Figure S1 the Pipeline of Calling and Filtering Rare Variants from RNA-Seq Data in This Study

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Ann Rheum Dis

Figure S1 The pipeline of calling and filtering rare variants from RNA-seq data in this study.

Meng X, et al. Ann Rheum Dis 2021; 80:626–631. doi: 10.1136/annrheumdis-2020-218359 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Ann Rheum Dis

Figure S2 Validation of variants called from RNA-seq by Sanger sequencing in an independent cohort of three samples. Sanger sequencing chromatograms of the validated variants among 10 variants randomly selected from each samples.

Sample1

Sample2

Sample3

Figure S3 The sample quality control filtering based on the number of rare variants carried by each sample. The number of rare variants called from RNA-seq of each sample was plotted and those outside of the linear phase of the distribution were filtered out. The number of variants in the linear phase is shown in orange and the number of variants which is either too low or too high in the exponential phase is shown in grey, indicating the excluded samples.

250

200

150

100 variant number variant

0 0 100 200 300 400 500 600 sample ID

Figure S4 The distribution of mutation types among the 63 recurrent rare variants found in our study.

SNVs 2% 5%

missense_NA 30% missense_D missense_T 63% stoploss/stopgain_NA

missense_NA: rare missense SNVs with SIFT functional prediction not available; missense_D: rare missense SNVs with SIFT functional prediction to be deleterious; missense_T: rare missense SNVs with SIFT functional prediction to be tolerant; stoploss/stopgain_NA: SNVs with a gene truncating effect (stop gain or stop loss) with SIFT functional prediction not available.

Figure S5. The expression level of genes with recurrent deleterious rare variants based on data in DICE. (https://dice-database.org/) A. polyarticular JIA

B. oligoarticular JIA

C. systemic JIA

DICE:Database of Immune Cell Expression; TPM:Transcripts per million.

Figure S6 The expression level of genes with recurrent deleterious rare variants based on in HPA (https://www.proteinatlas.org/) A. polyarticular JIA

B. oligoarticular JIA

C. systemic JIA

HPA: Human protein Atlas; pTPM: Protein- transcripts per million.

Figure S7 The differentially expressed genes in the meta-analysis of polyarticular and oligoarticular subtypes of three RNA-seq datasets (|FC|>2, adjusted P-value <0.05). Volcano plot showing the gene differential expression analysis of three RNA-seq datasets. The vertical lines correspond to 2.0-fold up and down, respectively, and the horizontal line represents adjust-p value of 0.05. The red points in the plot represent the 43 significantly up-regulated genes; and the blue points represent the 4 significantly down-regulated genes.

Figure S8 Volcano plots showing the results of pathway over-representation analysis. It shows the log of the FDR versus the enrichment ratio for all the pathways in the KEGG database, highlighting the degree by which the significant pathways stand out from the background. The size and color of the dot is proportional to the number of input genes falling into each pathway. (A) Pathway analysis of 63 genes with recurrent rare variants; (B) Pathway analysis of 138 differentially expressed genes of polyarticular and oligoarticular subtypes of JIA.

Table S1 The fraction of rare variants called from RNA-sequencing data were detected in whole exome sequencing (WES) data of each of the 100 randomly selected GTEx samples. RNA-seq WES Fraction RNA-seq WES Fraction SRR1069024 SRR2167400 72.70% SRR1361368 SRR2167124 60.80% SRR1071931 SRR2165980 66.20% SRR1363611 SRR2165743 66.70% SRR1072345 SRR2168332 77.40% SRR1366543 SRR2165999 80.40% SRR1072529 SRR2166291 88.00% SRR1368529 SRR2167121 75.80% SRR1072871 SRR2167072 83.10% SRR1370742 SRR2165890 83.30% SRR1074646 SRR2167359 62.70% SRR1378026 SRR2167957 82.10% SRR1076511 SRR2165120 69.20% SRR1381435 SRR2168744 82.20% SRR1077503 SRR2166156 80.90% SRR1381481 SRR2166915 87.80% SRR1079259 SRR2165448 60.40% SRR1382615 SRR2168325 72.20% SRR1079660 SRR2167414 79.70% SRR1383855 SRR2156637 78.30% SRR1080998 SRR2167470 80.40% SRR1386967 SRR2166500 76.50% SRR1083432 SRR1343762 76.70% SRR1388081 SRR2170921 64.90% SRR1083657 SRR2167152 62.20% SRR1389133 SRR1310297 74.00% SRR1084577 SRR2165457 90.20% SRR1392547 SRR1348058 76.60% SRR1084720 SRR2164914 77.10% SRR1396191 SRR2167760 85.50% SRR1087654 SRR2167068 68.80% SRR1397673 SRR2165117 85.70% SRR1090508 SRR2166372 91.30% SRR1400032 SRR2163570 82.20% SRR1091452 SRR2164811 62.70% SRR1400054 SRR2163573 82.50% SRR1092422 SRR2166301 100% SRR1407758 SRR2157513 78.80% SRR1096571 SRR1305587 75.80% SRR1409510 SRR2167950 84.20% SRR1099260 SRR2167942 90.70% SRR1413892 SRR2166259 86.50% SRR1099648 SRR2167756 91.40% SRR1416560 SRR2167440 85.50% SRR1099744 SRR2165963 72.70% SRR1420669 SRR2170534 69.70% SRR1101324 SRR2166998 77.90% SRR1433044 SRR2167335 78.70% SRR1101787 SRR2167293 70.50% SRR1433860 SRR2166939 86.80% SRR1102031 SRR2166948 70.20% SRR1435833 SRR2164488 68.90% SRR1310412 SRR2165954 87.10% SRR1440224 SRR2165753 77.80% SRR1311419 SRR2166173 88.50% SRR1440603 SRR2167421 91.70% SRR1311644 SRR2167963 85.30% SRR1444852 SRR2165960 78.60% SRR1312598 SRR2170783 60.70% SRR1446244 SRR2170487 65.90% SRR1314916 SRR2167408 66.70% SRR1446850 SRR2167131 75.00% SRR1320137 SRR2166827 71.20% SRR1447523 SRR2167496 90.40% SRR1322619 SRR2165570 64.10% SRR1457574 SRR2167277 84.60% SRR1326536 SRR2167467 85.50% SRR1459739 SRR2166269 70.30% SRR1328407 SRR2164694 94.40% SRR1464618 SRR2165024 69.10% SRR1329047 SRR2167309 89.60% SRR1468850 SRR2163078 76.90% SRR1331311 SRR2165452 67.90% SRR1474839 SRR2165523 84.60% SRR1331684 SRR2170126 86.00% SRR1475930 SRR2166052 72.60% SRR1332007 SRR2164492 84.80% SRR1476207 SRR1306141 66.00% SRR1333570 SRR2165222 93.50% SRR1476300 SRR2166515 81.50% SRR1337540 SRR2166369 78.30% SRR1477991 SRR2167387 69.00%

SRR1338880 SRR2167707 62.50% SRR1480789 SRR2167332 90.50% SRR1339619 SRR1310396 60.00% SRR1481060 SRR2164704 88.00% SRR1345266 SRR2156686 66.00% SRR1481351 SRR1308426 78.80% SRR1345541 SRR2155763 81.20% SRR1486021 SRR2164933 62.70% SRR1345847 SRR2170211 63.20% SRR1488261 SRR1307843 84.10% SRR1349032 SRR2167437 62.70% SRR1489116 SRR2157311 78.90% SRR1349276 SRR2166865 60.90% SRR1489926 SRR2164748 83.70% SRR1352530 SRR1307722 79.40% SRR1491332 SRR2165363 88.60% SRR1355102 SRR2156394 73.00% SRR1498313 SRR2170789 88.90%

