Dnazyme-Based Target-Triggered Rolling-Circle Amplification for High Sensitivity Detection of Micrornas

sensors

Article DNAzyme-Based Target-Triggered Rolling-Circle Ampliﬁcation for High Sensitivity Detection of microRNAs

Chen Liu, Jialun Han, Lujian Zhou, Jingjing Zhang and Jie Du * State Key Laboratory of Marine Resource Utilization in South China Sea, College of Materials Science and Engineering, Hainan University, Haikou 570228, China; [email protected] (C.L.); [email protected] (J.H.); [email protected] (L.Z.); [email protected] (J.Z.) * Correspondence: [email protected]

Received: 7 March 2020; Accepted: 1 April 2020; Published: 3 April 2020

Abstract: MicroRNAs regulate and control the growth and development of cells and can play the role of oncogenes and tumor suppressor genes, which are involved in the occurrence and development of cancers. In this study, DNA fragments obtained by target-induced rolling-circle amplification were constructed to complement with self-cleaving deoxyribozyme (DNAzyme) and release fluorescence biomolecules. This sensing approach can affect multiple signal amplification permitting fluorescence 1 detection of microRNAs at the pmol L− level hence affording a simple, highly sensitive, and selective low cost detection platform.

Keywords: microRNAs; deoxyribozyme; rolling-circle ampliﬁcation; signal ampliﬁcation

1. Introduction MicroRNAs are endogenous small RNAs that regulate genes, almost all of which are associated with known physiological or pathological processes, thus can reflect a person’s health status [1]. Furthermore, certain microRNAs are involved in the formation and death of tumor cells, and the expression of microRNAs changes during these processes [2], thus cancer may be detected, treated, and also prevented by studying such changes. Biological microRNAs may serve as a drug or as a diagnostic tool in disease treatment [3,4]. In addition to oncology disease, there are many other conditions associated with microRNAs, including diabetes, Parkinson’s disease, cardiovascular disease [5], HIV, and nervous system conditions [6]. In these diseases, it is equally important to monitor the expression of microRNAs [7]. MicroRNAs are characterized by short sequences, high similarity, and low quantity of expression. Traditional detection methods include mainly real-time quantitative PCR using the microarray method and the RNA imprinting method. However, these methods are not sufficiently sensitive, the detection speed is slow, the equipment is expensive, and operational requirements are demanding [8]. In order to improve these deficiencies, we chose DNA fluorescent biosensor as the research foundation. Rolling circle amplification (RCA) and deoxyribozyme (DNAzyme) were combined to conceive a detection platform with high sensitivity and high selectivity. Fluorescence measurement is attractive because of its high sensitivity, simple operation, and low cost, and because it is widely accepted for biological monitoring purposes [9]. Using reactive dyes as specific probes, Jiang et al. were able to monitor the rolling ring amplification reaction in real time [10]. Wan et al. used a target-assisted self-cleavage of fluorescently modified deoxyribozyme to develop a sensor that can detect different kinds of microRNAs and at the same time amplify the fluorescence signal [11]. Using the self-RCA technology, Chen et al. designed a biosensor for fluorescent signal

Sensors 2020, 20, 2017; doi:10.3390/s20072017 www.mdpi.com/journal/sensors Sensors 2020, 20, 2017 2 of 12 amplification and demonstrated applicability to tumor-related microRNAs, detecting concentrations 1 as low as the fmol L− level [12]. Zhuang et al. described a novel DNA nanomachine constructed using 1 RCA technology and DNAzyme with fmol L− level detection capability to measure microRNAs [13]. Using the specific fluorescence response of thioprotein T to g-tetrad formed by RCA products, hong-xin Jiang et al. designed a microRNA detection platform with detection limit of 4 am, which also proved the feasibility of microRNA analysis in human lung cancer cells [14]. Thus, the combination of RCA and DNAzyme for use as a fluorescence detection platform is viable. Rolling-circle amplification is a novel thermostated nucleic acid amplification technology that can amplify targets as primers and convert deoxyribonucleoside triphosphates (dNTPs) into single-stranded DNA under enzymatic catalysis [15]. The amplified fragment is essentially an infinite number of repeating fragments complementary to circular DNA. The RCA approach has been widely studied and applied in the biomedical field to areas such as whole genome DNA detection, single nucleotide polymorphism detection, in situ cell detection, and immunochip detection [16]. Ge et al. used the target to initiate RCA and in situ fluorescence detection of microRNAs in tumor cells with high sensitivity and ease of operation [17]. Liu et al. developed a simple isothermal DNA amplification method by combining DNA amplification with molecular recognition to obtain DNA index amplification by RNA-cleaving DNAzyme (RCD) and RCA [18]. Zhou et al. exploited RCA to effect chain displacement and detect microRNAs by monitoring changes in fluorescence [19]. Thus, it can be seen that RCA has become a popular signal amplification method for biological analysis, with wide application, simple operation, and high selectivity. DNAzymes are single stranded DNA fragments with phosphodiester cleavage activity, structural recognition ability, and high catalytic activity. Some DNAzymes exhibit metal specificity, however, most DNAzymes require metal ions to initiate activity. Kim et al. studied the metal dependence and activity of 8-17 DNAzyme using a fluorescence resonance energy transfer method [20]. Using a self-dividing DNAzyme that is highly selective for mercury ions, Hollenstein et al. developed a highly selective mercury ion sensor that is not stimulated by any other metal cation and has the advantage of being active over a wide concentration range [21]. Wen et al. used a combination of RCA, nicking enzyme signal amplification, and DNAzyme to devise a highly sensitive colorimetric detection method 1 for microRNA affording detection limits as low as 2 amol L− [22]. The DNAzyme featured specific recognition properties and binds to the RCA, which amplified the detection signal to achieve dual signal amplification. DNAzyme recognized the amplified chain and released the fluorescence by the cleavage of metal ions. The amplified strand may be recycled and continuously combined with DNAzyme to generate enhanced fluorescence. In the present study, we designed a fluorescence biosensor, which consisted of target-induced rolling-loop amplification with Mg2+ recognition and self-cleaving DNAzyme for cyclic amplification of the fluorescence signal of microRNAs. The signal amplification of this sensor is of great significance in the context of ultratrace detection of small biomolecules. The method affords detection limits at 1 the 0.49 pmol L− level and can provide high sensitivity, specificity, and accuracy for measurement of microRNAs in biological assays.

