DOCSLIB.ORG

UC Merced Electronic Theses and Dissertations

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
UC Merced Electronic Theses and Dissertations UC Merced UC Merced Electronic Theses and Dissertations Title High-throughput Analysis of WNT Signaling Pathway in Osteoblasts Permalink https://escholarship.org/uc/item/8b48d5hn Author Sebastian, Aimy Publication Date 2016 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, MERCED High-throughput Analysis of WNT Signaling Pathway in Osteoblasts A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Quantitative and Systems Biology by Aimy Sebastian Committee in charge: Dr. Suzanne S. Sindi, Chair Dr. David H. Ardell Dr. Gabriela G. Loots Dr. Jennifer O. Manilay 2016 Copyright Aimy Sebastian, 2016 All rights reserved The Dissertation of Aimy Sebastian is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Gabriela G. Loots Jennifer O. Manilay David H. Ardell Suzanne S. Sindi, Chair Date University of California, Merced 2016 iii Table of Contents Signature Page ..................................................................................................................... iii Table of Contents ................................................................................................................. iv List of Figures ...................................................................................................................... vi List of Tables ..................................................................................................................... viii Acknowledgements .............................................................................................................. ix VITA ..................................................................................................................................... x Abstract .............................................................................................................................. xiii Chapter 1: Introduction ........................................................................................................ 1 1.1. WNT proteins ................................................................................................................. 1 1.2. WNT signaling pathways ............................................................................................... 2 1.3. Overview of bone development and metabolism ........................................................... 5 1.4. WNT signaling in bone development and homeostasis ............................................... 10 1.5. Objectives of the study ................................................................................................. 23 Chapter 2: High-throughput Sequencing to Study Gene Expression and Gene Regulation ............................................................................................................................ 27 2.1. Introduction .................................................................................................................. 27 2.2 High-throughput sequencing technologies ................................................................... 27 2.3. Profiling gene expression changes with RNA-seq ...................................................... 28 2.4. Studying transcription regulation with ChIP-seq ........................................................ 37 2.5. Summary ...................................................................................................................... 41 Chapter 3: WNT Co-receptors LRP5 and LRP6 Differentially Mediate WNT3A Signaling in Osteoblasts ........................................................................................ 43 3.1. Introduction .................................................................................................................. 43 3.2. Methods ........................................................................................................................ 43 3.3. Results ......................................................................................................................... 46 3.4. Discussion ................................................................................................................... 57 iv Chapter 4: Integrative Analysis of ChIP-seq and RNA-seq Experiments Identifies WNT3A Inducible Regulatory Elements in Osteoblasts ...................................97 4.1. Introduction ................................................................................................................97 4.2. Methods ......................................................................................................................98 4.3. Results ......................................................................................................................100 4.4. Discussion ................................................................................................................106 Chapter 5: WNT16 Regulates the Expression of Canonical and Non-canonical WNT Targets in Osteoblasts ............................................................................................121 5.1. Introduction ..............................................................................................................121 5.2. Methods ....................................................................................................................122 5.3. Results ......................................................................................................................123 5.4. Discussion ................................................................................................................129 Chapter 6: