DOCSLIB.ORG

Involvement of PI3K/Akt Pathway in Cell Cycle Progression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Involvement of PI3K/Akt Pathway in Cell Cycle Progression Leukemia (2003) 17, 590–603 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu MOLECULAR TARGETS FOR THERAPY (MTT) Involvement of PI3K/Akt pathway in cell cycle progression, apoptosis, and neoplastic transformation: a target for cancer chemotherapy F Chang1,4, JT Lee1,4, PM Navolanic1, LS Steelman1, JG Shelton1, WL Blalock2, RA Franklin1,3 and JA McCubrey1,3 1Department of Microbiology & Immunology, Brody School of Medicine at East Carolina University, Greenville, NC, USA; 2Shands Cancer Center, University of Florida, Gainesville, FL, USA; and 3Leo Jenkins Cancer Center, Brody School of Medicine at East Carolina University, Greenville, NC, USA The PI3K/Akt signal transduction cascade has been investi- Aberrant PI3K activity and oncogenic transformation gated extensively for its roles in oncogenic transformation. Initial studies implicated both PI3K and Akt in prevention of apoptosis. However, more recent evidence has also associated The relation between dysregulated PI3K activity and cancer is this pathway with regulation of cell cycle progression. Un- well documented. For example, a mutated form of the p85 covering the signaling network spanning from extracellular subunit of PI3K has recently been isolated in a Hodgkin’s environment to the nucleus should illuminate biochemical lymphoma-derived cell line (CO).12 The PI3K/Akt pathway has events contributing to malignant transformation. Here, we been shown to be the predominant growth-factor-activated discuss PI3K/Akt-mediated signal transduction including its pathway in LNCaP human prostate carcinoma cells.13 PI3K mechanisms of activation, signal transducing molecules, and activity has been linked to a variety of human tumors including effects on gene expression that contribute to tumorigenesis. 14 15 16 17 Effects of PI3K/Akt signaling on important proteins controlling breast cancer, lung cancer, melanomas, and leukemia cellular proliferation are emphasized. These targets include among others. Further evidence has shown that Akt (protein cyclins, cyclin-dependent kinases, and cyclin-dependent ki- kinase B, PKB), a downstream kinase of PI3K, is also involved in nase inhibitors. Furthermore, strategies used to inhibit the malignant transformation.18 Inhibition of this pathway is a PI3K/Akt pathway are presented. The potential for cancer promising approach for novel chemotherapeutic agents. treatment with agents inhibiting this pathway is also addressed. Leukemia (2003) 17, 590–603. doi:10.1038/sj.leu.2402824 Keywords: PI3K; PTEN; Akt; cell cycle; apoptosis; targeted Cytokine activation of PI3K/Akt pathway therapy; inhibition Introduction After cytokine activation of a specific receptor, PI3K can be activated by two mechanisms. First, a phosphorylated tyrosine (Y) residue on the receptor serves as a docking site for the p85 An understanding of normal cellular function has been gained 1 from research characterizing various signal transduction path- regulatory subunit of PI3K. This recruits the catalytic subunit of ways. Despite these advances, processes responsible for PI3K, p110, to this complex. Alternatively, upon activation of the receptor by the cognate cytokine, Shc binds the receptor to neoplastic transformation of normal cells remain largely 19–22 undefined. For this reason, many chemotherapeutic regimens enable Grb-2 and Sos to form a complex that activates Ras. currently available are relatively nonspecific and have many Ras can then induce membrane localization and activation of the p110 subunit of PI3K, as determined by crystal structure toxic side effects. The ultimate goal of signal-transduction-based 23 research is to develop chemotherapeutic drugs that target studies. Specifically, this interaction occurs between regions cancerous cells without affecting nontransformed cells. on Ras, known as switch I (residues 33–41) and switch II (residues 63, 64, and 73), which bind to a sequence on PI3K-g Signaling through the Raf/MEK/ERK cascade is relatively well 24 understood1–9 and much progress has been achieved in the referred to as the Ras-binding domain (RBD). It was recently inhibition of this signaling pathway.10,11 In many cases, shown that the PI3K regulatory subunit, p85, contains two however, activation of the Raf/MEK/ERK pathway alone is not additional regulatory