RNA-seq= the SRR ID of the RNA-seq file; WES= the SRR ID of the WES file for the same sample as the RNA-seq file; fraction= the fraction of rare variants called from RNA-seq data was detected by the WES data

Table S2 The variants called from RNA-seq data of an independent cohort of three samples and were randomly selected for Sanger validation

Sample SNV(hg19) REF ALT Forward Primer Reverse Primer Validate 1 1:16133978 T C AGAAACAAATGGTACATCCGAAACC AGGAGATGATTGTTAAGAGCTCAGG N 1 1:228336503 C T TTGATGTGGTCATCATTAACGACAG TATTTTATTAGGATGTCAGCCCTGG Y 1 3:49145934 C T ATAATGCGGGTCAGAAGAATTGAAG AGTATCCTAGGGTGTGTATCCATCT Y 1 3:52848266 C T GTAAAACTGGCCTGAGATACAAAGG AATCAGAAGATTTAAGGGCCTTCCC Y 1 4:57976234 T C GGAAGTCTGAGGTCTCGGAAAATC ATGGAGTGCGTGAAGAGCCG N 1 7:39990548 A G GGATTATCGTGGCGCTTTTCC GAGCTCACATCCTCGTATTCCAC N 1 14:45564473 A G AAGATATGCCGTTTTCCAGTGATTG ATCAGGTGACTGTTCCATTTCTGTA Y 1 14:92249535 C G TTTTACTGTCTGTGTCTCTTGTTGC ATTTTTGAGTGGTTGGGATCAGTTT Y 1 19:12989289 C T ACTTACAGGTACCACTTCATTCACA CTCAGTTCTCGAAGATGGGTAAGTC Y 1 22:19163747 C T CTTAGTCCGTCTTCCACACTTTGTT ACACTCCTCTGGATGTGATTAAGAC Y 2 1:225974614 A G GCTTACCCTTGGTAGATTGAGTACA AGCAAGTATACCTAACCACTCTGTG N 2 2:159488324 G A ACTGTGATTGTCTCAGTTCTTAACG TACTGAATATGCATCTAACCCGAGG Y 2 3:5229492 T C GAGTTCCTTAAAGGGGAAGCGAG CCATGTAGTTGTCGTAGCCAAAGA Y 2 4:159048596 T C GTATTCATCTACACTGCCTCATTGC AGTCTGTCATGTTCTGAATGGTGTA Y 2 5:159830404 C G TCTTGGATGGTCTTCTGACTAGTTG GTCTCTACCAGAAGCATCATTTGTG Y 2 7:39990548 A G GGATTATCGTGGCGCTTTTCC GAGCTCACATCCTCGTATTCCAC N 2 9:130652962 T C GGAACAGTCAAGACTTTACATTGGG ATGTTGACTTTCCTTATCCACCAGA Y 2 15:74911647 C T TCTTCACTTCATAAACCTCTGGGAG CTAAGTTTGACCTGGGAGCTAAGAT Y 2 16:3647893 G A TTTCCCACCCTTCCTTTAAAATCCT CTCTAGCCCCAGTAACTTTTCTCTT Y 2 20:58440459 C T AGGGCCTGTTTAAATTACCCCTATT AAAGCGAACAACAGAGGTTAGTATG Y 3 1:6586050 C A AAAAACACTGTTGCTAATAAGGGCA GGGGGATATTCCTACCATTCTCATC Y 3 2:136874182 C T TCATTCTCCTAAAGCGCAAAAACTT GAAACCTTTTGAAACCCTCTTGCTA Y 3 3:58141791 A G GCCTTACCCCACTAAGGAAATCATA CACTGCACTGTTATTTTTGTGTTGG N

3 3:112724558 C G GACTGAACTGAAATGAACTCCTGTG AAAGTTGCAGTCGACTCTTTTAAGG Y 3 4:79832984 C G GGAAAGATAGGGGGAATGTCTTACA CCCTTTTCTCCTGAAGAGGAATCA Y 3 7:39990527 A G GGATTATCGTGGCGCTTTTCC GAGCTCACATCCTCGTATTCCAC N 3 8:90965508 G T CTTCATCTTTCTGTGCCTGTTTCTT GAAATGGATGATGTGGCCATAGAAG Y 3 9:88257811 T A ACTGCAGCTCAGGATATTGACATAA CCTCTTCAGTTAAATGGGGGTAACT Y 3 11:18637192 C T CTTTCCAGCTCCATTAAAAACAGGT CCACCCATGAACTTCACTGATTTAC Y 3 17:17942897 G A AGTCAATCAGCATCACAAACGC GTACGAGTTCCCCTTGCTCTTCTG Y

REF: reference allele; ALT: the alternative variant allele; validate: the presence of the alternative allele was confirmed by Sanger sequencing or not; Y: Yes; N: No.

Table S3 The characteristics of JIA patients in the three RNA-seq datasets of JIA cohorts and in the whole exome sequencing dataset of JIA patients at CAG, CHOP before sample quality control filtering. Characteristics GSE79970 GSE81259 GSE112057 WES JIA 66 47 115 56 HC 16 14 12 NA female among JIA 53 (80%) 38 (81%) 79(69%) 37 (66%) female among HC 16 (100%) 10 (71%) NA NA JIA subtype oligoarticular 6 (13%) 43 (37%) 5 (9%) polyarticular 66 (100%) 41 (87%) 46 (40%) 38 (68%) systemic 26 (23%) enthesitis related 10 (18%) undifferentiated 3 (5%) PMID 27385437 28582527 29950172

HC: Healthy Controls; JIA: Juvenile Idiopathic Arthritis patients; PMID: Pubmed ID; WES: whole exome sequencing data.

Table S4 The distribution of recurrent rare variants across the three RNA-seq datasets after quality control filtering on samples and variants. GSE79970 GSE81259 GSE112057 GSE112057 GSE112057

poly poly/oligo* poly oligo sys Number of samples 56 47 46 43 26 passed QC Number of distinct 38 27 25 15 7 variants

*GSE81259 contains 41 polyarticular JIA samples and 6 oligoarticular JIA samples, but the samples were not labeled with the disease subtype at the individual level. Because of the small number of oligoarticular JIA subjects and the similarity in clinical presentations between oligoarticular and polyarticular subtypes, we considered all of the samples in GSE81259 as of polyariticular JIA subtype.

Table S5 The list of recurrent rare variants in polyarticular subtype of JIA. Poly Poly R A GSE GSE GSE GSE GSE gnomAD_ gnomAD_ gnomAD_ SNV WES Fisher phen2_ phen2_ SIFT cytoBand E L Gene Type AA Change 79970 81259_ 112057 112057 112057_ genome_ genome_ genome_ (hg19) _poly Pval HDIV_ HVAR _pred F T _poly poly/oligo _poly _oligo systemic ALL AFR NFE pred _pred

1:12405540 1p36.22 C G VPS13D missense p.P2974A 1 0 1 0 0 0 1.07E-01 . . . B B .

