Human and Mouse Cyclin D2 Splice Variants: Transformingactivity and Subcellular Localization

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Oncogene (2008) 27, 1253–1262 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc ORIGINAL ARTICLE Human and mouse cyclin D2 splice variants: transformingactivity and subcellular localization C Denicourt1, P Legault1, F-AC McNabb and E Rassart Laboratoire de Biologie Mole´culaire, De´partement des Sciences Biologiques, Universite´ du Que´bec a` Montre´al, Que´bec, Canada We have previously reported the identification of a novel characterized Gris1 as a novel common integration site 17 kDa truncated isoform of the cyclin D2 activated in in 13% of Graffi murine retrovirus-induced leukemias 13% of the leukemias induced by the Graffi murine (Denicourt et al., 2002). This novel locus was located on leukemia retrovirus. Retroviral integration in the Gris1 mouse chromosome 6, 75–85 kbp upstream of the cyclin locus causes an alternative splicingof the mouse cyclin D2 D2 gene. Integrations in Gris1 were shown to activate gene and expression of a truncated protein of 159 amino the expression of the 6.5 kb major transcript of the acids that is detected at high levels in the Gris1 tumors and cyclin D2 gene (CCND2)and also a smaller 1.1 kb also in normal mouse tissues mainly the brain and ovaries. transcript that we have shown to represent an alter- A truncated form of the cyclin D2 was also found in native transcript encoding a 17 kDa truncated cyclin D2 human. We show here that both mouse- and human- protein. The protein is detected at high level in the Gris1 truncated cyclin D2 are able to transform primary mouse tumors and also in smaller quantities in normal tissue embryo fibroblasts (MEF) when co-expressed with an mainly in the brain and ovaries (Denicourt et al., 2002). activated Ras protein. The truncated cyclin D2 localizes We also have reported the existence of several expressed only to the cytoplasm of transfected cells. It has retained sequence tags (ESTs)in the databases encoding a similar the ability to interact with cyclin-dependent kinases truncated cyclin D2 in humans. Moreover, such a (CDKs), although it is a poor catalyst of pRb phosphor- transcript was also reported in Xenopus laevis cloned ylation. Interestingly, the presence of a similar, alterna- from an ovary cDNA library (Taı¨ eb and Jessus, 1996). tively spliced cyclin D2 mRNA was also detected in some Cyclin D2 is a G1 cyclin that belongs to the family of human brain tumors. three closely related D-type cyclins, namely, D1, D2 and Oncogene (2008) 27, 1253–1262; doi:10.1038/sj.onc.1210750; D3. These cyclins have been identified as positive published online 17 September 2007 regulators of the cell cycle and have a well-established role in the progression through the G1 phase of the cell Keywords: truncated cyclin D2; transformation; splice cycle. D-type cyclins assemble with their cyclin-depen- variant dent kinase (CDK)partners CDK4 and CDK6 to phosphorylate target proteins such as pRb (reviewed in Sherr and Roberts, 1999; Ortega et al., 2002). Mitogenic signaling ultimately leads to the upregulated expression Introduction of D-type cyclins as well as their kinase-associated activity. Cyclin D2 is a well-defined human proto-oncogene Slow-transforming murine retroviruses can induce and, when illegitimately activated or overexpressed, it leukemia in their host by insertional mutation of cellular can contribute to cellular transformation (reviewed in proto-oncogenes or tumor suppressor genes. Following Malumbres and Barbacid, 2001). Indeed, deregulated the retroviral integration, cellular genes may become expression of the cyclin D2 gene has been reported for aberrantly expressed through activation by viral pro- the first time in murine leukemia virus-induced T-cell moter or enhancer sequences. The abnormal expression leukemias by the identification of the common viral inte- of a certain proto-oncogene may then provide a growth gration site vin1 (Tremblay et al., 1992; Hanna et al., advantage to the target cell and contribute to malignant 1993). In collaboration with an activated Ras (H-RasV12), transformation. During the past years an important overexpressed cyclin D2 can transform primary number of critical cancer genes have been identified in rat embryo fibroblasts (REF)(Kerkhoff and Ziff, 1995). these leukemias by proviral tagging. We have recently In human, overexpression of cyclin D2 is associated with different types of lymphoid malignancy, testicular Correspondence: Dr E Rassart, De´ partement des Sciences Biologiques, carcinoma and ovarian cancer (Sicinski et al., 1996; Universite´ du Que´ bec a` Montre´ al, Case Postale 8888 Succ. Centre- Bartkova et al., 1999; Teramoto et al., 1999). ville, Montre´ al, Canada H3C-3P8. In this article, we present evidence that the over- E-mail: [email protected] or [email protected] 1These authors contributed equally to this work. expression of the truncated cyclin D2 can transform Received 4 June 2007; revised 25 July 2007; accepted 26 July 