bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Nubp2 is required for cranial neural crest survival in the mouse.
2 Andrew DiStasio1, David Paulding1, Praneet Chatuverdi2, Rolf W. Stottmann1,2,3 #
3 1Divisions of Human Genetics and 2Developmental Biology, Cincinnati Children’s Hospital Medical Center,
4 3Department of Pediatrics, University of Cincinnati, Cincinnati, OH, 45229, USA.
5
6 # Author for correspondence
8
9 Keywords:
10 Nubp2, neural crest, ENU mutagenesis, cilia
11
12
13 Summary Statement
14 An ENU screen identifies a novel allele of Nubp2 which is then demonstrated to be required for cranial
15 neural crest survival and proper midfacial development.
16
17
18
19
20
21 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
22 Abstract
23 The N-ethyl-N-nitrosourea (ENU) forward genetic screen is a useful tool for the unbiased discovery of
24 novel mechanisms regulating developmental processes. We recovered the dorothy mutation in such a
25 screen designed to recover recessive mutations affecting craniofacial development in the mouse. Dorothy
26 embryos die prenatally and exhibit many striking phenotypes commonly associated with ciliopathies,
27 including a severe midfacial clefting phenotype. We used exome sequencing to discover a missense
28 mutation in Nucleotide Binding Protein 2 (Nubp2) to be causative. This finding was confirmed with a
29 complementation analysis between the dorothy allele and a Nubp2 null allele (Nubp2Null). We demonstrate
30 that Nubp2 is indispensable for embryogenesis. NUBP2 is implicated in both the Cytosolic Iron/Sulfur
31 cluster Assembly (CIA) pathway and in the negative regulation of ciliogenesis. Conditional ablation of
32 Nubp2 in the neural crest lineage with Wnt1-cre recapitulates the dorothy craniofacial phenotype. Using
33 this model, we found that the proportion of ciliated cells in the craniofacial mesenchyme was unchanged,
34 and that markers of the Shh, Fgf, and Bmp signaling pathways are unaltered. Finally, we show that the
35 phenotype results from a marked increase in apoptosis within the craniofacial mesenchyme.
36
37
38 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
39 Introduction
40 Vertebrate craniofacial development is a dynamic process highly dependent on a fascinating cell
41 population known as the neural crest. Craniofacial neural crest cells (CNCC) are a multipotent and
42 migratory cell type which delaminate from the dorsal aspect of the closing neural tube and travel
43 ventrolaterally into the frontonasal process (FNP) and pharyngeal arches (PAs) where they become the
44 mesenchyme of the emerging facial primordia [1, 2]. On each side of the mouse face, proliferation of the
45 post-migratory neural crest causes medial and lateral nasal processes (MNP, LNP) to swell from the FNP
46 around embryonic day (E) 10, resulting in paired horseshoe-shaped outgrowths with visible depressed
47 nasal pits in the center. The outgrowth of these processes is coupled with that of the maxillary processes
48 (MxPs) to bring the three primordia into contact [3, 4]. This contact and the subsequent fusion of the MNP,
49 LNP, and MxP create the nostrils and upper lip [5]. As development continues past E10.5, further growth
50 brings the paired MNPs into contact at the midface, where they fuse and give rise to the nasal septum,
51 philtrum, and premaxilla.
52 During these early stages of craniofacial development, the CNCC rely on signaling cues from
53 surrounding tissues to regulate their survival and the proliferation required to properly expand the facial
54 primordia. Sonic Hedgehog (SHH) and Fibroblast Growth Factor 8 (FGF8) secreted by the surface
55 ectoderm maintain CNCC survival and induce their proliferation [6-9]. Loss of these signals, or an inability
56 of CNCC to properly transduce ligand binding within the cell, impairs the outgrowth and subsequent fusion
57 of the facial primordia, often ultimately leading to midline defects of the face [10]. The CNCC are also a
58 particularly vulnerable cell population as evidenced by their marked susceptibility to ribosome biogenesis
59 insults, sensitivity to the teratogenic effects of alcohol and many examples of genetic mutations leading to
60 elevated CNCC apoptosis [11-14] [15-17].
61 Despite significant advances in understanding the signaling pathways and transcriptional networks
62 involved in craniofacial developmental disorders, their etiology remains unclear in many cases. Unbiased
63 forward genetics approaches in model organisms allow discovery of previously unexamined roles for genes
64 and pathways in embryogenesis, providing new insights and angles for investigation [18]. Here we report
65 on a new allele from an N-ethyl-N-nitrosourea (ENU) screen in the mouse that is integral to craniofacial bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
66 development. We found the causal mutation to be in the gene nucleotide binding protein 2 (Nubp2). Nubp2
67 is a highly conserved P-loop NTPase first described in early sequencing and mapping of cDNA isolated
68 from E7.5 mouse embryos [19]. In Saccharomyces cerevisiae it was identified as cytosolic Fe-S cluster
69 deficient (Cfd1) in a screen for genes able to convert Iron regulatory protein 1 into c-aconitase [20] [21].
