Cells B+ Via Sustained PKB Induction in Igm TLR9-Activating DNA Up

TLR9-Activating DNA Up-Regulates ZAP70 via Sustained PKB Induction in IgM + B Cells

This information is current as Isabelle Bekeredjian-Ding, Anne Doster, Martin Schiller, of September 26, 2021. Petra Heyder, Hanns-Martin Lorenz, Burkhart Schraven, Ursula Bommhardt and Klaus Heeg J Immunol 2008; 181:8267-8277; ; doi: 10.4049/jimmunol.181.12.8267

http://www.jimmunol.org/content/181/12/8267 Downloaded from

References This article cites 103 articles, 52 of which you can access for free at: http://www.jimmunol.org/content/181/12/8267.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 26, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

TLR9-Activating DNA Up-Regulates ZAP70 via Sustained PKB Induction in IgM؉ B Cells1

Isabelle Bekeredjian-Ding,2* Anne Doster,* Martin Schiller,† Petra Heyder,† Hanns-Martin Lorenz,† Burkhart Schraven,‡ Ursula Bommhardt,‡ and Klaus Heeg*

In the past, ZAP70 was considered a T cell-specific kinase, and its aberrant expression in B-CLL cells was interpreted as a sign of malignant transformation and dedifferentiation. It was only recently that ZAP70 was detected in normal human B cells. In this study, we show that TLR9-activated B cells resemble B-cell chronic lymphocytic leukemia cells with regard to CD5, CD23, CD25, and heat shock protein 90 expression. Furthermore, stimulatory CpG and GpC DNA oligonucleotides target CD27؉IgM؉ and .CD27؊IgM؉ B cells (but not IgM؊ B cells) and enhance ZAP70 expression predominantly in the IgM؉CD27؉ B cell subset ZAP70 is induced via activation of TLR-7 or -9 in a MyD88-dependent manner, depends on protein kinase B (PKB)/mammalian target of rapamycin signaling and is rapamycin sensitive. Furthermore, ZAP70 expression levels correlate with induction of cyclin Downloaded from A2, prolonged B cell proliferation, and sustained induction of PKB. These events are not observed upon CD40 ligation. However, this deficit can be overcome by the expression of constitutively active PKB, given that CD40 ligation of PKB-transgenic B cells induces B cell proliferation and ZAP70 expression. These results highlight a major difference between CD40- and TLR-7/9- mediated B cell activation and suggest that ZAP70 expression levels in B cells give an estimate of the proliferative potential and the associated PKB availability. The Journal of Immunology, 2008, 181: 8267–8277. http://www.jimmunol.org/ AP70 is a syk-related tyrosine kinase of 70 kDa originally a specific role for ZAP70 in BCR-triggered pro- to pre-B cell de- described in T cells and NK cells. It has been shown to be velopment (14). Z required in TCR signal transduction, in T cell apoptosis B-CLL cells phenotypically resemble activated B cells and typ- (1), and in positive and negative selection in the thymus (2). Until ically express CD5, CD23, and CD25 among other activation lately, expression of ZAP70 in human B cells was believed to be markers (15). In an aggressive course of disease, B-CLL patients restricted to B cell chronic lymphatic leukemia (B-CLL)3 cells present with splenomegaly and lymph node engrossment. This co- where it is associated with an unfavorable outcome, although its incides with high levels of soluble CD23, CD38, and ZAP70 ex- exact role remains unknown (3–7). Recently, ZAP70 expression pression that have been associated with an unfavorable prognosis by guest on September 26, 2021 was also observed in B cells from healthy donors (8–10). How- (16, 17). Moreover, B-CLL cells express tumor-associated survival ever, this issue remained controversial because other investigators genes such as the anti-apoptotic molecules bcl-2 (18, 19), survivin failed to detect ZAP70 expression in mature human B cells (11). In (20), protein kinase B (PKB), also known as Akt (21), and heat marked contrast to T cells, ZAP70 is considered to be dispensable shock protein 90 (Hsp-90; Ref. 22). Additionally, TCL-1, a fre- for mature B cell function in the presence of the closely related quently encountered B-CLL oncogene, enhances cell survival and tyrosine kinase Syk (12, 13); thus far, only one study has described proliferation by activating PKB signaling (23–27). TLR9 ligands such as CpG DNA oligodeoxynucleotides (ODN) represent very potent activators of polyclonal B cell proliferation (28, 29). They induce a transient splenomegaly after in vivo ad- *Department of Medical Microbiology and Hygiene, University Hospital Heidelberg, ministration (30) and have also been described as stimuli for B- Heidelberg, Germany; †Department of Internal Medicine V, Division of Rheumatol- CLL cells (21, 31–33). Because it is currently under debate ‡ ogy, University Hospital, Heidelberg, Heidelberg, Germany; and Institute of Molec- whether infections can trigger the development or progression of ular and Clinical Immunology, Otto-von-Guericke-University, Magdeburg, Magde- burg, Germany B-CLL (15, 34–37) and B cell-active phosphorothioate-modified Received for publication January 4, 2008. Accepted for publication October 17, 2008. type B CpG DNA ODNs (PTO) are currently making their way The costs of publication of this article were defrayed in part by the payment of page into clinics (33, 38–40), we were prompted to investigate the ef- charges. This article must therefore be hereby marked advertisement in accordance fects and possible side effects of CpG DNA ODNs on normal with 18 U.S.C. Section 1734 solely to indicate this fact. human B cells. 1 This study was supported by Deutsche Forschungsgemeinschaft Grants BO1054/2-1 This study shows that CpG DNA ODN-stimulated B cells to U.B. and LO 437/5-3 to H.-M.L. and M.S. I.B.-D. is supported by an Olympia closely resemble B-CLL cells, including ZAP70 expression. We Morata grant from the medical faculty of the University of Heidelberg, Germany. This ϩ ϩ study contains parts of the doctoral thesis of A.D. further demonstrate that CpG DNA ODNs stimulate IgM CD27 ϩ Ϫ 2 Address correspondence and reprint requests to Dr. Isabelle Bekeredjian-Ding, and IgM CD27 B cells, the B cell subsets thought to represent Department of Medical Microbiology and Hygiene, University of Heidelberg, Im the cellular origin of B-CLL. Neuenheimer Feld 324, 1.OG, D-69120 Heidelberg, Germany. E-mail address: [email protected] Materials and Methods 3 Abbreviations used in this paper: B-CLL, B cell chronic lymphatic leukemia; PTO, phosphorothioate-modified ODN; PKB, protein kinase B; Hsp-90, heat shock protein Cells, mice, cell isolation, and stimulation 90; ODN, oligodeoxynucleotide; CD2 myrPKB tg, myrPKB-transgenic; WT, wild type; 17-AAG, 17-(allylamino)-17-demethoxygeldanamycin; MFI, mean fluores- The use of PBMCs from healthy volunteers was approved by the local cence intensity; FSC, forward light scatter; SSC, side light scatter. ethics committee. For B cell isolation, PBMC were isolated from heparin- ized blood or from buffy coats by density gradient centrifugation. B cells ϩ Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 for Western blot analysis were always isolated from buffy coats. CD19 B www.jimmunol.org 8268 TLR9-INDUCED B CELL EXPRESSION OF ZAP70 cells (purity, 98.5 Ϯ 1%) were positively selected as previously described from the MFI for the anti-ZAP70 mAb. Intracellular staining for IgM and (41). CD27ϩ fractions were positively isolated with CD27ϩ microbeads IgG was performed as previously described (41). For BrdU incorporation from untouched resting B cells negatively isolated after depletion with assays, B cells were pulsed with 0.5 ␮M BrdU (Roche Biochemicals) on CD3 microbeads followed by CD43 microbeads (purity, 98 Ϯ 2%); day 0. BrdU incorporation was quantified on day 5 using the allophyco- CD43ϪCD27Ϫ naive cells remained untouched after CD27 depletion. For cyanin BrdU flow kit from BD Biosciences following the protocol pro- isolation of IgMϩ and IgMϪ B cells, cells were first stained with an allo- vided. CFSE staining was performed with 1 ␮M CFSE (Molecular Probes); phycocyanin-conjugated anti-human IgM mAb (BD Pharmingen). IgMϩ B CFSE dilution was analyzed on day 6. Annexin V-FITC and propidium cells were first depleted from PBMCs with anti-allophycocyanin mi- iodide staining were performed according to the manufacturer’s protocol crobeads and then purified from the positive fraction (purity, 98 Ϯ 1%). (BenderMedSystems). Ϫ Ϫ ϩ IgM B cells were isolated from the IgM fraction with CD19 beads as For immunofluorescent staining, B cells were centrifuged onto poly-L- above (purity, 92 Ϯ 5%). Isolated B cell fractions were cultured in RPMI lysine (Sigma-Aldrich)-coated slides, air dried, and fixed with 4% para- 1640 (Biochrom) supplemented with 100 IU/ml penicillin and 100 ␮g/ml formaldehyde-PBS. Cells were blocked in PBS, 0.1% saponin, 5% FCS, streptomycin, 1% HEPES buffer (all from Sigma-Aldrich), and 10% heat- 2% nonfat dry milk and stained with Alexa 488-conjugated anti-ZAP70 inactivated autologous serum and incubated overnight before stimulation. mAb or murine IgG1 isotype control diluted 1:10. 4Ј,6Ј-Diamidino-2-phe- In all B cell fractions, the percentage of contaminating T cells was 0.5 Ϯ nylindole (Molecular Probes) was added at 0.1 ␮M in PBS-glycerol mount- 0.5% on the day of isolation; T cells were rarely detectable on the day of ing medium. Images were acquired on a Leica DMI 6000 B microscope. analysis (Fig. 6D). The experimental use of mice was approved by the local animal com- Western blot analysis mittee. MyD88 knockout mice and constitutively active myrPKB-trans- Cell lysates were prepared in radioimmunoprecipitation assay lysis buffer genic (CD2 myrPKB tg) mice have been previously described (42, 43). from 2 or 5 ϫ 106 B cells. Twelve percent polyacrylamide gels were myrPKB expression in B cells was demonstrated previously (44). Murine ϩ blotted on nitrocellulose (ZAP70 and PKB blots) or polyvinylidene diflu- CD19 B cells were isolated from single-cell suspensions from spleens of oride (Hsp-90 blots) membranes. Membranes were blocked in 5% milk or Ն Downloaded from wild-type (WT; C57BL/6), MyD88 knockout ( 6 backcrosses) and myr- 3% BSA and incubated with the respective Abs according to the manu- Ն PKB tg mice ( 8 backcrosses) with anti-CD19 microbeads. Purity was facturers’ recommendations: rabbit anti-ZAP70 (Epitomics); anti-Hsp-90 Ϯ 92 2%. Murine B cells were resuspended in RPMI 1640 supplemented (Santa Cruz Biotechnology); mouse anti-GAPDH (Chemicon); anti-actin ϫ Ϫ7 with penicillin and streptomycin, 5 10 M 2-ME (Sigma-Aldrich), and (Sigma-Aldrich); rabbit anti-(pan-)Akt (Cell Signaling). 10% heat-inactivated FCS (Biochrom). For stimulation, human and murine CD19ϩ B cells were plated at 1 ϫ Real-time RT-PCR 105/well unless otherwise indicated. All media and reagents were tested for endotoxin as previously described (45). The stimulatory agents were ti- Total RNA isolation (High Pure RNA Isolation Kit; Roche) and cDNA http://www.jimmunol.org/ trated for optimal concentrations and used as follows: human CpG-B DNA synthesis with poly(T) primers (First Strand cDNA Kit; Fermentas) were ODN 2006-PTO (5Ј-tcgtcgttttgtcgttttgtcgtt-3Ј) and 2006-GpC DNA ODN- performed according to the manufacturers’ protocols. Real-time PCR was PTO (5Ј-tgctgcttttgtgcttttgtgctt-3Ј); murine CpG-B DNA ODN 1668-PTO performed with a quantitative PCR mix using SYBR-Green following the (5Ј-tccatgttcctgatgct-3Ј), all at 0.5 ␮M (Western blots and experiments in standard protocol (Eurogentec; ABI PRISM 7700; Applied Biosystems) on Figs. 2 and 6) or 1 ␮M, full-length phosphorothioate linkage, all purchased a Taqman (Applied Biosystems). RT-PCR was controlled by no template ␮ ␣ and no reverse transcriptase controls. Relative expression to ␤-actin was from MWG Biotech); R848 (InvivoGen), 0.25 g/ml, and IFN- 1000 Ϫ ␮ calculated as [1/2(Ct target gene Ct actin)]. Primers and fragment size: U/ml (Preprotech); Pam3CysSerLys4 (EMC Microcollections), 1 g/ml; ␤ Ј Ј highly purified LPS, 100 ng/ml (gift from U. Seidel, Research Center Bor- -actin, forward 5 AGAGCTACGAGCTGCCTGAC; reverse 5 AG ϩ ϩ ϩ Ј CACTGTGTTGGCGTACAG; 184 bp; cyclin A2, forward 5Ј AGAC- stel, Borstel, Germany); goat anti-human IgM IgG IgA (H L) F(ab )2 Ј fragments, and goat anti-murine IgMϩIgG (HϩL) F(abЈ) fragments were GAGACGGGTTGCAC, reverse 5 GGGCATCTTCACGCTCTATT; 174 2 bp; Hsp-90, forward 5Ј GATGGAGGAGGAGGTTG, reverse 5Ј TACCG purchased from Jackson Immunoresearch and used at 5 ␮g/ml, unless oth- by guest on September 26, 2021 GATTTTGTCCAATGC; 150 bp; ZAP70, forward 5Ј TGGCCTC erwise indicated. BHK-CD40L and BHK-pTCF control cells (gift from H. Ј Engelmann, Institute of Immunology, University of Munich, Munich, Ger- TCCAAAGCACT; reverse 5 CGGCCCTTTCATCTTCTTG; 199 bp. many) were UV irradiated (0.75 J/cm2) and used at a ratio of 1:10 B cells. Statistics For murine CD40 activation, purified (no azide, low endotoxin) anti-CD40 (3/23) mAb (BD Pharmingen) was diluted in PBS (10 ␮g/ml); wells were Data are shown as means Ϯ SEM. Statistical significance of differences coated with 50 ␮l/well for1hat37°C and 4°C overnight. The inhibitors was determined by the paired two-tailed Student t test using Microsoft for ء allylamino)-17-demethoxygeldanamycin (17-AAG; 1 ␮M; unless oth- Excel software. Statistically significant differences are indicated with)17- for p Յ 0.005. Whisker plots were created using Graphءء erwise indicated), rapamycin (10 ng/ml), and Bay-11-7082 (10 ␮M) were p ϭ 0.05 and purchased from Calbiochem; wortmannin (200 nM) was purchased from Pad Prism software. Sigma-Aldrich. Results Proliferation assays CpG DNA ODNs mediate prolonged B cell activation 4 5 B cells were plated at 5 ϫ 10 human B cells/well (200 ␮l) and 1 ϫ 10 CpG DNA ODN have been described as potent inducers of poly- murine B cells/well. Stimulation was performed in triplicates. Cells were ␮ 3 ␮ clonal B cell proliferation. Here we compared short-term prolifer- pulsed with 1 Ci [ H]TdR (Amersham) per well after 54 h or with 0.5 M 3 BrdU (Roche Biochemicals) after 48 h. All proliferation assays were har- ation over 72 h measured by [ H]TdR incorporation to long-term vested after 72 h. [3H]TdR incorporation was quantified in cpm. BrdU proliferation visualized with CFSE dilution over 5 days. When incorporation was measured in relative light units using the BrdU prolif- comparing CpG DNA ODN 2006 to BCR cross-linking with anti- eration ELISA for chemiluminescence from Roche Biochemicals. human Ig or CD40L stimulation, one major difference became ap- Flow cytometry and immunofluorescent microscopy parent: upon CD40 ligation, proliferation mainly resulting from CD27ϩ memory B cells was detectable with [3H]TdR incorpora- For flow cytometric analysis of cell surface markers, cells were stained in PBS/2% FCS according to standard procedures. The Abs used were pur- tion (Fig. 1A) whereas absence of long-term proliferative activity chased from BD Pharmingen: anti-human IgD (FITC); IgM (PE); IgM was observed in CFSE dilution assays (Fig. 1B). Similar results (allophycocyanin); IgG (FITC); CD5 (allophycocyanin); CD5 (FITC); were obtained with BCR cross-linking (Fig. 1, A and B): despite an CD20 (PerCP); CD19 (PE); CD25 (CyChrome); CD25 (allophycocyanin); early and comparably strong proliferative response to anti-Ig in CD27 (PE); CD38 (FITC); CD38 (PE); CD71 (FITC); CD138 (PE); anti- [3H]TdR incorporation assays which was seen in both CD27ϩ and mouse B220 (PE). Anti-human CD23 (FITC) was purchased form Caltag Ϫ Laboratories. Cells were analyzed on a FACSCanto (BD Biosciences) with CD27 B cells, CFSE dilution was nearly absent on day 5. In FACSDiva Software (BD Biosciences). Only live gated cells were sub- marked contrast, TLR9 stimulation not only induced high prolif- jected to analysis. eration rates at early time points (most prominent in the CD27ϩ B Intracellular staining for ZAP70 was performed after cell fixation in 4% cell fraction; Fig. 1A), but additionally induced significant CFSE paraformaldehyde with Alexa 488-conjugated anti-ZAP70 or murine IgG1 isotype control (Caltag Laboratories) in permeabilizing medium B (Caltag dilution resulting from ongoing cell division over several days Laboratories). Mean fluorescence intensity for ZAP70 (⌬MFI) was calcu- (Fig. 1B). Synergistic activity of CD40L was observed when co- lated by subtracting the MFI (median) for the murine IgG1 isotype control stimulating anti-Ig (Fig. 1, A and B) or CpG DNA (Fig. 1B), which The Journal of Immunology 8269 Downloaded from http://www.jimmunol.org/

