DOCSLIB.ORG

Modification of Platinum Sensitivity by KEAP1/NRF2 Signals in Non-Small

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Modification of Platinum Sensitivity by KEAP1/NRF2 Signals in Non-Small Tian et al. Journal of Hematology & Oncology (2016) 9:83 DOI 10.1186/s13045-016-0311-0 RESEARCH Open Access Modification of platinum sensitivity by KEAP1/NRF2 signals in non-small cell lung cancer Yijun Tian†, Kongming Wu†, Qian Liu, Na Han, Li Zhang, Qian Chu* and Yuan Chen* Abstract Background: The objective of this study was to evaluate the effect of platinum-based drugs on nuclear-factor erythroid2 like 2 (NRF2) signaling in non-small cell lung cancer cell lines with or without Kelch-like ECH-associated protein 1 (KEAP1) mutations and to determine the role of NRF2 and KEAP1 on platinum-based drug treatment. Methods: We used real-time PCR to assess relative mRNA expression and used western blotting and immunofluorescence assays to assess protein expression. Small interfering RNA and shuttle plasmids were used to modulate the expression of NRF2, wild-type KEAP1, and mutant KEAP1. Drug sensitivity to platinum-based drugs was evaluated with Cell Count Kit-8. Results: We found that platinum-based therapies modified the NRF2 signaling pathway differently in KEAP1- mutated non-small cell lung cancer (NSCLC) cell lines compared with wild-type KEAP1 cell lines. The reactive degree of NRF2 signaling also varies between nedaplatin and cisplatin. The modification of NRF2 or KEAP1 expression in NSCLC cell lines disrupted downstream gene expression and cell sensitivity to platinum-based drugs. Finally, gene expression data retrieved from The Cancer Genome Atlas (TCGA) consortium indicated that KEAP1 mutation significantly affects NRF2 signaling activity in patients with NSCLC. Conclusions: Our findings suggest that NRF2 signaling plays an indispensable role in NSCLC cell sensitivity to platinum-based treatments and provides a rationale for using NRF2 as a specific biomarker for predicting which patients will be most likely to benefit from platinum-based treatment. Keyword: NRF2, KEAP1, Non-small cell lung cancer, HO1, NQO1, GCLM, Nedaplatin, Cisplatin Abbreviations: KEAP1, Kelch-like ECH-associated protein 1; NRF2, Nuclear-factor erythroid2 like 2; NSCLC, Non-small cell lung cancer; BTB, Broad complex, tramtrack, and bric à brac; IVR, Intervention region; wt, Wild type; mut, Mutation; HO1, Heme oxygenase-1; NQO1, NAD (P) H-quinone oxidoreductase 1; GCLM, Glutamate-cysteine ligase modifier subunit; TCGA, The Cancer Genome Atlas; CDS, Coding sequence; EGFR-TKI, Epidermal growth factor receptor tyrosine kinase inhibitor; EML4-ALK-TKI, Echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion tyrosine kinase inhibitor; ARE, Antioxidant responsive element * Correspondence: [email protected]; [email protected] †Equal contributors Department of Oncology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, 1095 Jiefang Avenue, Wuhan 430030, China © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Tian et al. Journal of Hematology & Oncology (2016) 9:83 Page 2 of 14 Background Methods Non-small cell lung cancer (NSCLC) is associated with Chemicals and cell culture considerably high mortality worldwide [1]. Surgery Unless otherwise stated, all chemicals were purchased can ensure local disease control in patients with early from Sigma-Aldrich (Shanghai, China). Antibodies against stages of disease, and patients unsuitable for surgery NRF2 (ab62352) were purchased from Abcam; antibodies at diagnosis, primarily those with advanced stage dis- against HO1 (#5853) and NQO1 (#3187) were purchased ease, receive