1:17280821 1p36.13 G C CROCC missense p.R1097P 1 0 2 0 0 0 4.81E-02 . . . D D D

1:67880914 1p31.3 C T SERBP1 missense p.G369S 0 1 1 0 0 0 1.07E-01 5.00E-04 1.00E-04 2.00E-04 P B T

1:118420768 1p12 T C GDAP2 missense p.T437A 1 0 1 0 0 0 1.07E-01 2.00E-04 1.00E-04 4.00E-04 B B T

1:153750689 1q21.3 G A SLC27A3 missense p.R533H 1 0 1 0 0 0 1.07E-01 5.00E-04 2.00E-04 7.00E-04 D P D

1:235969353 1q42.3 G C LYST missense p.S1028C 1 0 1 1 0 1 4.81E-02 5.00E-04 2.00E-04 9.00E-04 B B T

2:74754170 2p13.1 G A AUP1 missense p.P365L 1 1 0 0 0 1 1.07E-01 4.00E-04 1.00E-04 5.00E-04 B B T

2:97915302 2q11.2 C A ANKRD36 missense p.H1908N 1 1 0 0 0 0 1.07E-01 . . . B B T

2:136598457 2q21.3 T C MCM6 missense p.Y805C 1 0 1 0 0 1 1.07E-01 4.00E-04 3.00E-04 6.00E-04 B B T

2:238672557 2q37.3 C T LRRFIP1 missense p.P678L 2 1 0 0 0 2 4.81E-02 5.00E-04 2.00E-04 1.00E-03 B B T

2:242606083 2q37.3 C G ATG4B missense p.P188A 0 1 1 0 0 1 1.07E-01 3.00E-04 0.00E+00 6.00E-04 B B T

3:31674551 3p23 A G STT3B missense p.K771R 1 1 0 0 0 0 1.07E-01 6.46E-05 0.00E+00 1.00E-04 B B T

3:46414580 3p21.31 A T CCR5 missense p.S63C 0 1 1 0 0 1 1.07E-01 7.00E-04 2.00E-04 9.00E-04 B B D

3:48638451 3p21.31 T C UQCRC1 missense p.N308S 1 0 1 0 0 0 1.07E-01 4.00E-04 1.00E-04 6.67E-05 B B T

3:57302493 3p14.3 A G APPL1 missense p.N654S 1 1 0 0 0 1 1.07E-01 5.00E-04 3.00E-04 9.00E-04 B B T

3:179051234 3q26.33 A G ZNF639 missense p.E161G 1 1 0 0 0 0 1.07E-01 5.00E-04 2.00E-04 9.00E-04 D D D

4:997837 4p16.3 G A IDUA missense p.G589S 1 1 0 0 0 0 1.07E-01 2.00E-04 2.00E-04 2.00E-04 B B T

4:151835483 4q31.3 T C LRBA missense p.K342R 2 0 1 0 0 0 4.81E-02 3.34E-05 0.00E+00 6.88E-05 D D T

5:133887787 5q31.1 T C JADE2 missense p.Y67H 1 1 0 0 0 0 1.07E-01 6.46E-05 0.00E+00 1.00E-04 B B T

5:140044604 5q31.3 T C WDR55 missense p.V36A 1 0 1 0 0 0 1.07E-01 9.69E-05 0.00E+00 2.00E-04 B B T

6:32083657 6p21.33 G C ATF6B missense p.I654M 1 1 0 0 0 2 1.07E-01 2.00E-04 0.00E+00 3.00E-04 D D D

6:36995793 6p21.2 C T FGD2 missense p.R608W 1 1 0 0 0 0 1.07E-01 2.00E-04 6.00E-04 0.00E+00 D D D

7:92734036 7q21.2 G A SAMD9 stopgain p.R459X 3 0 1 0 0 0 2.24E-02 6.47E-05 0.00E+00 1.00E-04 . . .

7:100853388 7q22.1 C T PLOD3 missense p.G557R 2 0 1 0 0 0 4.81E-02 . . . B B T

7:133164812 7q33 C T EXOC4 missense p.S446L 1 1 0 0 0 0 1.07E-01 . . . P B T

7:150739111 7q36.1 G A ABCB8 missense p.D473N 2 1 0 0 0 1 4.81E-02 9.69E-05 1.00E-04 0.00E+00 P B T

8:144991424 8q24.3 C T PLEC missense p.V4175M 1 1 0 0 0 0 1.07E-01 3.00E-04 0.00E+00 5.00E-04 D D T

8:145235171 8q24.3 C T MROH1 missense p.R131C 1 1 0 0 0 0 1.07E-01 5.00E-04 2.00E-04 8.00E-04 P B D

10:43312058 10q11.21 G A BMS1 missense p.G781S 0 1 1 0 0 0 1.07E-01 9.69E-05 1.00E-04 1.00E-04 D D T

10:121259670 10q26.11 A T RGS10 missense p.D167E 0 1 1 0 0 0 1.07E-01 2.00E-04 8.00E-04 0.00E+00 B B T

11:61205157 11q12.2 C T SDHAF2 missense p.R33C 0 1 1 0 0 0 1.07E-01 7.00E-04 6.00E-04 1.00E-04 B B T

12:48062824 12q13.11 T A RPAP3 missense p.I496L 1 1 0 0 0 0 1.07E-01 4.00E-04 1.00E-04 7.00E-04 B B T

12:104337023 12q23.3 G A HSP90B1 missense p.E606K 1 1 0 0 0 0 1.07E-01 5.00E-04 3.00E-04 7.00E-04 B B T

14:64519270 14q23.2 C G SYNE2 missense p.S2880C 1 0 1 0 0 0 1.07E-01 . . . D P T

14:65210089 14q23.3 G A PLEKHG3 missense p.G1110R 1 0 1 0 0 0 1.07E-01 9.70E-05 1.00E-04 1.00E-04 D B T

14:74364942 14q24.3 A G ZNF410 missense p.K113R 1 1 0 0 0 0 1.07E-01 3.23E-05 0.00E+00 6.66E-05 D D T

15:43482569 15q15.2 T C CCNDBP1 missense p.C159R 1 0 1 0 0 0 1.07E-01 6.46E-05 2.00E-04 0.00E+00 D P D

15:44888441 15q21.1 T C SPG11 missense p.N1425S 1 0 1 0 0 0 1.07E-01 1.00E-04 0.00E+00 2.00E-04 B B T

16:22337187 16p12.2 A G POLR3E missense p.Q449R 1 0 1 0 0 0 1.07E-01 3.24E-05 0.00E+00 6.68E-05 B B D

16:23497372 16p12.2 C G GGA2 missense p.R254S 2 1 0 0 0 0 4.81E-02 3.23E-05 0.00E+00 0.00E+00 B B T

16:28498845 16p11.2 C T CLN3 missense p.S31N 1 1 0 0 0 0 1.07E-01 3.00E-04 0.00E+00 6.00E-04 D P D

16:28916281 16p11.2 C A RABEP2 missense p.D565Y 1 1 0 0 0 0 1.07E-01 6.47E-05 0.00E+00 1.00E-04 D D D

16:30727465 16p11.2 C T SRCAP missense p.R858C 1 0 1 0 0 0 1.07E-01 3.00E-04 0.00E+00 6.00E-04 D D D

16:74957867 16q23.1 T C WDR59 missense p.N229S 1 0 1 0 0 1 1.07E-01 7.00E-04 1.00E-03 7.00E-04 B B T

SNV: the single nucleotide variant shown as chromosome: position on human genome build hg19; cytoBand: human chromosome cytoband; REF: the allele in the reference genome; ALT: the alternative allele called; Gene: Gene symbol; Type: the variant type; AA Change: Amino acid change; GSE79970_poly: the number of alternative alleles among GSE79970 patients; GSE81259_poly/oligo: the number of alternative alleles among GSE81259 patients; GSE112057_poly: the number of alternative alleles among GSE112057 polyarticular patients; GSE112057_oligo: the number of alternative alleles among GSE112057 oligoarticular patients; GSE112057_systemic: the number of alternative alleles among GSE112057 systemic patients; WES_poly: the number of alternative alleles among patients of WES data; Fisher Pval: Fisher Exact Test Pval; gnomAD_genome_ALL: The allele frequency from all populations in the Genome Aggregation Database (gnomAD); gnomAD_genome_AFR: The allele frequency from the

gnomAD, African population; gnomAD_genome_NFE: The allele frequency from the gnomAD, Non-Finnish European population; Polyphen2_HDIV_pred: Pholyphen2 prediction based on HDIV; Polyphen2_HVAR_pred: Polyphen2 prediction based on HVAR; SIFT_pred: SIFT prediction.