FIGURE 1. TLR9-mediated B cell activation. A and B, Proliferation. B cells were stimulated with BHK-CD40L (CD40L; 40L), BHK-pTCF (pTCF) control cells, anti-Ig (Ig, 10 ␮g/ml), or CpG DNA ODN 2006 (CpG) or combined stimuli as indicated. A,[3H]TdR incorporation of CD27ϩ (black, n ϭ p ϭ 0.002, Igϩ pTCF:Igϩ 40L ,ءء ;(p ϭ 0.016, pTCF:40L (CD27Ϫ) and 0.02 (CD27ϩ ,ء .and CD27Ϫ (gray, n ϭ 5) B cells after 72 h is given in cpm (4 (CD27Ϫ) and 0.01 (CD27ϩ). B, CD19ϩ B cells were labeled with CFSE. CFSE dilution was measured on day 5. One representative experiment of Ն4 experiments is shown. The percentage of proliferating cells is indicated. C, Activation markers. Flow cytometric analysis of CD5, CD23, and CD25 expression on CD19ϩ human B cells after stimulation with either CD40L or CpG DNA 2006 for 5 days. D, Expression of Hsp-90. Top, Hsp-90 mRNA expression. RNA was isolated from CpG DNA ODN 2006-stimulated and unstimulated B cells after 3 h. Results are summarized from three independent by guest on September 26, 2021 donors. Hsp-90 mRNA expression was normalized to actin as the housekeeping gene. Values were normalized by defining the unstimulated conditions as p (unstimulated:CpG) ϭ 0.015. Bottom, Hsp-90 expression ,ء ;to show the x-fold increase in mRNA expression in comparison to unstimulated samples 1 was analyzed in protein lysates from B cells stimulated with or without CpG DNA ODN 2006 for 24 h. Actin was used as the loading control. Results are for two independent donors of a total of four. synergistically increased proliferation rates and CFSE dilution, CpG DNA ODN activate both memory and naive B cell thus proving the integrity of the CD40L stimulus. fractions ϩ ϩ TLR9-induced prolonged B cell proliferation is linked IgM CD27 B cells represent the human counterpart to murine to a B-CLL-like phenotype marginal zone B cells (49, 50). These B cells are major players in the immune response against encapsulated bacteria such as pneu- B-CLL cells resemble activated B cells. Concomitant expression mococci and Haemophilus. They are strongly reactive to T cell- of CD5, CD23, and CD25 is used as a diagnostic criterion. Sim- independent Ags and are thought to represent the cellular origin for ilarly, B cell stimulation with CpG DNA ODN induces long lasting B-CLL. Because CpG DNA-stimulated B cells and B-CLL share up-regulation of activation markers, including those characteristic many phenotypical features, we asked whether CpG DNA ODN for B-CLL. This is shown in Fig. 1C which compares B cell ex- target human IgMϩ memory B cells. Currently, CpG DNA ODN pression of CD5, CD23, and CD25 in B cells stimulated with CD40L or CpG DNA ODN 2006 for 5 days. Marked up-regulation have been described as polyclonal T cell-independent B cell stim- of expression of these markers is observed only upon CpG DNA uli that predominantly stimulate memory B cells. We therefore first wanted to confirm that TLR9 stimulation mainly activates memory treatment. ϩ Ϫ Another hallmark of B-CLL is overexpression of the chaperone (CD27 ) B cells. To this end, resting (CD43 ) B cells were iso- molecule Hsp-90. Heat shock protein expression is associated with lated from human PBMCs and stimulated with CpG DNA ODN improved cell survival, and targeting Hsp-90 is therefore widely 2006 or CD40L. Activation marker expression, cell survival, and applied in tumor therapy. Here we corroborate previous reports proliferation were monitored at different time points after stimu- (46–48) showing that B cell stimulation with CpG DNA ODN lation. The main findings are summarized in Fig. 2A, which shows 2006 induces Hsp-90 expression on mRNA level (Fig. 1D, top) the results from a representative experiment on day 4 after CpG and on protein level (Fig. 1D, bottom). In summary, CpG DNA DNA stimulation. The forward/sideward scatter blots (Fig. 2A, ϩ Ϫ ODN-mediated prolonged proliferation, CD5, CD23, and CD25 left) show cell survival (live gate; P1) in both CD27 and CD27 expression along with Hsp-90 induction turns normal human B cell fractions, albeit blast formation is predominant in CD27ϩ cells into B-CLL-resembling B cell blasts. memory B cells. We further detected up-regulation of CD23 8270 TLR9-INDUCED B CELL EXPRESSION OF ZAP70 Downloaded from http://www.jimmunol.org/ FIGURE 3. TLR9-mediated up-regulation of ZAP70 in peripheral B cells. A, Human CD19ϩ peripheral blood B cells were stimulated with CpG DNA ODN 2006. On day 6, cells were stained with Alexa 488-conjugated anti-ZAP70 mAb or the corresponding isotype. 4Ј,6Ј-Diamidino-2-phe- nylindole (DAPI) was used for counterstaining of the nuclei. The images show one representative experiment of Ն4. B, ZAP70 expression was quantified by intracellular flow cytometric analysis on days 0 and 6 in CD40L (40L) or CpG DNA ODN 2006-stimulated CD19ϩ B cells. Results are summarized frp from three experiments as mean values Ϯ SEM for by guest on September 26, 2021 p ϭ 0.04, CD40L:CpG. C, Expression of ZAP70 in B cell ,ء .(MFI (⌬MFI lysates generated on day 4. The results of two independent donors from Ն6 donors are shown. GAPDH was used as a loading control.