chemotherapy or targeted therapy as a from Cell Signaling Technology; and antibodies against first line of treatment. Epidermal growth factor recep- KEAP1 (10503-2-AP), GCLM (14241-1-AP), and β-actin tor tyrosine kinase inhibitor (EGFR-TKI) and echino- were purchased from Proteintech. derm microtubule-associated protein-like 4-anaplastic The A549 (human lung adenocarcinoma), H292 (human lymphoma kinase fusion tyrosine kinase inhibitor mucoepidermoid carcinoma), H460 (human large cell lung (EML4-ALK-TKI) exert substantial therapeutic effects cancer), and SKMES-1 (human squamous lung cancer) cell in lung adenocarcinomas with specific commonly oc- lines were obtained from the Cell Resource Center, Peking curring mutations [2–5]. Platinum-based treatment Union Medical College. The cells were cultured in RPMI- regimens remain the standard of care recommended 1640, with the exception of SKMES-1 cells, which were cul- by the lung cancer guidelines for squamous lung can- tured in MEM. All media were supplemented with 10 % cer or adenocarcinoma with undefined mutation status fetal bovine serum (GIBCO, NY, USA). No antibiotics were [6]. Recently, studies [7, 8] have revealed that a added to the media. nedaplatin-based treatment regimen is associated with a favorable response in patients with squamous cell Plasmid and siRNA design lung cancer. Platinum-based drugs are defined as The wild-type KEAP1 coding sequence (CDS) was cloned DNA adduct-forming agents that exert antineoplastic into the pEnter shuttle plasmid. The Fast Mutagenesis sys- effects by inducing the formation of double-stranded tem (Transgene, Beijing, China) was used to introduce the DNA cross-links, thus resulting in irreversible DNA G333C and D236H mutations. The primers used were: damage [9]. Accumulating DNA damage eventually leads to apoptosis [10, 11]. G333C-forward, TGATCTACA Nuclear-factor (NF)-E2-related factor 2 (NRF2) is a CCGCGGGCTGCTACTTCCGACAGTC core transcription factor involved in the cellular re- G333C-reverse, sponse to oxidative stress [12]. Under basal conditions, AGCCCGCGGTGTAGATCAGGCGGCCCACC NRF2 forms a complex with Kelch-like ECH-associated D236H-forward, protein-1 (KEAP1), which is targeted for ubiquitination. AGCCCGCGGTGTAGATCAGGCGGCCCACC Upon exposure to stress or electrophilic regents, NRF2 D236H-reverse, evades the ubiquitination process and translocates from GGTCCCGGCTGATGAGGGTCACCAGTTGG the cytoplasm to the nucleus [13]. By binding to antioxi- The small interfering RNAs used to silence NRF2 were: dant responsive element (ARE), NRF2 increases the Sense, GGUUGAGACUACCAUGGUUTT transcription of multiple cytoprotective enzymes [14] Antisense, AACCAUGGUAGUCUCAACCTT such as heme oxygenase-1(HO1), NAD (P) H dehydro- genase (quinone) 1 (NQO1), and glutamate-cysteine lig- Transfection was conducted with Lipofectamine ase modifier (GCLM) [15]. 2000 (Invitrogen) according to a previously published In urethane-induced lung carcinogenesis model, method [24]. NRF2 activation suppresses tumorigenesis, but somatic activation of NRF2 in cancer cells enhanced growth of Real-time PCR analysis tumors [16]. Studies have demonstrated that NRF2 acti- Total messenger RNA (mRNA) was extracted from cells vation contributes to chemo-resistance [17–19] or using TRIzol according to the manufacturer’sprotocol radio-resistance [20] in lung cancers. Investigators have (Takara, Japan). Seven hundred fifty-nanogram total mRNA also focused on the relationship between NRF2 activity was used to synthesize first strand complementary DNA and platinum treatment in NSCLC cell line [21, 22]. (cDNA) using the cDNA synthesis kit (ThermoFisher However, studies