2. Materials and Methods

2.1. Reagents and Materials

2.1.1. Materials The microRNAs, the padlock probe and DNAzyme, were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). T4 DNA ligase, phi29 DNA polymerase, exonuclease I (EXO I), ribonuclease 1 inhibitor, BSA, (NH4)2SO4, and Tris-buﬀer solution (1 mol L− ; pH 8.0) were purchased from Sangon 1 Biotech Co., Ltd. (Shanghai, China). dNTP mix (25 mmol L− each) was purchased from Solarbio. Cell culture-grade ultrapure water was purchased from KeyGEN BioTECH. Magnesium chloride was Sensors 2020, 20, 2017 3 of 12 purchased from Shanghai Macklin Biochemical industry (Shanghai, China). The sequences of nucleic acids employed in this study are given in Table1 in the Supporting Information.

Table 1. DNA sequences.

Name Sequence(5’–3’) pCTGATAAGCTATTTATTTCCTCAATGCTGC Padlock probe TGCTGTACTACTAGTGATTTACTTGGATGTCTTCAACATCAGT TTTATTTCAAACT(Dabcyl)rAGGT(FAM)CTTT DNAzyme TTTTTTGACTCCGAGCCGGACGAAGTTAATGCTG MiR-21 UAGCUUAUCAGACUGAUGUUGA MiR-16 UAGCAGCACGUAAAUAUUGGCG mut-miR-21 UAGCUUAACAGACUGAUGUUGA Single RNA UUGUACUACACAAAAGUACUG

2.1.2. Construction of the Circulating Detection Platform

1 1 The Tris-HCl buffer (1 mol L− ; pH 8.0) was diluted to 30 mmol L− (pH 8.0) with ultrapure 1 2+ 1 water. The (NH4)2SO4 solution (500 mmol L− ) and the Mg solution (15 mmol L− ) were stored at room temperature. 1 The microRNAs were diluted to 10 µmol L− with DEPC (diethyl decarbonate) water. The padlock 1 1 probe and DNAzyme were diluted to 2 µmol L− with Tris-HCl buffer (30 mmol L− ; pH 8.0) and heated to 90 ◦C. After 5 min, the solutions were placed in a refrigerator at –20 ◦C for rapid cooling. Next 1 1 the following solutions were prepared: (1) 20 mg mL− BSA, 40 U ml− ribonuclease inhibitor, 4Ku 1 1 EXO I and 25mmol L− dNTPs; (2) T4 DNA ligase and ligase buffer (pH 7.8, 400 mmol L− Tris-HCl, 100 1 1 1 1 mmol L− MgCl2, 100mmol L− DTT, 5 mmol L− ATP); (3) 10 U µL− phi29 DNA polymerase; (4) 10 X 1 1 1 reaction buffer (330 mmol L− ), Tris-acetate (pH 7.9 at 37 ◦C), 1% (v v− ), Tween 20, 660 mmol L− 1 K-acetate, 10 mmol L-1 DTT, 100 mmol L− Mg-acetate. All the above reagents were stored in a refrigerator at 4 ◦C.

2.1.3. Instrumentation Fluorescence measurements were performed with a ﬂuorescence spectrophotometer (Model RF-6000; Shimadzu, Kyoto, Japan). The ﬂuorescence dye used was FAM with excitation and emission wavelengths of 494 nm and 522 nm, respectively. The wavelength range for spectral scanning was 494–560 nm.

2.2. Method

2.2.1. Design Strategy for miR-21 Detection As shown in Figure1, the target microRNA was used as a cyclization template and primer to achieve the RCA reaction. The RCA amplifies the padlock probe fragment to form a long-stranded DNA product with hundreds of repeats, which can be combined with a fluorescently labeled DNAzyme chain to form a target-assisted self-cleaving DNAzyme. Cleavage resulted in a long chain product releasing from the DNAzyme probe, making the dyes apart from the quenchers. After Mg2+ cleavage of DNAzyme, the quenching fluorescence of DNAzyme was recovered, and the DNA strands after cleavage were separated from the RCA products. The long chain product can freely combine with the next deoxyribozyme to form the hairpin structure, generate activity, and continue to be cut by Mg2+, and thus drives another catalytic cycle. Sensors 2019, 19, x FOR PEER REVIEW 4 of 13 combineSensors 2020 with, 20, the 2017 next deoxyribozyme to form the hairpin structure, generate activity, and continue4 of 12 to be cut by Mg2+, and thus drives another catalytic cycle.

FigureFigure 1. 1. Schematic ofof microRNA microRNA detection detection based based on rolling on rolling circle amplificationcircle amplification (RCA) and (RCA) DNAzyme. and DNAzyme. The two ends of the padlock probe are, specifically, complementary to the target nucleic acid sequence,The two and ends are of ligated the padlock into a loop probe under are, thespecific actionally, of T4complementary DNA ligase; however, to the target when nucleic a mismatch acid sequence,occurs, the and ligation are ligated reaction into of a the loop probe under cannot the beaction completed. of T4 DNA T4 DNA ligase; ligase however, can repair when single-stranded a mismatch occurs,incisions the in ligation the DNA reaction/RNA complex, of the probe connecting cannot the be stickycompleted. and terminal T4 DNA ends ligase of DNA, can repair and catalyzing single- strandedthe formation incisions of phosphodiester in the DNA/RNA bonds complex, between connecting the adjacent the 5’sticky phosphate and terminal groups ends and the of DNA, 3’ hydroxyl and catalyzingterminal endsthe formation of DNA. of Using phosphodiester the cyclized bonds probe between as a template, the adjacent microRNA 5’ phosphate serves asgroups a primer, and the and 3’is hydroxyl extended terminal by the phi29 ends DNAof DNA. polymerase Using the and cycl dNTPsized probe to generate as a template long-chain, microRNA DNA of hundredsserves as a of primer,tandem and repeats. is extended Thus, concentrationby the phi29 DNA and amplificationpolymerase and of thedNTPs detection to generate signal long-chain are realized. DNA At thisof hundredspoint, the of free tandem deoxynuclease repeats. chainThus, andconcentratio the RCAn products and amplification complement of each the otherdetection to form signal a hairpin are realized.structure At and this produce point, the “activity.” free deoxynuclease In the presence chain of and Mg the2+, RCA the substrate products fragments complement on each the hairpin other tostructure form a hairpin are cleaved structure and fluorescenceand produce is “activity.” restored. AtIn the the presence same time, of theMg substrate2+, the substrate removes fragments the RCA onproducts the hairpin and drivesstructure another are cleaved catalytic and cycle. fluorescence is restored. At the same time, the substrate removes the RCA products and drives another catalytic cycle. 2.2.2. Ligation Reactions