70 These and subsequent studies in yeast and animal cell lines established that Nubp2 is an integral
71 component of the cytosolic iron-Sulphur (Fe-S) cluster assembly (CIA) pathway where it acts along with
72 its homologous binding partner Nubp1 as a scaffold for transfer of the Fe-S cofactor to non-mitochondrial
73 apoproteins [22-24]. Later studies revealed that knockdown of Nubp1 alone, or of both Nubp1 and Nubp2,
74 led to excessive centrosome duplication in vitro [25]. Further work indicated that silencing of Nubp1 and
75 Nubp2 in cell culture led to supernumerary cilia formation [26]. An ENU screen isolated a mouse allele of
76 Nubp1 with interrupted lung budding and centriole over-duplication [27].
77 This implication of Nubp2 in regulation of centriole duplication and ciliary dynamics, and the
78 importance of the primary cilia to intercellular signaling, led us to hypothesize dysregulation of ciliogenesis
79 would lead to interruptions in crucial CNCC signaling pathways, resulting in loss of mitogenic and/or
80 survival signals and subsequent midfacial fusion defects. On the contrary, here we demonstrate that loss
81 of Nubp2 from the CNCC does not lead to ciliogenesis or signaling defects, but causes a rapid onset of
82 apoptosis throughout the craniofacial mesenchyme following CNCC migration which underlies the
83 distinctive craniofacial presentation of the Dorothy mutant. This represents the first example of a role for
84 CIA pathway components in midfacial development.
85 Materials and Methods
86 Animal husbandry
87 All animals were housed and cared for in accordance with the Guide for the Care and Use of Laboratory Animals
88 (National Institutes of Health), and all animal-associated activity was approved by the Institutional Animal Care and
89 Use Committee of the Cincinnati Children’s Hospital Medical Center (Protocol # IACUC2016-0098). All animals were
90 monitored daily by registered veterinary technicians and additional care provided where necessary. Euthanasia was
91 performed via Isoflurane sedation followed by dislocation of the cervical vertebrae and secondary euthanasia. Mice
92 were housed in ventilated cages provided with automated water supply and Purina 5010 Laboratory Rodent Chow bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
93 ad libitum. During timed mating, noon of the day a copulation plug was detected was considered embryonic day (E)
94 0.5 (E0.5).
95 ENU mutagenesis
96 ENU mutagenesis was performed as previously published [18]. Wildtype C57BL/6J (B6; Jackson Laboratory, Bar
97 Harbor ME) 6- to 8-week-old males were given a fractionated dose of ENU (three weekly dosages of 90-100 mg/kg
98 ENU, Sigma). Mutagenized males were bred with Tg(Etv1-EGFP)B2192 GSat females (FVB/N TaC background) as part
99 of a larger effort to identify potential mutants in cortical neuron patterning [28]. Following a three-generation
100 backcross breeding scheme [18], G3 litters were dissected at late embryonic stages to detect gross developmental
101 anomalies. The allele was propagated with test crosses onto the FVB background (to facilitate mapping if needed)
102 until the causal allele was identified.
103 Variant detection
104 Exome sequencing was carried out in the CCHMC Genetic Variation and Gene Discovery Core Facility (Cincinnati,
105 OH, USA). An exome library was prepared from genomic DNA using the NimbleGen EZ Exome V2 kit (Madison, WI,
106 USA). Sequencing of the resulting exome library was done with an Illumina Hi Seq 2000 (San Diego, CA, USA). The
107 Broad Institute’s GATK algorithm was used for alignment and variant detection. Variants were then filtered as
108 described in Table 1. Mutations were validated by Sanger sequencing.
109 Alleles and genotyping
110 Nubp2Dor (Nubp2 c.626T>A; Nubp2V209D; dorothy) was discovered in an ENU mutagenesis screen as described above
111 and maintained on a mixed background. Dorothy genotyping was performed using the TaqMan™ Sample-to-SNP™
112 Kit using proprietary primers designed by the vendor targeting Nubp2:c:626T>A or Zbtb12:c:1061C>A (Thermo
113 Fisher Scientific, Waltham, MA, USA). The Nubp2tm1a (Nubp2null) allele was imported from the European Conditional
114 Mouse Mutagenesis Program (EUCOMM, EM:08954) [29] using standard in vitro fertilization protocols. We excised
115 the reporter gene trap cassette to create a traditional floxed allele Nubp2tm1c (Nubp2fx) by crossing the Nubp2tm1a with
116 carriers of the Flippase enzyme [30]. PCR primers amplified a 470bp amplicon unique to the Nubp2tm1a allele
117 (Nubp2tm1a F: TCATGCTGGAGTTCTTCGCC, Nubp2tm1a R: ATTCTTCCGCCTACTGCGAC). A separate primer pair
118 amplify a 263bp sequence in the wildtype Nubp2 allele and 457bp band in the Nubp2fx allele (Nubp2WtFxF:
119 GGATCCCAGTGCTGAGCTTT, Nubp2WtFxR: ACCACCTGCTAGCACTCAAC). For conditional ablations, we used bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
120 the Wnt1-cre allele (B6.Cg-H2afvTg(Wnt1-cre)11RthTg(Wnt1-GAL4)11Rth/J) [31] which was genotyped using a standard Cre
121 detection PCR reaction (CreF: GCGGTCTGGCAGTAAAAACTATC, CreR: GTGAAACAGCATTGCTGTCACTT).