2007; primary MEF in conjunction with activated Ras. We published online 17 September 2007 also present evidence for a human homolog transcript of Characterization of mouse and human truncated cyclin D2 C Denicourt et al 1254 a truncated cyclin D2 that is overexpressed in some types of primary human brain tumors. As opposed to 12 3 the subcellular localization of the cyclin D2 protein, this truncated cyclin D2 was never observed in the nucleus of NIH/3T3 fibroblasts but was predominantly localized to the cytoplasm. Despite the fact that this truncated cyclin represents half of the full-length cyclin D2, this isoform still retains the ability to interact with CDK4, but the 45 6 complex is unable to phosphorylate its target pRb. Results Ectopic expression of the truncated cyclin D2 and activated Ras causes transformation of primary MEF Since the truncated cyclin D2 transcript was found over- expressed in the leukemias induced by Graffi retrovirus, b we hypothesized that the protein could probably function as an oncogene. MEF were transfected with a truncated cyclin D2 expressing construct and with an activated H-Ras to determine if it was able to trans- form in vitro. As controls, MEF were also transfected with H-Ras alone, H-Ras þ c-Myc and H-Ras þ cyclin D2. The truncated cyclin D2 was not able to induce transformation alone or with c-Myc (not shown and Figure 1a). Very few foci were obtained with H-Ras alone and no foci at all were seen in the mock-trans- fected MEF. As expected, the co-transfection of the cyclin D2 in combination with an activated Ras gave some foci. It has been shown that cyclin D2 is able to trans- form primary REF in co-expression with an activated Ras (Kerkhoff and Ziff, 1995). In that study, the oncogenic activity of cyclin D2 and H-Ras was much lower than the combination of c-Myc and H-Ras (Kerkhoff and Ziff, 1995). However, when the MEF Figure 1 Transformation properties of the truncated cyclin D2 on were co-transfected with an activated Ras and a primary mouse embryo fibroblasts (MEF). (a)For the focus truncated cyclin D2 expression vector, they presented formation assay, primary MEF were mock transfected (1), a large number of foci at a density comparable to that transfected with Ras EJ 6.6 construct (2), truncated cyclin D2 obtained with H-Ras þ c-Myc (Table 1). The density of and pSV2-Myc constructs (3), cyclin D2 and Ras EJ 6.6 constructs (4), truncated cyclin D2 and Ras EJ 6.6 constructs (5), pSV2-Myc foci induced with the truncated cyclin D2 was much and Ras EJ 6.6 constructs (6). Fourteen days after transfection, higher than that obtained with the full-length cyclin D2 cells were fixed with methanol and stained with methylene blue. suggesting that the truncated cyclin D2 is a more potent (b)MEF transfected with the truncated cyclin D2 and activated inducer of transformation. Also, the size of each foci Ras were also treated with G418 for selection of stable was larger with the truncated cyclin D2. Similar transfectants. The colonies showing a transformed phenotype were isolated and replated for observations. Upper panel (magnification transformation results were obtained with the human  40)shows typical foci obtained with truncated cyclin D2 and truncated cyclin D2 (results not shown). In contrast, the activated Ras. Arrows in lower panel (magnification  100) combination of the normal and the truncated cyclins D2 indicate transformed multinucleated cells. did not produce foci (results not shown). MEF transfected with the truncated cyclin D2 and activated Ras were also treated with G418 for selection of stable transfectants. The colonies showing a trans- with the combination of cyclin D2 and activated Ras formed phenotype were selected and replated. These stable transfectants (not shown; Kerkhoff and Ziff, cells were dependent on the presence of serum for their 1995). The majority of the truncated cyclin D2 and proliferation and showed no contact inhibition and H-Ras stable transfectants were attached very weakly to continued to proliferate even when confluency was the plates and only stable transfectants expressing low reached (Figure 1b). These cells were also morphologi- level of the truncated cyclin D2 were obtained (not cally different from the primary MEF as they were rod shown). It is possible that high levels of expression of the shaped and highly refractile. An important number of truncated cyclin D2 in transformed MEF interfere with cells presenting multinucleation were also observed cell adhesion. This property was also observed in the (Figure 1b, lower panel). Similar results were obtained cyclin D2 transformed REF (Kerkhoff and Ziff, 1995). Oncogene Characterization of mouse and human truncated cyclin D2 C Denicourt et al 1255 Truncated cyclin D2 expression is detected in human to normal brain tissue, an increased expression of the brain tissues truncated human cyclin D2 was observed in certain We previously reported the identification of human tumor types (Figure 2).
Recommended publications
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage

    Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage

    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
  • Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS

    Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS

    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding1, Paul-Joseph Aspuria1, Hasmik Agadjanian1, Dong-Joo Cheon1, Takako Mizuno1,2, Danielle Greenberg1, Jenieke R. Allen1,2, Lindsay Spurka3, Vincent Funari3, Elizabeth Spiteri4, Qiang Wang1,5, Sandra Orsulic1, Christine Walsh1,6, Beth Y. Karlan1,6, W. Ruprecht Wiedemeyer1 1 Women’s Cancer Program at the Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 2Graduate Program in Biomedical Sciences and Translational Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 3Genomics Core, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 4Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 5Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 6 Department of Obstetrics and Gynecology, David Geffen School of Medicine, University of California, Los Angeles, CA 90048, USA Correspondence to: W. Ruprecht Wiedemeyer, e-mail: [email protected] Keywords: Cyclin-dependent kinase inhibitors, palbociclib, dinaciclib, cyclin E1, ovarian cancer Received: July 15, 2014 Accepted: November 02, 2014 Published: December 22, 2014 ABSTRACT High-grade serous ovarian cancers (HGSOC) are genomically complex, heterogeneous cancers with a high mortality rate, due to acquired chemoresistance and lack of targeted therapy options. Cyclin-dependent kinase inhibitors (CDKi) target the retinoblastoma (RB) signaling network, and have been successfully incorporated into treatment regimens for breast and other cancers. Here, we have compared mechanisms of response and resistance to three CDKi that target either CDK4/6 or CDK2 and abrogate E2F target gene expression.
  • Phosphatidylinositol 3-Kinase Mediates Proliferative Signals in Intestinal Epithelial Cells H Sheng, J Shao, C M Townsend Jr, B M Evers

    Phosphatidylinositol 3-Kinase Mediates Proliferative Signals in Intestinal Epithelial Cells H Sheng, J Shao, C M Townsend Jr, B M Evers

    1472 COLON Gut: first published as 10.1136/gut.52.10.1472 on 11 September 2003. Downloaded from Phosphatidylinositol 3-kinase mediates proliferative signals in intestinal epithelial cells H Sheng, J Shao, C M Townsend jr, B M Evers ............................................................................................................................... Gut 2003;52:1472–1478 Background and aims: Determination of intracellular signalling pathways that mediate intestinal epithelial proliferation is fundamental to the understanding of the integrity and function of the intestinal tract under normal and diseased conditions. The phosphoinositide 3-kinase (PI3K)/Akt pathway transduces signals See end of article for initiated by growth factors and is involved in cell proliferation and differentiation. In this study, we assessed authors’ affiliations the role of PI3K/Akt in transduction of proliferative signals in intestinal epithelial cells. ....................... Methods: A rat intestinal epithelial (RIE) cell line and human colorectal cancer HCA-7 and LS-174 cell lines Correspondence to: served as in vitro models. The Balb/cJ mouse was the in vivo model. Dr H Sheng, Department of Results: PI3K activation was critical for G1 cell cycle progression of intestinal epithelial cells. Ectopic Surgery, University of expression of either active p110a or Akt-1 increased RIE cell proliferation. In vivo experiments Texas Medical Branch, 301 University Boulevard, demonstrated that PI3K activation was closely associated with the proliferative activity of intestinal mucosa. Galveston, Texas 77555, Treatment of mice with PI3K inhibitors blocked induction of PI3K activity and attenuated intestinal mucosal USA; [email protected] proliferation associated with oral intake. Epidermal growth factor and transforming growth factor a Accepted for publication stimulated PI3K activation which was required for growth factor induced expression of cyclin D1.
  • Targeting the Phosphatidylinositol 3-Kinase Signaling Pathway in Acute