designed to observe and compare Scientific). Quantification reactions were performed with NRF2 signaling response under different platinum the ABI 7900 HT platform. Each reaction consisted of 5 μl treatment are rarely reported [23]. In this study, we SYBR Green/ROX qPCR Master Mix (ThermoFisher sought to elucidate the role of NRF2 in platinum-based Scientific), 1 μlcDNA,1μl10μMforwardandreverse chemotherapy for NSCLC, and we identified KEAP1 primer mix, and 3 μlddH2O. Cycling conditions were as mutation as a key factor contributing to platinum follows: 95 °C for 10 min and 40 cycles of 95 °C for 15 s sensitivity. and 60 °C for 60 s. Cycle thresholds were calculated as the Tian et al. Journal of Hematology & Oncology (2016) 9:83 Page 3 of 14 −△△ expression fold-changes according to the 2 CT algorithm. lysed with RIPA buffer. Each sample was denatured in The primers used for real-time PCR are: 100 °C boiling water in the presence of SDS and DTT. A total of 20 μg of protein from each sample was loaded NRF2, forward, TCCAGTCAGAAACCAGTGGAT onto a 10 % SDS-PAGE gel for separation by electro- Reverse, GAATGTCTGCGCCAAAAGCTG phoresis. A tank system was used to transfer proteins HO1, forward, AAGATTGCCCAGAAAGCCCTGGAC from gels to PVDF membranes. The membranes were Reverse, AACTGTCGCCACCAGAAAGCTGAG blocked with nonfat milk for 1 h and incubated with pri- NQO1, forward, GAAGAGCACTGATCGTACTGGC mary antibodies overnight. All primary antibodies were Reverse, GGATACTGAAAGTTCGCAGGG used at a dilution of 1:1000, with the exception of anti- GCLM, forward, TGTCTTGGAATGCACTGTATCTC β-actin (1:5000) and anti-NQO1 (1:3000). Blots were Reverse, CCCAGTAAGGCTGTAAATGCTC sufficiently washed in 0.1 % Tris-buffered saline and Tween20 (TBST) four to six times for at least 5 min per KEAP1 mutation sequencing wash. Washed membranes were incubated with second-
Load more

Recommended publications
  • China During the Tang-Song Interregnum, 878–978
    China during the Tang-Song Interregnum, 878–978 This book challenges the long-established structure of Chinese history around dynasties, adopting a more “organic” approach which emphasises cultural and economic trends that transcend arbitrary dynastic boundaries. It argues that with the collapse of the Tang court and northern control over the holistic empire in the last decades of the ninth century, the now-autonomous kingdoms that filled the political vacuum in the south responded with a burst of innovative energy that helped set the stage for the economic and cultural transformations of the following Song dynasty. Moreover, it argues that these transformations and this economic and cultural innovation deeply affected the subsequent model of holistic empire which continues right up to the present and that therefore the interregnum century of division left a critically important legacy. Hugh R. Clark is Professor Emeritus of History and East Asian Studies at Ursinus College, Pennsylvania Asian States and Empires Edited by Peter Lorge, Vanderbilt University For a full list of available titles please visit: https://www.routledge.com/Asian- States-and-Empires/book-series/SE900. The importance of Asia will continue to grow in the twenty-first century, but remarkably little is available in English on the history of the polities that constitute this critical area. Most current work on Asia is hindered by the extremely limited state of knowledge of the Asian past in general, and the history of Asian states and empires in particular. Asian States and Empires is a book series that will provide detailed accounts of the history of states and empires across Asia from earliest times until the present.