122 Cell culture
123 Human Embryonic 293T (HEK293T) cells were cultured in Dulbecco’s modified eagle medium (DMEM, Sigma-
124 Aldrich) supplemented with 10% Fetal Bovine Serum and 1% Penicillin-Streptomycin (Sigma-Aldrich). C- and N-
125 terminal GFP-tagged Nubp1 and Nubp2 expression plasmids [32] were transfected using Lipofectamine® 3000
126 (Thermo Fisher Scientific, Waltham, MA, USA) and imaged using a Nikon C2 Confocal microscope.
127 Histology and Immunohistochemistry
128 Embryos designated for hematoxylin and eosin (H&E) staining were dissected and fixed overnight in 10% neutral
129 buffered formalin solution (Sigma-Aldrich) at room temperature (RT) and then dehydrated in 70% ethanol for 48h.
130 Following fixation and dehydration, samples were submitted to the CCHMC Pathology Research Core (Cincinnati,
131 OH, USA) for paraffin embedding. Embedded samples were sectioned at a thickness of 10-14μM and processed
132 through H&E staining. H&E slides were sealed with Cytoseal Mounting Medium (Thermo-Scientific). Samples
133 designated for Immunohistochemical (IHC) analysis were dissected and fixed overnight in 4% paraformaldehyde at
134 4°C followed by immersion in 30% sucrose solution at 4°C for 24-48 hours until sufficiently dehydrated as observed
135 by changes in sample buoyancy. Embryos were then embedded sagittally (E9.5) or coronally (E10.5) in OCT
136 compound (Tissue-Tek) and cryosectioned at a thickness of 10-14μM. Sections were dried on a slide warmer at 42°C
137 for 30-45 minutes for general IHC or dried at room temperature for 15-30 minutes when cilia were to be imaged.
138 Samples were then soaked in boiling citrate buffer for 45-60 minutes for antigen retrieval followed by three PBS
139 washes and blocked for 1 hour at RT in 4% normal goat serum in PBST. After blocking, sections were incubated
140 overnight at 4°C with the following primary antibodies as indicated: CC3 (1:400, Cell Signaling 9661), PHH3 (1:500,
141 Sigma H0412), AP2 (1:20, Developmental Studies Hybridoma Bank), Laminin (1:250, Sigma L9393), γ-Tubulin
142 (1:1000, Sigma T6557), Arl13b (1:250, Proteintech 17711-1-AP). The following morning, sections were washed three
143 times in PBS and incubated at RT in AlexaFluor 488 goat anti-mouse and AlexaFluor 594 goat anti-rabbit secondary
144 (1:500, Life Technologies) for 1 hour at RT, washed 3 times in PBS and incubated in DAPI (1:1000, Sigma) for 20
145 minutes at RT. After 3 more PBS washes slides were sealed with ProLong Gold Antifade Reagent (Life Technologies)
146 and imaged using a Nikon C2 confocal microscope. IHC images depicting cell death and proliferation were quantified
147 using ImageJ (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
148 https://imagej.nih.gov/ij/, 1997-2018). Quantification of primary cilia was performed using NIS elements software
149 (Nikon Instruments, Melville, NY, USA).
150 In Situ Hybridization
151 Whole Mount In Situ Hybridization (WMISH) was performed as described previously [33] with a hybridization
152 temperature of 65°C. Probes were transcribed from linearized plasmids using T7 RNA polymerase: Etv5 (Xin Sun/
153 Gail Martin), Ptc1 [34], Msx1 [35], and FGF8 [36].
154 RNA Sequencing
155 3 WT and 3 Wnt1-cre; Nubp2cKO mutant E9.5 embryos were dissected from the yolk sac, and heads were snap
156 frozen on dry ice. RNA was isolated and the individual samples were used for paired-end bulk-RNA sequencing
157 (BGI-Americas, Cambridge, MA). RNA-Seq analysis pipeline steps were performed using CSBB [Computational
158 Suite for Bioinformaticians and Biologists: https://github.com/csbbcompbio/CSBB-v3.0]. CSBB has multiple
159 modules, RNA-Seq module is focused on carrying out analysis steps on sequencing data, which comprises of
160 quality check, alignment, quantification and generating mapped read visualization files. Quality check of the
161 sequencing reads was performed using FASTQC (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc). Reads
162 were mapped (to mm10 version of Mouse genome) and quantified using RSEM-v1.3.0 [37].
163 RESULTS
164 Dorothy mutants were recovered in an ENU mutagenesis experiment.
165 We performed a forward Ethyl-N-Nitrosourea (ENU) genetic screen in the mouse to discover and study
166 unidentified alleles important for craniofacial development [18]. Dorothy (dor) mutants were isolated from
167 this screen and readily identified by a characteristic craniofacial phenotype (Figure 1, Tables 1 and 2). At
168 E16.5, dorothy mutants displayed a striking midfacial cleft phenotype in which the rostral-most nasal
169 cartilage appears to be absent while the remaining nasal and maxillary structures were shifted laterally
170 (Figure 1: A-F). We also noted micromelia and oligodactyly in each mutant embryo and commonly
171 observed blood pooling in the distal hindlimbs reminiscent of the eponymous ruby slippers (Baum F. book)
172 (Table 2). While all surviving embryos (6/6) collected at E16.5 had midline clefting and truncated limb
173 phenotypes, mandibular development was variably affected (ranging from apparently normal development
174 in 3/6 to complete agenesis in 1/6 non-necrotic E16.5 embryos observed). Curiously, despite the bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
175 dysmorphic nature of the dorothy face, histological analysis revealed the presence of tooth buds in
176 relatively appropriate positions, albeit with slightly delayed development (Figure 1: C, F, white dotted
177 outlines). We also noted a significant portion of dorothy mutants did not survive beyond organogenesis
178 stages. These commonly featured extensive hematomas and appeared morphologically to have arrested
179 around E9.0-E9.5 (Figure 1: G-N, Table 1,2). During maintenance of the dorothy colony, living embryos
180 past E10.5 appropriate for phenotypic analysis were increasingly rare. We hypothesize this was due to the
181 increasingly inbred genetic background as the propagation of line was onto an FVB background in the
182 event genetic mapping would be needed to clone the causal gene. The initial B6/FVB hybrid environment
183 in the first matings may have led to increased dorothy mutant survival.