expression in CD27Ϫ-naive B cells (Fig. 2A, middle) which was seen neither with CD27ϩ B cells nor after CD40L stimulation at this late time point (data not shown). In contrast, stimulation of CD27ϩ B cells with CpG DNA induced an up-regulation of CD27 expression that was completely absent in naive B cells (Fig. 2A, middle) and was not observed after CD40 ligation (data not shown). These differences conﬁrm the purity of our cell fractions. Furthermore, CD71 expression which was used as a surrogate marker for cell proliferation was brighter in memory B cells (Fig. 2A, right panels), as expected from the results shown in Fig. 1A. Moreover, CD71 expression was highest in an intracellular IgMϩ B cell subset. We concluded that CpG DNA ODNs target both Ϫ memory and naive B cells although proliferation is, indeed, most FIGURE 2. Cellular target of CpG DNA 2006. A, CD27 (bottom row) ϩ ϩ and CD27ϩ B cells (top row) were isolated from resting (CD43Ϫ) periph- pronounced in IgM CD27 B cells. eral blood B cells and stimulated with CpG DNA ODN 2006 (0.5 ␮M). ϩ CpG DNA ODN target IgM B cells Cells were analyzed on day 4 post stimulation for FSC/SSC properties (left), CD23 and CD27 expression (middle), and intracellular IgM and To further assess which B cell subset represents the main target for CD71 surface expression (right). One representative experiment of four is CpG DNA ODN, we stimulated total CD19ϩ B cells with CpG ϩ shown. B, CD19 B cells were isolated form PBMC and analyzed for IgM DNA ODN 2006 or CD40L and analyzed intracellular IgM and and IgG expression on days 0 and 5 after stimulation with CpG DNA ODN IgG expression on day 0 and at different time points after stimu- 2006 or CD40L. Results are for three representative experiments of ﬁve lation. Fig. 2B shows the data obtained from three donors, thus independent experiments. C, IgMϩ and IgMϪCD19ϩ B cell fractions were summarizing the main result of these experiments: CpG DNA isolated from PBMCs. Cells were analyzed after 4 days of stimulation for FSC/SSC properties (left), CD23 and CD27 expression (middle), and in- stimulation shifts Ig expression to IgM which is neither present on tracellular IgM and CD71 surface expression (right). Results are for one day 0 nor visible after CD40 stimulation. Moreover, CpG DNA- representative donor of six. induced IgG expression is absent (Fig. 2B, donor 1) or negligible (Fig. 2B, donors 2 and 3). On the basis of these experiments, we The Journal of Immunology 8271 Downloaded from

FIGURE 4. Role of MyD88 and Hsp-90 in CpG DNA-stimulated ZAP70 expression. A, Splenic CD19ϩ B cells were isolated from WT and MyD88Ϫ/Ϫ mice. Cells were stimulated with CpG DNA ODN 1668 (CG) or anti-mouse Ig at 20 ␮g/ml. ZAP70 expression was measured on day 3 by flow cytometry. The results p ϭ 0.003, WT/CpG:MyD88Ϫ/Ϫ/CpG. B, CD43ϪCD27ϩ and CD43ϪCD27Ϫ ,ءء .are given as mean values Ϯ SEM of ⌬MFI of four independent experiments human B cells were isolated from PBMCa and stimulated with CpG DNA ODN 2006. ZAP70 expression was assessed on day 4. Costaining was performed with http://www.jimmunol.org/ anti-CD20 (left) and anti-IgM (right). Results are for one representative experiment of four. C, CD19ϩ B cells were stimulated with CpG DNA 2006 ODN. On day 6 anti-ZAP70 staining (bottom) was compared with the isotype control (top). Costaining was performed with anti-CD138 to stain plasmablasts. D–F, Effect of Hsp-90 inhibitor 17-AAG on CpG DNA ODN 2006-stimulated CD19ϩ B cells. Analysis on day 3. D, ZAP70 expression. Results summarize the mean values Ϯ p ϭ 0.04, CpGϩDMSO:CpGϩ 17-AAG). E, Proliferation was assessed by [3H]TdR incorporation. Mean values Ϯ SEM of four ,ء .SEM of six experiments p ϭ 0.017, CpGϩDMSO:CpG ϩ 17AAG 1 ␮M. F, Cell viability was measured as a percentage of propidium iodide and annexin VϪ ,ء .experiments are given .p ϭ 0.006, CpGϩDMSO:CpGϩ 17AAG 1 ␮M ,ءء .cells. The mean values Ϯ SEM of six experiments are shown by guest on September 26, 2021 decided to compare IgMϩ to IgMϪ B cells to assess whether CpG ODN 2006 for 6 days, ZAP70 was detected in individual, mostly DNA ODN would predominantly activate IgMϩ B cells. large B cell blasts, with a cytoplasmic staining pattern (Fig. 3A). To address this question, we isolated IgMϩ B cells. After de- Next, we wanted to know whether ZAP70 expression in human pletion of residual IgMϩ cells from PBMC, we isolated the IgMϪ B cells represents an exclusive hallmark of TLR9-mediated B cell fraction of B cells using CD19ϩ microbeads. As in our routine activation. To this end, we compared human CD19ϩ peripheral protocol, B cells were left unstimulated overnight and stimulated blood B cells stimulated with CpG DNA ODN 2006 with B cells with CpG DNA ODN 2006 or CD40L the next morning. The key stimulated with CD40L. Flow cytometric analysis revealed that results obtained in these experiments are shown in Fig. 2C; cell despite detection of basal (low) ZAP70 expression in unstimulated survival and blast formation were predominant in the IgMϩ B cell and CD40L-treated cells, only CpG DNA ODN induced a strong fraction (Fig. 2C, left). CD23 induction was observed only in the and long-lasting increase in ZAP70 expression (Fig. 3, B and C). IgMϩ B cells. This is well suitable with the fact that all naive B cells Similarly, stimulation with TLR2-active lipopeptides and anti- should be found in this fraction (Fig. 2C, middle); CD27 was strongly human Ig (5, 10, and 20 ␮g/ml) failed to induce relevant increases up-regulated in the IgMϩ population, whereas only a small fraction of in ZAP70 expression measured by flow cytometry and immuno- B cells in the IgMϪ fraction became CD27high (2.5 Ϯ 1.5%). The fluorescent microscopy (data not shown). latter cells may correspond to a residual IgMlowCD27ϩ population The immunofluorescence data were confirmed by Western blot (Fig. 2C, middle). This was supported by the finding that intracellular analysis (Fig. 3C). Here, ZAP70 was detectable in both CpG ϩ IgM expression correlated with CD71 expression in IgM B cells and DNA- and CD40L-stimulated B cells which is well explainable by Ϫ CD71 was up-regulated only in a very small B cell subset in the IgM the flow cytometric finding of basal ZAP70 levels in all B cells fraction that stained IgMlow (Fig. 2C, right). We concluded that, in- (Fig. 3, B and C). These basal levels are conserved with CD40L deed, the effects of B cell-active CpG DNA ODN are due to activation stimulation. Cellular hypertrophy visualized in the forward light ϩ and expansion of IgM B cells. scatter (FSC)-side light scatter (SSC) blots in Fig. 2 and by the increase in GAPDH expression as well as total protein content TLR9-mediated B cell stimulation induces ZAP70 expression accompanies the elevated ZAP70 levels in CpG DNA ODN 2006- Because B-CLL cells are thought to originate from IgMϩ B cells and stimulated B cells when compared with CD40L stimulation. Donor microbial stimuli are currently believed to drive progression of B- variability after CD40 ligation may be explained by donor-depen- CLL (15, 34–37), we wanted to examine the TLR9-activated B cell dent differences in the percentual representation of naive and mem- phenotype more closely. We therefore asked whether ZAP70 that has ory B cell populations or cellular preactivation (compare Fig. 1A). been associated with an unfavorable prognosis could be induced with Next, we tested whether ZAP70 expression after CpG DNA TLR9 ligands in B cells from healthy donors: Indeed, when CD19ϩ ODN stimulation would depend on MyD88, the key signaling human peripheral blood B cells were stimulated with CpG DNA molecule in TLR signaling. Splenic CD19ϩ B cells from 8272 TLR9-INDUCED B CELL EXPRESSION OF ZAP70

MyD88-deficient and WT control mice were stimulated with CpG DNA ODN 1668-PTO or anti-mouse Ig. As seen in Fig. 4A, CpG DNA ODN also induced ZAP70 expression in murine B cells; this was dependent on the presence of MyD88. As previously described (14), and in marked contrast to our findings in human B cells, ZAP70 expression in murine B cells was also inducible via BCR cross-linking, which was independent of MyD88 (Fig. 4A). These data indicated that in human B cells ZAP70 is expressed in response to a specific signal delivered by TLR9 agonists.

