Restoration of Temozolomide Sensitivity by PARP Inhibitors In
Total Page：16
File Type：pdf, Size：1020Kb
Published OnlineFirst January 3, 2020; DOI: 10.1158/1078-0432.CCR-19-2000 CLINICAL CANCER RESEARCH | TRANSLATIONAL CANCER MECHANISMS AND THERAPY Restoration of Temozolomide Sensitivity by PARP Inhibitors in Mismatch Repair Deficient Glioblastoma is Independent of Base Excision Repair Fumi Higuchi1,2, Hiroaki Nagashima1, Jianfang Ning1,3, Mara V.A. Koerner1, Hiroaki Wakimoto1, and Daniel P. Cahill1 ABSTRACT ◥ Purpose: Emergence of mismatch repair (MMR) deficiency is a Results: While having no detectable effect in MSH6 wild-type frequent mechanism of acquired resistance to the alkylating che- GBMs, PARPi selectively restored TMZ sensitivity in MSH6- motherapeutic temozolomide (TMZ) in gliomas. Poly(ADP-ribose) deficient GBM cells. This genotype-specific restoration of activity polymerase inhibitors (PARPi) have been shown to potentiate TMZ translated in vivo, where combination treatment of veliparib cytotoxicity in several cancer types, including gliomas. We tested and TMZ showed potent suppression of tumor growth of whether PARP inhibition could re-sensitize MSH6-null MMR- MSH6-inactivated orthotopic xenografts, compared with TMZ deficient gliomas to TMZ, and assessed the role of the base excision monotherapy. Unlike PARPi, genetic and pharmacological block- repair (BER) DNA damage repair pathway in PARPi-mediated age of BER pathway did not re-sensitize MSH6-inactivated GBM effects. cells to TMZ. Similarly, CRISPR PARP1 knockout did not re- Methods: Isogenic pairs of MSH6 wild-type and MSH6-inacti- sensitize MSH6-inactivated GBM cells to TMZ. vated human glioblastoma (GBM) cells (including both IDH1/2 Conclusions: PARPi restoration of TMZ chemosensitivity in wild-type and IDH1 mutant), as well as MSH6-null cells derived MSH6-inactivated glioma represents a promising strategy to from a patient with recurrent GBM were treated with TMZ, the overcome acquired chemoresistance caused by MMR deficiency. PARPi veliparib or olaparib, and combination thereof. Efficacy of Mechanistically, this PARPi-mediated synthetic phenotype was PARPi combined with TMZ was assessed in vivo. We used genetic independent of BER blockage and was not recapitulated by loss and pharmacological approaches to dissect the contribution of BER. of PARP1. Introduction and survive, albeit with the accumulation of a massive number of DNA mis-pairs, resulting in a characteristic cytidine-to-thymidine Mismatch repair (MMR) is one of the critical pathways responsible “hypermutator” phenotype (4). for repair of base-base mismatches arising during DNA replication or Temozolomide (TMZ) is the most commonly used alkylator for otherwise caused by DNA damage. MMR deficiency resulting from gliomas, with significant clinical activity in both lower-grade tumors inactivating MMR gene mutations not only predisposes cells to carrying isocitrate dehydrogenase 1 (IDH1) mutations (5, 6), as well as tumorigenesis, but also affects a tumor cell's response to DNA dam- primary IDH1-wild-type glioblastoma (GBM) exhibiting methylation aging agents. MMR deficiency causes drug resistance to alkylating of the O6-methyguanine DNA methyltransferase (MGMT) promoter agents that mediate the formation of O6 methylguanine-containing (7, 8). Unfortunately, prolonged treatment with TMZ is often follow- mismatches (1). Mechanistically, the recognition of alkylator-induced ed by the development of acquired resistance to TMZ, contributing O6meG:T mismatches by the multiprotein complex MutSa (com- to malignant progression, tumor recurrence, and mortality. Inactiva- prised of the heterodimer of MSH2 and MSH6) is thought to result in tion of mismatch repair (MMR) genes, that is, MSH2, MSH6, MLH1, repeated replacement of the mispaired thymidine, rendering a futile and PMS2, has been identified in both IDH mutant (9, 10) and IDH cycle of replication/repair, and ultimately programmed cell death (2, 3). wild-type (11, 12) recurrent malignant gliomas that have been pre- In the absence of a functional MMR response, O6meG:T is not targeted viously treated, whereas these alterations are extremely rare in primary for this “futile repair” cycle, and the cells avoid programmed cell death tumors (13, 14). Studies have identified MSH6 inactivation as a key molecular mechanism of acquired TMZ resistance in glioma cells (15), and strong association between TMZ treatment and the development 1 Department of Neurosurgery, Massachusetts General Hospital, Harvard Medical of MMR deficiency in patient tumors (16). Furthermore, MMR 2 School, Boston, Massachusetts. Department of Neurosurgery, Dokkyo Medical alterations after TMZ treatment of low-grade gliomas are considered University, Mibu, Tochigi, Japan. 