184
185 The dorothy allele is a missense mutation in nucleotide binding protein 2 (Nupb2).
186 We performed exome sequencing to identify the causal allele in dorothy mutant. We sequenced three
187 mutants and initially identified approximately 176,000 variants after quality control and read depth filters
188 were applied. We first filtered out variants that were heterozygous in one or more mutants or that didn’t
189 result from single nucleotide changes working under the assumption the dorothy allele is a recessive SNP,
190 bringing the list of potential variants from ~176,000 to ~30,000 (Table 3). After filtering out SNPs known to
191 be strain polymorphisms and variants predicted to have “low” impact, along with genes containing multiple
192 variants (assumed to be highly polymorphic genes), 3 variants remained. One of these was in Pbx2 which
193 has been deleted in mouse with no resulting phenotype [38]. The remaining variants were in nucleotide
194 binding protein 2 (Nubp2) and zinc finger and BTB domain containing 12 (Zbtb12). We further genotyped
195 ten mutants and only homozygosity for the Nubp2 was concordant with the phenotype (Table 3). The
196 Zbtb12 mutation was also homozygous in 9 unaffected embryos. Thus, Nubp2:c.626T>A; p.Val209Asp
197 was identified as a candidate causal variant and this allele was designated Nubp2Dor.
198 The Nubp2Dor missense mutation (Val209Asp, NUBP2V209D), changes the coding for a highly conserved
199 nonpolar valine into a charged aspartic acid residue five amino acids downstream from a pair of Iron-
200 interacting cysteine residues [23] (Figure 2A). Sanger sequencing confirmed the nucleotide change bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
201 c626T>A in dorothy embryos (Figure 2B). Transfection of HEK293T cells with GFP-tagged hNUBP2wt and
202 hNUBP2Dor expression constructs [32] demonstrated uninterrupted translation and cellular localization of
203 hNUBP2V209D (Figure 2C).
204 While the dorothy phenotype was completely concordant with homozygosity for the NUBP2V209D allele, we
205 sought to further confirm that the causal allele was in Nubp2 via a complementation test with an
206 independently derived null allele of Nubp2. We imported the Nubp2tm1a (Nubp2Null) allele from the
207 international mouse phenotyping consortium [29, 39]. We first demonstrated that the Nubp2Null/Null embryos
208 were not viable and were never recovered at early organogenesis stages (Table 4). Consistent with this,
209 we noted frequent resorptions during these experiments, consistent with an early developmental lethality
210 phenotype. We then intercrossed Nubp2dor/wt with Nubp2Null/wt and never recovered Nubp2Null/dor embryos
211 at E16.5 (Table 5). This failure of the null allele to complement the ENU allele is the strongest possible
212 genetic evidence that dorothy is an allele of Nupb2.
213
214 Nubp2 deletion from the neural crest lineage recapitulates the dorothy craniofacial phenotypes.
215 Given the dorothy craniofacial phenotype, we hypothesized a unique requirement for Nubp2 in the CNCC
216 lineage. In order to test the hypothesis of cell-autonomous requirement for Nubp2 in the CNCC and
217 circumvent the early lethality and phenotypic variability of the dorothy allele, we used Wnt1-cre to ablate
218 Nubp2 in just the CNCC [31]. We first generated the Nubp2tm1c (Nubp2fx) allele by crossing the Nubp2tm1a
219 with a FLP transgenic [30] . We then mated Nubp2Null/wt with Wnt1-cre to generate Wnt1-cre Nubp2 Null/wt.
220 These were again mated to Nubp2fx/wt or Nubp2fx/fx to create the Wnt1-cre; Nubp2cKO. We also perfomed
221 similar crosses to generate Wnt1-cre; Nubpfx/fx. The two genotypes did not results in significantly different
222 phenotypes and are collectively referred to here as Wnt1-cre; Nupb2cKO (Supplemental Table 1). The
223 resulting Wnt1-cre Nupb2cKO embryos had phenotypes remarkably similar to the dorothy homozygous
224 mutants (Figure 3A-H). At E15.5, embryos were recovered with midfacial clefts and undersized nasal,
225 mandibular, and maxillary structures. Histological imaging revealed severe hypoplasia of the cartilage
226 primordia of the nasal septum along with agenesis of the lateral cartilage primordia of the nasal capsule bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
227 (Figure 3C,D,G,H, white and yellow dotted outlines, respectively). Combined with the cleft palate, this
228 seems to lead to a situation where the olfactory epithelium is continuous with the oral cavity and, as in the
229 dorothy mutant, the brain is shifted rostrally. We next set out to determine the developmental stage at
230 which mutants are first phenotypically distinct from littermates. Virtually all Wnt1-cre; Nubp2cKO embryos
231 (34/35) were anatomically indistinguishable from littermate controls at E9.5 (Figure 3: I-L; Table 6). In
232 contrast, a day later at E10.5, a majority (14/17) of conditional mutants are easily identified by their
233 conspicuously undersized facial primordia (Figure 3: M-P; Table 5). Thus, the Wnt1-cre; Nubp2cKO
234 phenotype appears to emerge after CNCC migration, during early expansion stages, and results in a loss
235 of craniofacial tissue.