Table S6 The list of recurrent rare variants in oligoarticular subtype of JIA. R A GSE GSE GSE GSE GSE gnomAD_ gnomAD_ gnomAD_ Polyphen2_ Polyphen2_ SNV Fisher SIFT_ cytoBand E L Gene Type AAChange 79970 81259 112057 112057 112057 genome_ genome_ genome_ HDIV_ HVAR_ (hg19) Pval pred F T _poly _poly/oligo _poly _oligo _systemic ALL AFR NFE pred pred

1:86842004 1p22.3 G A ODF2L missense p.A241V 0 1 0 4 0 1.07E-02 . . . D D D

1:144147014 1q21.1 G C NBPF19 missense p.K56N 0 0 0 2 0 4.81E-02 ......

5:179290918 5q35.3 C T TBC1D9B missense p.A1078T 0 0 0 2 0 1.07E-01 2.00E-04 7.00E-04 0.00E+00 B B T

10:121591604 10q26.11 T A MCMBP missense p.E572D 0 0 0 2 0 1.07E-01 . . . D P D

10:126449064 10q26.13 G A EEF1AKMT2 missense p.L131F 0 0 0 2 0 1.07E-01 6.46E-05 0.00E+00 1.00E-04 . . .

11:613966 11p15.5 C G IRF7 missense p.A264P 0 0 0 2 0 1.07E-01 6.49E-05 1.00E-04 6.71E-05 B B T

13:79940211 13q31.1 G A RBM26 missense p.P419S 0 0 0 2 0 1.07E-01 5.00E-04 1.00E-04 8.00E-04 P B T

16:22546840 16p12.2 C T NPIPB5 missense p.P846S 0 0 0 2 2 2.24E-02 . . . D D T

16:28401855 16p11.2 G A EIF3C missense p.H433Y 0 0 0 2 0 1.07E-01 . . . B B T

16:50332912 16q12.1 A T ADCY7 missense p.K349M 0 0 0 2 0 1.07E-01 2.00E-04 0.00E+00 3.00E-04 D D D

16:69921963 16q22.1 C G WWP2 missense p.A126G 0 0 0 2 0 1.07E-01 4.00E-04 1.00E-04 6.00E-04 B B T

17:78327338 17q25.3 G A RNF213 missense p.G3484S 0 0 0 2 0 1.07E-01 3.00E-04 0.00E+00 4.00E-04 B B T

21:16338958 21q11.2 G A NRIP1 missense p.P519L 0 0 0 2 0 1.07E-01 3.00E-04 1.00E-04 6.00E-04 B B T

SNV: the single nucleotide variant shown as chromosome: position on human genome build hg19; cytoBand: human chromosome cytoband; REF: the allele in the reference genome; ALT: the alternative allele called; Gene: Gene symbol; Type: the variant type; AA Change: Amino acid change; GSE79970_poly: the number of alternative alleles among GSE79970 patients; GSE81259_poly/oligo: the number of alternative alleles among GSE81259 patients; GSE112057_poly: the number of alternative alleles among GSE112057 polyarticular patients; GSE112057_oligo: the number of alternative alleles among GSE112057 oligoarticular patients; GSE112057_systemic: the number of alternative alleles among GSE112057 systemic patients; Fisher Pval: Fisher Exact Test Pval; gnomAD_genome_ALL: The allele frequency from all populations in the Genome Aggregation Database (gnomAD); gnomAD_genome_AFR: The allele frequency from the gnomAD, African population; gnomAD_genome_NFE: The allele frequency from the gnomAD, Non-Finnish European population; Polyphen2_HDIV_pred: Pholyphen2 prediction based on HDIV; Polyphen2_HVAR_pred: Polyphen2 prediction based on HVAR; SIFT_pred: SIFT prediction

Table S7 The list of recurrent rare variants in systemic subtype of JIA. R A GSE GSE GSE GSE GSE gnomAD_ gnomAD_ gnomAD_ Polyphen2_ Polyphen2_ SNV Fisher SIFT_ cytoBand E L Gene Type AAChange 79970 81259 112057 112057 112057 genome_ genome_ genome_ HDIV_ HVAR_ (hg19) Pval pred F T _poly _poly/oligo _poly _oligo _systemic ALL AFR NFE pred pred

1:207643432 1q32.2 C G CR2 missense p.P404A 0 0 0 0 2 1.07E-01 4.00E-04 1.00E-04 6.00E-04 D D D

2:157369910 2q24.1 G T GPD2 missense p.C188F 0 0 0 0 2 1.07E-01 4.00E-04 0.00E+00 5.00E-04 B B T

4:190881928 4q35.2 C G FRG1 missense p.T188S 0 0 1 0 2 4.81E-02 . . . B B T

5:179044808 5q35.3 T C HNRNPH1 missense p.I305V 0 0 0 0 2 1.07E-01 . . . P D D

12:27890519 12p11.22 C A MRPS35 missense p.N190K 0 0 0 0 2 1.07E-01 4.00E-04 0.00E+00 8.00E-04 D D D

16:22545380 16p12.2 C T NPIPB5 missense p.P359L 0 0 0 1 2 4.81E-02 . . . B B D

16:22546840 16p12.2 C T NPIPB5 missense p.P846S 0 0 0 2 2 2.24E-02 . . . D D T

SNV: the single nucleotide variant shown as chromosome: position on human genome build hg19; cytoBand: human chromosome cytoband; REF: the allele in the reference genome; ALT: the alternative allele called; Gene: Gene symbol; Type: the variant type; AA Change: Amino acid change; GSE79970_poly: the number of alternative alleles among GSE79970 patients; GSE81259_poly/oligo: the number of alternative alleles among GSE81259 patients; GSE112057_poly: the number of alternative alleles among GSE112057 polyarticular patients; GSE112057_oligo: the number of alternative alleles among GSE112057 oligoarticular patients; GSE112057_systemic: the number of alternative alleles among GSE112057 systemic patients; Fisher Pval: Fisher Exact Test Pval; gnomAD_genome_ALL: The allele frequency from all populations in the Genome Aggregation Database (gnomAD); gnomAD_genome_AFR: The allele frequency from the gnomAD, African population; gnomAD_genome_NFE: The allele frequency from the gnomAD, Non-Finnish European population; Polyphen2_HDIV_pred: Pholyphen2 prediction based on HDIV; Polyphen2_HVAR_pred: Polyphen2 prediction based on HVAR; SIFT_pred: SIFT prediction

Table S8 Variants called in our study and have been reported in previous JIA whole exome sequencing studies. SNV(hg19) cytoBand REF ALT Gene Type AA Change JIA allele 17:73825036 17q25.1 C G UNC13D missense p.A995P 2 17:73827335 17q25.1 T G UNC13D missense p.I848L 2 9:94172507 9q22.31 C T NFIL3 missense p.M170I 2