2.2.2. Ligation Reactions 1 Total of 5 µL of T4 DNA ligase buffer, 1 µL of the padlock probe (25 nmol L− ), an appropriate 1 amountTotal of of MiR-21 5 μL of (the T4 dosageDNA ligase of MiR-21 buffer, in 1 the μL optimized of the padlock test conditions probe (25 was nmol 25 L pmol−1), an L− appropriate) and 0.5 µL amountof ribonuclease of MiR-21 inhibitor (the dosage were placedof MiR-21 in the in samplethe optimized tube (in test the conditions real environment, was 25 5pmolµL of L serum−1) andwere 0.5 μaddedL of ribonuclease into the sample inhibitor tube). were The mixtureplaced in was the incubated sample tube at 65 (in◦C the for real 3 min environment, and held at 375 μ◦CL forof serum 30 min. wereAfter added cooling into at roomthe sample temperature tube). forThe more mixture than was 10 min, incubated 200 U ofatT4 65 DNA°C for ligase 3 minutes and 7.5 andµL held of T4 at DNA 37 °Cligase for 30 bu minutes.ffer were After added cooling and the at solutionroom temperature was held at for 37 more◦C for than 2 hours. 10 minutes, Finally, 200 2 µ UL of ExoT4 DNA I was ligaseadded and and 7.5 the μL solution of T4 DNA was ligase incubated buffer for were 1 hour added at 37 and◦C tothe eliminate solution unreactedwas held at probes. 37 °C for Exo 2 Ihours. is used Finally,to digest 2 single-strandedμL of Exo I was unreacted added and probes the solution so that the was final incubated result is onlyfor 1 a hour ring-locked at 37 °C probe, to eliminate reducing unreactedthe error; probes. the solution Exo I was is used then to inactivated digest single-str by holdinganded at unreacted 80 ◦C for 15 probes min. Theso that probes the werefinal result joined is by onlyligase a ring-locked to form closed probe, circular reducing DNA. the Unused error; samplethe solution may bewas stored then in inactivated a refrigerator by holding (4 ◦C) [23 at]. 80 °C for 15 minutes. The probes were joined by ligase to form closed circular DNA. Unused sample may be2.2.3. stored The in RCA a refrigerator Reactions (4 °C) [23]. Twenty U of phi29 DNA polymerase, 2 µL of phi29 DNA polymerase buffer, 6 µL of dNTP mix, 2.2.3. The RCA Reactions 1 µL of BSA, and 1 µL of (NH4)2SO4 were added to the ligation reaction solution. The RCA reaction was performedTwenty for U 4of h phi29 at 30 ◦DNAC. The polymerase, mixture was 2 then μL of held phi29 for 5DNA min atpolymerase 75 ◦C to inactivate buffer, 6 the μL polymerase. of dNTP mix, 1 μL of BSA, and 1 μL of (NH4)2SO4 were added to the ligation reaction solution. The RCA reaction was performed for 4 h at 30 °C. The mixture was then held for 5 min at 75 °C to inactivate the polymerase.

Sensors 2020, 20, 2017 5 of 12 Sensors 2019, 19, x FOR PEER REVIEW 5 of 13

2.2.4.2.2.4. Fluorescence Fluorescence Signal Signal Amplification Ampliﬁcation based based on on DNAzyme DNAzyme

Total of 2 μL of DNAzyme, 12 μL of Mg2+2+, and 6 μL of Tris-HCl buffer (1 mol L−11; pH 8.0) were Total of 2 µL of DNAzyme, 12 µL of Mg , and 6 µL of Tris-HCl buﬀer (1 mol L− ; pH 8.0) were added to the RCA product solution and the mixture was incubated at 37 °C for 2 hours. The final added to the RCA product solution and the mixture was incubated at 37 ◦C for 2 hours. The ﬁnal product was stored in a refrigerator (4 °C). product was stored in a refrigerator (4 ◦C).

3.3. Results Results and and Discussion Discussion

3.1.3.1. Feasibility Feasibility Study Study TheThe feasibility feasibility of of the the experiment experiment was was demonstr demonstratedated for forthe theRCA RCA and andDNAzyme DNAzyme reaction reaction by the by releasethe release of fluorescence, of fluorescence, which which was initiated was initiated by the by different the diff erentconcentrations concentrations of target of targetmiR-21. miR-21. The −1 1 spectrumThe spectrum for 5 pmol for 5 pmolL miR-21 L− miR-21 (blue color) (blue in color) Figure in Figure2 indicates2 indicates that the that fluorescence the fluorescence intensity intensity of the detectionof the detection platform platform was slightly was slightlyhigher than higher the than fluorescence the fluorescence intensity intensity of the DNAyme of the DNAyme itself (black itself color)(black without color) without addition addition of the target of the miR-21. target The miR-21. fluorescence The fluorescence spectra corresponding spectra corresponding to the different to the −1 1 −1 1 targetdifferent concentrations, target concentrations, that is, that5 pmol is, 5 L pmol, 25 L −pmol, 25 pmolL , are L− ,represented are represented by byblue blue and and red red colors, colors, respectively.respectively. It It can can be be seen seen that that as as the the concentrat concentrationion increases, increases, the the fluorescence fluorescence intensity intensity released released by by thethe detection detection platform increasesincreases progressively.progressively. Compared Compared with with the the DNAzyme DNAzyme detection detection platform, platform, the thefluorescence fluorescence intensity intensity increases increases more more than than 1-fold, 1-fold, indicating indicating the participation the participation of miR-21 of miR-21 in the reaction in the reactionprocess, process, thus confirming thus confirming the feasibility the feasibility of the detectionof the detection platform platform for RCA for amplificationRCA amplification and cyclic and cycliccapture capture of DNAzyme of DNAzyme and cleavage, and cleavage, and release and release of fluorescence. of fluorescence.

FigureFigure 2. 2. FluorescenceFluorescence spectra spectra for for various various concentrations concentrations of of miR-21. miR-21. 3.2. Optimization Studies 3.2. Optimization Studies 3.2.1. Padlock Probe 3.2.1. Padlock Probe For a constant concentration of DNAzyme and fixed conditions for other experimental parameters, the eForffect a on constant fluorescence concentration of varying of the DNAzyme concentration an ofd thefixed padlock conditions probe for was other investigated. experimental As can parameters,be seen from the Figure effect3, theon fluorescencefluorescence intensity of vary increaseding the concentration gradually with of the the increase padlock in theprobe padlock was investigated. As can be seen from Figure 3, the fluorescence intensity increased gradually1 with the probe concentration reaching a maximum intensity at a concentration of 25 nmol L− , beyond which increasethere was in athe slight padlock decrease probe in concentration fluorescence signal. reaching Therefore, a maximum the concentration intensity at a ofconcentration the padlock probeof 25 nmol L−1, beyond which there1 was a slight decrease in fluorescence signal. Therefore, the was maintained at 25 nmol L− in subsequent experiments. concentration of the padlock probe was maintained at 25 nmol L−1 in subsequent experiments.