TLR9-induced ZAP70 expression is highest in memory B cells and does not require terminal B cell differentiation Next we assessed which TLR9-responsive B cell subset would be prone to express higher levels of ZAP70. To this end, resting (CD43Ϫ), CD27ϩ, and CD27Ϫ B cells were isolated and stimulated with CpG DNA ODN 2006 or CD40L. ZAP70 expression was analyzed on day 4. Fig. 4B summarizes the results from a representative experiment. All isolated cells stained positive for Downloaded from CD20, confirming the purity of the isolated fractions (Fig. 4B, left). ZAP70 expression was higher in CD27ϩ B cells than in CD27Ϫ B cells. IgMϩ memory B cells expressed the comparably highest levels of ZAP70 (Fig. 4B, right). However, the isolation of CD43Ϫ resting B cells resulted in generally lower ZAP70 levels than those ϩ measured in CD19 B cells. This indicates that cellular preacti- http://www.jimmunol.org/ vation, e.g., by positive selection or CD19-induced PI3K activation (51), may positively influence ZAP70 expression. FIGURE 5. Correlation of ZAP70 expression with B cell proliferation. Because previous reports have associated B cell expression of A, In the presence of BrdU, B cells were stimulated with R848 Ϯ IFN-␣ ZAP70 with activation, terminal differentiation, and CD38 expres- (IFNa) or CpG DNA ODN 2006 and compared with unstimulated and ␣ u sion (8–10) and because CpG DNA ODNs have been demon- IFN- only controls. ZAP70 expression in BrdU-negative (neg., ) and f ⌬ strated to induce terminal B cell differentiation, we argued that the BrdU-positive (pos., ) cells was analyzed by flow cytometry. MFIs ,ءءء .from six independent experiments are given as mean values Ϯ SEM detection of ZAP70 in TLR9-stimulated B cells could arise from ϩ Ϫ ϩ Ϫ p ϭ ,ءءء ;( / p ϭ 0.001, R848 (BrdU ,ءءء ;( / p ϭ 0.0003, CpG (BrdU plasmablasts. We therefore compared ZAP70 expression in 0.001, R848ϩIFN-␣ (BrdUϩ/Ϫ) ϭ 0.001. B, Cyclin A2 mRNA expression Ϫ ϩ ϩ by guest on September 26, 2021 CD138 B cells and CD138 (syndecan-1 ) plasmablasts and in was measured in human CD19ϩ B cells on days (d) 0, 1, 2, and 3 with or Ϫ ϩ CD38 and CD38 B cell populations. ZAP70 MFI was enhanced without stimulation with CpG DNA ODN 2006, 2006 GpC DNA ODN, ϩ ϩ in gated CD138 (Fig. 4C) and CD38 populations (data not BHK-CD40L, or BHK-pTCF. Values are the means obtained from three shown), but high ZAP70 expression was not excluded in CD138Ϫ independent donors after normalization to ␤-actin 1) as gray columns on a or CD38Ϫ populations. Moreover, CD38 and ZAP70 expression logarithmic scale (left) Ϯ SEM (long columns indicate low expression were nearly absent in freshly isolated B cells from the majority of of cyclin A2 mRNA whereas short columns indicate an up-regulation of healthy donors but were detected in B cell blasts when B cells were cyclin A2 mRNA) and 2) as the time course (black curve) on a linear isolated from buffy coats which were mainly used for the Western scale. C, Western blot analysis of PKB and actin after stimulation of human CD19ϩ B cells with CpG DNA ODN (CG) or BHK-CD40L blot analyses (Fig. 6B). This indicated that ZAP70 expression (40L) for 1 or 4 days as indicated. Equal cell numbers were loaded. could, indeed, be linked to the degree of cellular preactivation. Results are representative of two of four independent donors.

Inhibition of Hsp-90 correlates with reduced ZAP70 expression ZAP70 expression is associated with B cell proliferation Geldanamycin and its derivates interfere with cell survival by blocking the interaction of the chaperone molecule Hsp-90 with its To test this hypothesis, ZAP70 expression in B cells stimulated in the ϩ Ϫ client proteins, e.g., ZAP70 (22, 52) and PKB (53–56), thus ex- presence of BrdU was compared in BrdU and BrdU B cell pop- posing them to ubiquitinylation and degradation (57). Because we ulations (Fig. 5A). The data obtained revealed that ZAP70 expression ϩ found that ZAP70 mRNA levels were regulated only to the extent in response to TLR9 stimulation is highest in the proliferating BrdU of variations in housekeeping gene expression (data not shown), subset. Similar results were observed after stimulation with R848, a we asked whether inhibition of the Hsp-90 chaperone function synthetic TLR7 agonist, with and without sensitization of B cells for would affect ZAP70 protein expression. Indeed, treatment with the TLR7 ligands with IFN-␣ (58). These data proved that ZAP70 ex- geldanamycin derivate 17-AAG decreased ZAP70 protein expres- pression accompanies B cell proliferation. sion (Fig. 4C). Therefore, intact chaperone function of Hsp-90 is These results were further corroborated by the ﬁnding that TLR9 required for the induction of stable ZAP70 protein expression in stimulation but not CD40 ligation induced expression of cyclin A2 human B cells. mRNA, a molecule expressed in the S phase of the cell cycle. Inter- Moreover, titrative analyses demonstrated that 17-AAG-medi- estingly enough, an increase of cyclin A2 mRNA was also observed ated inhibition of ZAP70 expression was observed only at con- after stimulation with the GpC DNA control ODN (Fig. 5B). centrations, e.g., Ն1 ␮M, that interfered with B cell proliferation and survival (Fig. 4, D and E). This prompted us to investigate PKB signaling is involved in the induction of ZAP70 expression whether ZAP70 expression could represent an indicator of cell Because targeting Hsp-90 also interferes with protein stability viability or proliferative potential. of PKB, an enzyme that plays a central role in cell cycle entry The Journal of Immunology 8273 Downloaded from

FIGURE 6. Effect of GpC control ODN on ZAP70 and PKB. A, Flow cytometric analysis of ZAP70 ⌬MFI on day 6. The diagram summarizes the results from six experiments. p ϭ 0.07. B, Western blot analysis of ZAP70, PKB, and actin performed from CD19ϩ B cell lysates from buffy coats on day 0 or day 6 after stimulation with either 2006 GpC DNA ODN or CpG DNA ODN 2006. Equal cell equivalents were loaded per lane. The experiment shown is representative of six experiments. C, CFSE dilution assay from CD19ϩ splenic B cells from WT or TLR9Ϫ/Ϫ B cells measured on day 5. Cells were

left unstimulated or stimulated with with CpG DNA ODN 2006 (CpG), 2006 GpC DNA ODN (GpC) or Pam3CysSerLys4 (Pam3). D, FSC/SSC properties http://www.jimmunol.org/ (left) and intracellular IgM/IgG staining in unstimulated (top) or 2006 GpC DNA ODN (middle)- or CpG DNA ODN 2006 (bottom)-stimulated CD19ϩ B cells. Results are representative of four experiments.

(59–61), we asked whether PKB could be involved in the up- PKB levels are elevated after 6 days of CpG DNA stimulation in regulation of ZAP70 expression. Results showed that CpG DNA comparison with unstimulated (day 0) levels and are well compat- ODN-mediated B cell activation was accompanied by higher in- ible with cellular hypertrophy, e.g., elevated actin levels per cell. duction of PKB than after CD40 ligation. This effect was already Detectable ZAP70 on day 0 indicates cellular preactivation as ex- observed after 24 h in some donors (Fig. 5C, donor 2) and most plained previously. by guest on September 26, 2021 pronounced and reproducible after prolonged periods of stimula- Most importantly, these observations were completed by an in- tion, e.g., after 4 days. In marked contrast, mRNA expression lev- duction of Hsp-90 protein expression (data not shown) and B cell els of the three PKB genes PKB-␣,-␤, and -␥ were not regulated proliferation in response to GpC ODN (Fig. 6C). Thus, GpC ODN beyond the extent of variations in housekeeping gene expression stimulated B cells in a manner similar to that of CpG DNA ODN, (data not shown). These findings suggested that TLR9-mediated albeit over a shorter time span with markedly lower cell cycling. up-regulation of Hsp-90 (Fig. 1D) may indeed play a central role GpC DNA-induced B cell proliferation was further found to be in stabilizing its client protein PKB. Moreover, these results indi- dependent on TLR9 given that GpC and CpG DNA ODN failed to cated that, in contrast to TLR9 activation, CD40L-mediated PKB promote CFSE dilution in TLR9Ϫ/Ϫ B cells whereas TLR2-active engagement is transient and does not suffice to initiate sustained lipopeptides did (Fig. 6C). Moreover, in analogy to CpG DNA proliferation and an increase in ZAP70 expression. Thus, DNA ODN, GpC ODN stimulated IgMϩ B cells (Fig. 6D). ODN and CD40L differ in strength, duration, and quality of the proliferative stimulus. TLR9-induced PKB signaling is a prerequisite for ZAP70 expression ϩ GpC control ODNs stimulate ZAP70-expressing IgM B cells To test whether inhibition of PKB signaling interferes with ZAP70 in a TLR9-dependent manner expression, we stimulated human B cells with CpG DNA in the Because up-regulation of cyclin A2 was a rather surprising finding, presence and absence of wortmannin, a PI3K inhibitor acting up- we investigated whether B cells stimulated with GpC control ODN stream of PKB (62), and with rapamycin, an inhibitor of mamma- expressed ZAP70 (Fig. 6, A and B). Interestingly enough, kinetics lian target of rapamycin, an enzyme involved in the execution of revealed that in the majority of donors GpC ODN-induced ZAP70 PKB-mediated G1- to S-phase transition (63). These treatments levels were comparable with those of CpG DNA until day 4 or 5 lead to partial (wortmannin) or complete loss (rapamycin) of CpG of stimulation. Differences in ZAP70 expression in most donors DNA-induced B cell blasts (Fig. 7A, top), which were phenotyped only became evident starting with day 5 or 6. This indicated that as CD27ϩCD71ϩ (proliferating) B cells (Fig. 7A, bottom). Loss of GpC ODN stimulation of B cells closely resembles that triggered B cell blasts was accompanied by a reduction in CpG DNA-in- by CpG DNA ODN. duced ZAP70 MFI (Fig. 7B, left). Moreover, extensive Western blot studies revealed that, similar As an alternate approach, ZAP70 expression was assessed in to CpG DNA, GpC ODN up-regulate PKB. In the majority of Ramos B cells cultured in the presence or absence of rapamycin, donors, PKB elevation is sustained until day 4 or 5, as already wortmannin, or the NF-␬B inhibitor (Bay-11-7082) (Fig. 7B, observed for ZAP70, but declines afterward (Fig. 6B). On day 6, right). Because Ramos B cells represent drug-resistant tumor cells, ZAP70 and PKB expression are lower in GpC DNA ODN-stim- this experimental setup enabled us to study the effects of the in- ulated B cells than with CpG DNA ODN treatment. ZAP70 and hibitors on ZAP70 expression while avoiding some of their toxic 8274 TLR9-INDUCED B CELL EXPRESSION OF ZAP70 Downloaded from