Conclusion......................................................................................................148 References .......................................................................................................................151 v List of Figures 1. Figure 1.1: Dendrogram of mouse WNT proteins ...................................................1 2. Figure 1.2: Canonical WNT signaling ....................................................................3 3. Figure 1.3: Non-canonical WNT pathways .............................................................4 4. Figure 1.4: Structure of a long bone ........................................................................6 5. Figure 1.5: Osteoblast differentiation ......................................................................7 6. Figure 1.6: Bone formation ......................................................................................8 7. Figure 1.7: Bone remodeling ...................................................................................9 8. Figure 1.8: Osteoporotic bone ................................................................................10 9. Figure 1.9: Cell type specific promoters commonly used to drive transgene or Cre-recombinase expression in rodent animal models ......................................11 10. Figure 2.1: Fastq file format ..................................................................................29 11. Figure 2.2: RNA-seq data analysis workflow ........................................................30 12. Figure 2.3: Low and high quality RNA-seq data ...................................................31 13. Figure 2.4: Read mapping ......................................................................................33 14. Figure 2.5: RNA-seq data before and after filtering ..............................................34 15. Figure 2.6: RNA-seq data before and after normalization .....................................35 16. Figure 2.7: Heatmap representation of differentially expressed genes ..................36 17. Figure 2.8: ChIP-seq experimental workflow ........................................................38 18. Figure 2.9: Enhancers ............................................................................................39 19. Figure 2.10: Osteoblast enhancers .........................................................................41 20. Figure 3.1: Experimental design ............................................................................47 21. Figure 3.2: qPCR analysis of known WNT targets................................................48 22. Figure 3.3: Enriched GO terms associated with WNT3A targets ..........................49 23. Figure 3.4: Expression profiles of WNT3A targets during the differentiation of early pre-osteoblast to mature osteoblasts (Day 2 to Day 18) ...........................51 24. Figure 3.5: Osteoblast proliferation assay .............................................................52 25. Figure 3.6: Calvarial injection ...............................................................................53 26. Figure 3.7: Histology and µ-CT data .....................................................................54 27. Figure 3.8: Venn diagrams of sets of genes differentially expressed in Lrp5-/-, Lrp6-/- and Lrp5-/-;Lrp6-/- osteoblasts compared to respective controls .....56 28. Figure 3.9: Venn diagrams of significantly differentially expressed genes in WNT3A-treated WT, Lrp5-/-, Lrp6-/- and Lrp5-/-;Lrp6-/- osteoblasts. ................57 29. Figure 4.1: TCF/LEF binding sites in Axin2 promoter .......................................101 30. Figure 4.2: Distribution of overlapping H3K4me1 and H3K27ac peaks ............102 31. Figure 4.3: Overlapping H3K4me1 and H3K27ac peaks ....................................102
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • MDR-1, Bcl-Xl, H. Pylori, and Wnt&Sol;Β-Catenin Signalling in the Adult Stomach
    Laboratory Investigation (2012) 92, 1670–1673 & 2012 USCAP, Inc All rights reserved 0023-6837/12 $32.00 EDITORIAL MDR-1, Bcl-xL, H. pylori, and Wnt/b-catenin signalling in the adult stomach: how much is too much? R John MacLeod Laboratory Investigation (2012) 92, 1670–1673; doi:10.1038/labinvest.2012.151 ultiple drug resistance (MDR) is a interaction between the antiapoptotic protein major cause of failure of che- Bcl-xL and MDR-1. Knockdown of MDR-1 motherapy in cancer treatment. increases the apoptotic index of these cells exposed The membrane transporter P-gly- to oxidative stress consistent with a role for MDR- coprotein (MDR-1, Pgp) encoded 1 in apoptosis. Several questions emerge from Mby the adenosine triphosphate-binding cassette, these findings. The first is why is MDR-1 increased subfamily B, member 1 is the main mechanism for in some HP-positive mucosa but in 100% of the decreased intracellular drug accumulation in MDR intestinal metaplasia samples? A likely causative cancer.1 Increases in Mdr-1 expression prevent effector of the increase in MDR-1 is the activation tumor cells from a variety of induced apoptosis, of canonical or Wnt/b-catenin signaling. It has but how this occurs is poorly understood. It is been known for a dozen years that the MDR-1 essential to understand how this occurs to be able gene may be stimulated by Tcf4.4 Yamada et al4 to design effective therapeutic interventions. The clearly demonstrated the presence of Tcf4 sites on study by Rocco et al2 (this issue) clearly shows that the MDR-1 promoter and showed that MDR-1 in the mitochondria of gastric cancer cell lines protein had substantially increased in adenomas MDR1 physically interacts with Bcl-xL, a well- and colon cancer.