236
237 Deletion of Nubp2 in the CNCC does not affect centriole duplication or ciliogenesis.
238 Due to previously described roles for Nubp2 in regulation of centriole duplication and ciliogenesis [25, 26],
239 we hypothesized that similar disruptions in primary cilia biology may compromise the CNCC-derived
240 mesenchyme. We used immunohistochemistry with confocal fluorescence microscopy to image and
241 quantify centrosomes and primary cilia within the E9.5 craniofacial mesenchyme (Figure 4). We used g-
242 tubulin to mark centrioles and Arl13b to highlight the ciliary axoneme. The cilia in Wnt1-cre; Nubp2cKO
243 mutants were qualitatively indistinct from those in littermates (Figure 4, A-H). We quantified the number of
244 cilia and centrioles per nucleus for conditional mutants and controls. We observed slight increase in
245 average cilia/cell (Figure 4I, p=0.009) but no difference in centriole number (Figure 4J; p=0.422).
246
247 Loss of Nupb2 does not alter Shh, Fgf or Bmp signaling in craniofacial neural crest cells.
248 The midfacial defects found in the Wnt1-cre; Nubp2cKO mutants suggested a number of developmental
249 signaling pathways may be adversely affected. Appropriate levels of Shh, Fgf and Bmp signaling are all
250 known to be crucial for proper CNCC development. We addressed each of these individually with whole
251 mount in situ hybridization on selected markers as canonical transcriptional targets of each signaling
252 pathway. bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
253 Hedgehog signaling is well known to be a survival signal for the CNCC [40]. Genetic ablation of
254 smoothened (Smo) in the neural crest using the same Wnt1-cre allele used here led to a phenotype highly
255 reminiscent of the dorothy phenotype we present here [6]. However, Ptch1 expression was qualitatively
256 and unaffected in Wnt1-cre; Nubp2cKO mutants at E9.5 (Figure 5, A-D). Fgf signaling is required from the
257 surface ectoderm to the neural crest-derived facial mesenchyme during early craniofacial development [8,
258 9]. Etv5 as a measure of Fgf signaling was transcribed normally (Figure 5, E-H). Finally, disturbances in
259 bone morphogenetic protein (Bmp) signaling during craniofacial development have been associated with
260 defective fusion of the facial primordia [41], and mutation of the downstream transcription factor Msx1
261 causes cleft lip/palate. Msx1 levels also appeared unchanged in conditional mutants (Figure 5, I-L).
262 In order to look for more markers of these canonical pathways and perform an unbiased transcriptional
263 analysis of mutants, we dissected E9.5 heads from three controls and two mutants and performed bulk
264 RNAsequencing. We first measured levels of Shh signaling (Ptch1, Gli1, Gli2, Gli3), FGF signaling (Fgf8,
265 Etv5, Spry1, Spry2), and Bmp signaling (Msx1, Lef1) and saw no significant changes between wild-type
266 and mutant embryos (Figure 5 M).
267
268 Neural crest-specific ablation of Nubp2 does not significantly alter proliferation, but increases apoptosis.
269 In the absence of intercellular signaling defects, we hypothesized that the failure of facial primordia to
270 sufficiently expand may be due to altered proliferation and/or cell survival. The craniofacial mesenchyme
271 at this stage must be highly proliferative in order to produce the maxillary, mandibular, and nasal
272 prominences and to ensure that the paired MNPs meet at the midline to form the intermaxillary segment.
273 At E9.5 the ratio of proliferating cells in the craniofacial mesenchyme as measured by a mitotic index of
274 Phosphorylated Histone 3 (PHH3) to DAPI-stained nuclei is unchanged in Wnt1-cre; Nubp2cKO mutants
275 (Figure 6, A-C; p=0.453). This ratio is mildly elevated at E10.5, when the LNP and MNP are noticeably
276 truncated in comparison to littermate controls (Figure 6, D-F; p=0.060).
277 We then assayed levels of apoptosis by calculating the ratio of Cleaved Caspase 3 (CC3) to DAPI-stained
278 nuclei. We observed increased apoptosis at E9.5 (Figure 6, G-I; p=0.040) and a drastic increase at E10.5 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
279 (Figure 6, J-L; p<0.0001). This increase was more substantial in the MNPs than the LNPs (Fig. 6K) Taken
280 together, these data show CNCC lacking Nubp2 are capable of migrating into the FNP and PA’s, correctly
281 regulating ciliogenesis, responding properly to intercellular signaling, and proliferating at a normal rate, but
282 undergo abrupt apoptosis between E9.5 and E10.5.