FIGURE 7. Role of PKB in ZAP70 induction. AϩB: CD19ϩ B cells or Ramos B cells (submitted to4hofserum starvation) were treated with rapamycin (Rap), wortmannin (Wort), Bay-11, or the vehicle control (DMSO; D) as indicated. Primary B cells were stimulated with CpG DNA ODN 2006. A, Flow cytometric analysis on day 3. Top row, B cell blasts in the FSC/SSC analysis are marked by arrows. Bottom row, Percentages of activated (CD27ϩ) and proliferating (CD71ϩ) B cells are indicated. Results are for one representative experiment of three. B, ⌬MFI for ZAP70. Left,: CD19ϩ B cells on day 3. p ϭ 0.035, CpG/DMSO:CpG/rapamycin. Right, Ramos B cells treated with ,ء .Results are the mean values Ϯ SEM from three independent experiments /p ϭ 0.01, DMSO: http://www.jimmunol.org ,ءء .the inhibitors for 4 days. Results are ⌬MFIs Ϯ SEM for ZAP70. Results are summarized from three independent experiments rapamycin. C, B cell proliferation in response to CD40 activation (left) or CpG DNA ODN 1668 stimulation (right) as well as in unstimulated controls (left) in WT and myrPKB tg mice. Proliferation was assessed by BrdU incorporation (relative light units; RLU). Results were obtained from six independent mice. D, ZAP70 expression in murine B cells on day 3 after anti (␣)-CD40 or CpG DNA ODN 1668 treatment in WT and myrPKB tg mice (n ϭ 6 mice each). effects on cellular proliferation and survival that affect primary B nied by B cell proliferation and ZAP70 expression. In marked cells. These experiments revealed that ZAP70 expression was in- contrast, weaker PKB stimuli such as CD40 ligation with the 3/23 hibited by rapamycin but was not affected by wortmannin or Bay- mAb require myrPKB overexpression to unleash proliferation and 11-7082, indicating that ZAP70 expression in Ramos B cells oc- ZAP70 expression. by guest on September 26, 2021 curred independently of NF␬B or PI3K activation, the latter most likely being circumvented by constitutive activation of PKB down- Discussion stream of PI3K as frequently encountered in B-CLL and other The study presented here demonstrates that TLR9-stimulated B malignancies (64, 65). We can only speculate that the incomplete cells acquire a phenotype similar to B-CLL cells, including ZAP70 block in blast formation in wortmannin-treated primary B cells is expression (Figs. 1 and 2). We provide evidence that ZAP70 ex- due to cellular preactivation, e.g., possibly of PI3K, that counter- pression is linked to sustained proliferation (Fig. 4) and to TLR- acts the effects of wortmannin. mediated long-lasting up-regulation of PKB (Figs. 4 and 5). We further show that both CpG and GpC DNA ODNs target IgMϩ B Expression of myrPKB restores ZAP70 expression and cells (Figs. 6 and 7), the precursor cells for B-CLL. We conclude proliferation after CD40 ligation that B cell expression of ZAP70 is not only is a hallmark of B-CLL Because our data indicated that in B cells ZAP70 expression and but is also connected to speciﬁc proliferation and differentiation long-term proliferation are linked to the duration of PKB induc- processes in normal IgMϩ B cells. tion, we reasoned that expression of a constitutively active form of TLR7 and TLR9 agonists represent very potent stimuli for B PKB may facilitate CD40-mediated B cell proliferation and cell activation and subsequent polyclonal human B cell expansion ZAP70 expression. To test this hypothesis, we compared B cell and Ig secretion (Fig. 1 and Refs. 41, 58, and 66–69). In addition, proliferation and ZAP70 expression from WT and myrPKB tg CpG DNA stimulation has been demonstrated to enhance B cell mice. Although no difference in ZAP70 expression of WT and survival by promoting the expression of antiapoptotic molecules myrPKB tg B cells could be detected before stimulation (data not such as BclxL and Bcl-2 and of heat shock proteins that stabilize shown) myrPKB tg B cells displayed enhanced proliferation (Fig. protein expression of prosurvival molecules such as PKB (46, 47, 7C) and ZAP70 expression (Fig. 7D) in response to anti-CD40 70, 71). Surprisingly, only a few studies have reported activity of stimulation with the 3/23 mAb when compared with WT B cells. GpC control ODN (72). Here we show that these ODN potently However, proliferation rates and ZAP70 expression levels after stimulate IgMϩ B cells via TLR9 and that although activation by TLR9 stimulation were comparable in WT and transgenic mice GpC DNA ODN displays a briefer kinetic they potently enhance (Fig. 7, C and D), indicating that TLR9-mediated PKB induction ZAP70 expression. overrides the effects of myrPKB in this mouse model. Thus far, TLR9-stimulatory CpG DNA ODN have been de- Due to variable transgene expression under a canonical T cell scribed as polyclonal B cell activators promoting the expansion of promoter (CD2), we did not reach statistical signiﬁcance in the memory B cells. However, the activation of naive B cells in the experiments shown in Fig. 7, C and D. Although the conclusions absence of a BCR stimulus has remained a controversial issue (58, we can draw are limited, the trend is clear; the results suggest that 66, 73, 74). Here we demonstrate that CpG DNA ODN stimulate high PKB expression as seen with CpG DNA ODN is accompa- both naive and memory peripheral blood B cells in the absence of The Journal of Immunology 8275

BCR cross-linking. CpG DNA stimulation results in the up-regu- stimuli such as CpG DNA ODN-triggered activation of TLR9 en- lation of distinct activation markers, e.g., CD23 in naive B cells hanced PKB expression and induced B cell cycling independently and high expression of CD27 in memory B cells (Fig. 2). More- of myrPKB expression (Fig. 7C). In marked contrast, weaker stim- over, CD27 up-regulation in memory B cells is associated with uli such as CD40 ligation lacked strong proliferative activity (Figs. CD5 and CD38 up-regulation (data not shown). Therefore, CpG 1–7), despite their positive effects on B cell survival, which have DNA-activated B cells differ from B-CLL cells that characteristi- been attributed to a transient activation of PKB (74, 94, 95, 98). In cally display concomitant CD5 and CD23 expression. In contrast fact, expression of constitutively active PKB enabled CD40-me- to a recent report (73), we did not observe transitional (CD38ϩ)B diated induction of B cell proliferation and up-regulation of cells in our naive B cell fractions and subsequently did not detect ZAP70 expression (Fig. 7, C and D). Thus, pathologically elevated CD27 up-regulation in the CD27Ϫ fraction. This may reflect dif- PKB levels may lower the threshold for recognition of weak en- ferences in the cell isolation procedure, stimulatory conditions, and dogenous or microbial stimuli, which may then be sufficient to time points of analysis. Interestingly enough, a recent report de- drive continuous cellular proliferation in B-CLL. scribed surface expression of TLR9 on two B cell subsets From a clinical point of view, our results emphasize the potency (CD27highCD80ϩ and a CD27ϪCD23ϩ) that resemble the pheno- of CpG DNA ODN as a B cell stimulus. In our hands, CpG DNA type that in our hands is induced upon CpG DNA stimulation (75). ODN stimulated IgMϩ B cells only (Fig. 2C). ZAP70 expression Although TLR-induced proliferation and cell survival is tightly was highest in memory B cells (Fig. 4B), a finding that is well linked to activation of NF␬B (76–78), lately several groups fo- compatible with the higher proliferation rates observed in Fig. 1A. cused on other TLR-mediated cellular activation pathways includ- Because IgMϩCD27ϩ B cells are thought to represent the cellular ing PKB signaling (79–84). PKB induction is generally associated origin for B-CLL, treatment with CpG DNA ODN over prolonged Downloaded from with cell survival and induction of cell cycling (60, 85–88), the periods of time should be considered a potential risk factor for the two features accompanying TLR-induced ZAP70 expression. development of an monoclonal lymphocytosis of unknown signif- Pathological activation of PKB has been demonstrated in neopla- icance (101–103) or a clinically relevant B-CLL until refuted. sias including B-CLL where it promotes drug resistance (27, 89) by inactivating proapoptotic molecules (90), mediating cytoplas- Acknowledgments