    [Show full text]
  • Repurposed Tocilizumab in Patients with Severe COVID-19
    Published December 9, 2020, doi:10.4049/jimmunol.2000981 The Journal of Immunology Repurposed Tocilizumab in Patients with Severe COVID-19 Jianbo Tian,*,1 Ming Zhang,*,1 Meng Jin,†,1 Fengqin Zhang,‡ Qian Chu,‡ Xiaoyang Wang,* Can Chen,* Huihui Yue,‡ Li Zhang,x Ronghui Du,{ Dong Zhao,† Zhaofu Zeng,† Yang Zhao,† Kui Liu,‡ Mengmei Wang,† Ke Hu,† Xiaoping Miao,* and Huilan Zhang‡ The coronavirus disease 2019 (COVID-19) has caused a global pandemic, resulting in considerable morbidity and mortality. Tocilizumab, an inhibitor of IL-6, has been widely repurposed as a treatment of severely ill patients without robust evidence supporting its use. In this study, we aimed to systematically describe the effectiveness of treatment and prevention of the cytokine storms in COVID-19 patients with tocilizumab. In this multicentered retrospective and observational cohort study, 65 patients with COVID-19 receiving tocilizumab and 130 not receiving tocilizumab were propensity score matched at a ratio of 2:1 based on age, sex, and comorbidities from January 20, 2020 to March 18, 2020 in Wuhan, China. After adjusting for confounding, the detected risk for in-hospital death was lower in the tocilizumab group versus nontocilizumab group (hazard ratio = 0.47; 95% confidence interval = 0.25–0.90; p = 0.023). Moreover, use of tocilizumab was associated with a lower risk of acute respiratory distress syndrome (odds ratio = 0.23; 95% confidence interval = 0.11–0.45; p < 0.0001). Furthermore, patients had heightened inflammation and more dysregulated immune cells before treatment, which might aggravate disease progression. After tocilizu- mab administration, abnormally elevated IL-6, C-reactive protein, fibrinogen, and activated partial thromboplastin time de- creased.
    [Show full text]
  • Albert Welter CV
    Albert Welter, Curriculum Vitae Albert Welter Department of East Asian Studies University of Arizona 1512 E First Street, Learning Services Building Tucson, Arizona, 85721-0105 [email protected] PROFESSIONAL POSITIONS 2013-present Professor and Head, Department of East Asian Studies Associate Director, School of International Languages, Literatures, and Cultures, University of Arizona 2020 Numata Research Fellow, Ryūkoku University (Kyoto); April – August (5 months) 2019-present Vice-Chair, International Confucian Association 国际儒学联合会 2017-present Honorary Professor, Hangzhou Academy of Social Sciences 杭州社会科学院 2013-16 Adjunct Professor, Department of Religion & Culture University of Winnipeg 2011-13 Professor and Chair, Department of Religion & Culture; Director, Program in East Asian Languages & Cultures, University of Winnipeg. 2003-10 Professor and Acting Chair (6 months per year), Department of Religion & Culture (formerly Religious Studies), University of Winnipeg. 2006-07 Visiting Professor, Renmin University 人民大学, Beijing, China. 1999 Research Associate, Institute of Oriental Studies 東洋文化研究所, Tokyo University. 1996-2003 Associate Professor, Department of Religious Studies, University of Winnipeg. 1990-96 Assistant Professor, Joint Appointment, Department of History and Department of Religious Studies, North Central College (Naperville, Illinois). 1989-90 Post-Doctoral Fellow, Department of Religious Studies, McMaster University. 1987-89 Post-Doctoral Research Fellow, Buddhist Studies Department, Komazawa University 駒沢 大学 (Tokyo, Japan). EDUCTIONAL BACKGROUND 6/1987 Ph.D. Religious Studies, McMaster University, Hamilton ON, Canada Comp Exams: East Asian Buddhism, Indian Buddhism, and Western Religious Thought 9/84-6/85 Fudan University 复旦大学, Shanghai, PRC Field: Chinese Philosophy (dissertation research) 1/80-12/82 Komazawa University 駒沢大学, Tokyo, Japan Field: Zen Buddhism (dissertation research) 6/1978 M.A.