Table S9 Information of genes with recurrent functional rare variants in JIA cohorts. Varia AA Protein Gene Range Function GTEx HIPED Disease tion Change Size 1. May be involved in the inflammatory response to tissue injury, the regulation of extra-osseous calcification, and function downstream of TNF-alpha signaling. (PMID: 18094730,

16960814) whole blood, overexpressed chr7: 92,728,826- SAMD9 G/A p.R459X 1589 2. Participated in the regulation of EGR1, by an white blood cells, in Cervix and 92,747,336 interaction with RGL2. (PMID: 21160498,) lymph node Lymph node

3. Decreased SAMD9 expression led to elevated expression of cytokines (IFN-γ, IL-4, IL-8, and TNF-α) in Jurkat cells with SAMD9 being knocked down. (PMID: 30715670) overexpressed whole blood, chr3:179,040,779- 1. Binds DNA. in Breast, ZNF639 A/G p.E161G 485 white blood cells, 179,053,323 2. Transcriptional repressor. Adipocyte and lymph node CD8 Tcells 1. Transcription factor that plays a role in the LS (PMID: whole blood, chr6:32,065,953- unfolded protein response (UPR) pathway by overexpressed 26651848); ATF6B G/C p.I654M 703 white blood cells, 32,096,030 activating UPR target genes induced during ER in Serum TA(PMID: lymph node stress.(PMID:11256944) 25604533) 1.CDC42-specific exchange factor expressed by whole blood, overexpressed chr6:36,973,422- antigen-presenting cells, localizes to early FGD2 C/T p.R608W 655 white blood cells, in Spleen and 36,996,846 endosomes and active membrane ruffles.(PMID: lymph node Whole Blood 18838382)

1. functions in membrane trafficking and homotypic early endosome docking and fusion. (PMID: 9524116). overexpressed 2. plays a role in arteriogenesis by modulating in Lymph node endosomal trafficking to regulate vascular whole blood, chr16:28,915,742- and Peripheral RABEP2 C/A p.D565Y 569 endothelial growth factor receptor 2 (VEGFR2) white blood cells, 28,947,847 blood cell surface expression and VEGF lymph node mononuclear signaling.(PMID:29425100). cells 3. localizes to centrosomes and interacts with SDCCAG8. Knockdown of RABEP2 results in ciliogenesis defects. (PMID: 27224062). 1. Plays a role in transcriptional regulation of gene expression by chromatin remodeling. overexpressed Mediates the ATP-dependent exchange of histone in Ovary, H2AZ/H2B dimers for nucleosomal H2A/H2B. whole blood, Peripheral blood chr16:30,709,530- SLE (PMID: SRCAP C/T p.R858C 3230 2. Functions as a coactivator for several white blood cells, mononuclear 30,755,602 28714469) transcriptional regulation processes, such as lymph node cells,B CREB-mediated transcription, steroid lymphocyte, and receptor-mediated transcription, and Lung Notch-mediated transcription.(PMID:10347196) whole blood, chr1: 86,812,507- 1. Acts as a suppressor of ciliogenesis, overexpressed ODF2L G/A p.A241V 636 white blood cells, 86,862,025 particularly at the initiation of ciliogenesis. in Milk lymph node

1.One of the important structural components of the ciliary rootlet, a cytoskeletal-like structure in ciliated cells. overexpressed 2. Necessary for the correct positioning of the whole blood, chr1:17,066,768- in Neutrophil, CROCC G/C p.R1097P 2017 cilium basal body relative to the cell nucleus white blood cells, 17,299,474 Retina, and (PMID:27623382). lymph node Lymph node 3.Plays a role in centrosome cohesion before mitosis by forming centriole-associated fibers (PMID:16203858). 1.Protein-lysine methyltransferase that selectively chr10:126,436,718 CD, IBD EEF1AKMT2 G/A p.L131F 291 catalyzes the trimethylation of EEF1A at - 126,480,439 (PMID:28067908) 'Lys-318'.(PMID: 25144183) 1. Complement C3d Receptor 2, also a receptor overexpressed for the Epstein-Barr virus on human B-cells and whole blood, chr1:207,627,575- in Lymph node, SS (PMID: CR2 C/G p.P404A 1033 T-cells and for p120RNP. (PMID: 7753047) white blood cells, 207,663,240 Plasma, and 29293537) 2. Participates in B lymphocytes activation lymph node Serum (PMID: 2825176). 1. Diseases linked to MRPS35 include Alcoholic Cardiomyopathy. whole blood, overexpressed chr12:27,863,706- MRPS35 C/A p.N190K 323 2. MRPS35 related pathways are organelle white blood cells, in Pancreas and 27,909,237 biogenesis and maintenance, as well as lymph node Adrenal mitochondrial translation.

1. Regulates zymosan- induced increase intracellular cAMP, activates kinase A pathway and thus to modulate innate immune responses IBD through heterotrimeric G proteins G (12/13). overexpressed (PMID:28067908, 2. Plays a role in signaling cascades stimulated by in Monocytes, whole blood, 28067910, chr16:50,280,048- dopamine and C5 alpha chain and regulation of Peripheral blood ADCY7 A/T p.K349M 1080 white blood cells, 26301688); CD 50,352,046 cAMP synthesis.(PMID:23842570, mononuclear lymph node (PMID:20570966); PMID:23229509). cells, Placenta, ATD (PMID: 3. Regulation of inflammation in response to and CD8 Tcells 32581359 ) bacterial infection by sensing the serum factors.

4. Participates in cAMP synthesis of B and T cells in adaptive immune responses.

Gene: gene name; Range: the start and end position of each gene; Variants: the allele in the reference genome and the alternative allele called; AA Change: change in the amino acid due to mutation; Protein Size: the number of encoded amino acids of each gene; Function: function have been reported of each gene; GTEx: mRNA expression in normal human tissues from GTEx; HIPED: protein differential expression in normal tissues from HIPED (the Human Integrated Protein Expression Database) for each gene; Disease: common-variant associated immune diseases, CD: Crohn Disease; RA: Rheumatoid Arthritis; IBD: Inflammatory Bowel Disease; LS: Löfgren’s syndrome; TA: Takayasu Arteritis; SLE: systemic lupus erythematosus; SS: Systemic sclerosis; ATD: autoimmune thyroid disease.

Table S10 The knock-out mouse models showing defects in immune system. Gene System Phenotypes Allele PMID abnormal mean corpuscular hemoglobin hematopoietic system SRCAP concentration Srcap abnormal platelet cell number EEF1AKMT2 behavior/neurological impaired pupillary reflex Eef1akmt2 immune system peritoneal inflammation Adcy7/Adcy7 23178822 ADCY7 increased tumor necrosis factor secretion Lyz2/Lyz2<+> behavior/neurological abnormal depression-related behavior Adcy7/Adcy7<+> 17135423 CR2 immune system decreased IgG level Cr2/Cr2 impaired humoral immune response decreased B-1a cell number abnormal germinal center B cell physiology decreased IgG2b level decreased IgG2c level Cr2/Cr2 23733878 decreased IgG3 level decreased IgM level increased susceptibility to bacterial infection induced morbidity/mortality decreased neutrophil cell number decreased tumor necrosis factor secretion 11120817, increased marginal zone B cell number 11371362, decreased follicular B cell number Cr2/Cr2 8624815, decreased B cell number 10779753, abnormal B-1 B cell morphology 11067882 abnormal spleen germinal center morphology

decreased spleen germinal center size decreased IgG2a level decreased IgG2b level decreased IgG3 level decreased B-1a cell number decreased immunoglobulin level decreased IgM level abnormal immune system morphology decreased spleen germinal center number decreased IgG level abnormal humoral immune response increased anti-double stranded DNA antibody level abnormal memory B cell differentiation abnormal B cell physiology abnormal class switch recombination 19706534, abnormal B cell activation Cr2/Cr2 8622941, decreased IgG level 15585877 decreased IgM level increased susceptibility to bacterial infection decreased spleen germinal center number abnormal adaptive immunity decreased IgG level decreased IgG1 level Cr2/Cr2 12479818 decreased IgG2b level decreased IgG3 level decreased IgM level

increased susceptibility to bacterial infection abnormal memory B cell differentiation abnormal B cell physiology Cr2/Cr2 19706534 abnormal class switch recombination abnormal B cell activation

Gene: gene name; System: phenotypes belong to which system; Phenotypes: immune-associated phenotype of gene knockout mouse model

Table S11 The composition of polyarticular JIA patients in the replication cohort with diverse ancestry.