Sensors 2019, 19, x FOR PEER REVIEW 6 of 13 SensorsSensors2020 2019, 20, ,19 2017, x FOR PEER REVIEW 6 of6 of 12 13

Figure 3. Effect of padlock probe concentration on fluorescence intensity. Figure 3. Effect of padlock probe concentration on fluorescence intensity. 3.2.2. T4 DNA Ligase 3.2.2. T4 DNA Ligase In the cyclization reaction, the type and content of the ligase is critical, given that the ligase affects the rateIn and the quantity cyclization of ringreaction, formation. the type T4 DNAand content ligase isof capable the ligase of linkingis critical, the given two adjacent that the ends ligase andaffects the RNA the rate template and quantity complementary of ring formation. to the padlock T4 DNA probe. ligase To optimizeis capable the of linking dose, several the two di ffadjacenterent detectionends and platforms the RNA were template constructed. complementary In the absence to the of padlock ligase, the probe. probe To is hydrolyzedoptimize the by dose, Exo Iseveral and cannotdifferent form detection a ring [24 platforms]. With regard were to constructed. Figure4a and In the the fluorescence absence of ligase, released the by probe di fferent is hydrolyzed amounts of by T4Exo DNA I and ligase, cannot maximum form a ring fluorescence [24]. With was regard realized to Figure for 200 4a U.and Further, the fluorescence from inspection released of Figureby different4b, it canamounts be seen of T4 that DNA the fluorescenceligase, maximum intensities fluorescence for 200, was 225, realized and 250 for U 200 T4 DNAU. Further, ligase from were inspection similar, indicatingof Figure that 4b, evenit can if be the seen amount that ofthe ligase fluorescence was increased, intensities the amount for 200, of 225, cyclization and 250 hadU T4 reached DNA ligase the limitwere such similar, that fluorescence indicating that would even not if increase. the amount Thus, of 200ligase U was was considered increased, to the be amount the optimal of cyclization amount ofhad ligase reached for the the sensor limit platform. such that fluorescence would not increase. Thus, 200 U was considered to be the optimal amount of ligase for the sensor platform.

Figure 4. (a) Fluorescence spectra for various T4 DNA ligase concentrations; (b) comparison of Figure 4. (a) Fluorescence spectra for various T4 DNA ligase concentrations; (b) comparison of fluorescence intensities for various ligase concentrations. fluorescence intensities for various ligase concentrations. 3.2.3. Phi29 DNA Polymerase 3.2.3. Phi29 DNA Polymerase Polymerase plays a very important role in the entire RCA reaction and only when the polymerase Polymerase plays a very important role in the entire RCA reaction and only when the acts canPolymerase the entire reaction plays bea initiated.very important The phi29 role DNA in polymerasethe entire RCA used inreaction the present and experimentonly when has the polymerase acts can the entire reaction be initiated. The phi29 DNA polymerase used in the present highpolymerase polymerase acts activity can the and entire scalability, reaction and be can initia generateted. The chain phi29 replacement DNA polymerase reactions used by itself in the without present experiment has high polymerase activity and scalability, and can generate chain replacement theexperiment help of any has additional high polymerase proteins. Inactivity the presence and scalability, of phi29 DNAand can polymerase generate and chain dNTPs, replacement chain reactions by itself without the help of any additional proteins. In the presence of phi29 DNA extensionreactions can by be itself carried without out continuously. the help of Conversely,any additional RCA proteins. reactions In can the be presence difficult toof implement.phi29 DNA polymerase and dNTPs, chain extension can be carried out continuously. Conversely, RCA reactions Inpolymerase this experiment, and dNTPs, as shown chain in Figureextension5a, itcan is alsobe ca evidentrried out that continuously. the fluorescence Conversely, intensity RCA increased reactions can be difficult to implement. In this experiment, as shown in Figure 5a, it is also evident that the

Sensors 2020, 20, 2017 7 of 12

SensorsSensors 20192019,, 1919,, xx FORFOR PEERPEER REVIEWREVIEW 77 ofof 1313 significantly when the amount of the enzyme increased from 10 U to 20 U. Thereafter, when the fluorescence intensity increased significantly when the amount of the enzyme increased from 10 U to fluorescenceamount of intensity enzyme increased increased, significantly the increase when trend the of amount fluorescence of the intensity enzyme increased decreased. from The 10 relative U to 20 U. Thereafter, when the amount of enzyme increased, the increase trend of fluorescence intensity 20changes U. Thereafter, in fluorescence when the are amount illustrated of enzyme in Figure increa5b,sed, however, the increase when thetrend polymerase of fluorescence was greater intensity than decreased. The relative changes in fluorescence are illustrated in Figure 5b, however, when the decreased.20 U, the The effects relative on the changes fluorescence in fluorescence response are ar note illustrated so clear cut. in Figure For cost 5b, purposes, however, the when amount the of polymerase was greater than 20 U, the effects on the fluorescence response are not so clear cut. For polymerasepolymerase was used greater in subsequent than 20 U, experiments the effects on was th 20e fluorescence U. response are not so clear cut. For costcost purposes,purposes, thethe amountamount ofof polymerasepolymerase usedused inin subsequentsubsequent experimentsexperiments waswas 2020 U.U.