    [Show full text]
  • Preservation of Lilong Neighborhoods in Shanghai
    PRESERVATION OF LILONG NEIGHBORHOODS IN SHANGHAI: SOCIAL CHANGE AND SPATIAL RIGHTS A Thesis Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Master of Arts in Historic Preservation Planning by Ran Yan August 2013 © 2013 Ran Yan ALL RIGHTS RESERVED ABSTRACT As once the most common form of dwelling in Shanghai, the Lilong has played a vital role in Shanghai’s local culture. Gradually declining in number during the second half of the 20th century, it is now faced with a challenging and undecided future. This thesis aims to further the discussion of the preservation of Lilong neighborhoods in its fundamental relation with people and basic social context. Four case studies, Tian Zi Fang, Jian Ye Li, Jing An Bie Shu and Bu Gao Li, are used to add some realistic, specific details and to deepen the reflection on this topic. Each of the cases has its special architectural features, residential composition, history, and current problems all of which provide some insight into the uniqueness and individuality of every Lilong neighborhood. In the end recommendations are made to address to Lilong residents’ right and to call for an equal way of Lilong preservation as a means to a better living environment for everyone and a more equitable society. BIOGRAPHICAL SKETCH Ran Yan was born on August 9th, 1988 in Beijing, China, where she grew up and finished her early education. In 2011 she received her Bachelor of Engineering degree in Historic Preservation from Tongji University, in Shanghai. With a background in both architecture and historic preservation, she continued on to graduate study in the Historic Preservation Planning program at the City and Regional Planning Department of Cornell University.
    [Show full text]
  • From Warhorses to Ploughshares: the Later Tang Reign of Emperor Mingzong
    《中國文化研究所學報》 Journal of Chinese Studies No. 61 – July 2015 Book Reviews 353 From Warhorses to Ploughshares: The Later Tang Reign of Emperor Mingzong. By Richard L. Davis. Hong Kong: Hong Kong University Press, 2014. Pp. xiii + 219. $60.00. Within the emerging field of Five Dynasties and Ten States studies, starting with 1 Edward H. Schafer, Brigitte Amthor, and Wang Hongjie, biographies of rulers have played an important part. The present study of Emperor Mingzong 明宗 (r. 926–933) of the Later Tang 後唐 by Richard L. Davis is thus a most welcome addition. Davis conveniently summarizes the history of the Shatuo 沙陀 and Shatuo rule in northern China until the end of the Later Tang dynasty. Previous studies have examined Shatuo rule in the general context of Five Dynasties history whereas Davis singles out the reign of one ruler, that of the second Later Tang ruler Mingzong, whom he clearly sees as an exemplary “good” ruler in terms of his adoption of cultural policies and leanings towards peaceful policies. The writing style is fluid, and the contents covers much more than just the life of Mingzong. This book starts with a preface (pp. xi–xvi), followed by Chapter 1 “People and Places” (pp. 1–31), an introduction to Shatuo history, family relations, and the main political actors. Chapter 2 “Royal Passage” (pp. 33–61) describes the rise of Li Siyuan 李嗣源, the later Mingzong, to the throne of the Later Tang. Chapters 3 and 4 “Political Events” look at Mingzong’s reign according to his reign titles Tiancheng 天 成 (pp.
    [Show full text]
  • The Revival of Tiantai Buddhism in the Late Ming: on the Thought of Youxi Chuandeng 幽溪傳燈 (1554-1628)
    The Revival of Tiantai Buddhism in the Late Ming: On the Thought of Youxi Chuandeng 幽溪傳燈 (1554-1628) Yungfen Ma Submitted in partial fulfillment of the Requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2011 © 2011 Yungfen Ma All Rights Reserved ABSTRACT The Revival of Tiantai Buddhism in the Late Ming: On the Thought of Youxi Chuandeng 幽溪傳燈 (1554-1628) Yungfen Ma This dissertation is a study of Youxi Chuandeng’s (1554-1628) transformation of “Buddha-nature includes good and evil,” also known as “inherent evil,” a unique idea representing Tiantai’s nature-inclusion philosophy in Chinese Buddhism. Focused on his major treatise On Nature Including Good and Evil, this research demonstrates how Chuandeng, in his efforts to regenerate Tiantai, incorporated the important intellectual themes of the late Ming, especially those found in the Śūraṃgama Sūtra. In his treatise, Chuandeng systematically presented his ideas on doctrinal classification, the principle of nature-inclusion, and the practice of the Dharma-gate of inherent evil. Redefining Tiantai doctrinal classification, he legitimized the idea of inherent evil to be the highest Buddhist teaching and proved the superiority of Buddhism over Confucianism. Drawing upon the notions of pure mind and the seven elements found in the Śūraṃgama Sūtra, he reinterpreted nature-inclusion and the Dharma-gate of inherent evil emphasizing inherent evil as pure rather than defiled. Conversely, he reinterpreted the Śūraṃgama Sūtra by nature-inclusion. Chuandeng incorporated Confucianism and the Śūraṃgama Sūtra as a response to the dominating thought of his day, this being the particular manner in which previous Tiantai thinkers upheld, defended and spread Tiantai.