domains: a GTPase-responsive domain responsible for oncogenic transformation. Recent evidence has (GRD) that can mediate PI3K activation through binding small suggested that the PI3K/Akt pathway is a viable target for novel GTPases (Ras, Rac1), and an inhibitory domain that can block antineoplastic drugs. This review will describe PI3K/Akt path- these binding events. PI3K inhibition can be lifted when certain tyrosine kinases such as Src, Lck, and Abl phosphorylate the way signaling and its effects on cell cycle progression, 25 prevention of apoptosis, and malignant transformation. Lastly, S668 residue contained within the inhibitory domain. several potential anticancer therapies targeting this cascade are Different Ras isoforms have also been shown to have varying discussed. abilities to activate PI3K. Although Ras molecules are commonly believed to activate both PI3K/Akt and Raf/MEK/ERK cascades, Ha-Ras preferentially activates PI3K and Ki-Ras preferentially Correspondence: JA McCubrey, Department of Microbiology & 26 Immunology, Brody School of Medicine at East Carolina University, activates Raf. Greenville, NC 27858, USA; Fax: 1 252 816 3104 Activated PI3K converts phosphatidylinositol (4,5)-phos- 4 The first two authors contributed equally to this work. phate [PI(4,5)P2] into phosphatidylinositol (3,4,5)-phosphate Received 3 September 2002; accepted 23 January 2002 [PI(3,4,5)P3], which results in membrane localization of P13K/Akt pathway as a target for cancer chemotherapy F Chang et al 591 Figure 1 Activation of the PI3K/Akt pathway. Two mechanisms by which cytokine receptor activation can result in activation of the PI3K/Akt pathway are indicated. Note that significant activation of this pathway occurs in close proximity to the cell membrane. SH2: Src homology-2 domain; PH: pleckstrin homology domain. phosphotidylinositol-dependent kinase-1 (PDK1) via its pleck- active serine/threonine kinase monomers that become activated strin homology (PH) domain. Akt is also recruited to the lipid- when bound to specific cyclins. Cyclins are nuclear proteins that rich plasma membrane by its PH domain and is phosphorylated are transiently expressed in order to activate its cognate Cdk. at residues T308 and S473 by PDK1 and an unidentified kinase, These proteins form complexes that facilitate cell cycle respectively (Figure 1). progression through various cell cycle stages (Figure 3). Cdk Akt is the primary mediator of PI3K-initiated signaling and has activities are inhibited by two families of Cdk inhibitors (CKIs). a number of downstream substrates that may contribute to The first CKI family is composed of inhibitors of Cdk4 (INK4), malignant transformation. Some of these substrates are Bad, which are p16INK4a, p15INK5b, p18INK4c, and p19INK4d. INK4 procaspase-9, I-kB kinase (IKK), CREB, the forkhead family of family CKIs inhibit kinase activity of Cdk4/cyclin D and Cdk6/ transcription factors (FKHR/AFX/FOX), glycogen synthase ki- cyclin D complexes.32 The second family is Cip/Kip CKIs, which nase-3 (GSK-3), p21Cip1, and Raf.18 IKK and CREB are activated includes p21Cip1, p27Kip1, and p57Kip2. Cip/Kip family CKIs by Akt phosphorylation, whereas Raf, Bad, procaspase-9, FKHR, inhibit a broader set of Cdks, including Cdk2, Cdk4, and and GSK-3 are inactivated. Mechanisms by which Akt modu- Cdk6.33,34 The roles that these regulatory proteins play in cell lates activity of these proteins to promote cell survival and cell cycle progression can be modulated by PI3K signaling. cycle progression will be discussed in the following sections. Activity of the PI3K/Akt pathway is negatively regulated by p21Cip1 and PI3K/Akt: cell cycle regulatory effects phosphatases. Phosphatase and tensin homologue deleted on chromosome 10 (PTEN), which is also known as mutated in As previously discussed, the PI3K/Akt pathway is important for multiple advanced cancers-1 (MMAC1), as well as Src the regulation of cell cycle progression.35–40 For instance, the homology 2 (SH2) containing phosphatases 1 and 2 (SHIP-1 PI3K/Akt pathway is crucial for DNA synthesis in mesenchymal 27–31 35 and SHIP-2) remove phosphates from PI(3,4,5)P3. Muta- cells and expression of dominant negative (DN) Akt blocks tions in these phosphatases that eliminate their activity can lead platelet-derived-growth-factor (PDGF)-induced DNA synthesis to tumor progression. Consequently, genes encoding these and cell proliferation.40 p21Cip1 was initially thought to be