    Targeting the Phosphatidylinositol 3-Kinase Signaling Pathway in Acute

    Integrative Cancer Science and Therapeutics Review Article ISSN: 2056-4546 Targeting the phosphatidylinositol 3-kinase signaling pathway in acute myeloid leukemia Ota Fuchs* Institute of Hematology and Blood Transfusion, Prague, Czech Republic Abstract The phosphatidylinositol-3-kinase-Akt (protein kinase B) - mechanistic target of rapamycin (PI3K-Akt-mTOR) pathway is often dysregulated in cancer, including hematological malignancies. Primary acute myeloid leukemia (AML) cell populations may include various subclones at the time of diagnosis. A relapse can occur due to regrowth of the originally dominating clone, a subclone detectable at the time of first diagnosis, or a new clone derived either from the original clone or from remaining preleukemic stem cells. Inhibition of mTOR signaling has in general modest growth-inhibitory effects in preclinical AML models and clinical trials. Therefore, combination of allosteric mTOR inhibitors with standard chemotherapy or targeted agents has a greater anti-leukemia efficacy. Dual mTORC1/2 inhibitors, and dual PI3K/mTOR inhibitors show greater activity in pre-clinical AML models. Understanding the role of mTOR signaling in leukemia stem cells is important because AML stem cells may become chemoresistant by displaying aberrant signaling molecules, modifying epigenetic mechanisms, and altering the components of the bone marrow microenvironment. The PI3K/Akt/mTOR signaling pathway is promising target in the treatment of hematological malignancies, including AML, especially by using of combinations of mTOR inhibitors with conventional cytotoxic agents. Introduction syndromes, chronic myelogenous leukemia (CML), multiple myeloma and lymphoid leukemias and lymphomas [42-54]. Below, I discuss the The mammalian target of rapamycin (mTOR) is a serine/threonine PI3K/Akt/mTOR pathway and its role in AML.
  • Cytometry of Cyclin Proteins

    Cytometry of Cyclin Proteins

    Reprinted with permission of Cytometry Part A, John Wiley and Sons, Inc. Cytometry of Cyclin Proteins Zbigniew Darzynkiewicz, Jianping Gong, Gloria Juan, Barbara Ardelt, and Frank Traganos The Cancer Research Institute, New York Medical College, Valhalla, New York Received for publication January 22, 1996; accepted March 11, 1996 Cyclins are key components of the cell cycle pro- gests that the partner kinase CDK4 (which upon ac- gression machinery. They activate their partner cy- tivation by D-type cyclins phosphorylates pRB com- clin-dependent kinases (CDKs) and possibly target mitting the cell to enter S) is perpetually active them to respective substrate proteins within the throughout the cell cycle in these tumor lines. Ex- cell. CDK-mediated phosphorylation of specsc sets pression of cyclin D also may serve to discriminate of proteins drives the cell through particular phases Go vs. GI cells and, as an activation marker, to iden- or checkpoints of the cell cycle. During unper- tify the mitogenically stimulated cells entering the turbed growth of normal cells, the timing of expres- cell cycle. Differences in cyclin expression make it sion of several cyclins is discontinuous, occurring possible to discrirmna* te between cells having the at discrete and well-defined periods of the cell cy- same DNA content but residing at different phases cle. Immunocytochemical detection of cyclins in such as in G2vs. M or G,/M of a lower DNA ploidy vs. relation to cell cycle position (DNA content) by GI cells of a higher ploidy. The expression of cyclins multiparameter flow cytometry has provided a new D, E, A and B1 provides new cell cycle landmarks approach to cell cycle studies.
  • A-Camkii Controls the Growth of Human Osteosarcoma by Regulating Cell Cycle Progression Kaiyu Yuan1, Leland WK Chung2, Gene P Siegal3 and Majd Zayzafoon1

    A-Camkii Controls the Growth of Human Osteosarcoma by Regulating Cell Cycle Progression Kaiyu Yuan1, Leland WK Chung2, Gene P Siegal3 and Majd Zayzafoon1