    [Show full text]
  • The Literary Design of Liu Yiqing's Qiantang Yishi And
    THE POETICS OF MISCELLANEOUSNESS: THE LITERARY DESIGN OF LIU YIQING’S QIANTANG YISHI AND THE HISTORIOGRAPHY OF THE SOUTHERN SONG by Gang Liu A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Asian Languages and Cultures) In the University of Michigan 2010 Doctoral Committee: Professor Shuen-fu Lin, Chair Professor Yopie Prins Associate Professor David L. Rolston Assistant Professor Christian de Pee © Gang Liu 2010 To Wei and Ava ii ACKNOWLEDGEMENTS I owe my deepest gratitude to my adviser, Professor Shuen-fu Lin, whose unfailing support and incisive comments have made the writing of this dissertation such a pleasant and rewarding experience for me. Professor Lin is not only an inspiring mentor and teacher, but also an amiable person whom I have always been comfortable to work with. I am grateful to have him as my adviser during my graduate study. I also owe great debts of thanks to Professors David L. Rolston, Christian de Pee, and Yopie Prins, who are on my dissertation committee. Professors Rolston, de Pee, and Prins have all been very supportive and have helped me immeasurably throughout the entire course of this dissertation. They have been most willing to read and to offer me feedback from different perspectives (literary, historical and theoretical, etc.) on drafts of this dissertation at various stages. Without their support and insightful comments, this dissertation would never become possible. I would like to extend my thanks to Professors William Baxter, Miranda Brown, Xiaobing Tang, Jonathan Zwicker, Ken Ito, and Nancy Florida, who have showed enthusiastic interests in this dissertation and offered me invaluable suggestions on it.
    [Show full text]
  • Tope and T Opos the Leifeng Pagoda and the Discourse of the Demonic
    Tope and Topos Tope and T opos The Leifeng Pagoda and the Discourse of the Demonic Eugene Y. Wang Fig. 11.1 Huang Yanpei, Lafeng Pagoda at Sunset. Photograph. 1914. After Zhongguo mingshen (Scenic China), no. 4: West La/u, Hangchow [HangzhouJ, ed. Huang Yanpei ec aI., 2.: 19 A site is often a topos in that it both marks a locus and serves as a topic. It is a (Shanghai: Commercial Press, 1915). common place that can be traversed or inhabited by a public and a rhetorical commonplace familiar to both its ~uthor and his audience.l Although there quently its topographiC features and its landmarks become a secondary and 4 is no exact equivalent in Chinese to the Greek word topos that conveniently tangential matter. Cycles of decay and repair may render the landmark into collapses the dual senses of locus and topic, the notion ofji ~ (site, trace, something widely different from the original. That matters little. The only vestige) comes close. A ji is a site that emphasizes "vestiges" and "traces." It is function of the landmark, after all, is to stand as a perceptual cue or synec­ a peculiar spatial-temporal construct. Spatially, a landmark, such as a tower, doche for the proverbial construct called a "site," a somewhat deceptive no­ a terrace, a pavilion, or simply a stele, serves as its territorial signpost or per­ tion premised on the primacy of physical place, topographic features, and ceptual cue, and it is perceived to be a terrain distinct ftom the humdrum prominence of landmarks. In reality, a site is a topos etched in collective environment.