a CKI phosphatases are referred to as antioncogenes or tumor because it inhibited cell proliferation when overexpressed in suppressor genes. An overview of the PI3K/Akt pathway is human fibroblasts. Evidence gathered by in vitro reconstitution presented in Figure 2. studies showed that p21Cip1 inhibited activity of most Cdk isoforms.41,42 Further investigation has suggested that p21Cip1 has a more complex role in regulating Cdk activity. Under Cell cycle overview physiological conditions, p21Cip1 can bind to Cdk4/cyclin D and Cdk6/cyclin D complexes, and induce their kinase activities 43 Cip1 Uncontrolled cell division can lead to tumorigenesis. Cell from early G1 until the middle of S phase. In contrast, p21 division is coordinated by a number of proteins including can bind
Load more

Recommended publications
  • Defining the Akt1 Interactome and Its Role in Regulating the Cell Cycle
    www.nature.com/scientificreports OPEN Defning the Akt1 interactome and its role in regulating the cell cycle Shweta Duggal1,3, Noor Jailkhani2, Mukul Kumar Midha2, Namita Agrawal3, Kanury V. S. Rao1 & Ajay Kumar1 Received: 13 July 2017 Cell growth and proliferation are two diverse processes yet always linked. Akt1, a serine/threonine Accepted: 8 January 2018 kinase, is a multi-functional protein implicated in regulation of cell growth, survival and proliferation. Published: xx xx xxxx Though it has a role in G1/S progression, the manner by which Akt1 controls cell cycle and blends cell growth with proliferation is not well explored. In this study, we characterize the Akt1 interactome as the cell cycle progresses from G0 to G1/S and G2 phase. For this, Akt1-overexpressing HEK293 cells were subjected to AP-MS. To distinguish between individual cell cycle stages, cells were cultured in the light, medium and heavy labelled SILAC media. We obtained 213 interacting partners of Akt1 from these studies. GO classifcation revealed that a signifcant number of proteins fall into functional classes related to cell growth or cell cycle processes. Of these, 32 proteins showed varying association with Akt1 in diferent cell cycle stages. Further analyses uncovered a subset of proteins showing counteracting efects so as to tune stage-specifc progression through the cycle. Thus, our study provides some novel perspectives on Akt1-mediated regulation of the cell cycle and ofers the framework for a detailed resolution of the downstream cellular mechanisms that are mediated by this kinase. Te mammalian cell cycle consists of an ordered series of events and is a highly coordinated and regulated pro- cess1.
    [Show full text]
  • Constitutive Activation of Akt/Protein Kinase B in Melanoma Leads to Up- Regulation of Nuclear Factor-␬B and Tumor Progression1
    [CANCER RESEARCH 62, 7335–7342, December 15, 2002] Constitutive Activation of Akt/Protein Kinase B in Melanoma Leads to Up- Regulation of Nuclear Factor-␬B and Tumor Progression1 Punita Dhawan, Amar B. Singh, Darrel L. Ellis, and Ann Richmond2 Departments of Veterans Affairs [A. R.], Cancer Biology [P. D., A. R.], Nephrology [A. B. S.], and Medicine, Division of Dermatology [D. L. E.], Vanderbilt University School of Medicine, Nashville, Tennessee 37232 ABSTRACT iting a cumulative melanoma risk of 1.9% compared with 0.04% of patients without dysplastic nevi (7). The current lifetime incidence The serine/threonine kinase Akt/protein kinase B and the pleiotropic of melanoma in the United States is estimated at 1:74 (8). The high transcription factor nuclear factor-␬B [NF-␬B (p50/p65)] play important incidence of dysplastic nevi and melanoma presents a large public roles in the control of cell proliferation, apoptosis, and oncogenesis. Pre- vious studies from our laboratory have shown the constitutive activation health problem. of NF-␬B in melanoma cells. However, the mechanism of this activation is Whereas histopathology is the current gold standard for the diag- not clearly understood. The purpose of this study was to explore the role nosis of atypical melanocytic lesions, interobserver correlation in the of Akt in the activation of NF-␬B during melanoma tumor progression. diagnosis of dysplastic nevi is variable (9, 10). The malignant poten- Based on our observation that two of the five melanoma cell lines exam- tial of dysplastic nevi and early melanomas is difficult to predict with ined exhibit constitutive Akt activation, we evaluated Akt activation by standard histological staining.