    Laboratory Investigation (2007) 87, 938–950 & 2007 USCAP, Inc All rights reserved 0023-6837/07 $30.00 a-CaMKII controls the growth of human osteosarcoma by regulating cell cycle progression Kaiyu Yuan1, Leland WK Chung2, Gene P Siegal3 and Majd Zayzafoon1 Osteosarcoma is the most frequent type of primary bone cancer in children and adolescents. These malignant osteoid forming tumors are characterized by their uncontrolled hyperproliferation. Here, we investigate the role of Ca2 þ / calmodulin-dependent protein kinase II (CaMKII) in the growth of human osteosarcoma. We show that a-CaMKII is expressed in human osteosarcoma cell lines and in primary osteosarcoma tissue derived from patients. The pharmaco- logic inhibition of CaMKII in MG-63 and 143B human osteosarcoma cells by KN-93 resulted in an 80 and 70% decrease in proliferation, respectively, and induced cell cycle arrest in the G0/G1 phase. The in vivo administration of KN-93 to mice xenografted with human osteosarcoma cells significantly decreased intratibial and subcutaneous tumor growth. Mechanistically, KN-93 and a-CaMKII siRNA increased p21(CIP/KIP) gene expression, protein levels, and decreased the phosphorylation of retinoblastoma protein and E2F transactivation. Furthermore, the inhibition of CaMKII decreased membrane-bound Tiam1 and GTP-bound Rac1, which are known to be involved in p21 expression and tumor growth in a variety of solid malignant neoplasms. Our results suggest that CaMKII plays a critical role in the growth of osteosarcoma, and its inhibition could be an attractive therapeutic target to combat conventional high-grade osteosarcoma in children. Laboratory Investigation (2007) 87, 938–950; doi:10.1038/labinvest.3700658; published online 16 July 2007 KEYWORDS: osteosarcoma; CaMKII; cell cycle; osteoblasts; p21; Rac1 Osteosarcomas are among the most frequent primary bone cycle progression.
  • Dual-Specificity, Tyrosine Phosphorylation-Regulated Kinases

    Dual-Specificity, Tyrosine Phosphorylation-Regulated Kinases

    International Journal of Molecular Sciences Review Dual-Specificity, Tyrosine Phosphorylation-Regulated Kinases (DYRKs) and cdc2-Like Kinases (CLKs) in Human Disease, an Overview Mattias F. Lindberg and Laurent Meijer * Perha Pharmaceuticals, Perharidy Peninsula, 29680 Roscoff, France; [email protected] * Correspondence: [email protected] Abstract: Dual-specificity tyrosine phosphorylation-regulated kinases (DYRK1A, 1B, 2-4) and cdc2- like kinases (CLK1-4) belong to the CMGC group of serine/threonine kinases. These protein ki- nases are involved in multiple cellular functions, including intracellular signaling, mRNA splicing, chromatin transcription, DNA damage repair, cell survival, cell cycle control, differentiation, ho- mocysteine/methionine/folate regulation, body temperature regulation, endocytosis, neuronal development, synaptic plasticity, etc. Abnormal expression and/or activity of some of these kinases, DYRK1A in particular, is seen in many human nervous system diseases, such as cognitive deficits associated with Down syndrome, Alzheimer’s disease and related diseases, tauopathies, demen- tia, Pick’s disease, Parkinson’s disease and other neurodegenerative diseases, Phelan-McDermid syndrome, autism, and CDKL5 deficiency disorder. DYRKs and CLKs are also involved in dia- betes, abnormal folate/methionine metabolism, osteoarthritis, several solid cancers (glioblastoma, breast, and pancreatic cancers) and leukemias (acute lymphoblastic leukemia, acute megakaryoblas- Citation: Lindberg, M.F.; Meijer, L. tic leukemia), viral infections (influenza, HIV-1, HCMV, HCV, CMV, HPV), as well as infections Dual-Specificity, Tyrosine caused by unicellular parasites (Leishmania, Trypanosoma, Plasmodium). This variety of pathological Phosphorylation-Regulated Kinases implications calls for (1) a better understanding of the regulations and substrates of DYRKs and (DYRKs) and cdc2-Like Kinases CLKs and (2) the development of potent and selective inhibitors of these kinases and their evaluation (CLKs) in Human Disease, an as therapeutic drugs.
  • Review Therapeutic Potential of Phosphoinositide 3-Kinase Inhibitors