    [Show full text]
  • From Warhorses to Ploughshares: the Later Tang Reign of Emperor Mingzong
    《中國文化研究所學報》 Journal of Chinese Studies No. 61 – July 2015 Book Reviews 353 From Warhorses to Ploughshares: The Later Tang Reign of Emperor Mingzong. By Richard L. Davis. Hong Kong: Hong Kong University Press, 2014. Pp. xiii + 219. $60.00. Within the emerging field of Five Dynasties and Ten States studies, starting with 1 Edward H. Schafer, Brigitte Amthor, and Wang Hongjie, biographies of rulers have played an important part. The present study of Emperor Mingzong 明宗 (r. 926–933) of the Later Tang 後唐 by Richard L. Davis is thus a most welcome addition. Davis conveniently summarizes the history of the Shatuo 沙陀 and Shatuo rule in northern China until the end of the Later Tang dynasty. Previous studies have examined Shatuo rule in the general context of Five Dynasties history whereas Davis singles out the reign of one ruler, that of the second Later Tang ruler Mingzong, whom he clearly sees as an exemplary “good” ruler in terms of his adoption of cultural policies and leanings towards peaceful policies. The writing style is fluid, and the contents covers much more than just the life of Mingzong. This book starts with a preface (pp. xi–xvi), followed by Chapter 1 “People and Places” (pp. 1–31), an introduction to Shatuo history, family relations, and the main political actors. Chapter 2 “Royal Passage” (pp. 33–61) describes the rise of Li Siyuan 李嗣源, the later Mingzong, to the throne of the Later Tang. Chapters 3 and 4 “Political Events” look at Mingzong’s reign according to his reign titles Tiancheng 天 成 (pp.
    [Show full text]
  • Arts of Asia Lecture Series Fall 2015 Asia's Storied Traditions Sponsored
    Arts of Asia Lecture Series Fall 2015 Asia’s Storied Traditions Sponsored by The Society for Asian Art Eugene Y. Wang (Harvard University), “The Same Me That Stands Here Now: Jataka Tales on Tenth Century Reliquaries.” Society of Asian Art – Arts of Asia Lecture Series, November 20, 2015 Glossary: 1. Jataka 2. Aśoka (r. ca. 273-232 BCE) 3. śarīra; sheli 4. Liu Sahe 5. Jianzhen (Ganjin; 688-763) 6. Mabito Genkai (722-785) 7. Qian Chu, or Qian Hongchu (928-988; r. 947-978), king of Wuyue 8. Leifeng Pagoda (Thunder Peak Pagoda) 9. Sattva, who feeds himself to the hungry tigress 10. Sudhīra, or Quick-Eyed King, who gives his eyes as alms 11. Candraprabha, or Moonlight, who disposes of his brain 12. Sivi/Sibi, who saves the dove with his flesh 13. dhāraṇī 14. “Stupa of the Precious Chest Mudrā” (baoqieyin ta) 15. garuḍa, or golden-winged bird Suggested reading: • Shi, Zhiru. “From Bodily Relic to Dharma Relic Stupa: Chinese Materialization of the Asoka Legend in the Wuyue Period.” In India in the Chinese imagination, ed. J. Kieschnick and M. Shahar (Philadelphia: University of Pennsylvania, 2014): 83-109. • Soper, Alexander. “Japanese Evidence for the History of the Architecture and Iconography of Chinese Buddhism.” Monumenta Serica. Vol. 4, no. 2 (1940): 638-679. Further reading: • Eugene Y. Wang, “Painted Statue in an Optical Theater: A Fifth-Century Chinese Buddhist Cave.” https://www.academia.edu/5911506/Painted_Statue_in_an_Optical_Theater_A_Fifth- Century_Chinese_Buddhist_Cave • --. “Of the True Body: The Famen Monastery Relics and Corporeal Transformation in Tang Imperial Culture.” In Body and Face in Chinese Visual Culture (2004): 79-118.