European African Hispanic Other polyarticular JIA 19 12 5 2

Tables S12 Significant genes in gene-based rare variants association tests in JIA RNAseq cohort with CMC, KBAC and SKAT testing methods. (CMC: combined multivariate collapsing; KBAC: kernel based adaptive clustering model; SKAT: sequence kernel association )

Gene Range NumVar P-value CMC NPIPB5 16:22524843-22547841 7 2.40E-03 ODF2L 1:86812506-86862025 5 1.05E-02 SAMD9 7:92728825-92747336 4 2.21E-02 LRRFIP1 2:238600806-238674558 3 4.78E-02 LRBA 4:151185595-151936436 3 4.78E-02 GGA2 16:23474862-23521815 3 4.78E-02 PLOD3 7:100849257-100861011 3 4.78E-02 ABCB8 7:150725509-150744869 3 4.78E-02 LYST 1:235824344-236030220 3 4.78E-02 FRG1 4:190861973-190884359 3 4.78E-02 CROCC 1:17248444-17299474 3 4.78E-02 KBAC NPIPB5 16:22524843-22547841 7 3.40E-03 ODF2L 1:86812506-86862025 5 1.50E-02 SAMD9 7:92728825-92747336 4 3.42E-02 SKAT NPIPB5 16:22524843-22547841 7 9.93E-03 ODF2L 1:86812506-86862025 5 1.05E-02 SAMD9 7:92728825-92747336 4 2.21E-02 FRG1 4:190861973-190884359 3 4.78E-02 GGA2 16:23474862-23521815 3 4.78E-02 LRRFIP1 2:238600806-238674558 3 4.78E-02 CROCC 1:17248444-17299474 3 4.78E-02 LYST 1:235824344-236030220 3 4.78E-02 PLOD3 7:100849257-100861011 3 4.78E-02 LRBA 4:151185595-151936436 3 4.78E-02 ABCB8 7:150725509-150744869 3 4.78E-02

Table S13 The differentially expressed genes (DEGs) in the meta-analysis of polyarticular and oligoarticular subtypes in three RNA-seq Datasets (|FC|>1.5, padj<0.05). ENSEMBL SYMBOL log2FC pvalue padj ENSG00000137331 IER3 1.29 6.91E-11 5.43E-07 ENSG00000112149 CD83 1.31 4.82E-10 1.90E-06 ENSG00000081041 CXCL2 2.33 6.10E-10 1.92E-06 ENSG00000124882 EREG 1.66 3.79E-09 7.45E-06 ENSG00000100906 NFKBIA 1.26 5.49E-09 9.59E-06 ENSG00000153234 NR4A2 1.37 7.03E-09 1.00E-05 ENSG00000162490 DRAXIN -0.89 6.56E-09 1.00E-05 ENSG00000115523 GNLY -0.72 1.43E-08 1.60E-05 ENSG00000163734 CXCL3 1.63 2.94E-08 2.57E-05 ENSG00000266559 MIR4530 2.34 2.84E-08 2.57E-05 ENSG00000148671 ADIRF -1.39 8.08E-08 4.73E-05 ENSG00000099860 GADD45B 0.59 1.63E-07 6.93E-05 ENSG00000186197 EDARADD -0.62 2.52E-07 1.04E-04 ENSG00000118503 TNFAIP3 0.74 3.03E-07 1.19E-04 ENSG00000120129 DUSP1 0.84 3.63E-07 1.29E-04 ENSG00000163661 PTX3 0.98 3.68E-07 1.29E-04 ENSG00000169429 CXCL8 1.61 3.56E-07 1.29E-04 ENSG00000099985 OSM 0.96 4.03E-07 1.37E-04 ENSG00000228549 LOC112267871 -0.82 5.50E-07 1.66E-04 ENSG00000184557 SOCS3 0.99 8.12E-07 2.28E-04 ENSG00000271614 ATP2B1-AS1 0.73 9.52E-07 2.51E-04 ENSG00000137801 THBS1 1.05 1.08E-06 2.64E-04 ENSG00000011422 PLAUR 0.61 1.18E-06 2.73E-04 ENSG00000183439 TRIM61 -0.59 1.18E-06 2.73E-04 ENSG00000256690 LOC105369332 0.69 1.22E-06 2.79E-04 ENSG00000273129 PACERR 1.32 1.42E-06 3.10E-04 ENSG00000185950 IRS2 0.61 1.52E-06 3.18E-04 ENSG00000175592 FOSL1 1.07 1.66E-06 3.30E-04 ENSG00000100450 GZMH -0.71 1.85E-06 3.38E-04 ENSG00000118515 SGK1 0.66 1.75E-06 3.38E-04 ENSG00000171596 NMUR1 -0.63 1.77E-06 3.38E-04 ENSG00000073756 PTGS2 1.04 2.55E-06 4.45E-04 ENSG00000166527 CLEC4D 0.65 2.74E-06 4.67E-04 ENSG00000112096 SOD2 0.66 3.07E-06 4.97E-04 ENSG00000124920 MYRF -0.66 3.41E-06 5.36E-04 ENSG00000090104 RGS1 0.86 3.73E-06 5.81E-04 ENSG00000170345 FOS 0.70 3.91E-06 6.02E-04 ENSG00000142178 SIK1 0.80 4.58E-06 6.85E-04 ENSG00000177606 JUN 0.86 4.75E-06 7.05E-04 ENSG00000104804 TULP2 1.81 5.17E-06 7.24E-04 ENSG00000112715 VEGFA 0.66 5.20E-06 7.24E-04