3Department of Neurosurgery, University of Minnesota Medical School, Minneapolis, Minnesota. a driver for malignant progression to higher grade and a post-TMZ hypermutator phenotype (14). Note: Supplementary data for this article are available at Clinical Cancer To potentiate TMZ cytotoxicity, combination therapies that mod- Research Online (http://clincancerres.aacrjournals.org/). ulate DNA repair pathways have been evaluated as a potential strategy Corresponding Authors: Daniel P. Cahill, Massachusetts General Hospital/ to overcome TMZ resistance. TMZ induces not only Ome6G but also Harvard Medical School, 55 Fruit Street, MGH Brain Tumor Center, Boston, MA large numbers of N3-methyladenine and N7-methylguanine adducts 02114. Phone: 6177240884; Fax: 6177240887; E-mail: [email protected]; and Hiroaki Wakimoto, [email protected] that are rapidly processed by the base excision repair (BER) DNA repair pathway. N3-methyladenine and N7-methylguanine lesions Clin Cancer Res 2020;XX:XX–XX activate the nuclear enzyme PARPs, which synthesize poly(ADP- doi: 10.1158/1078-0432.CCR-19-2000 ribose) chains (PARylation) and facilitate the recruitment of XRCC1, Ó2020 American Association for Cancer Research. pol-beta, and DNA ligase to the DNA-strand break sites, thus playing AACRJournals.org | OF1 Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2020 American Association for Cancer Research. Published OnlineFirst January 3, 2020; DOI: 10.1158/1078-0432.CCR-19-2000 Higuchi et al. Western blot analysis Translational Relevance Cells were lysed in RIPA (Boston Bioproducts) with a cocktail There is a keen interest to investigate the efficacy of PARPi of protease and phosphatase inhibitors (Roche). Protein (10– combination with TMZ in gliomas, and multiple National 15 mg) was separated by 4% to 20% SDS-PAGE and transferred Cancer Institute (NCI) consortia sponsored trials are underway. to polyvinylidene difluoride membranes by electroblotting. After However, preclinical studies in gliomas have shown variable blocking with 5% nonfat dry milk in TBS-T [20 mmol/L Tris responses to the combination treatment, and molecular biomar- (pH 7.5) 150 mmol/L NaCl, 0.1% Tween20] for 1 to 2 hours at kers to identify subgroups which benefitfromPARPicombi- room temperature, membranes were incubated with primary anti- nation with TMZ are still elusive. Meanwhile, multiple studies body at 4C overnight. Membranes were washed in TBS-T and have identified MSH6 inactivation as a key molecular mecha- incubated with appropriate peroxidase conjugated secondary anti- nism of acquired TMZ resistance in glioma cells in vitro,andthe bodies for 1 hour at room temperature. Signals were visualized development of MMR deficiency in post-treatment gliomas in using the enhanced chemiluminescense (ECL) Kit (Amersham clinical tumor specimens. We here show MMR deficiency Bioscience). Primary antibodies used were: MSH6 (#5425), XRCC1 mediated by MSH6 inactivation is a unique molecular alteration (#2735; Cell Signal Technology), PARP1 (sc-8007; Santa Cruz), predicting PARPi restoration of TMZ chemosensitivity. Fur- and b-actin (A1978; Sigma). thermore, we demonstrate that the PARPi re-sensitization effect is independent of BER blockage, revealing a distinct therapeutic MSH6-shRNA, XRCC1-shRNA, and PARP1-knockout cell lines impact of PARPi. generation Lentivirus vector plasmids containing shRNA sequences for MSH6 (TRCN0000286578 shMSH6no.1) and XRCC1 (TRCN0000007913 no.1, TRCN0000011211 no.2), and nontargeting shRNA sequence an critical role in the initiation of BER machinery. PARPi combina- (SHC002 shNS) were obtained from Sigma. shMSH6no.2, a second tions have been shown to increase TMZ sensitivity in the treatment of shRNA for MSH6, was from Dharmacon (V3LHS 318784). For various cancer cell types (17–20), and are under active investigation in PARP1 knockout, lentivirus vector plasmids containing SpCas9 IDH wild-type (21, 22) and IDH mutant (23, 24) gliomas. Because of (pLentiCRISPR v2) with/without sgRNA sequences for PARP1 the documented role of PARP in single-strand break repair and BER, (No.1:TTCTAGTCGCCCATGTTTGA, No.2: CCCCTTGCACGT- PARP inhibitor (PARPi)-mediated potentiation of TMZ sensitivity ACTTCTGT) were obtained from GenScript. To generate lentiviral has been speculated to be due to its inhibition of BER, nevertheless particles, 293T cells were transfected with a lentiviral plasmid, pack- direct evidence is lacking. aging plasmid (pCMV-dR8.2), and envelope plasmid (pCMV-VSV-G) Here, we show that PARPis restore TMZ sensitivity in MSH6- with FuGene (Promega). Cells were infected with lentivirus in the inactivated, MMR-deficient TMZ-resistant gliomas (both IDH presence of polybrene (8 mg/mL) for 8 hours. Three days later, cells wild-type and IDH mutant) in vitro and in vivo.Notably,thisre- were selected with puromycin (0.6 mg/mL for LN229, 0.2 mg/mL for storation