    Review Therapeutic Potential of Phosphoinositide 3-Kinase Inhibitors

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Chemistry & Biology, Vol. 10, 207–213, March, 2003, 2003 Elsevier Science Ltd. All rights reserved. DOI 10.1016/S1074-5521(03)00048-6 Therapeutic Potential of Review Phosphoinositide 3-Kinase Inhibitors Stephen Ward,1,* Yannis Sotsios,1 James Dowden,1 p55␥ encoded by specific genes and p55␣ and p50␣ that Ian Bruce,2 and Peter Finan2,* are produced by alternate splicing of the p85␣ gene). A 1Department of Pharmacy and Pharmacology distinct lipid kinase termed PI3K␥ (or p110␥) is activated Bath University by G protein-coupled receptors, and this is the only Claverton Down characterized member of the class 1B G protein-cou- Bath, BA2 7AY pled PI3K family. The class IB PI3Ks are stimulated by 2 Novartis Horsham Research Centre G protein ␤␥ subunits and do not interact with the SH2- Wimblehurst Road containing adaptors that bind class IA PI3Ks. Instead, Horsham, West Sussex the only identified member of this family, p110␥, associ- United Kingdom ates with a unique p101 adaptor molecule [5]. Neverthe- less, there is some evidence that G protein-coupled receptors (GPCR), such as receptors for chemokines At least one Holy Grail for many academic researchers and lysophosphatidic acid, are also able to activate the and pharmaceutical research divisions alike has been p85/p110 heterodimeric PI3Ks [6, 7]. In this respect, the to identify therapeutically useful selective PI3K inhibi- p85/p110 heterodimer has been demonstrated to be tors. There are several different but closely related synergistically activated by the ␤␥ subunits of G proteins PI3Ks which are thought to have distinct biological and by phosphotyrosyl peptides [8].
  • Phosphatidylinositol 3-Kinase and Akt Protein Kinase Are Necessary and Sufficient for the Survival of Nerve Growth Factor- Dependent Sympathetic Neurons

    Phosphatidylinositol 3-Kinase and Akt Protein Kinase Are Necessary and Sufficient for the Survival of Nerve Growth Factor- Dependent Sympathetic Neurons

    The Journal of Neuroscience, April 15, 1998, 18(8):2933–2943 Phosphatidylinositol 3-Kinase and Akt Protein Kinase Are Necessary and Sufficient for the Survival of Nerve Growth Factor- Dependent Sympathetic Neurons Robert J. Crowder and Robert S. Freeman Department of Pharmacology and Physiology, University of Rochester, School of Medicine, Rochester, New York 14642 Recent studies have suggested a role for phosphatidylinositol of c-jun, c-fos, and cyclin D1 mRNAs. Treatment of neurons (PI) 3-kinase in cell survival, including the survival of neurons. with NGF activates endogenous Akt protein kinase, and We used rat sympathetic neurons maintained in vitro to char- LY294002 or wortmannin blocks this activation. Expression of acterize the potential survival signals mediated by PI 3-kinase constitutively active Akt or PI 3-kinase in neurons efficiently and to test whether the Akt protein kinase, a putative effector of prevents death after NGF withdrawal. Conversely, expression PI 3-kinase, functions during nerve growth factor (NGF)- of dominant negative forms of PI 3-kinase or Akt induces mediated survival. Two PI 3-kinase inhibitors, LY294002 and apoptosis in the presence of NGF. These results demonstrate wortmannin, block NGF-mediated survival of sympathetic neu- that PI 3-kinase and Akt are both necessary and sufficient for rons. Cell death caused by LY294002 resembles death caused the survival of NGF-dependent sympathetic neurons. by NGF deprivation in that it is blocked by a caspase inhibitor Key words: apoptosis; phosphatidylinositol 3-kinase; NGF; or a cAMP analog and that it is accompanied by the induction neuronal survival; Akt; neurotrophic factor The survival of developing neurons requires extracellular signals TrkA autophosphorylates specific tyrosine residues within its that actively prevent programmed cell death.
  • Cyclin-Dependent Kinase (CDK) Phosphorylation Destabilizes Somatic Wee1 Via Multiple Pathways

