Modification of Platinum Sensitivity by KEAP1/NRF2 Signals in Non-Small

Modification of Platinum Sensitivity by KEAP1/NRF2 Signals in Non-Small

Tian et al. Journal of Hematology & Oncology (2016) 9:83 DOI 10.1186/s13045-016-0311-0 RESEARCH Open Access Modification of platinum sensitivity by KEAP1/NRF2 signals in non-small cell lung cancer Yijun Tian†, Kongming Wu†, Qian Liu, Na Han, Li Zhang, Qian Chu* and Yuan Chen* Abstract Background: The objective of this study was to evaluate the effect of platinum-based drugs on nuclear-factor erythroid2 like 2 (NRF2) signaling in non-small cell lung cancer cell lines with or without Kelch-like ECH-associated protein 1 (KEAP1) mutations and to determine the role of NRF2 and KEAP1 on platinum-based drug treatment. Methods: We used real-time PCR to assess relative mRNA expression and used western blotting and immunofluorescence assays to assess protein expression. Small interfering RNA and shuttle plasmids were used to modulate the expression of NRF2, wild-type KEAP1, and mutant KEAP1. Drug sensitivity to platinum-based drugs was evaluated with Cell Count Kit-8. Results: We found that platinum-based therapies modified the NRF2 signaling pathway differently in KEAP1- mutated non-small cell lung cancer (NSCLC) cell lines compared with wild-type KEAP1 cell lines. The reactive degree of NRF2 signaling also varies between nedaplatin and cisplatin. The modification of NRF2 or KEAP1 expression in NSCLC cell lines disrupted downstream gene expression and cell sensitivity to platinum-based drugs. Finally, gene expression data retrieved from The Cancer Genome Atlas (TCGA) consortium indicated that KEAP1 mutation significantly affects NRF2 signaling activity in patients with NSCLC. Conclusions: Our findings suggest that NRF2 signaling plays an indispensable role in NSCLC cell sensitivity to platinum-based treatments and provides a rationale for using NRF2 as a specific biomarker for predicting which patients will be most likely to benefit from platinum-based treatment. Keyword: NRF2, KEAP1, Non-small cell lung cancer, HO1, NQO1, GCLM, Nedaplatin, Cisplatin Abbreviations: KEAP1, Kelch-like ECH-associated protein 1; NRF2, Nuclear-factor erythroid2 like 2; NSCLC, Non-small cell lung cancer; BTB, Broad complex, tramtrack, and bric à brac; IVR, Intervention region; wt, Wild type; mut, Mutation; HO1, Heme oxygenase-1; NQO1, NAD (P) H-quinone oxidoreductase 1; GCLM, Glutamate-cysteine ligase modifier subunit; TCGA, The Cancer Genome Atlas; CDS, Coding sequence; EGFR-TKI, Epidermal growth factor receptor tyrosine kinase inhibitor; EML4-ALK-TKI, Echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion tyrosine kinase inhibitor; ARE, Antioxidant responsive element * Correspondence: [email protected]; [email protected] †Equal contributors Department of Oncology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, 1095 Jiefang Avenue, Wuhan 430030, China © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Tian et al. Journal of Hematology & Oncology (2016) 9:83 Page 2 of 14 Background Methods Non-small cell lung cancer (NSCLC) is associated with Chemicals and cell culture considerably high mortality worldwide [1]. Surgery Unless otherwise stated, all chemicals were purchased can ensure local disease control in patients with early from Sigma-Aldrich (Shanghai, China). Antibodies against stages of disease, and patients unsuitable for surgery NRF2 (ab62352) were purchased from Abcam; antibodies at diagnosis, primarily those with advanced stage dis- against HO1 (#5853) and NQO1 (#3187) were purchased ease, receive chemotherapy or targeted therapy as a from Cell Signaling Technology; and antibodies against first line of treatment. Epidermal growth factor recep- KEAP1 (10503-2-AP), GCLM (14241-1-AP), and β-actin tor tyrosine kinase inhibitor (EGFR-TKI) and echino- were purchased from Proteintech. derm microtubule-associated protein-like 4-anaplastic The A549 (human lung adenocarcinoma), H292 (human lymphoma kinase fusion tyrosine kinase inhibitor mucoepidermoid carcinoma), H460 (human large cell lung (EML4-ALK-TKI) exert substantial therapeutic effects cancer), and SKMES-1 (human squamous lung cancer) cell in lung adenocarcinomas with specific commonly oc- lines were obtained from the Cell Resource Center, Peking curring mutations [2–5]. Platinum-based treatment Union Medical College. The cells were cultured in RPMI- regimens remain the standard of care recommended 1640, with the exception of SKMES-1 cells, which were cul- by the lung cancer guidelines for squamous lung can- tured in MEM. All media were supplemented