires recognition, adhesion, cell signaling, cytoskeletal al- through specification of precursor cells to the myoblast terations, and membrane rearrangements. Current lineage, followed by differentiation, both of which are evidence, reviewed elsewhere, implicates numerous pro- accomplished by the muscle-specific transcription factors teins and regulatory pathways in the recognition, adhesion, MyoD and Myogenin [1, 2].
    [Show full text]
  • UC Merced Electronic Theses and Dissertations
    UC Merced UC Merced Electronic Theses and Dissertations Title High-throughput Analysis of WNT Signaling Pathway in Osteoblasts Permalink https://escholarship.org/uc/item/8b48d5hn Author Sebastian, Aimy Publication Date 2016 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, MERCED High-throughput Analysis of WNT Signaling Pathway in Osteoblasts A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Quantitative and Systems Biology by Aimy Sebastian Committee in charge: Dr. Suzanne S. Sindi, Chair Dr. David H. Ardell Dr. Gabriela G. Loots Dr. Jennifer O. Manilay 2016 Copyright Aimy Sebastian, 2016 All rights reserved The Dissertation of Aimy Sebastian is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Gabriela G. Loots Jennifer O. Manilay David H. Ardell Suzanne S. Sindi, Chair Date University of California, Merced 2016 iii Table of Contents Signature Page ..................................................................................................................... iii Table of Contents ................................................................................................................. iv List of Figures ...................................................................................................................... vi List of Tables ....................................................................................................................
    [Show full text]
  • Supplementary Information
    SUPPLEMENTARY INFORMATION 1. SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Long-term exposure to sorafenib increases the expression of progenitor cell-like features. A) mRNA expression levels of PROM-1 (CD133), THY-1 (CD90), EpCAM, KRT19, and VIM assessed by quantitative real-time PCR. Data represent the mean expression value for a gene in each phenotypic type of cells, displayed as fold-changes normalized to 1 (expression value of its corresponding parental non-treated cell line). Expression level is relative to the GAPDH gene. Bars indicate standard deviation. Significant statistical differences are set at p<0.05. B) Immunocitochemical staining of CD90 and vimentin in Hep3B sorafenib resistant cell line and its parental cell line. C) Western blot analysis comparing protein levels in resistant Hu6 and Hep3B cells vs their corresponding parental cells lines. Supplementary Figure 2. Efficacy of gene silencing of IGF1R and FGFR1 and evaluation of MAPK14 signaling activation. IGF1R and FGFR1 knockdown expression 48h after transient transfection with siRNAs (50 nM), in non-treated parental cells and sorafenib-acquired resistant tumor derived cells was assessed by quantitative RT-PCR (A) and western blot (B). C) Activation status of MAPK14 signaling was evaluated by western blot analysis in vivo, in tumors with acquired resistance to sorafenib in comparison to non-treated tumors (right panel), as well as in in vitro, in sorafenib resistant cell lines vs parental non-treated. Supplementary Figure 3. Gene expression levels of several pro-angiogenic factors. mRNA expression levels of FGF1, FGF2, VEGFA, IL8, ANGPT2, KDR, FGFR3, FGFR4 assessed by quantitative real-time PCR in tumors harvested from mice.
    [Show full text]
  • Systems Genetics in Polygenic Autoimmune Diseases
    From the Institute of Experimental Dermatology Director: Prof. Saleh Ibrahim Systems genetics in polygenic autoimmune diseases Dissertation for Fulfillment of Requirements for the Doctoral Degree of the University of Lübeck from the Department of Medicine Submitted by Yask Gupta from New-Delhi, India Lübeck 2015 i First referee:- Prof. Dr. med Saleh Ibrahim Second referee:- Prof. Dr. rer. nat. Jeanette Erdman Chairman:- Prof. Dr. Horst-Werner Stüzbecher Data of oral examination:- 7 June 2016 ii iii Contents 1. Introduction 9 1.1 Autoimmune diseases 3 1.2 Autoimmune bullous diseases 4 1.3 Epidermolysis bullosa acquisita (EBA): an autoantibody-mediated autoimmune skin disease 5 1.4 Role of miRNA in autoimmune diseases 5 1.5 Genes in autoimmune diseases 7 1.6 Gene networks 8 1.6.1 Gene/Protein interaction database 9 1.6.2 Ab intio prediction of gene networks 11 1.7 QTL and expression QTL 12 1.8. Prediction of ncRNA 13 1.8.1 Support vector machine and random forest 15 1.9. Structure of the thesis 18 2. Aims of the thesis 21 3. Materials and methods 23 3.1 Generation of a four way advanced intercross line 23 iv 3.2 Experimental EBA and observation protocol 24 3.2.1 Generation of recombinant peptides 24 3.3 Extraction of genomic DNA for genotypic analysis 25 3.4 Generation of microarray data (miRNAs/genes) and bioinformatics analysis 25 3.5 Software for Expression QTL analysis 26 3.5.1 HAPPY 27 3.5.2 EMMA 28 3.5.3 Implementation of software for expression QTL mapping 30 3.6 Ab initio Gene and microRNAs networks prediction 31 3.6.1 MicroRNAs 32 3.6.2 Genes 33 3.6.3 MicroRNAs gene target prediction 34 3.7 Visualization of interaction networks 35 3.8 Network databases (STRING and IPA) 36 3.9 Prediction of ncRNA tools 37 3.9.1 Dataset 38 3.9.2 Features for classification 39 3.9.3 Classification system 41 v 3.9.4 Implementation of support vector machines and random forest on the post transcriptional non coding RNA dataset 42 3.9.5 Work flow and output of ptRNApred 45 4.
    [Show full text]