    Cyclin-Dependent Kinase (CDK) Phosphorylation Destabilizes Somatic Wee1 Via Multiple Pathways

    Cyclin-dependent kinase (CDK) phosphorylation destabilizes somatic Wee1 via multiple pathways Nobumoto Watanabe*†, Harumi Arai*‡, Jun-ichi Iwasaki*§, Masaaki Shiina¶, Kazuhiro Ogata¶, Tony Hunterʈ, and Hiroyuki Osada*‡§ *Antibiotics Laboratory, Discovery Research Institute, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan; ‡Department of Molecular Biology, Graduate School of Science and Engineering, Saitama University, 255 Shimo-Okubo, Sakura, Saitama 338-8570, Japan; §Department of Applied Chemistry, Faculty of Engineering, Toyo University, 2100 Kujirai, Kawagoe, Saitama 350-8585, Japan; ¶Department of Biochemistry, Yokohama City University School of Medicine, 3-9 Fukuura, Kanazawa-ku, Yokohama 236-0004, Japan; and ʈMolecular and Cell Biology Laboratory, The Salk Institute for Biological Studies, 10010 North Torrey Pines Road, La Jolla, CA 92037 Edited by Joan V. Ruderman, Harvard Medical School, Boston, MA, and approved June 14, 2005 (received for review January 18, 2005) At the onset of M phase, the activity of somatic Wee1 (Wee1A), the activity is regulated at both the protein level and by phosphor- inhibitory kinase for cyclin-dependent kinase (CDK), is down- ylation. In addition, Plk family kinases, including Plk1, have a regulated primarily through proteasome-dependent degradation unique domain, PBD (polo box domain), in their C-terminal after ubiquitination by the E3 ubiquitin ligase SCF␤-TrCP. The F-box noncatalytic region, which is important not only for regulation of protein ␤-TrCP (␤-transducin repeat-containing protein), the sub- their intrinsic kinase activity and cellular localization but also for strate recognition component of the ubiquitin ligase, binds to its substrate recognition (4–7). PBD functions as a phospho-Ser͞ substrates through a conserved binding motif (phosphodegron) Thr-binding motif (6).
  • Cyclin D2 Is Overexpressed in Proliferation Centers of Chronic Lymphocytic Leukemia ⁄Small Lymphocytic Lymphoma

    Cyclin D2 Is Overexpressed in Proliferation Centers of Chronic Lymphocytic Leukemia ⁄Small Lymphocytic Lymphoma

    Cyclin D2 is overexpressed in proliferation centers of chronic lymphocytic leukemia ⁄small lymphocytic lymphoma Takuro Igawa,1 Yasuharu Sato,1,6 Katsuyoshi Takata,1 Soichiro Fushimi,2 Maiko Tamura,1 Naoya Nakamura,3 Yoshinobu Maeda,4 Yorihisa Orita,5 Mitsune Tanimoto4 and Tadashi Yoshino1 Departments of 1Pathology; 2Pathology and Experimental Medicine, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Okayama, Japan; 3Department of Pathology, Tokai University School of Medicine, Isehara, Japan; 4Department of Hematology and Oncology; 5Department of Otolaryngology–Head and Neck Surgery, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Okayama, Japan (Received May 16, 2011 ⁄ Revised July 14, 2011 ⁄ Accepted July 17, 2011 ⁄ Accepted manuscript online July 25, 2011 ⁄ Article first published online August 25, 2011) The D cyclins are important cell cycle regulatory proteins involved Previous reports have described that peripheral blood neoplas- in the pathogenesis of some lymphomas. Cyclin D1 overexpression tic cells of patients with CLL ⁄ SLL are closely related to cyclin is a hallmark of mantle cell lymphoma, whereas cyclins D2 and D3 D2.(15–17) In these studies, the vast majority of circulating tumor have not been shown to be closely associated with any particular cells were arrested in the G0 ⁄ early G1 phase and were not the subtype of lymphoma. In the present study, we found that cyclin proliferative component.(11) The proliferating cells are located D2 was specifically overexpressed in the proliferation centers (PC) in the proliferation centers (PC) of lymph nodes, which show a of all cases of chronic lymphocytic leukemia ⁄ small lymphocytic pseudofollicular pattern of pale areas on a dark background of lymphoma (CLL ⁄ SLL) examined (19 ⁄ 19).