FigureFigureFigure 5.5. 5.((aa))( aFluorescenceFluorescence) Fluorescence spectraspectra spectra forfor for variousvarious various dosesdoses doses ofof ofphi29phi29 phi29 DNADNA DNA polymerase;polymerase; polymerase; ((bb) () b FluorescenceFluorescence) Fluorescence increaseincreaseincrease percentagepercentage percentage comparisoncomparison comparison chartchart chart (521(521 (521 nm).nm). nm). 3.2.4. The Concentration of dNTPs 3.2.4.3.2.4. TheThe ConcentrationConcentration ofof dNTPsdNTPs Deoxyribonucleoside triphosphates (dNTPs) include dCTP, dGTP, dATP, dTTP, which are the DeoxyribonucleosideDeoxyribonucleoside triphosphatestriphosphates (dNTPs)(dNTPs) includeinclude dCTP,dCTP, dGTP,dGTP, dATP,dATP, dTTP,dTTP, whichwhich areare thethe basic raw materials required for PCR amplification, fluorescence quantification, reverse transcription, basicbasic rawraw materialsmaterials requiredrequired forfor PCRPCR amplification,amplification, fluorescencefluorescence quantification,quantification, reversereverse transcription,transcription, sequencing, and labeling. The dNTPs play a key role in providing energy and the raw materials for the sequencing,sequencing, andand labeling.labeling. TheThe dNTPsdNTPs playplay aa keykey rolerole inin providingproviding energyenergy andand thethe rawraw materialsmaterials forfor DNA amplification. As can be seen in Figure6a,b, as the concentration of the dNTPs increased above thethe DNADNA amplification.amplification.1 AsAs cancan bebe seenseen inin FigureFigure 6a,6a, b,b, asas thethe concentrationconcentration ofof thethe dNTPsdNTPs increasedincreased 0.075 mmol L− , the fluorescence intensity of the system hardly changed. Thus, it can be inferred at aboveabove 0.0750.075 mmolmmol LL−−11,, thethe fluorescencefluorescence intensityintensity ofof thethe systemsystem hardlyhardly changed.changed. Thus,Thus, itit cancan bebe inferredinferred this point that the concentration of the dNTPs had little effect on the length of the RCA product, which atat thisthis pointpoint thatthat thethe concentrationconcentration ofof thethe dNTPsdNTPs hahadd littlelittle effecteffect onon thethe lengthlength ofof thethe RCARCA product,product, 1 was governed by the polymerization ability of phi29 DNA polymerase. Accordingly, 0.075 mmol L− whichwhich waswas governedgoverned byby thethe polymerizationpolymerization abilityability ofof phi29phi29 DNADNA polymerase.polymerase. Accordingly,Accordingly, 0.0750.075 of dNTPs was used in subsequent experiments. mmolmmol LL−−11 ofof dNTPsdNTPs waswas usedused inin subsequentsubsequent experiments.experiments.

Figure 6. (a) Optimization map of dNTPs dose in RCA. (b) The effect of various concentrations of FigureFigure 6.6. ((aa)) OptimizationOptimization mapmap ofof dNTPsdNTPs dosedose inin RCA.RCA. ((bb)) TheThe effecteffect ofof variousvarious concentrationsconcentrations ofof dNTPs on fluorescence (521 nm). dNTPsdNTPs onon fluorescencefluorescence (521nm).(521nm). 3.2.5. The Concentration of Mg2+ 3.2.5.3.2.5. TheThe ConcentrationConcentration ofof MgMg2+2+ The catalytic activity of DNAzyme is dependent on certain metal ions. In this experiment, we detectedTheThe catalyticcatalytic the fluorescence activityactivity ofof of DNAzymeDNAzyme 8-17 DNAzyme isis dependentdependent under theonon certaincertain action ofmetalmetal RCA ions.ions. product InIn thisthis and experiment,experiment, Mg2+ cleavage. wewe 2+2+ detecteddetectedFigure7 theathe shows fluorescencefluorescence that as the ofof Mg8-178-172 +DNAzymeDNAzymeconcentration underunder was thethe increased, actionaction ofof the RCARCA fluorescence productproduct andand intensity MgMg cleavage.cleavage. underwent FigureFigure 7a7a showsshows thatthat asas thethe MgMg2+2+ concentrationconcentration waswas increased,increased, thethe fluorescencefluorescence intensity1intensity underwentunderwent stepwise increases, but further increases in concentration beyond 0.09 mmol L− resulted in a decrease stepwisestepwise increases,increases, butbut furtherfurther increasesincreases inin concentrationconcentration beyondbeyond 0.090.09 mmolmmol LL−−11 resultedresulted inin aa decreasedecrease inin fluorescencefluorescence intensities.intensities. ThisThis trendtrend inin thethe fluorescencefluorescence responseresponse cancan bebe moremore clearlyclearly

Sensors 2020, 20, 2017 8 of 12

SensorsSensors 2019 2019, 19,, 19x FOR, x FOR PEER PEER REVIEW REVIEW 8 of8 13of 13 in fluorescence intensities. This trend in the fluorescence response can be more clearly discerned in discerneddiscerned in inFigure Figure 7b, 7b, where where the the fluorescence fluorescence intensity intensity reached reached a 2maximum +a maximum at Mgat Mg2+ concentration2+ concentration1 Figure7b, where the fluorescence intensity reached a maximum at Mg concentration of 0.09 mmol L− . of of0.09 0.09 mmol mmol L− 1L. −1.

2+ Figure 7. (a) Fluorescence spectra for various concentrations of Mg2+ .(b) Fluorescence intensity FigureFigure 7. (7.a) (Fluorescencea) Fluorescence spectra spectra for for various various concentrations concentrations of Mgof Mg2+. (b. )( bFluorescence) Fluorescence intensity intensity (521 (521 2+ (521 nm) as a function of Mg2+ concentration. nm)nm) as aas function a function of Mgof Mg2+ concentration. concentration. 3.2.6. miR-21 Detection 3.2.6.3.2.6. miR-21 miR-21 Detection Detection The miR-21 platform was constructed by using the optimized set of experimental conditions The miR-21 platform was constructed by using the optimized set of experimental conditions as as outlinedThe miR-21 above platform and using was preparedconstructed samples by using of th dieff optimizederent concentrations set of experimental for the RCA conditions reaction. as outlined above and using prepared samples of different concentrations for the RCA reaction. The outlinedThe results above obtained and using are shown prepared in Figure samples8a. The of fluorescencedifferent concentrat of the DNAzymeions for the itself RCA gave reaction. the lowest The results obtained are shown in Figure 8a. The fluorescence of the DNAzyme itself gave the lowest resultsfluorescence obtained intensity are shown of the in detection Figure 8a. platform. The fluorescence The addition of the of DNAzyme miR-21 initiates itself gave a rolling the lowest circle fluorescencefluorescence intensity intensity of ofthe the detection detection platform. platform. The The addition addition of ofmiR-21 miR-21 initiates initiates a rollinga rolling circle circle1 amplification reaction to increase the fluorescence of the detection platform. On addition of 5 pmol L− amplification reaction to increase the fluorescence of the detection platform. On addition of 5 pmol amplificationmiR-21, the fluorescence reaction to ofincrease the system the fluorescence did increased. of When the detection the concentration platform. of On miR-21 addition was of increased 5 pmol −1 L−1L miR-21, miR-21, the 1the fluorescence fluorescence of ofthe the system system did did in creased.increased. When When the the concentration concentration of ofmiR-21 miR-21 was was to 25 pmol L− , a very high fluorescence response was detected, indicating that the target of this increased to 25 pmol− 1L−1, a very high fluorescence response was detected, indicating that the target of increasedconcentration to 25 was pmol highly L , a utilizedvery high in fluorescence the system and response released was a largedetected, amount indicating of fluorescence. that the target As the of thisthis concentration concentration was was highly highly utilized utilized in inthe the system system and and released released a1 large a large amount amount of1 offluorescence. fluorescence. As As concentration of miR-21 was gradually increased from 5 pmol L− to 25 pmol L− , the fluorescence the concentration of miR-21 was gradually increased from 5 pmol− 1L−1 to 25 pmol− 1L−1, the fluorescence theintensity concentration of the system of miR-21 increased was gradually in a regular increased manner. from After 5 severalpmol L parallel to 25 pmol experiments L , the fluorescence (n = 5), error intensity of the system increased in a regular manner. After several parallel experiments（（n =） 5）, intensityanalysis wasof the carried system out increased on the obtained in a regula data,r manner. as shown After in several Figure8 b.parallel In the experiments figure, the standardn = 5 , error analysis was carried out on the obtained data, as shown in Figure 8b. In the figure, the standard errordeviation analysis of the was detected carried values out on of th eache obtained concentration data, as is shown less than in Figure 0.03. It 8b. indicates In the thatfigure, the the repeatability standard deviation of the detected values of each concentration is less than 0.03. It indicates that the deviationof the sensor of isthe acceptable. detected values of each concentration is less than 0.03. It indicates that the repeatabilityrepeatability of ofthe the sensor sensor is acceptable.is acceptable.