with 10 % cer or adenocarcinoma with undefined mutation status fetal bovine serum (GIBCO, NY, USA). No antibiotics were [6]. Recently, studies [7, 8] have revealed that a added to the media. nedaplatin-based treatment regimen is associated with a favorable response in patients with squamous cell Plasmid and siRNA design lung cancer. Platinum-based drugs are defined as The wild-type KEAP1 coding sequence (CDS) was cloned DNA adduct-forming agents that exert antineoplastic into the pEnter shuttle plasmid. The Fast Mutagenesis sys- effects by inducing the formation of double-stranded tem (Transgene, Beijing, China) was used to introduce the DNA cross-links, thus resulting in irreversible DNA G333C and D236H mutations. The primers used were: damage [9]. Accumulating DNA damage eventually leads to apoptosis [10, 11]. G333C-forward, TGATCTACA Nuclear-factor (NF)-E2-related factor 2 (NRF2) is a CCGCGGGCTGCTACTTCCGACAGTC core transcription factor involved in the cellular re- G333C-reverse, sponse to oxidative stress [12]. Under basal conditions, AGCCCGCGGTGTAGATCAGGCGGCCCACC NRF2 forms a complex with Kelch-like ECH-associated D236H-forward, protein-1 (KEAP1), which is targeted for ubiquitination. AGCCCGCGGTGTAGATCAGGCGGCCCACC Upon exposure to stress or electrophilic regents, NRF2 D236H-reverse, evades the ubiquitination process and translocates from GGTCCCGGCTGATGAGGGTCACCAGTTGG the cytoplasm to the nucleus [13]. By binding to antioxi- The small interfering RNAs used to silence NRF2 were: dant responsive element (ARE), NRF2 increases the Sense, GGUUGAGACUACCAUGGUUTT transcription of multiple cytoprotective enzymes [14] Antisense, AACCAUGGUAGUCUCAACCTT such as heme oxygenase-1(HO1), NAD (P) H dehydro- genase (quinone) 1 (NQO1), and glutamate-cysteine lig- Transfection was conducted with Lipofectamine ase modifier (GCLM) [15]. 2000 (Invitrogen) according to a previously published In urethane-induced lung carcinogenesis model, method [24]. NRF2 activation suppresses tumorigenesis, but somatic activation of NRF2 in cancer cells enhanced growth of Real-time PCR analysis tumors [16]. Studies have demonstrated that NRF2 acti- Total messenger RNA (mRNA) was extracted from cells vation contributes to chemo-resistance [17–19] or using TRIzol according to the manufacturer’sprotocol radio-resistance [20] in lung cancers. Investigators have (Takara, Japan). Seven hundred fifty-nanogram total mRNA also focused on the relationship between NRF2 activity was used to synthesize first strand complementary DNA and platinum treatment in NSCLC cell line [21, 22]. (cDNA) using the cDNA synthesis kit (ThermoFisher However, studies designed to observe and compare Scientific). Quantification reactions were performed with NRF2 signaling response under different platinum the ABI 7900 HT platform. Each reaction consisted of 5 μl treatment are rarely reported [23]. In this study, we SYBR Green/ROX qPCR Master Mix (ThermoFisher sought to elucidate the role of NRF2 in platinum-based Scientific), 1 μlcDNA,1μl10μMforwardandreverse chemotherapy for NSCLC, and we identified KEAP1 primer mix, and 3 μlddH2O. Cycling conditions were as mutation as a key factor contributing to platinum follows: 95 °C for 10 min and 40 cycles of 95 °C for 15 s sensitivity. and 60 °C for 60 s. Cycle thresholds were calculated as the Tian et al. Journal of Hematology & Oncology (2016) 9:83 Page 3 of 14 −△△ expression fold-changes according to the 2 CT algorithm. lysed with RIPA buffer. Each sample was denatured in The primers used for real-time PCR are: 100 °C boiling water in the presence of SDS and DTT. A total of 20 μg of protein from each sample was loaded NRF2, forward, TCCAGTCAGAAACCAGTGGAT onto a 10 % SDS-PAGE gel for separation by electro- Reverse, GAATGTCTGCGCCAAAAGCTG phoresis. A tank system was used to transfer proteins HO1, forward, AAGATTGCCCAGAAAGCCCTGGAC from gels to PVDF membranes. The membranes were Reverse, AACTGTCGCCACCAGAAAGCTGAG blocked with nonfat milk for 1 h and incubated with pri- NQO1, forward, GAAGAGCACTGATCGTACTGGC mary antibodies overnight. All primary antibodies were Reverse, GGATACTGAAAGTTCGCAGGG used at a dilution of 1:1000, with the exception of anti- GCLM, forward, TGTCTTGGAATGCACTGTATCTC β-actin (1:5000) and anti-NQO1 (1:3000). Blots were Reverse, CCCAGTAAGGCTGTAAATGCTC sufficiently washed in 0.1 % Tris-buffered saline and Tween20 (TBST) four to six times for at least 5 min per KEAP1 mutation sequencing wash. Washed membranes were incubated with second-

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    14 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us