    [Show full text]
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • List of Genes Used in Cell Type Enrichment Analysis
    List of genes used in cell type enrichment analysis Metagene Cell type Immunity ADAM28 Activated B cell Adaptive CD180 Activated B cell Adaptive CD79B Activated B cell Adaptive BLK Activated B cell Adaptive CD19 Activated B cell Adaptive MS4A1 Activated B cell Adaptive TNFRSF17 Activated B cell Adaptive IGHM Activated B cell Adaptive GNG7 Activated B cell Adaptive MICAL3 Activated B cell Adaptive SPIB Activated B cell Adaptive HLA-DOB Activated B cell Adaptive IGKC Activated B cell Adaptive PNOC Activated B cell Adaptive FCRL2 Activated B cell Adaptive BACH2 Activated B cell Adaptive CR2 Activated B cell Adaptive TCL1A Activated B cell Adaptive AKNA Activated B cell Adaptive ARHGAP25 Activated B cell Adaptive CCL21 Activated B cell Adaptive CD27 Activated B cell Adaptive CD38 Activated B cell Adaptive CLEC17A Activated B cell Adaptive CLEC9A Activated B cell Adaptive CLECL1 Activated B cell Adaptive AIM2 Activated CD4 T cell Adaptive BIRC3 Activated CD4 T cell Adaptive BRIP1 Activated CD4 T cell Adaptive CCL20 Activated CD4 T cell Adaptive CCL4 Activated CD4 T cell Adaptive CCL5 Activated CD4 T cell Adaptive CCNB1 Activated CD4 T cell Adaptive CCR7 Activated CD4 T cell Adaptive DUSP2 Activated CD4 T cell Adaptive ESCO2 Activated CD4 T cell Adaptive ETS1 Activated CD4 T cell Adaptive EXO1 Activated CD4 T cell Adaptive EXOC6 Activated CD4 T cell Adaptive IARS Activated CD4 T cell Adaptive ITK Activated CD4 T cell Adaptive KIF11 Activated CD4 T cell Adaptive KNTC1 Activated CD4 T cell Adaptive NUF2 Activated CD4 T cell Adaptive PRC1 Activated
    [Show full text]
  • Finding Drug Targeting Mechanisms with Genetic Evidence for Parkinson’S Disease
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.24.208975; this version posted July 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Finding drug targeting mechanisms with genetic evidence for Parkinson’s disease Catherine S. Storm1,*, Demis A. Kia1, Mona Almramhi1, Sara Bandres-Ciga2, Chris Finan3, Aroon D. Hingorani3,4,5, International Parkinson’s Disease Genomics Consortium (IPDGC), Nicholas W. Wood1,6,* 1 Department of Clinical and Movement Neurosciences, University College London Queen Square Institute of Neurology, London, WC1N 3BG, United Kingdom 2 Molecular Genetics Section, Laboratory of Neurogenetics, National Institute on Aging, National Institutes of Health, Bethesda, MD 20892, United States of America 3 Institute of Cardiovascular Science, Faculty of Population Health, University College London, London WC1E 6BT, United Kingdom 4 University College London British Heart Foundation Research Accelerator Centre, New Delhi, India 5 Health Data Research UK, 222 Euston Road, London, United Kingdom 6 Lead Contact * Correspondence: [email protected] (CSS), [email protected] (NWW) Summary Parkinson’s disease (PD) is a neurodegenerative movement disorder that currently has no disease-modifying treatment, partly owing to inefficiencies in drug target identification and validation using human evidence. Here, we use Mendelian randomization to investigate more than 3000 genes that encode druggable proteins, seeking to predict their efficacy as drug targets for PD. We use expression and protein quantitative trait loci for druggable genes to mimic exposure to medications, and we examine the causal effect on PD risk (in two large case-control cohorts), PD age at onset and progression.
    [Show full text]
  • FTY720P Upregulates the Na+/K+ Atpase in Hepg2 Cells by Activating S1PR3 and Inducing PGE2 Release
    Cellular Physiology Cell Physiol Biochem 2019;53:518-531 DOI: 10.33594/00000015510.33594/000000155 © 2019 The Author(s).© 2019 Published The Author(s) by and Biochemistry Published online: 11 SeptemberSeptember 20192019 Cell Physiol BiochemPublished Press GmbH&Co. by Cell Physiol KG Biochem 518 + + Press GmbH&Co. KG, Duesseldorf ChakkourAccepted: 5et September al.: FTY720-P 2019 Upregulates Na /K Atpase www.cellphysiolbiochem.com This article is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 Interna- tional License (CC BY-NC-ND). Usage and distribution for commercial purposes as well as any distribution of modified material requires written permission. Original Paper FTY720P Upregulates the Na+/K+ ATPase in HepG2 Cells by Activating S1PR3 and Inducing PGE2 Release Mohamed Chakkour Sawsan Kreydiyyeh Department of Biology, Faculty of Arts & Sciences, American University of Beirut, Beirut, Lebanon Key Words FTY720-P • Na+/K+ATPase • HepG2 • PKC • ERK • PGE2 Abstract Background/Aims: Liver regeneration is induced by S1P and accompanied with an increase in hepatic Na+/K+ ATPase activity, suggesting a potential modulatory role of the sphingolipid on the ATPase activity. The ability of S1P to alter the ATPase activity was confirmed in a previous work which showed a time dependent effect, with an inhibition appearing at 15min and a stimulation at two hours. The aim of this work was to investigate if FTY720-P, an analogue of S1P used in the treatment of multiple sclerosis, exerts a similar effect at 2 hours. Methods: HepG2 cells were treated with FTY720-P for two hours and the activity of the Na+/K+ ATPase was assayed by measuring the amount of inorganic phosphate liberated in presence and absence of ouabain.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Edinburgh Research Explorer
    Edinburgh Research Explorer International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list Citation for published version: Davenport, AP, Alexander, SPH, Sharman, JL, Pawson, AJ, Benson, HE, Monaghan, AE, Liew, WC, Mpamhanga, CP, Bonner, TI, Neubig, RR, Pin, JP, Spedding, M & Harmar, AJ 2013, 'International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list: recommendations for new pairings with cognate ligands', Pharmacological reviews, vol. 65, no. 3, pp. 967-86. https://doi.org/10.1124/pr.112.007179 Digital Object Identifier (DOI): 10.1124/pr.112.007179 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Pharmacological reviews Publisher Rights Statement: U.S. Government work not protected by U.S. copyright General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct. 2021 1521-0081/65/3/967–986$25.00 http://dx.doi.org/10.1124/pr.112.007179 PHARMACOLOGICAL REVIEWS Pharmacol Rev 65:967–986, July 2013 U.S.