ENSG00000173578 XCR1 -0.73 5.05E-06 7.24E-04 ENSG00000134755 DSC2 0.74 5.40E-06 7.38E-04 ENSG00000125538 IL1B 1.28 5.58E-06 7.55E-04 ENSG00000109321 AREG 2.36 5.81E-06 7.71E-04 ENSG00000162772 ATF3 0.98 6.09E-06 7.91E-04 ENSG00000087074 PPP1R15A 0.78 8.76E-06 1.06E-03 ENSG00000176597 B3GNT5 0.63 9.80E-06 1.13E-03 ENSG00000165030 NFIL3 0.59 1.00E-05 1.15E-03 ENSG00000109956 B3GAT1 -0.69 1.25E-05 1.38E-03 ENSG00000186431 FCAR 0.59 1.52E-05 1.54E-03 ENSG00000265185 SNORD3B-1 1.12 1.53E-05 1.54E-03 ENSG00000148488 ST8SIA6 -0.66 1.59E-05 1.59E-03 ENSG00000161835 GRASP 0.68 1.60E-05 1.60E-03 ENSG00000123689 G0S2 1.32 1.66E-05 1.63E-03 ENSG00000145632 PLK2 0.61 1.68E-05 1.63E-03 ENSG00000262074 SNORD3B-2 1.09 1.98E-05 1.80E-03 ENSG00000144655 CSRNP1 0.59 2.02E-05 1.83E-03 ENSG00000130656 HBZ 1.28 2.39E-05 2.07E-03 ENSG00000206177 HBM 1.28 2.39E-05 2.07E-03 ENSG00000124575 H1-3 1.37 2.56E-05 2.14E-03 ENSG00000119508 NR4A3 0.86 2.72E-05 2.21E-03 ENSG00000165949 IFI27 -1.17 4.00E-05 2.90E-03 ENSG00000232810 TNF 1.25 4.27E-05 3.04E-03 ENSG00000201558 RNVU1-6 1.38 5.54E-05 3.61E-03 ENSG00000183722 LHFPL6 0.67 6.02E-05 3.86E-03 ENSG00000136244 IL6 1.01 6.18E-05 3.93E-03 ENSG00000156453 PCDH1 -0.62 6.72E-05 4.16E-03 ENSG00000162711 NLRP3 0.60 7.23E-05 4.35E-03 ENSG00000266698 MIR3945 1.44 7.41E-05 4.36E-03 ENSG00000233261 FAM238A 0.59 7.58E-05 4.42E-03 ENSG00000185897 FFAR3 1.02 8.06E-05 4.53E-03 ENSG00000120738 EGR1 1.12 9.80E-05 5.14E-03 ENSG00000124216 SNAI1 0.90 9.81E-05 5.14E-03 ENSG00000264773 MIR4420 0.74 1.00E-04 5.24E-03 ENSG00000181773 GPR3 1.01 1.34E-04 6.29E-03 ENSG00000163923 RPL39L -0.67 1.35E-04 6.34E-03 ENSG00000180720 CHRM4 1.02 1.54E-04 6.93E-03 ENSG00000167355 OR51B5 1.18 1.61E-04 7.11E-03 ENSG00000196565 HBG2 1.18 1.61E-04 7.11E-03 ENSG00000213931 HBE1 1.18 1.61E-04 7.11E-03 ENSG00000213934 HBG1 1.18 1.61E-04 7.11E-03 ENSG00000229111 MED4-AS1 0.87 1.63E-04 7.11E-03 ENSG00000214944 ARHGEF28 -0.97 1.72E-04 7.39E-03 ENSG00000225231 LINC02470 -1.27 1.81E-04 7.56E-03

ENSG00000200169 RNU5D-1 1.68 1.87E-04 7.78E-03 ENSG00000259884 NR4A1AS 1.55 1.88E-04 7.78E-03 ENSG00000113070 HBEGF 0.87 1.90E-04 7.84E-03 ENSG00000184292 TACSTD2 1.07 1.94E-04 7.93E-03 ENSG00000264229 RNU4ATAC 1.21 1.96E-04 7.97E-03 ENSG00000267365 KCNJ2-AS1 0.72 1.97E-04 7.99E-03 ENSG00000184349 EFNA5 -0.87 2.04E-04 8.15E-03 ENSG00000272666 LOC105373098 0.70 2.18E-04 8.53E-03 ENSG00000182272 B4GALNT4 -0.81 2.48E-04 9.26E-03 ENSG00000173269 MMRN2 -0.75 2.78E-04 1.00E-02 ENSG00000179934 CCR8 -0.62 2.77E-04 1.00E-02 ENSG00000110203 FOLR3 -0.80 3.17E-04 1.10E-02 ENSG00000003137 CYP26B1 4.09 3.26E-04 1.10E-02 ENSG00000105835 NAMPT 0.65 3.22E-04 1.10E-02 ENSG00000157168 NRG1 0.63 3.27E-04 1.10E-02 ENSG00000125740 FOSB 0.83 3.37E-04 1.12E-02 ENSG00000179388 EGR3 0.80 3.52E-04 1.15E-02 ENSG00000122861 PLAU 0.68 3.68E-04 1.18E-02 ENSG00000227051 C14orf132 -0.65 3.99E-04 1.24E-02 ENSG00000197993 KEL 0.86 4.16E-04 1.27E-02 ENSG00000164850 GPER1 0.66 5.19E-04 1.49E-02 ENSG00000120875 DUSP4 0.67 5.37E-04 1.52E-02 ENSG00000254245 PCDHGA3 -0.91 5.38E-04 1.52E-02 ENSG00000162383 SLC1A7 -0.64 5.78E-04 1.57E-02 ENSG00000198435 NRARP 0.69 5.87E-04 1.57E-02 ENSG00000152766 ANKRD22 0.75 5.92E-04 1.58E-02 ENSG00000108950 FAM20A 0.68 6.03E-04 1.59E-02 ENSG00000167680 SEMA6B 0.68 7.25E-04 1.81E-02 ENSG00000264940 SNORD3C 0.77 7.38E-04 1.84E-02 ENSG00000249173 LINC01093 1.60 8.25E-04 1.99E-02 ENSG00000128918 ALDH1A2 0.59 9.44E-04 2.19E-02 ENSG00000249138 SLED1 1.28 1.04E-03 2.30E-02 ENSG00000188996 HUS1B 0.71 1.20E-03 2.51E-02 ENSG00000255346 NOX5 0.61 1.20E-03 2.51E-02 ENSG00000258484 SPESP1 0.61 1.20E-03 2.51E-02 ENSG00000101542 CDH20 0.62 1.36E-03 2.69E-02 ENSG00000185933 CALHM1 -0.70 1.71E-03 3.12E-02 ENSG00000213088 ACKR1 1.16 1.86E-03 3.28E-02 ENSG00000272273 IER3-AS1 0.83 1.97E-03 3.38E-02 ENSG00000126251 GPR42 0.80 1.98E-03 3.39E-02 ENSG00000234323 LINC01505 -0.75 2.50E-03 4.00E-02 ENSG00000206737 RNVU1-18 0.74 2.60E-03 4.11E-02 ENSG00000125968 ID1 1.00 2.92E-03 4.40E-02 ENSG00000255545 LOC283177 -0.92 2.92E-03 4.40E-02

ENSG00000235488 JARID2-AS1 0.69 3.01E-03 4.47E-02 ENSG00000173349 SFT2D3 -5.28 3.16E-03 4.61E-02 ENSG00000074590 NUAK1 -0.75 3.23E-03 4.66E-02 ENSG00000076864 RAP1GAP 1.05 3.33E-03 4.72E-02 ENSG00000204882 GPR20 -0.69 3.35E-03 4.74E-02 ENSG00000207205 RNVU1-15 0.82 3.38E-03 4.77E-02 ENSG00000271880 AGAP11 -0.76 3.58E-03 4.90E-02 ENSG00000131459 GFPT2 -0.87 3.60E-03 4.92E-02 ENSG00000166831 RBPMS2 -0.65 3.62E-03 4.92E-02

ENSEMBL: ENSEMBL ID; Symbol: Gene Symbol; log2FC: Log2 value of fold change; pvalue: P-value; padj: adjusted P-value

Table S14 The over-represented pathways in genes harboring rare variants based on KEGG Pathways database. GeneSet Description Size Overlap Expect EnrichmentRatio Pvalue hsa04918 Thyroid hormone synthesis 74 3 0.23 13.17 1.43E-03 hsa04211 Longevity regulating pathway 89 3 0.27 10.95 2.44E-03 hsa04142 Lysosome 123 3 0.38 7.92 6.07E-03 hsa04915 Estrogen signaling pathway 137 3 0.42 7.11 8.17E-03 hsa04141 Protein processing in endoplasmic reticulum 165 3 0.51 5.90 1.36E-02 hsa04623 Cytosolic DNA-sensing pathway 63 2 0.19 10.31 1.58E-02 hsa04927 Cortisol synthesis and secretion 64 2 0.20 10.15 1.63E-02 hsa05203 Viral carcinogenesis 201 3 0.62 4.85 2.29E-02 hsa04911 Insulin secretion 85 2 0.26 7.64 2.77E-02 hsa05163 Human cytomegalovirus infection 225 3 0.69 4.33 3.06E-02