FigureFigure 8. ( (8.aa) ) (Fluorescencea Fluorescence) Fluorescence spectra spectra spectra for for for various various various concentrations concentrations concentrations of miR-21. of miR-21. ( (b) )( Plotb Plot) Plot for for for the the the dependence dependence dependence of of fluorescenceﬂuorescencefluorescence intensity intensity on on miR-21 miR-21 concentration.co ncentration.concentration. Error Error Error bars bars indicate indicate five ﬁve five consecutive consecutive measurements measurements performedperformed at each at each concentration concentration (n =(n 5).5). = 5).

In Inthe the real real environment, environment, samples samples were were tested tested five five five times, times, and and the the results results obtained obtained are are shown shown in in FigureFigure 99a.a. 9a. TheThe The overalloverall overall fluorescencefluorescence fluorescence intensityintensity intensity waswas was higherhigher higher thanthan than thatthat that inin FigureinFigure Figure8 b.8b. 8b. The The The fluorescence fluorescence fluorescence increasesincreases regularly regularly regularly in in inFigure Figure Figure 99a,a, 9a, whichwhich which isis theisthe the samesame same asas theasthe the trendtrend trend ofof detectingofdetecting detecting targetstargets targets inin theinthe the bubuffer bufferffer environment.environment. The The standard standard curve curve is obtainedis obtained accordin according tog tothe the detection detection data, data, as asshown shown in inFigure Figure 9b, 9b, pinkpink curve curve equation equation Y =Y 279.2198+6.09179= 279.2198+6.09179 X (whereX (where Y =Y F=（ MicroRNAF（MicroRNA concentration concentration）) ）and) and the the detection detection limit limit

Sensors 2020, 20, 2017 9 of 12

environment.Sensors 2019, 19, x TheFOR standardPEER REVIEW curve is obtained according to the detection data, as shown in Figure9 of9 b,13 pink curve equation Y = 279.2198 + 6.09179 X (where Y = F(MicroRNA concentration)) and the detection − 1 − 1 limitcan be can as low be as as low 0.49 as pmol 0.49 L pmol1 (according L− (according to the LOD to the = 3σ LOD/ S == 0.493σ /pmolS = 0.49 L 1), pmol which L −had), whicha correlation had a 2 correlationcoefficient close coeffi tocient 1 (Pearson's close to 1 r (Pearson’s = 0.99664, rr=2 =0.99664, 0.99106). r The= 0.99106). black curve The blackequation curve Y = equation 301.57393 Y =+ 301.573939.21947 X +is 9.21947the standard X is the curve standard of the curve real sample of the real in the sample serum in environment the serum environment (Pearson's (Pearson’sr = 0.99588, r =r2 2 0.99588,= 0.98904). r =It0.98904). can be seen It can that be the seen fluorescence that the fluorescence of serum of samples serum samplesis slightly is slightlyhigher higherthan that than of thatthe ofdetection the detection system, system, showing showing a linear a linear trend. trend. A standard A standard curve curve is formed is formed between between the concentration the concentration of 5 1 1 ofpmol 5 pmol L − 1 Land− and25 pmol 25 pmol L− 1 L, −indicating, indicating that that the the platform platform has has a astrong strong linear linear relationship relationship at at the 1 concentration level of pmol L− . The results demonstrated that the platform provided a feasible concentration level of pmol L−1. The results demonstrated that the platform provided a feasible method for signal amplification and high sensitivity detection of microRNAs. Compared with most othermethod literatures for signal (Table amplification2), the linearity and high of thesensitivity sensor isdetection better and of microRNAs. the detection Compared limit can reachwith most pM. Therefore,other literatures we can (Table conclude 2), the that linearity this method of the isse verynsor suitableis better forand the the detection detection of limit microRNAs can reach in pM. this linearTherefore, range, we providing can conclude a feasible that this scheme method for sensorsis very tosuitable detect for small the molecules. detection of microRNAs in this linear range, providing a feasible scheme for sensors to detect small molecules.

Figure 9. (a) Fluorescence spectra of miR-21miR-21 at didifferentﬀerent concentrationsconcentrations inin serum.serum. (b) TheThe standardstandard curve of miR-21. Table 2. Comparison of other methods for microRNAs detection.