    [Show full text]
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Coordinate Phosphorylation of Multiple Residues on Single AKT1 and AKT2 Molecules
    Oncogene (2014) 33, 3463–3472 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc ORIGINAL ARTICLE Coordinate phosphorylation of multiple residues on single AKT1 and AKT2 molecules H Guo1,6, M Gao1,6,YLu1, J Liang1, PL Lorenzi2, S Bai3, DH Hawke4,JLi1, T Dogruluk5, KL Scott5, E Jonasch3, GB Mills1 and Z Ding1 Aberrant AKT activation is prevalent across multiple human cancer lineages providing an important new target for therapy. Twenty- two independent phosphorylation sites have been identified on specific AKT isoforms likely contributing to differential isoform regulation. However, the mechanisms regulating phosphorylation of individual AKT isoform molecules have not been elucidated because of the lack of robust approaches able to assess phosphorylation of multiple sites on a single AKT molecule. Using a nanofluidic proteomic immunoassay (NIA), consisting of isoelectric focusing followed by sensitive chemiluminescence detection, we demonstrate that under basal and ligand-induced conditions that the pattern of phosphorylation events is markedly different between AKT1 and AKT2. Indeed, there are at least 12 AKT1 peaks and at least 5 AKT2 peaks consistent with complex combinations of phosphorylation of different sites on individual AKT molecules. Following insulin stimulation, AKT1 was phosphorylated at Thr308 in the T-loop and Ser473 in the hydrophobic domain. In contrast, AKT2 was only phosphorylated at the equivalent sites (Thr309 and Ser474) at low levels. Further, Thr308 and Ser473 phosphorylation occurred predominantly on the same AKT1 molecules, whereas Thr309 and Ser474 were phosphorylated primarily on different AKT2 molecules. Although basal AKT2 phosphorylation was sensitive to inhibition of phosphatidylinositol 3-kinase (PI3K), basal AKT1 phosphorylation was essentially resistant.
    [Show full text]
  • Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding1, Paul-Joseph Aspuria1, Hasmik Agadjanian1, Dong-Joo Cheon1, Takako Mizuno1,2, Danielle Greenberg1, Jenieke R. Allen1,2, Lindsay Spurka3, Vincent Funari3, Elizabeth Spiteri4, Qiang Wang1,5, Sandra Orsulic1, Christine Walsh1,6, Beth Y. Karlan1,6, W. Ruprecht Wiedemeyer1 1 Women’s Cancer Program at the Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 2Graduate Program in Biomedical Sciences and Translational Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 3Genomics Core, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 4Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 5Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 6 Department of Obstetrics and Gynecology, David Geffen School of Medicine, University of California, Los Angeles, CA 90048, USA Correspondence to: W. Ruprecht Wiedemeyer, e-mail: [email protected] Keywords: Cyclin-dependent kinase inhibitors, palbociclib, dinaciclib, cyclin E1, ovarian cancer Received: July 15, 2014 Accepted: November 02, 2014 Published: December 22, 2014 ABSTRACT High-grade serous ovarian cancers (HGSOC) are genomically complex, heterogeneous cancers with a high mortality rate, due to acquired chemoresistance and lack of targeted therapy options. Cyclin-dependent kinase inhibitors (CDKi) target the retinoblastoma (RB) signaling network, and have been successfully incorporated into treatment regimens for breast and other cancers. Here, we have compared mechanisms of response and resistance to three CDKi that target either CDK4/6 or CDK2 and abrogate E2F target gene expression.