Table S15 The over-represented pathways in differentially expressed genes of polyarticular and oligoarticular JIA based on KEGG Pathways database. GeneSet Description Size Overlap Expect EnrichmentRatio Pvalue FDR hsa04657 IL-17 signaling pathway 93 13 0.82 15.82 8.72E-13 2.84E-10 hsa04668 TNF signaling pathway 110 11 0.97 11.32 2.33E-09 3.79E-07 hsa04064 NF-kappa B signaling pathway 95 9 0.84 10.72 1.21E-07 1.31E-05 hsa04621 NOD-like receptor signaling pathway 168 11 1.48 7.41 1.98E-07 1.61E-05 hsa04625 C-type lectin receptor signaling pathway 104 9 0.92 9.79 2.66E-07 1.73E-05 hsa05134 Legionellosis 55 7 0.49 14.40 4.41E-07 2.40E-05 hsa05144 Malaria 49 6 0.43 13.86 3.92E-06 1.64E-04 hsa05133 Pertussis 76 7 0.67 10.42 4.11E-06 1.64E-04 hsa05167 Kaposi sarcoma-associated herpesvirus infection 186 10 1.64 6.08 4.53E-06 1.64E-04 hsa05132 Salmonella infection 86 7 0.76 9.21 9.42E-06 3.07E-04 hsa05323 Rheumatoid arthritis 90 7 0.80 8.80 1.27E-05 3.78E-04 hsa04380 Osteoclast differentiation 128 8 1.13 7.07 1.49E-05 4.05E-04 hsa04933 AGE-RAGE signaling pathway in diabetic complications 99 7 0.87 8.00 2.39E-05 5.98E-04 hsa05142 Chagas disease (American trypanosomiasis) 102 7 0.90 7.77 2.90E-05 6.75E-04 hsa04620 Toll-like receptor signaling pathway 104 7 0.92 7.62 3.29E-05 7.15E-04 hsa05140 Leishmaniasis 74 6 0.65 9.18 4.37E-05 8.91E-04 hsa04010 MAPK signaling pathway 295 11 2.61 4.22 4.67E-05 8.96E-04 hsa05164 Influenza A 171 8 1.51 5.29 1.19E-04 2.15E-03 hsa01523 Antifolate resistance 31 4 0.27 14.60 1.46E-04 2.51E-03 hsa05161 Hepatitis B 144 7 1.27 5.50 2.58E-04 4.20E-03 hsa04932 Non-alcoholic fatty liver disease (NAFLD) 149 7 1.32 5.32 3.18E-04 4.93E-03 hsa04931 Insulin resistance 107 6 0.95 6.35 3.40E-04 5.04E-03 hsa05219 Bladder cancer 41 4 0.36 11.04 4.41E-04 6.24E-03 hsa04012 ErbB signaling pathway 85 5 0.75 6.66 8.79E-04 1.19E-02

hsa05210 Colorectal cancer 86 5 0.76 6.58 9.27E-04 1.21E-02 hsa04060 Cytokine-cytokine receptor interaction 294 9 2.60 3.46 1.03E-03 1.25E-02 hsa04068 FoxO signaling pathway 132 6 1.17 5.14 1.04E-03 1.25E-02 hsa05168 Herpes simplex infection 185 7 1.63 4.28 1.16E-03 1.35E-02 hsa05418 Fluid shear stress and atherosclerosis 139 6 1.23 4.88 1.35E-03 1.52E-02 hsa05166 Human T-cell leukemia virus 1 infection 255 8 2.25 3.55 1.71E-03 1.86E-02 hsa04659 Th17 cell differentiation 107 5 0.95 5.29 2.45E-03 2.56E-02 hsa05321 Inflammatory bowel disease (IBD) 65 4 0.57 6.96 2.51E-03 2.56E-02 hsa05120 Epithelial cell signaling in Helicobacter pylori infection 68 4 0.60 6.66 2.96E-03 2.93E-02 hsa04920 Adipocytokine signaling pathway 69 4 0.61 6.56 3.13E-03 3.00E-02 hsa05020 Prion diseases 35 3 0.31 9.70 3.52E-03 3.11E-02 hsa05143 African trypanosomiasis 35 3 0.31 9.70 3.52E-03 3.11E-02 hsa05163 Human cytomegalovirus infection 225 7 1.99 3.52 3.53E-03 3.11E-02 hsa05332 Graft-versus-host disease 41 3 0.36 8.28 5.53E-03 4.74E-02

Table S16 The over-represented pathways of differentially expressed genes in systemic JIA based on KEGG Pathways database. GeneSet Description Size Overlap Expect EnrichmentRatio Pvalue FDR hsa04668* TNF signaling pathway 110 17 5.05 3.37 9.38E-06 3.06E-03 hsa04659* Th17 cell differentiation 107 16 4.91 3.26 2.63E-05 4.28E-03 hsa05142* Chagas disease (American trypanosomiasis) 102 15 4.68 3.20 5.72E-05 5.61E-03 hsa04658 Th1 and Th2 cell differentiation 92 14 4.22 3.31 6.88E-05 5.61E-03 hsa04650 Natural killer cell mediated cytotoxicity 131 17 6.02 2.83 9.42E-05 6.14E-03 hsa05134* Legionellosis 55 10 2.53 3.96 1.69E-04 9.16E-03 hsa04064* NF-kappa B signaling pathway 95 13 4.36 2.98 3.69E-041.72E-02 hsa05163* Human cytomegalovirus infection 225 22 10.33 2.13 6.25E-04 2.55E-02 hsa05169 Epstein-Barr virus infection 201 20 9.23 2.17 8.81E-04 3.00E-02 hsa05120* Epithelial cell signaling in Helicobacter pylori infection 68 10 3.12 3.20 9.86E-04 3.00E-02 hsa05162 Measles 132 15 6.06 2.47 1.01E-03 3.00E-02 hsa05215 Prostate cancer 97 12 4.45 2.69 1.53E-03 3.92E-02 hsa04621* NOD-like receptor signaling pathway 168 17 7.72 2.20 1.76E-03 3.92E-02 hsa05200 Pathways in cancer 526 39 24.16 1.61 1.82E-03 3.92E-02 hsa05140* Leishmaniasis 74 10 3.40 2.94 1.91E-03 3.92E-02 hsa05145 Toxoplasmosis 113 13 5.19 2.51 1.93E-03 3.92E-02 hsa05167* Kaposi sarcoma-associated herpesvirus infection 186 18 8.54 2.11 2.15E-03 3.92E-02 hsa04010* MAPK signaling pathway 295 25 13.55 1.85 2.16E-03 3.92E-02 hsa05161* Hepatitis B 144 15 6.61 2.27 2.43E-03 4.17E-02 hsa05221 Acute myeloid leukemia 66 9 3.03 2.97 2.99E-03 4.87E-02

*The overlapped pathways with DEGs in polyarticular and oligoarticular JIA subtypes enriched in KEGG Pathways database.

Meng X, et al. Ann Rheum Dis 2021; 80:626–631. doi: 10.1136/annrheumdis-2020-218359