283 DISCUSSION
284 In this report, we describe our identification of the dorothy mutation and determine it to be an allele
285 of Nubp2. The dorothy mutant has a variable phenotype with highly penetrant micromelia, syndactyly,
286 dysmorphic nasal cartilage, and midfacial clefting (Figure 1, Tables 1, 2). Exome sequencing identified a
287 variant in Nubp2 as a candidate causal mutation (Figure 3, Table 3). We used a null allele to show Nubp2
288 is required for early development (Table 4) and also used this allele in a complementation test to further
289 demonstrate dorothy is a hypo-morphic allele of Nubp2 (Table 5). We then determined that the dorothy
290 craniofacial phenotype is due to a cell-autonomous requirement for Nubp2 in the NCC lineage (Wnt1-cre;
291 Nubp2cKO), with a phenotype emerging between E9.5 and E10.5 (Figure 3). We used these Wnt1-cre;
292 Nupb2cKO embryos to show that ciliogenesis is only mildly affected in the craniofacial mesenchyme (Figure
293 4), despite previously demonstrated roles for Nubp2 as a regulator of ciliogenesis [26]. Several canonical
294 signaling pathways required for craniofacial development and the proportion of proliferating cells are
295 unaltered in Wnt1-cre; Nupb2cKO embryos (Figure 5, 6). Ultimately, we observed a conspicuous increase
296 in apoptosis among the post-migratory CNCC mesenchyme of the craniofacial primordia starting around
297 E9.5 (Figure 6, G-L). We hypothesize that it is this ectopic cell death which prevents the craniofacial
298 primordia from growing sufficiently to bring the opposing MNPs into contact, resulting in severe midfacial
299 clefting and hypoplasia of the mandible, nasal septum and nasal capsule. This study is the first to
300 demonstrate a requirement for Nubp2 in development and shows a more specific role in craniofacial
301 development.
302 The discovery of this role for Nubp2 illustrates the continuing power of unbiased forward genetic
303 screens, as it is unlikely the gene would have otherwise been selected for study in craniofacial
304 development. To our knowledge, no clinical disorders have been associated with NUBP2 variants. During
305 the course of this study, the IMPC characterized the Nubp2tm1b/tm1b mouse as preweaning lethal with bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
306 complete penetrance (Nubp2tm1b is derived from the Nubp2null allele we described above) [39]. ENU
307 mutagenesis creates missense mutations that are often hypo-morphic, providing more insight into how
308 essential genes function in specific developmental processes. For instance, ENU-induced mutations of
309 Hsd17b7 and Grhl2 provided informative craniofacial and neural phenotypes despite the fact that complete
310 deletion of either gene is lethal before completion of organogenesis [42-45]. In many such cases the effects
311 of point mutations cannot be inferred from knockout studies alone, and forward screens can provide a
312 genetic model more relevant to the natural population. For example, patients with mutations in both alleles
313 of POLR1C present with Treacher Collins Syndrome, while Plr1cnull/null mice are embryonic lethal [39, 46,
314 47].
315 Along with NUBP1, NUBP2 participates in an early step of the CIA pathway as a scaffold for the
316 Fe/S cluster, which is transferred to target proteins via ATP hydrolysis [22, 23]. The NUBP1NISW mutant is
317 compromised in its ability to bind NUBP2, thus abrogating the canonical heterodimer scaffold [27]. This
318 loss may explain similarities between the Nubp1Nisw and dorothy phenotypes, which include micromelia,
319 syndactyly, and defects in ocular development. Cataracts are also associated with mutations in Xpd/Ercc2
320 and Spry2, both of which are extramitochondrial Fe/S proteins [48-51]. Loss of Iop1 in the mouse, which
321 operates downstream of NUBP1/NUBP2 in the pathway, causes lethality prior to E10.5 as does loss of
322 Nubp2 [52, 53]. These data taken together suggest that aspects of the dorothy and Nubp1Nisw phenotypes
323 may be attributed to decreased CIA pathway activity, but also that complete loss of the pathway may be
324 lethal prior to organogenesis. This is consistent with our inability to recover Nubp2Null/Null embryos. It is
325 possible that the NUBP2 homodimer is much more important for Fe/S cluster maturation in the craniofacial
326 mesenchyme, or that the ATPase has acquired a secondary role during mammalian evolution.
327 Cases of “protein moonlighting” can be established when proteins acquire mutations or new post-
328 translational modifications during evolution and new interactions arise [54]. One relevant example is the
329 case of Irp1. This enzyme catalyzes the conversion of citrate to isocitrate when the CIA pathway provides
330 an Fe/S cluster, but in the absence of cofactor IRP1, becomes an active RNA-binding protein modifying
331 the turnover of target mRNAs [55]. Presumably these functions evolved as a way for the cell to couple the
332 activity of an important Fe/S protein to regulation of transcripts relevant to iron homeostasis. Could Nubp2 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
333 have another function outside of the CIA pathway that explains the presence of midfacial clefting in Nubp2,
334 but not Nubp1 mutants? Using the Harmonizome database [56] we found that both genes share 12
335 interaction partners, mostly other members of the CIA pathway such as CIAO1 and MMS19 [57-59].