Methods LOD Linear Range Correlation Coefficient (R2) Reference DNA self-assembled molecular tweezers 0.6 pM 1–500 nM 0.9929 [25] Graphene oxide for rapid / 50–400 nM 0.9562 [26] microRNA detection Fluorescence quenching of graphene 3.0fM 0.02–100 pM / [27] oxide integrating A novel DNA nanomachine based on the linear rolling circle 87fM 0.1 pM–0.1 nM 0.9908 [13] amplification strategy Highly sensitive determination of 0.025 pM–2.5 microRNA using target-primed and 0.25pM 0.9994 [23] nM branched rolling-circle amplification Fluorometric determination of microRNA based on strand 1.04fM 10 fM–0.1 nM 0.9957 [19] displacement amplification and rolling circle amplification Cascade amplification by 10pM 10 pM–100 nM / [28] catalytic DNAzymes Fluorescence quenching of gold nanoparticles with a 33.4fM 100 fM–1.0 nM / [29] competitive hybridization DNAzyme-based target-triggered 0.49pM 0–25 pM 0.99106 This work rolling-circle amplification

Sensors 2020, 20, 2017 10 of 12 Sensors 2019, 19, x FOR PEER REVIEW 11 of 13

3.2.7.3.2.7. Selectivity Selectivity of of microRNA microRNA Detection Detection ToTo test for selectivity,selectivity, didifferentfferent primers primers were were used used to to initiate initiate the the RCA RCA reaction reaction and and to evaluateto evaluate the theperformance performance of the of sensor.the sensor. Under Under the same the same conditions, conditions, mut-miR-21, mut-miR-21, single si RNA,ngle miR-16,RNA, miR-16, and miR-21 and miR-21were subjected were subjected to the RCA to the reaction, RCA reaction, respectively. respective Figurely. Figure10 shows 10 shows that because that because of the multipleof the multiple signal signalamplification, amplification, the fluorescence the fluorescence intensity intensity of the of miR-21 the miR-21 sample sample was significantly was significantly enhanced enhanced even ateven the 1 atpmol the Lpmol− level L−1 oflevel the targetof the primer.target primer. The fluorescence The fluorescen intensitiesce intensities for the otherfor the three other primer three samplesprimer 1 1 1 samples(5 nmol L(5− nmolmut-miR-21, L−1 mut-miR-21, 5 nmol 5 L −nmolsingle L−1 single RNA, RNA, and 5 and nmol 5 nmol L− miR-16) L−1 miR-16) were were much much lower lower and anddiffered differed little little from from the fluorescencethe fluorescence intensity intensity of the of DNAzymethe DNAzyme itself. itself. These Thes resultse results confirm confirm that that this thissensor sensor system system is highly is highly sensitive, sensitive, selective, selective, and and specific specific in detecting in detecting microRNA. microRNA.

Figure 10. Speciﬁc detection of miR-21. Figure 10. Specific detection of miR-21. 4. Conclusions 4. Conclusions A highly sensitive and selective microRNA sensor exploiting target-induced RCA and self-cleaving DNAzymeA highly has sensitive been developed. and selective The sensor microRNA exhibited sensor fast response, exploiting the target-induced detection limit canRCA be and as low self- as cleaving DNAzyme1 has been developed. The sensor exhibited fast response, the detection limit can 0.49 pmol L− , and the sensor platform can design target detection platform of diﬀerent concentration − belevels as low by as changing 0.49 pmol the L concentration1, and the sensor of experimental platform can conditions.design target The detection biosensor platform holds of promise different as concentrationa universal platform levels by for changing the analysis the concentration of microRNAs of withexperimental potential conditions. for new applications The biosensor in disease holds promiseprevention as a and universal treatment platform and drug for the discovery. analysis of microRNAs with potential for new applications in disease prevention and treatment and drug discovery. Author Contributions: C.L. and J.D. performed the experiments and wrote the paper; C.L., J.H., L.Z., and J.Z. Authoranalyzed Contributions: the data, and C.L. J.D. conceivedand J.D. performed and designed the experiments the experiments. and wrote All authors the paper; have C.L., read J.H., and L.Z., agreed and to J.Z. the analyzedpublished the version data, ofand the J.D. manuscript. conceived and designed the experiments.

Funding:Funding: TheThe above above scientific scientific research research projec projectsts are are funded funded by by the the National National Na Naturaltural Science Science Foundation Foundation of of China China (Grant(Grant No. No. 21763009), 21763009), Hainan Hainan Provincial Provincial Natural Natural Scienc Sciencee Foundation Foundation of China (Grant No.No. 519MS020), 519MS020), and and Graduate Students Innovation Research Project of Hainan Province (Hys2019-115). Graduate Students Innovation Research Project of Hainan Province (Hys2019-115). Conflicts of Interest: The authors declare no conflicts of interest. Conflicts of Interest: The authors declare no conflicts of interest. References References 1. Liu, Q.; Zhou, N.; Mo, Y.-Y. Oncogenic microRNAs in Cancer. In MicroRNA in Cancer; Springer: Dordrecht, 1. Liu, Q.; Zhou, N.; Mo, Y.-Y. Oncogenic microRNAs in Cancer. In MicroRNA in Cancer; Springer: The Netherlands, 2013. Dordrecht, The Netherlands, 2013. 2. Lujambio, A.; Lowe, S.W. The microcosmos of cancer. Nature 2012, 482, 347–355. [CrossRef][PubMed] 2. Lujambio, A.; Lowe, S.W. The microcosmos of cancer. Nature 2012, 482, 347–355. 3. Thum, T.; Gross, C.; Fiedler, J.; Fischer, T.; Kissler, S.; Bussen, M.; Galuppo, P.; Just, S.; Rottbauer, W.; 3. Thum, T.; Gross, C.; Fiedler, J.; Fischer, T.; Kissler, S.; Bussen, M.; Galuppo, P.; Just, S.; Rottbauer, W.; Frantz, S.; et al. MicroRNA-21 contributes to myocardial disease by stimulating MAP kinase signalling in Frantz, S.; et al. MicroRNA-21 contributes to myocardial disease by stimulating MAP kinase signalling in fibroblasts. Nature 2008, 456, 980–984. [CrossRef][PubMed] fibroblasts. Nature 2008, 456, 980–984. 4. Koscianska, E.; Starega-Roslan, J.; Czubala, K.; Krzyzosiak, W.J. High-resolution northern blot for a reliable 4. Koscianska, E.; Starega-Roslan, J.; Czubala, K.; Krzyzosiak, W.J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. Sci. World J. 2011, 11, 102–117. [CrossRef][PubMed] analysis of microRNAs and their precursors. Sci. World J. 2011, 11, 102–117.