    [Show full text]
  • Supplementary Data
    Supplemental Data A novel mouse model of X-linked nephrogenic diabetes insipidus: Phenotypic analysis and therapeutic implications Jian Hua Li, Chung-Lin Chou, Bo Li, Oksana Gavrilova, Christoph Eisner, Jürgen Schnermann, Stasia A. Anderson, Chu-Xia Deng, Mark A. Knepper, and Jürgen Wess Supplemental Methods Metabolic cage studies. Animals were maintained in mouse metabolic cages (Hatteras Instruments, Cary, NC) under controlled temperature and light conditions (12 hr light and dark cycles). Mice received a fixed daily ration of 6.5 g of gelled diet per 20 g of body weight per day. The gelled diet was composed of 4 g of Basal Diet 5755 (Test Diet, Richmond, IN), 2.5 ml of deionized water, and 65 mg agar. Preweighted drinking water was provided ad libitum during the course of the study. Mice were acclimated in the metabolic cages for 1-2 days. Urine was collected under mineral oil in preweighted collection vials for successive 24 hr periods. Analysis of GPCR expression in mouse IMCD cells via TaqMan real-time qRT-PCR. Total RNA prepared from mouse IMCD tubule suspensions was reverse transcribed as described under Experimental Procedures. Tissues from ten 10-week old C57BL/6 WT mice were collected and pooled for each individual experiment. cDNA derived from 640 ng of RNA was mixed with an equal volume of TaqMan gene expression 2 x master mix (Applied Biosystems, Foster City, CA). 100 μl-aliquots of this mixture (corresponding to 80 ng of RNA) were added to each of the 8 fill ports of a 384-well plate of a mouse GPCR array panel (Applied Biosystems).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Targeting the Tryptophan Hydroxylase 2 Gene for Functional Analysis in Mice and Serotonergic Differentiation of Embryonic Stem Cells
    TARGETING THE TRYPTOPHAN HYDROXYLASE 2 GENE FOR FUNCTIONAL ANALYSIS IN MICE AND SEROTONERGIC DIFFERENTIATION OF EMBRYONIC STEM CELLS Inaugural-Dissertation to obtain the academic degree Doctor rerum naturalium (Dr. rer. nat.) submitted to the Department of Biology, Chemistry and Pharmacy of Freie Universität Berlin by Dana Kikic, M.Sc. in Molecular biology and Physiology from Nis June, 2009 The doctorate studies were performed in the research group of Prof. Michael Bader Molecular Biology of Peptide Hormones at Max-Delbrück-Center for Molecular Medicine in Berlin, Buch Mai 2005 - September 2008. 1st Reviewer: Prof. Michael Bader 2nd Reviewer: Prof. Udo Heinemann date of defence: 13. August 2009 ACKNOWLEDGMENTS Herewith, I would like to acknowledge the persons who made this thesis possible and without whom my initiation in the world of basic science research would not have the spin it has now, neither would my scientific illiteracy get the chance to eradicate. I am expressing my very personal gratitude and recognition to: Prof. Michael Bader, for an inexhaustible guidance in all the matters arising during the course of scientific work, for an instinct in defining and following the intellectual challenge and for letting me following my own, for necessary financial support, for defining the borders of reasonable and unreasonable, for an invaluable time and patience, and an amazing efficiency in supporting, motivating, reading, correcting and shaping my scientific language during the last four years. Prof. Harald Saumweber and Prof. Udo Heinemann, for taking over the academic supervision of the thesis, and for breathing in it a life outside the laboratory walls and their personal signature.
    [Show full text]