mic sequestration of transcription factors involved in promoting We thank H. Engelmann for providing the BHK-CD40L and BHK-pTCF http://www.jimmunol.org/ cell death (91) and nuclear translocation of NF␬B with subsequent cells, S. Fo¨rmer and R. Benz for technical assistance, and H. Kirchgessner transcription of NF␬B-dependent survival genes (92, 93) as well as for technical advice. supporting cell cycle entry (60, 61). Western blot analysis of PKB Disclosures expression in activated normal B cells revealed that PKB expres- The authors have no financial conflict of interest. sion is prolonged in B cells stimulated via endosomally located TLR9 when compared with B cells stimulated via extracellular References CD40 ligation (Fig. 5C). In support of this finding, engagement of 1. Zhong, L., C. H. Wu, W. H. Lee, and C. P. Liu. 2004. ␨-associated protein of the cell surface receptors such as CD40 and the LPS receptor 70 kDa (ZAP70), but not Syk, tyrosine kinase can mediate apoptosis of T cells

through the Fas/Fas ligand, caspase-8 and caspase-3 pathways. J. Immunol. 172: by guest on September 26, 2021 TLR4 has been shown to provoke a transient activation of PKB in 1472–1482. different cell types but fails to induce long-lasting B cell prolifer- 2. Sakaguchi, N., T. Takahashi, H. Hata, T. Nomura, T. Tagami, S. Yamazaki, ation (Refs. 74 and 94–98, Fig. 1, and data not shown). Further- T. Sakihama, T. Matsutani, I. Negishi, S. Nakatsuru, and S. Sakaguchi. 2003. Altered thymic T-cell selection due to a mutation of the ZAP70 gene causes more, isolation of B cell blasts from 2-day CpG DNA-stimulated autoimmune arthritis in mice. Nature 426: 454–460. B cell cultures by density gradient centrifugation did not affect 3. Orchard, J. A., R. E. Ibbotson, Z. Davis, A. Wiestner, A. Rosenwald, P. W. Thomas, T. J. Hamblin, L. M. Staudt, and D. G. Oscier. 2004. ZAP70 prolonged cell survival despite the absence of CpG DNA in the expression and prognosis in chronic lymphocytic leukaemia. Lancet 363: fresh culture medium (I. Bekeredjian-Ding, unpublished data). En- 105–111. dosomal retention of CpG DNA ODN along with a comparably 4. Chen, L., G. Widhopf, L. Huynh, L. Rassenti, K. R. Rai, A. Weiss, and T. J. Kipps. 2002. Expression of ZAP70 is associated with increased B-cell long half-time life (99) may therefore be responsible for prolonged receptor signaling in chronic lymphocytic leukemia. Blood 100: 4609–4614. PKB activation. Duration of PKB signaling may represent a major 5. Gobessi, S., L. Laurenti, P. G. Longo, S. Sica, G. Leone, and D. G. Efremov. determinant regulating the extent of cellular turnover and associ- 2007. ZAP70 enhances B-cell-receptor signaling despite absent or inefficient tyrosine kinase activation in chronic lymphocytic leukemia and lymphoma B ated ZAP70 expression. Additionally, the resulting cellular hyper- cells. Blood 109: 2032–2039. trophy and increased protein content facilitate the detection of 6. Nedellec, S., Y. Renaudineau, A. Bordron, C. Berthou, N. Porakishvili, P. M. Lydyard, J. O. Pers, and P. Youinou. 2005. B cell response to surface IgM ZAP70. This is evident when comparing the increase in sensitivity cross-linking identifies different prognostic groups of B-chronic lymphocytic from fluorescent microscopy and Western blotting to flow leukemia patients. J. Immunol. 174: 3749–3756. cytometry. 7. Wiestner, A. 2005. More ZAP for chronic lymphocytic leukemia (CLL). Blood 105: 1839–1840. Infections are increasingly being discussed in the context of B- 8. Cutrona, G., M. Colombo, S. Matis, D. Reverberi, M. Dono, V. Tarantino, CLL pathogenesis (15, 34–37, 100). Thus, both microbial Ag rec- N. Chiorazzi, and M. Ferrarini. 2006. B lymphocytes in humans express ZAP70 ognition via the BCR or by pattern recognition receptors such as when activated in vivo. Eur. J. Immunol. 36: 558–569. 9. Nolz, J. C., R. C. Tschumper, B. T. Pittner, J. R. Darce, N. E. Kay, and TLRs might play a role in promoting B-CLL cell survival and D. F. Jelinek. 2005. ZAP70 is expressed by a subset of normal human B-lym- sustained proliferation. Indeed, B-CLL cells have been shown to phocytes displaying an activated phenotype. Leukemia 19: 1018–1024. 10. Scielzo, C., A. Camporeale, M. Geuna, M. Alessio, A. Poggi, M. R. Zocchi, be responsive to TLR ligands, especially to CpG DNA ODN (21, M. Chilosi, F. Caligaris-Cappio, and P. Ghia. 2006. ZAP70 is expressed by 31–33). In a recent publication, Longo et al. (21) demonstrated that normal and malignant human B-cell subsets of different maturational stage. ZAP70ϩ B-CLL cells respond to CpG DNA stimulation with pro- Leukemia 20: 689–695. 11. Crespo, M., N. Villamor, E. Gine, A. Muntanola, D. Colomer, T. Marafioti, liferation, whereas ZAP70 low to absent B-CLL cells were driven M. Jones, M. Camos, E. Campo, E. Montserrat, and F. Bosch. 2006. ZAP70 into cell cycle arrest and apoptosis. These two different outcomes expression in normal pro/pre B cells, mature B cells, and in B-cell acute lym- reflected differences in PKB activation. PKB overexpression in phoblastic leukemia. Clin. Cancer Res. 12: 726–734. 12. Kong, G. H., J. Y. Bu, T. Kurosaki, A. S. Shaw, and A. C. Chan. 1995. Re- noncycling B-CLL cells shifted the response to survival and pro- constitution of Syk function by the ZAP70 protein tyrosine kinase. Immunity 2: liferation. In our study, B cells from healthy donors responded to 485–492. 13. Fallah-Arani, F., E. Schweighoffer, L. Vanes, and V. L. Tybulewicz. 2008. TLR9 stimulation by proliferation and enhanced ZAP70 expres- Eur. J. Immu- ϩ Redundant role for Zap70 in B cell development and activation. sion, thus resembling the ZAP70 B-CLL subset. Strong B cell nol. 38: 1721–1733. 8276 TLR9-INDUCED B CELL EXPRESSION OF ZAP70

14. Schweighoffer, E., L. Vanes, A. Mathiot, T. Nakamura, and V. L. Tybulewicz. 40. Vollmer, J. 2005. Progress in drug development of immunostimulatory CpG 2003. Unexpected requirement for ZAP70 in pre-B cell development and allelic oligodeoxynucleotide ligands for TLR9. Expert Opin. Biol. Ther. 5: 673–682. exclusion. Immunity 18: 523–533. 41. Bekeredjian-Ding, I., S. Inamura, T. Giese, H. Moll, S. Endres, A. Sing, 15. Chiorazzi, N., K. R. Rai, and M. Ferrarini. 2005. Chronic lymphocytic leukemia. U. Zahringer, and G. Hartmann. 2007. Staphylococcus aureus protein A triggers N. Engl. J. Med. 352: 804–815. T cell-independent B cell proliferation by sensitizing B cells for TLR2 ligands. 16. Ghia, P., G. Guida, S. Stella, D. Gottardi, M. Geuna, G. Strola, C. Scielzo, and J. Immunol. 178: 2803–2812. F. Caligaris-Cappio. 2003. The pattern of CD38 expression deﬁnes a distinct 42. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, subset of chronic lymphocytic leukemia (CLL) patients at risk of disease pro- K. Nakanishi, and S. Akira. 1998. Targeted disruption of the MyD88 gene re- gression. Blood 101: 1262–1269. sults in loss of IL-1- and IL-18-mediated function. Immunity 9: 143–150. 17. Saka, B., M. Aktan, U. Sami, D. Oner, O. Sanem, and G. Dincol. 2006. Prog- 43. Na, S. Y., A. Patra, Y. Scheuring, A. Marx, M. Tolaini, D. Kioussis, nostic importance of soluble CD23 in B-cell chronic lymphocytic leukemia. B. A. Hemmings, T. Hunig, and U. Bommhardt. 2003. Constitutively active Clin. Lab. Haematol. 28: 30–35. protein kinase B enhances Lck and Erk activities and inﬂuences thymocyte 18. Caligaris-Cappio, F. 2003. Role of the microenvironment in chronic lympho- selection and activation. J. Immunol. 171: 1285–1296. cytic leukaemia. Br. J. Haematol. 123: 380–388. 44. Bommhardt, U., K. C. Chang, P. E. Swanson, T. H. Wagner, K. W. Tinsley, 19. Schmid, C., and P. G. Isaacson. 1994. Proliferation centres in B-cell malignant I. E. Karl, and R. S. Hotchkiss. 2004. Akt decreases lymphocyte apoptosis and lymphoma, lymphocytic (B-CLL): an immunophenotypic study. Histopathology improves survival in sepsis. J. Immunol. 172: 7583–7591. 24: 445–451. 45. Bekeredjian-Ding, I., S. I. Roth, S. Gilles, T. Giese, A. Ablasser, V. Hornung, 20. Granziero, L., P. Ghia, P. Circosta, D. Gottardi, G. Strola, M. Geuna, S. Endres, and G. Hartmann. 2006. T cell-independent, TLR-induced IL-12p70 L. Montagna, P. Piccoli, M. Chilosi, and F. Caligaris-Cappio. 2001. Survivin is production in primary human monocytes. J. Immunol. 176: 7438–7446. expressed on CD40 stimulation and interfaces proliferation and apoptosis in 46. De Nardo, D., P. Masendycz, S. Ho, M. Cross, A. J. Fleetwood, E. C. Reynolds, B-cell chronic lymphocytic leukemia. Blood 97: 2777–2783. J. A. Hamilton, and G. M. Scholz. 2005. A central role for the Hsp90.Cdc37 21. Longo, P. G., L. Laurenti, S. Gobessi, A. Petlickovski, M. Pelosi, P. Chiusolo, molecular chaperone module in interleukin-1 receptor-associated-kinase-depen- S. Sica, G. Leone, and D. G. Efremov. 2007. The Akt signaling pathway de- dent signaling by toll-like receptors. J. Biol. Chem. 280: 9813–9822. termines the different proliferative capacity of chronic lymphocytic leukemia 47. Kuo, C. C., C. M. Liang, C. Y. Lai, and S. M. Liang. 2007. Involvement of heat shock protein (Hsp)90 ␤ but not Hsp90 ␣ in antiapoptotic effect of CpG-B