Sensors 2020, 20, 2017 11 of 12

5. Small, E.M.; Olson, E.N. Pervasive roles of microRNAs in cardiovascular biology. Nature 2011, 469, 336–342. [CrossRef][PubMed] 6. Deng, R.; Tang, L.; Tian, Q. Toehold-initiated rolling circle amplification for visualizing individual microRNAs in situ in single cell. Angew. Chem. Int. Ed. Engl. 2014, 53, 2389–2393. [CrossRef] 7. Ardekani, A.M.; Naeini, M.M. The Role of MicroRNAs in Human Diseases. Avicenna J. Med. Biotechnol. 2010, 2, 161. 8. Zhou, Y.; Wang, M.; Meng, X.; Yin, H.; Ai, S. Amplified electrochemical microRNA biosensor using a hemin-G-quadruplex complex as the sensing element. RSC Adv. 2012, 2, 7140. [CrossRef] 9. Tian, T.; Li, L.; Zhang, Y.; Liu, H.; Zhang, L.; Yan, M.; Yu, J. Dual-mode fluorescence biosensor platform based on T-shaped duplex structure for detection of microRNA and folate receptor. Sens. Actuators B Chem. 2018, 261, 44–50. [CrossRef] 10. Jiang, H.-X.; Zhao, M.-Y.; Niu, C.-D.; Kong, D.-M. Real-time monitoring of rolling circle amplification using aggregation-induced emission: Applications in biological detection. Chem. Commun. 2015, 51, 16518–16521. [CrossRef] 11. Wan, Y.-H.; Zhou, Y.-J.; Xiao, K.-J.; Nie, C.-P. Target-assisted self-cleavage DNAzyme probes for multicolor simultaneous imaging of tumor-related microRNAs with signal amplification. Chem. Commun. 2019, 55, 3278–3281. [CrossRef] 12. Chen, Y.-R.; Han, Y.; Liu, R.; Xue, C. Intracellular self-enhanced rolling circle amplification to image specific miRNAs within tumor cells. Sens. Actuators B Chem. 2019, 282, 507–514. [CrossRef] 13. Zhuang, J.; Lai, W.; Chen, G.; Tang, D. A rolling circle amplification-based DNA machine for miRNA screening coupling catalytic hairpin assembly with DNAzyme formation. Chem. Commun. 2014, 50, 2935–2938. [CrossRef][PubMed] 14. Jiang, H.X.; Liang, Z.Z.; Ma, Y.H.; Kong, D.M.; Hong, Z.Y. G-quadruplex fluorescent probe-mediated real-time rolling circle amplification strategy for highly sensitive microRNA detection. Anal. Chim. Acta 2016, 943, 114–122. [CrossRef][PubMed] 15. Wu, Z.S.; Zhang, S.; Zhou, H.; Shen, G.L.; Yu, R. Universal Aptameric System for Highly Sensitive Detection of Protein Based on Structure-Switching-Triggered Rolling Circle Amplification. Anal. Chem. 2010, 82, 2221–2227. [CrossRef][PubMed] 16. Ali, M.M.; Li, F.; Zhang, Z.; Zhang, K. Rolling circle amplification: A versatile tool for chemical biology, materials science and medicine. Chem. Soc. Rev. 2014, 43, 3324–3341. [CrossRef] 17. Ge, J.; Zhang, L.L.; Liu, S.J.; Yu, R.Q.; Chu, X. A highly sensitive target-primed rolling circle amplification (TPRCA) method for fluorescent in situ hybridization detection of microRNA in tumor cells. Anal. Chem. 2014, 86, 1808–1815. [CrossRef] 18. Liu, M.; Yin, Q.; McConnell, E.M.; Chang, Y.; Brennan, J.D.; Li, Y.DNAzyme Feedback Amplification: Relaying Molecular Recognition to Exponential DNA Amplification. Chemistry 2018, 24, 4473–4479. [CrossRef] 19. Zhou, Y.; Li, B.; Wang, M.; Wang, J.; Yin, H.; Ai, S. Fluorometric determination of microRNA based on strand displacement amplification and rolling circle amplification. Microchim. Acta 2017, 184, 4359–4365. [CrossRef] 20. Kim, H.K.; Liu, J.; Li, J.; Nagraj, N.; Li, M.; Pavot, C.M.B.; Lu, Y. Metal-Dependent Global Folding and Activity of the 8-17 DNAzyme Studied by Fluorescence Resonance Energy Transfer. J. Am. Chem. Soc. 2007, 129, 6896–6902. [CrossRef][PubMed] 21. Hollenstein, M.; Hipolito, C.; Lam, C.; Dietrich, D.; Perrin, D.M. A highly selective DNAzyme sensor for mercuric ions. Angew. Chem. Int. Ed. Engl. 2008, 47, 4346–4350. [CrossRef] 22. Wen, Y.; Xu, Y.; Mao, X.; Wei, Y.; Song, H.; Chen, N.; Huang, Q.; Fan, C.; Li, D. DNAzyme-based rolling-circle amplification DNA machine for ultrasensitive analysis of microRNA in Drosophila larva. Anal. Chem. 2012, 84, 7664–7669. [CrossRef][PubMed] 23. Cheng, Y.; Zhang, X.; Li, Z.; Jiao, X.; Wang, Y.; Zhang, Y. Highly sensitive determination of microRNA using target-primed and branched rolling-circle amplification. Angew. Chem. Int. Ed. Engl. 2009, 48, 3268–3272. [CrossRef] 24. Jiang, H.; Xu, Y.; Dai, L.; Liu, X.; Kong, D. Ultrasensitive, label-free detection of T4 ligase and T4 polynucleotide kinase based on target-triggered hyper-branched rolling circle amplification. Sens. Actuators B Chem. 2018, 260, 70–77. [CrossRef] Sensors 2020, 20, 2017 12 of 12

25. Gong, X.; Zhou, W.; Li, D.; Chai, Y.; Xiang, Y.; Yuan, R. RNA-regulated molecular tweezers for sensitive fluorescent detection of microRNA from cancer cells. Biosens. Bioelectron. 2015, 71, 98–102. [CrossRef] [PubMed] 26. Lu, Z.; Zhang, L.; Deng, Y.; Li, S.; He, N. Graphene oxide for rapid microRNA detection. Nanoscale 2012, 4, 5840. [CrossRef] [PubMed] 27. Tu, Y.; Li, W.; Wu, P.; Zhang, H.; Cai, C. Fluorescence Quenching of Graphene Oxide Integrating with the Site-Specific Cleavage of the Endonuclease for Sensitive and Selective MicroRNA Detection. Anal. Chem. 2013, 85, 2536–2542. [CrossRef] 28. Tian, T.; Xiao, H.; Zhang, Z.; Long, Y.; Peng, S.; Wang, S.; Zhou, X.; Liu, S.; Zhou, X. Sensitive and Convenient Detection of microRNAs Based on Cascade Amplification by Catalytic DNAzymes. Chem. A Eur. J. 2013, 19, 92–95. [CrossRef] 29. Wang, W.; Kong, T.; Zhang, D.; Zhang, J.; Cheng, G. Label-Free MicroRNA Detection Based on Fluorescence Quenching of Gold Nanoparticles with a Competitive Hybridization. Anal. Chem. 2015, 21, 10822–10829. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).