    [Show full text]
  • Monks, Rulers, and Literati: the Political Ascendancy of Chan Buddhism Albert Welter
    Title Pages Monks, Rulers, and Literati: The Political Ascendancy of Chan Buddhism Albert Welter Print publication date: 2006 Print ISBN-13: 9780195175219 Published to Oxford Scholarship Online: October 2011 DOI: 10.1093/acprof:oso/9780195175219.001.0001 Title Pages (p.i) Monks, Rulers, and Literati (p.ii) (p.iii) Monks, Rulers, and Literati 2006 (p.iv) Oxford University Press, Inc., publishes works that further Oxford University's objective of excellence in research, scholarship, and education. Oxford New York Auckland Cape Town Dar es Salaam Hong Kong Karachi Kuala Lumpur Madrid Melbourne Mexico City Nairobi New Delhi Shanghai Taipei Toronto With offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey Ukraine Vietnam Copyright © 2006 by Oxford University Press, Inc. Published by Oxford University Press, Inc. Page 1 of 2 PRINTED FROM OXFORD SCHOLARSHIP ONLINE (www.oxfordscholarship.com). (c) Copyright Oxford University Press, 2019. All Rights Reserved. An individual user may print out a PDF of a single chapter of a monograph in OSO for personal use. Subscriber: UC - Berkeley Library; date: 30 September 2019 Title Pages 198 Madison Avenue, New York, New York 10016 www.oup.com Oxford is a registered trademark of Oxford University Press. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without prior permission of Oxford University Press. Library of Congress Cataloging-In-Publication Data Welter, Albert, 1952– Monks, rulers, and literati: the political ascendancy of Chan Buddhism/Albert Welter.
    [Show full text]
  • Crossing Thousands of Li of Waves: the Return of China's Lost Tiantai Texts
    JIABS Journal of the International Association of Buddhist Studies Volume 29 Number 1 2006 (2008) The Journal of the International Association of Buddhist Studies (ISSN 0193-600XX) is the organ of the International Association of Buddhist Studies, Inc. It welcomes scholarly contributions pertaining to all facets of Buddhist Studies. EDITORIAL BOARD JIABS is published twice yearly, in the summer and winter. KELLNER Birgit Manuscripts should preferably be sub- KRASSER Helmut mitted as e-mail attachments to: Joint Editors [email protected] as one single file, complete with footnotes and references, BUSWELL Robert in two different formats: in PDF-format, and in Rich-Text-Format (RTF) or Open- CHEN Jinhua Document-Format (created e.g. by Open COLLINS Steven Office). COX Collet GÓMEZ Luis O. Address books for review to: HARRISON Paul JIABS Editors, Institut für Kultur - und Geistesgeschichte Asiens, Prinz-Eugen- VON HINÜBER Oskar Strasse 8-10, AT-1040 Wien, AUSTRIA JACKSON Roger JAINI Padmanabh S. Address subscription orders and dues, KATSURA Shōryū changes of address, and UO business correspondence K Li-ying (including advertising orders) to: LOPEZ, Jr. Donald S. Dr Jérôme Ducor, IABS Treasurer MACDONALD Alexander Dept of Oriental Languages and Cultures SCHERRER-SCHAUB Cristina Anthropole SEYFORT RUEGG David University of Lausanne CH-1015 Lausanne, Switzerland SHARF Robert email: [email protected] STEINKELLNER Ernst Web: www.iabsinfo.net TILLEMANS Tom Fax: +41 21 692 30 45 ZÜRCHER Erik Subscriptions to JIABS are USD 40 per year for individuals and USD 70 per year for libraries and other institutions. For informations on membership in IABS, see back cover.
    [Show full text]