    [Show full text]
  • Expressed Gene Fusions As Frequent Drivers of Poor Outcomes in Hormone Receptor–Positive Breast Cancer
    Published OnlineFirst December 14, 2017; DOI: 10.1158/2159-8290.CD-17-0535 RESEARCH ARTICLE Expressed Gene Fusions as Frequent Drivers of Poor Outcomes in Hormone Receptor–Positive Breast Cancer Karina J. Matissek1,2, Maristela L. Onozato3, Sheng Sun1,2, Zongli Zheng2,3,4, Andrew Schultz1, Jesse Lee3, Kristofer Patel1, Piiha-Lotta Jerevall2,3, Srinivas Vinod Saladi1,2, Allison Macleay3, Mehrad Tavallai1,2, Tanja Badovinac-Crnjevic5, Carlos Barrios6, Nuran Beşe7, Arlene Chan8, Yanin Chavarri-Guerra9, Marcio Debiasi6, Elif Demirdögen10, Ünal Egeli10, Sahsuvar Gökgöz10, Henry Gomez11, Pedro Liedke6, Ismet Tasdelen10, Sahsine Tolunay10, Gustavo Werutsky6, Jessica St. Louis1, Nora Horick12, Dianne M. Finkelstein2,12, Long Phi Le2,3, Aditya Bardia1,2, Paul E. Goss1,2, Dennis C. Sgroi2,3, A. John Iafrate2,3, and Leif W. Ellisen1,2 ABSTRACT We sought to uncover genetic drivers of hormone receptor–positive (HR+) breast cancer, using a targeted next-generation sequencing approach for detecting expressed gene rearrangements without prior knowledge of the fusion partners. We identified inter- genic fusions involving driver genes, including PIK3CA, AKT3, RAF1, and ESR1, in 14% (24/173) of unselected patients with advanced HR+ breast cancer. FISH confirmed the corresponding chromo- somal rearrangements in both primary and metastatic tumors. Expression of novel kinase fusions in nontransformed cells deregulates phosphoprotein signaling, cell proliferation, and survival in three- dimensional culture, whereas expression in HR+ breast cancer models modulates estrogen-dependent growth and confers hormonal therapy resistance in vitro and in vivo. Strikingly, shorter overall survival was observed in patients with rearrangement-positive versus rearrangement-negative tumors. Cor- respondingly, fusions were uncommon (<5%) among 300 patients presenting with primary HR+ breast cancer.
    [Show full text]
  • Supplementary Table 1. in Vitro Side Effect Profiling Study for LDN/OSU-0212320. Neurotransmitter Related Steroids
    Supplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Percent Inhibition Receptor 10 µM Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective -20.94% Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site -16.15% GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1 -5.54% Histamine, H2 16.54% Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal (-BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1 Percent Inhibition Receptor 10 µM Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (hERG) (h) -6.44% Sodium, Site 2 -0.39% Second Messengers Nitric Oxide, NOS (Neuronal-Binding) -17.09% Prostaglandins Leukotriene,
    [Show full text]
  • Phosphatidylinositol 3-Kinase Mediates Proliferative Signals in Intestinal Epithelial Cells H Sheng, J Shao, C M Townsend Jr, B M Evers
    1472 COLON Gut: first published as 10.1136/gut.52.10.1472 on 11 September 2003. Downloaded from Phosphatidylinositol 3-kinase mediates proliferative signals in intestinal epithelial cells H Sheng, J Shao, C M Townsend jr, B M Evers ............................................................................................................................... Gut 2003;52:1472–1478 Background and aims: Determination of intracellular signalling pathways that mediate intestinal epithelial proliferation is fundamental to the understanding of the integrity and function of the intestinal tract under normal and diseased conditions. The phosphoinositide 3-kinase (PI3K)/Akt pathway transduces signals See end of article for initiated by growth factors and is involved in cell proliferation and differentiation. In this study, we assessed authors’ affiliations the role of PI3K/Akt in transduction of proliferative signals in intestinal epithelial cells. ....................... Methods: A rat intestinal epithelial (RIE) cell line and human colorectal cancer HCA-7 and LS-174 cell lines Correspondence to: served as in vitro models. The Balb/cJ mouse was the in vivo model. Dr H Sheng, Department of Results: PI3K activation was critical for G1 cell cycle progression of intestinal epithelial cells. Ectopic Surgery, University of expression of either active p110a or Akt-1 increased RIE cell proliferation. In vivo experiments Texas Medical Branch, 301 University Boulevard, demonstrated that PI3K activation was closely associated with the proliferative activity of intestinal mucosa. Galveston, Texas 77555, Treatment of mice with PI3K inhibitors blocked induction of PI3K activity and attenuated intestinal mucosal USA; [email protected] proliferation associated with oral intake. Epidermal growth factor and transforming growth factor a Accepted for publication stimulated PI3K activation which was required for growth factor induced expression of cyclin D1.