B-cells from patients with progressive and stable disease. Leukemia 21: Downloaded from 110–120. oligodeoxynucleotide. J. Immunol. 178: 6100–6108. 22. Castro, J. E., C. E. Prada, O. Loria, A. Kamal, L. Chen, F. J. Burrows, and 48. Kuo, C. C., S. M. Liang, and C. M. Liang. 2006. CpG-B oligodeoxynucleotide T. J. Kipps. 2005. ZAP70 is a novel conditional heat shock protein 90 (Hsp90) promotes cell survival via up-regulation of Hsp70 to increase Bcl-xL and to client: inhibition of Hsp90 leads to ZAP70 degradation, apoptosis, and impaired decrease apoptosis-inducing factor translocation. J. Biol. Chem. 281: signaling in chronic lymphocytic leukemia. Blood 106: 2506–2512. 38200–38207. 23. Barragan, M., B. Bellosillo, C. Campas, D. Colomer, G. Pons, and J. Gil. 2002. 49. Weller, S., M. C. Braun, B. K. Tan, A. Rosenwald, C. Cordier, M. E. Conley, Involvement of protein kinase C and phosphatidylinositol 3-kinase pathways in A. Plebani, D. S. Kumararatne, D. Bonnet, O. Tournilhac, et al. 2004. Human the survival of B-cell chronic lymphocytic leukemia cells. Blood 99: blood IgM “memory” B cells are circulating splenic marginal zone B cells harboring a prediversified immunoglobulin repertoire. Blood 104: 3647–3654. http://www.jimmunol.org/ 2969–2976. ϩ ϩ 24. Bichi, R., S. A. Shinton, E. S. Martin, A. Koval, G. A. Calin, R. Cesari, 50. Tangye, S. G., and K. L. Good. 2007. Human IgM CD27 B cells: memory B J. Immunol. G. Russo, R. R. Hardy, and C. M. Croce. 2002. Human chronic lymphocytic cells or “memory” B cells? 179: 13–19. leukemia modeled in mouse by targeted TCL1 expression. Proc. Natl. Acad. Sci. 51. Otero, D. C., S. A. Omori, and R. C. Rickert. 2001. Cd19-dependent activation USA 99: 6955–6960. of Akt kinase in B-lymphocytes. J. Biol. Chem. 276: 1474–1478. 52. Bartis, D., F. Boldizsar, K. Kvell, M. Szabo, L. Palinkas, P. Nemeth, 25. Herling, M., K. A. Patel, M. A. Teitell, M. Konopleva, F. Ravandi, E. Monostori, and T. Berki. 2007. Intermolecular relations between the glu- R. Kobayashi, and D. Jones. 2008. High TCL1 expression and intact T-cell cocorticoid receptor, ZAP70 kinase, and Hsp-90. Biochem. Biophys. Res. Com- receptor signaling define a hyperproliferative subset of T-cell prolymphocytic mun. 354: 253–258. leukemia. Blood 111: 228–237. Epub September 21, 2007. 53. Basso, A. D., D. B. Solit, G. Chiosis, B. Giri, P. Tsichlis, and N. Rosen. 2002. 26. Hoyer, K. K., M. Herling, K. Bagrintseva, D. W. Dawson, S. W. French, Akt forms an intracellular complex with heat shock protein 90 (Hsp90) and M. Renard, J. G. Weinger, D. Jones, and M. A. Teitell. 2005. T cell leukemia-1 ␥ Cdc37 and is destabilized by inhibitors of Hsp90 function. J. Biol. Chem. 277: modulates TCR signal strength and IFN- levels through phosphatidylinositol by guest on September 26, 2021 39858–39866. 3-kinase and protein kinase C pathway activation. J. Immunol. 175: 864–873. 54. Jones, D. T., E. Addison, J. M. North, M. W. Lowdell, A. V. Hoffbrand, 27. Pekarsky, Y., A. Koval, C. Hallas, R. Bichi, M. Tresini, S. Malstrom, G. Russo, A. B. Mehta, K. Ganeshaguru, N. I. Folarin, and R. G. Wickremasinghe. 2004. P. Tsichlis, and C. M. Croce. 2000. Tcl1 enhances Akt kinase activity and Geldanamycin and herbimycin A induce apoptotic killing of B chronic lym- mediates its nuclear translocation. Proc. Natl. Acad. Sci. USA 97: 3028–3033. phocytic leukemia cells and augment the cells’ sensitivity to cytotoxic drugs. 28. Gantner, F., P. Hermann, K. Nakashima, S. Matsukawa, K. Sakai, and Blood 103: 1855–1861. K. B. Bacon. 2003. CD40-dependent and -independent activation of human 55. Sato, S., N. Fujita, and T. Tsuruo. 2000. Modulation of Akt kinase activity by Eur. J. Immunol. tonsil B cells by CpG oligodeoxynucleotides. 33: 1576–1585. binding to Hsp90. Proc. Natl. Acad. Sci. USA 97: 10832–10837. 29. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, 56. Zhang, R., D. Luo, R. Miao, L. Bai, Q. Ge, W. C. Sessa, and W. Min. 2005. R. Teasdale, G. A. Koretzky, and D. M. Klinman. 1995. CpG motifs in bacterial Hsp90-Akt phosphorylates ASK1 and inhibits ASK1-mediated apoptosis. On- DNA trigger direct B-cell activation. Nature 374: 546–549. cogene 24: 3954–3963. 30. Sparwasser, T., L. Hultner, E. S. Koch, A. Luz, G. B. Lipford, and H. Wagner. 57. Whitesell, L., and S. L. Lindquist. 2005. HSP90 and the chaperoning of cancer. 1999. Immunostimulatory CpG-oligodeoxynucleotides cause extramedullary Nat. Rev. Cancer 5: 761–772. murine hemopoiesis. J. Immunol. 162: 2368–2374. 58. Bekeredjian-Ding, I. B., M. Wagner, V. Hornung, T. Giese, M. Schnurr, 31. Decker, T., S. Hipp, I. Ringshausen, C. Bogner, M. Oelsner, F. Schneller, and S. Endres, and G. Hartmann. 2005. Plasmacytoid dendritic cells control TLR7 C. Peschel. 2003. Rapamycin-induced G1 arrest in cycling B-CLL cells is as- sensitivity of naive B cells via type I IFN. J. Immunol. 174: 4043–4050. sociated with reduced expression of cyclin D3, cyclin E, cyclin A, and survivin. 59. Ahmed, N. N., H. L. Grimes, A. Bellacosa, T. O. Chan, and P. N. Tsichlis. 1997. Blood 101: 278–285. Transduction of interleukin-2 antiapoptotic and proliferative signals via Akt 32. Jahrsdorfer, B., L. Muhlenhoff, S. E. Blackwell, M. Wagner, H. Poeck, protein kinase. Proc. Natl. Acad. Sci. USA 94: 3627–3632. E. Hartmann, R. Jox, T. Giese, B. Emmerich, S. Endres, et al. 2005. B-cell 60. Cantrell, D. 2002. Protein kinase B (Akt) regulation and function in T lympho- lymphomas differ in their responsiveness to CpG oligodeoxynucleotides. Clin. cytes. Semin. Immunol. 14: 19–26. Cancer Res. 11: 1490–1499. 61. Liang, J., and J. M. Slingerland. 2003. Multiple roles of the PI3K/PKB (Akt) 33. Warren, T. L., and G. J. Weiner. 2002. Synergism between cytosine-guanine pathway in cell cycle progression. Cell Cycle 2: 339–345. oligodeoxynucleotides and monoclonal antibody in the treatment of lymphoma. 62. Franke, T. F., D. R. Kaplan, L. C. Cantley, and A. Toker. 1997. Direct regu- Semin. Oncol. 29: 93–97. lation of the Akt proto-oncogene product by phosphatidylinositol-3,4-bisphos- 34. Ghiotto, F., F. Fais, A. Valetto, E. Albesiano, S. Hashimoto, M. Dono, phate. Science 275: 665–668. H. Ikematsu, S. L. Allen, J. Kolitz, K. R. Rai, et al. 2004. Remarkably similar 63. Morice, W. G., G. J. Brunn, G. Wiederrecht, J. J. Siekierka, and R. T. Abraham. antigen receptors among a subset of patients with chronic lymphocytic leuke- 1993. Rapamycin-induced inhibition of p34cdc2 kinase activation is associated mia. J. Clin. Invest. 113: 1008–1016. with G1/S-phase growth arrest in T lymphocytes. J. Biol. Chem. 268: 35. Hamblin, T. J. 2006. Autoimmune complications of chronic lymphocytic leu- 3734–3738. kemia. Semin. Oncol. 33: 230–239. 64. Suzuki, E., K. Umezawa, and B. Bonavida. 2007. Rituximab inhibits the con- 36. Landgren, O., E. A. Engels, N. E. Caporaso, G. Gridley, L. Mellemkjaer, stitutively activated PI3K-Akt pathway in B-NHL cell lines: involvement in K. Hemminki, M. S. Linet, and L. R. Goldin. 2006. Patterns of autoimmunity chemosensitization to drug-induced apoptosis. Oncogene 26: 6184–6193. and subsequent chronic lymphocytic leukemia in Nordic countries. Blood 108: 65. Vivanco, I., and C. L. Sawyers. 2002. The phosphatidylinositol 3-kinase AKT 292–296. pathway in human cancer. Nat. Rev. Cancer 2: 489–501. 37. Landgren, O., J. S. Rapkin, N. E. Caporaso, L. Mellemkjaer, G. Gridley, 66. Bernasconi, N. L., N. Onai, and A. Lanzavecchia. 2003. A role for Toll-like L. R. Goldin, and E. A. Engels. 2007. Respiratory tract infections and subse- receptors in acquired immunity: up-regulation of TLR9 by BCR triggering in quent risk of chronic lymphocytic leukemia. Blood 109: 2198–2201. naive B cells and constitutive expression in memory B cells. Blood 101: 38. Krieg, A. M. 2004. Antitumor applications of stimulating Toll-like receptor 9 4500–4504. with CpG oligodeoxynucleotides. Curr. Oncol. Rep. 6: 88–95. 67. Hartmann, G., and A. M. Krieg. 2000. Mechanism and function of a newly 39. Krieg, A. M. 2006. Therapeutic potential of Toll-like receptor 9 activation. Nat. identified CpG DNA motif in human primary B cells. J. Immunol. 164: Rev. Drug Discov. 5: 471–484. 944–953. The Journal of Immunology 8277