336 Besides these, NUBP1 has 16, and NUBP2 43, unique interaction partners. Among the unique partners of
337 each protein are several proteins involved in the regulation of apoptosis. Notably, among the unique
338 partners of NUBP2 is Pleckstrin Homology-Like Domain Family A Member 3 (PHLDA3), a pro-apoptotic
339 repressor of the oncogene Akt [60]. Our RNAseq experiment showed that Phlda3 transcripts were
340 significantly upregulated in E9.5 Wnt1-cre; Nubp2cKO heads, suggesting a potential functional significance
341 for this interaction. NUBP2 (but not NUBP1) also has an interaction with E2F transcription factor 1 (E2F1),
342 which can induce both proliferation and apoptosis [61]. The ChIP Enrichment Analysis (ChEA) database
343 shows that E2F1 binds the promoter regions of both NUBP1 and NUBP2 [62]. In light of the increased
344 apoptosis in the craniofacial mesenchyme of Nubp2cKO and in the developing lungs of Nubp1Nisw embryos,
345 future studies could explore a role for the proteins in the regulation of cell death.
346
347 FIGURE LEGENDS:
348 Figure 1: The Dorothy mutants have variable craniofacial phenotypes. Whole-mount and histological
349 analysis of E16.5 control (A-C) and dorothy (D-F) mutant embryos. Mutants consistently present with
350 midfacial clefting, micromelia and oligodactyly. The nasal cartilage (black arrows) is underdeveloped and
351 ectopically located. Accumulation of blood or other fluid under the epithelium are also often noted (red
352 asterisk). (F) Coronal sections also reveal cleft palate (black asterisks). Tooth buds are present but tooth
353 development appears delayed (yellow dotted outlines). (G-N) Dorothy mutants with more severe
354 phenotypes are developmentally arrested at the start of organogenesis (G-M), and often show signs of
355 pervasive hematoma (red arrows). (Scale bars in B,C,E,F = 1mm, G-N = 200μm).
356
357 Figure 2: The dorothy mutation is an allele of Nubp2. (A) Amino acid sequence of NUPB2 in multiple
358 model organisms. Nonpolar side chains (valine and isoleucine) at the position of the affected residue (red bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
359 box, highlighted in yellow) are heavily conserved and located in close proximity to known functional Iron-
360 interaction sites (highlighted in purple). In the dorothy mutant (p.Val209Asp; NUBP2V209D), this is replaced
361 with an aspartate residue (red) harboring an electrically charged side chain. (B) Sanger sequencing
362 confirms that Nubp2:c.626T>A is homozygous in embryos with the dorothy phenotype. (C,D) transfection
363 of HEK293T cells with pAcGFP-C1-hNUBP2 (C) and pAcGFP-C1-hNUBP2DOR (D) expression constructs
364 revealed that the corresponding fusion proteins were both expressed and localized in roughly the same
365 pattern, suggesting that the Nubp2dor mutation does not preclude translation of NUBP2 protein.
366
367 Figure 3: Conditional ablation of Nubp2 in the neural crest lineage causes midfacial defects and
368 recapitulates the craniofacial phenotype of the dorothy mutant.
369 (A-H) Wnt1-cre; Nubp2cKO embryos recovered at E15.5 have severe craniofacial abnormalities including
370 midline clefting and mandibular hypoplasia. (C, G) H&E stained coronal sections demonstrate palatal
371 shelves fail to elevate. (D, H) higher magnification reveals that the cartilage primordium of the nasal septum
372 is severely truncated (black dotted outline), while cartilage primordium of the nasal capsule lateral to the
373 septum (yellow dotted outline) appears to be completely absent in the mutant. (I-L) At E9.5 Wnt1-cre;
374 Nubp2cKO mutants are indistinguishable from wild-type (M-P) but at E10.5 the phenotype becomes
375 apparent with hypoplastic nasal prominences, maxillary and mandibular prominences). (Scale bars in C,
376 G = 500μm; D,H=50μm; I-P 100μm.)
377
378 Figure 4: Craniofacial mesenchymal cells have normal primary cilia and centrioles. (A-H)
379 representitive fields showing immunostaining with fluorescent antibodies against γ-Tubulin and Arl13b in
380 E9.5 craniofacial mesenchyme. No gross abnormalities are observed in mutant cilia (white arrows) or
381 centrioles (white arrowheads). Mitotic cells can be observed with two centrioles (white M). (I) a minor, but
382 statistically significant increase in the proportion of cilia per cell was measured in mutants. (J) There was
383 no observed difference in the proportion of centrioles per cell in mutants. Scale bars: 5μm.
384 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
385 Figure 5: Major developmental signaling pathways are unaffected in Wnt1-cre; Nubp2cKO embryos.
386 (A-L) Whole mount in situ hybridizations of E9.5 embryos and (M) normalized FPKM values derived from
387 RNA-sequencing of dissected E9.5 heads show that the Shh (A-D), Fgf (E-H) and Bmp (I-L) signaling
388 pathways are unaltered at E9.5 in Wnt1-cre; Nubp2cKO embryos (Scale bars =100μm).
389 Figure 6: Loss of Nubp2 leads to decreased survival of craniofacial neural crest. (A-E’)
390 immunofluorescent staining for Phosphorylated Histone 3 (PHH3) at E9.5 (A-C; p=0.453) and E10.5 (D-F;
391 p=0.060) shows no significant change in the proportion of proliferating Wnt1-cre; Nubp2cKO craniofacial
392 mesenchymal cells at either stage. (G-L) in contrast, staining for cleaved caspase 3 (CC3) at E9.5 (G-I;
393 p=0.040) shows a slight increase in apoptotic mesenchyme and by E10.5 (J-L; p<0.0001) there is a striking
394 and statistically significant increase. Scale bars: 100μm.