    [Show full text]
  • Analysis of 3-Phosphoinositide-Dependent Kinase-1 Signaling and Function in ES Cells
    EXPERIMENTAL CELL RESEARCH 314 (2008) 2299– 2312 available at www.sciencedirect.com www.elsevier.com/locate/yexcr Research Article Analysis of 3-phosphoinositide-dependent kinase-1 signaling and function in ES cells Tanja Tamgüneya,b, Chao Zhangc, Dorothea Fiedlerc, Kevan Shokatc, David Stokoea,⁎ aUCSF Cancer Research Institute, USA bMolecular Medicine Program, Friedrich-Alexander University of Erlangen-Nuremberg, Erlangen, Germany cDepartment of Cellular and Molecular Pharmacology, University of California, San Francisco, 2340 Sutter Street, San Francisco, CA 94115, USA ARTICLE INFORMATION ABSTRACT Article Chronology: 3-Phosphoinositide-dependent kinase-1 (PDK1) phosphorylates and activates several Received 5 February 2008 kinases in the cAMP-dependent, cGMP-dependent and protein kinase C (AGC) family. Revised version received Many putative PDK1 substrates have been identified, but have not been analyzed following 15 April 2008 transient and specific inhibition of PDK1 activity. Here, we demonstrate that a previously Accepted 16 April 2008 characterized PDK1 inhibitor, BX-795, shows biological effects that are not consistent with Available online 23 April 2008 PDK1 inhibition. Therefore, we describe the creation and characterization of a PDK1 mutant, L159G, which can bind inhibitor analogues containing bulky groups that hinder access to the − − Keywords: ATP binding pocket of wild type (WT) kinases. When expressed in PDK1 / ES cells, PDK1 PDK1 L159G restored phosphorylation of PDK1 targets known to be hypophosphorylated in these PKB/Akt cells. Screening of multiple inhibitor analogues showed that 1-NM-PP1 and 3,4-DMB-PP1 − − PI3K optimally inhibited the phosphorylation of PDK1 targets in PDK1 / ES cells expressing PDK1 Chemical genetics L159G but not WT PDK1. These compounds confirmed previously assumed PDK1 substrates, AGC kinases but revealed distinct dephosphorylation kinetics.
    [Show full text]
  • Interaction Between the Protein Kinase B-Raf and the A-Subunit of the IIS Proteasome Regulator1
    (CANCER RESEARCH 58. 2986-2990, July 15, I998| Advances in Brief Interaction between the Protein Kinase B-Raf and the a-Subunit of the IIS Proteasome Regulator1 Andreas Kalmes,2 Garsten Hagemann,2 Christoph K. Weber, Ludmilla Wixler, Tillman Schuster, and Ulf R. Kapp* InstituífürMedizinische Strahlenkunde und Zettforschung (MSZ). University of Würzburg,97078 Würzburg,Germany ¡C.H.. C. K. W.. L. W.. T. S.. U. K. R.], and Department of Surgery, University of Washington, Seattle. Washington 9SI95 ¡A.KJ Abstract using the yeast two-hybrid system. In addition to the already known B-Raf-binding proteins (MEK and several 14-3-3 isoforms), we iso Protein kinases of the Raf family act as signal-transducing elements lated PA28a, the subunit of the 1IS proteasome regulator (11, 12), as downstream of activated cell surface receptors and are involved in the a novel B-Raf-binding partner. regulation of proliferation, differentiation, and cell survival. Whereas the role of c-Raf-1 as a mitogen-activated protein/extracellular signal-regu The 11S regulator is one of two known activators of the 20S lated kinase activator within the mitogenic cascade is well established, less proteasome (13). Both of these activators seem to possess different is known about the mammalian Raf isoforins A-Raf and B-Raf. Here we functions in vivo. The PA700 activator complex (19S regulator) binds report that B-Raf binds to PA28a, one of two subunits of the 1IS regulator to the 20S proteasome core complex to form the active 26S protea of proteasomes. PA28<* was isolated as a B-Raf-binding protein in a yeast some, which mediates the ATP- and ubiquitination-dependent degra two-hybrid screen of a PC 12 cDNA library.
    [Show full text]