68. He, B., X. Qiao, and A. Cerutti. 2004. CpG DNA induces IgG class switch DNA 88. Scheid, M. P., and J. R. Woodgett. 2001. PKB/AKT: functional insights from recombination by activating human B cells through an innate pathway that re- genetic models. Nat. Rev. Mol. Cell Biol. 2: 760–768. quires TLR9 and cooperates with IL-10. J. Immunol. 173: 4479–4491. 89. Cuni, S., P. Perez-Aciego, G. Perez-Chacon, J. A. Vargas, A. Sanchez, 69. Ruprecht, C. R., and A. Lanzavecchia. 2006. Toll-like receptor stimulation as a F. M. Martin-Saavedra, S. Ballester, J. Garcia-Marco, J. Jorda, and A. Durantez. third signal required for activation of human naive B cells. Eur. J. Immunol. 36: 2004. A sustained activation of PI3K/NF-␬B pathway is critical for the survival 810–816. of chronic lymphocytic leukemia B cells. Leukemia 18: 1391–1400. 70. Yi, A. K., P. Hornbeck, D. E. Lafrenz, and A. M. Krieg. 1996. CpG DNA rescue 90. Pang, Y., B. Zheng, L. W. Fan, P. G. Rhodes, and Z. Cai. 2007. IGF-1 protects of murine B lymphoma cells from anti-IgM-induced growth arrest and pro- oligodendrocyte progenitors against TNF␣-induced damage by activation of grammed cell death is associated with increased expression of c-myc and bcl-xL. PI3K/Akt and interruption of the mitochondrial apoptotic pathway. Glia 55: J. Immunol. 157: 4918–4925. 1099–1107. 71. Zhu, F. G., and D. S. Pisetsky. 2001. Role of the heat shock protein 90 in 91. Brunet, A., A. Bonni, M. J. Zigmond, M. Z. Lin, P. Juo, L. S. Hu, immune response stimulation by bacterial DNA and synthetic oligonucleotides. M. J. Anderson, K. C. Arden, J. Blenis, and M. E. Greenberg. 1999. Akt pro- Infect. Immun. 69: 5546–5552. motes cell survival by phosphorylating and inhibiting a Forkhead transcription 72. Bartz, H., Y. Mendoza, M. Gebker, T. Fischborn, K. Heeg, and A. Dalpke. 2004. factor. Cell 96: 857–868. Poly-guanosine strings improve cellular uptake and stimulatory activity of phos- 92. Hatano, E., and D. A. Brenner. 2001. Akt protects mouse hepatocytes from phodiester CpG oligonucleotides in human leukocytes. Vaccine 23: 148–155. TNF-␣- and Fas-mediated apoptosis through NK-␬B activation. Am. J. Physiol. 73. Capolunghi, F., S. Cascioli, E. Giorda, M. M. Rosado, A. Plebani, C. Auriti, 281: G1357–G1368. G. Seganti, R. Zuntini, S. Ferrari, M. Cagliuso, et al. 2008. CpG drives human transitional B cells to terminal differentiation and production of natural anti- 93. Jones, R. G., M. Parsons, M. Bonnard, V. S. Chan, W. C. Yeh, J. R. Woodgett, bodies. J. Immunol. 180: 800–808. and P. S. Ohashi. 2000. Protein kinase B regulates T lymphocyte survival, ␬ 74. Hermann, A., K. Schror, and A. A. Weber. 2002. CD40 ligand (CD40L) does nuclear factor B activation, and Bcl-xL levels in vivo. J. Exp. Med. 191: not stimulate proliferation of vascular smooth muscle cells. Eur J. Cell Biol. 81: 1721–1734. 213–221. 94. Deambrosis, I., E. Scalabrino, M. C. Deregibus, G. Camussi, and B. Bussolati. 75. Cognasse, F., H. Hamzeh-Cognasse, S. Lafarge, P. Chavarin, B. Pozzetto, 2005. CD40-dependent activation of phosphatidylinositol 3-kinase/AKT path- Y. Richard, and O. Garraud. 2008. Identiﬁcation of two subpopulations of pu- way inhibits apoptosis of human cultured mesangial cells induced by oxidized riﬁed human blood B cells, CD27ϪCD23ϩ and CD27highCD80ϩ, that strongly LDL. Int. J. Immunopathol. Pharmacol. 18: 327–337. Downloaded from express cell surface Toll-like receptor 9 and secrete high levels of interleukin-6. 95. Deregibus, M. C., S. Buttiglieri, S. Russo, B. Bussolati, and G. Camussi. 2003. Immunology. 125: 430–434. CD40-dependent activation of phosphatidylinositol 3-kinase/Akt pathway me- 76. Carmody, R. J., and Y. H. Chen. 2007. Nuclear factor-␬B: activation and reg- diates endothelial cell survival and in vitro angiogenesis. J. Biol. Chem. 278: ulation during toll-like receptor signaling. Cell Mol. Immunol. 4: 31–41. 18008–18014. 77. Doyle, S. L., and L. A. O’Neill. 2006. Toll-like receptors: from the discovery of 96. Francois, S., J. El Benna, P. M. Dang, E. Pedruzzi, M. A. Gougerot-Pocidalo, NF␬B to new insights into transcriptional regulations in innate immunity. Bio- and C. Elbim. 2005. Inhibition of neutrophil apoptosis by TLR agonists in whole chem. Pharmacol. 72:1102–1113. blood: involvement of the phosphoinositide 3-kinase/Akt and NF-␬B signaling

78. Kawai, T., and S. Akira. 2006. TLR signaling. Cell Death Differ. 13: 816–825. pathways, leading to increased levels of Mcl-1, A1, and phosphorylated Bad. http://www.jimmunol.org/ 79. Banerjee, A., R. Gugasyan, M. McMahon, and S. Gerondakis. 2006. Diverse J. Immunol. 174: 3633–3642. Toll-like receptors utilize Tpl2 to activate extracellular signal-regulated kinase 97. Lee, J. Y., J. Ye, Z. Gao, H. S. Youn, W. H. Lee, L. Zhao, N. Sizemore, and (ERK) in hemopoietic cells. Proc. Natl. Acad. Sci. USA 103: 3274–3279. D. H. Hwang. 2003. Reciprocal modulation of Toll-like receptor-4 signaling 80. Chu, W., X. Gong, Z. Li, K. Takabayashi, H. Ouyang, Y. Chen, A. Lois, pathways involving MyD88 and phosphatidylinositol 3-kinase/AKT by satu- D. J. Chen, G. C. Li, M. Karin, and E. Raz. 2000. DNA-PKcs is required for rated and polyunsaturated fatty acids. J. Biol. Chem. 278: 37041–37051. activation of innate immunity by immunostimulatory DNA. Cell 103: 909–918. 98. Tai, Y. T., K. Podar, N. Mitsiades, B. Lin, C. Mitsiades, D. Gupta, M. Akiyama, 81. Dragoi, A. M., X. Fu, S. Ivanov, P. Zhang, L. Sheng, D. Wu, G. C. Li, and L. Catley, T. Hideshima, N. C. Munshi, S. P. Treon, and K. C. Anderson. 2003. W. M. Chu. 2005. DNA-PKcs, but not TLR9, is required for activation of Akt CD40 induces human multiple myeloma cell migration via phosphatidylinositol by CpG-DNA. EMBO J. 24: 779–789. 3-kinase/AKT/NF-kappa B signaling. Blood 101: 2762–2769. 82. Osawa, Y., S. Iho, R. Takauji, H. Takatsuka, S. Yamamoto, T. Takahashi, 99. Honda, K., Y. Ohba, H. Yanai, H. Negishi, T. Mizutani, A. Takaoka, C. Taya, S. Horiguchi, Y. Urasaki, T. Matsuki, and S. Fujieda. 2006. Collaborative action and T. Taniguchi. 2005. Spatiotemporal regulation of MyD88-IRF-7 signalling of NF-␬B and p38 MAPK is involved in CpG DNA-induced IFN-␣ and che- by guest on September 26, 2021 for robust type-I interferon induction. Nature 434: 1035–1040. mokine production in human plasmacytoid dendritic cells. J. Immunol. 177: 4841–4852. 100. Chiorazzi, N., K. Hatzi, and E. Albesiano. 2005. B-cell chronic lymphocytic 83. Park, Y., S. W. Lee, and Y. C. Sung. 2002. Cutting edge: CpG DNA inhibits leukemia, a clonal disease of B lymphocytes with receptors that vary in spec- dendritic cell apoptosis by up-regulating cellular inhibitor of apoptosis proteins iﬁcity for (auto)antigens. Ann. NY Acad. Sci. 1062: 1–12. through the phosphatidylinositide-3Ј-OH kinase pathway. J. Immunol. 168: 5–8. 101. Kimby, E., H. Mellstedt, M. Bjorkholm, and G. Holm. 1989. Clonal cell surface 84. Sester, D. P., K. Brion, A. Trieu, H. S. Goodridge, T. L. Roberts, J. Dunn, structures related to differentiation, activation and homing in B-cell chronic D. A. Hume, K. J. Stacey, and M. J. Sweet. 2006. CpG DNA activates survival lymphocytic leukemia and monoclonal lymphocytosis of undetermined signif- in murine macrophages through TLR9 and the phosphatidylinositol 3-kinase- icance. Eur. J. Haematol. 43: 452–459. Akt pathway. J. Immunol. 177: 4473–4480. 102. Kimby, E., H. Mellstedt, B. Nilsson, M. Bjorkholm, and G. Holm. 1989. Dif- 85. Datta, S. R., A. Brunet, and M. E. Greenberg. 1999. Cellular survival: a play in ferences in blood T and NK cell populations between chronic lymphocytic leu- three Akts. Genes Dev. 13: 2905–2927. kemia of B cell type (B-CLL) and monoclonal B-lymphocytosis of undeter- 86. Ghosh, S., and M. Karin. 2002. Missing pieces in the NF-␬B puzzle. Cell mined signiﬁcance (B-MLUS). Leukemia 3: 501–504. 109(Suppl.): S81–S96. 103. Marti, G. E., A. C. Rawstron, P. Ghia, P. Hillmen, R. S. Houlston, N. Kay, 87. Plas, D. R., and C. B. Thompson. 2005. Akt-dependent transformation: there is T. A. Schleinitz, and N. Caporaso. 2005. Diagnostic criteria for monoclonal more to growth than just surviving. Oncogene 24: 7435–7442. B-cell lymphocytosis. Br. J. Haematol. 130: 325–332.