395
396 397 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
398 REFERENCES
399
400
401 1. Bronner, M.E., Simoes-Costa, M., The neural crest migrating into the 21st century. Curr Top Dev 402 Biol, 2016. 116: p. 115-34. 403 2. Cordero, D.R., et al., Cranial Neural Crest Cells on the Move: Their Roles in Craniofacial 404 Development. American Journal of Medical Genetics Part A, 2011. 155a(2): p. 270-279. 405 3. Yoon, H., et al., Development of the lip and palate in staged human embryos and early fetuses. 406 Yonsei Med J, 2000. 41(4): p. 477-84. 407 4. Kim, C.H., et al., Early development of the nose in human embryos: a stereomicroscopic and 408 histologic analysis. Laryngoscope, 2004. 114(10): p. 1791-800. 409 5. Jiang, R., J.O. Bush, and A.C. Lidral, Development of the upper lip: morphogenetic and molecular 410 mechanisms. Dev Dyn, 2006. 235(5): p. 1152-66. 411 6. Jeong, J., et al., Hedgehog signaling in the neural crest cells regulates the patterning and growth 412 of facial primordia. Genes Dev, 2004. 18(8): p. 937-51. 413 7. Billmyre, K.K. and J. Klingensmith, Sonic hedgehog from pharyngeal arch 1 epithelium is necessary 414 for early mandibular arch cell survival and later cartilage condensation differentiation. Dev Dyn, 415 2015. 244(4): p. 564-76. 416 8. Shao, M., et al., FGF8 signaling sustains progenitor status and multipotency of cranial neural crest- 417 derived mesenchymal cells in vivo and in vitro. J Mol Cell Biol, 2015. 7(5): p. 441-54. 418 9. Trumpp, A., et al., Cre-mediated gene inactivation demonstrates that FGF8 is required for cell 419 survival and patterning of the first branchial arch. Genes & Development, 1999. 13(23): p. 3136- 420 3148. 421 10. Suzuki, A., et al., Molecular mechanisms of midfacial developmental defects. Dev Dyn, 2016. 422 245(3): p. 276-93. 423 11. Weaver, K.N., et al., Acrofacial Dysostosis, Cincinnati Type, a Mandibulofacial Dysostosis 424 Syndrome with Limb Anomalies, Is Caused by POLR1A Dysfunction. Am J Hum Genet, 2015. 425 96(5): p. 765-74. 426 12. Zhang, P., et al., Alcohol exposure induces chick craniofacial bone defects by negatively affecting 427 cranial neural crest development. Toxicol Lett, 2017. 281: p. 53-64. 428 13. Smith, S.M., et al., Neural crest development in fetal alcohol syndrome. Birth Defects Res C Embryo 429 Today, 2014. 102(3): p. 210-20. 430 14. Berres, M.E., et al., Transcriptome Profiling Identifies Ribosome Biogenesis as a Target of Alcohol 431 Teratogenicity and Vulnerability during Early Embryogenesis. Plos One, 2017. 12(1). 432 15. Hasegawa, S., et al., Apoptosis in neural crest cells by functional loss of APC tumor suppressor 433 gene. Proc Natl Acad Sci U S A, 2002. 99(1): p. 297-302. 434 16. Wang, J., et al., Defective ALK5 signaling in the neural crest leads to increased postmigratory 435 neural crest cell apoptosis and severe outflow tract defects. BMC Dev Biol, 2006. 6: p. 51. 436 17. Vieceli, F.M. and M.E. Bronner, Leukocyte receptor tyrosine kinase interacts with secreted midkine 437 to promote survival of migrating neural crest cells. Development, 2018. 145(20). 438 18. Stottmann, R.W. and D.R. Beier, Using Enu Mutagenesis for Phenotype-Driven Analysis of the 439 Mouse. Methods in Enzymology, Vol 477: Guide to Techniques in Mouse Development, Part B: 440 Mouse Molecular Genetics, Second Edition, 2010. 477: p. 329-348. 441 19. Nakashima, H., et al., Two novel mouse genes--Nubp2, mapped to the t-complex on chromosome 442 17, and Nubp1, mapped to chromosome 16--establish a new gene family of nucleotide-binding 443 proteins in eukaryotes. Genomics, 1999. 60(2): p. 152-60. 444 20. Roy, A., et al., A novel eukaryotic factor for cytosolic Fe-S cluster assembly. Embo j, 2003. 22(18): 445 p. 4826-35. 446 21. Voss, H., et al., Nucleotide sequence and analysis of the centromeric region of yeast chromosome 447 IX. Yeast, 1995. 11(1): p. 61-78. 448 22. Netz, D.J., et al., The Cfd1-Nbp35 complex acts as a scaffold for iron-sulfur protein assembly in 449 the yeast cytosol. Nat Chem Biol, 2007. 3(5): p. 278-86. bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
450 23. Netz, D.J.A., et al., A Bridging [4Fe-4S] Cluster and Nucleotide Binding Are Essential for Function 451 of the Cfd1-Nbp35 Complex as a Scaffold in Iron-Sulfur Protein Maturation. Journal of Biological 452 Chemistry, 2012. 287(15): p. 12365-12378. 453 24. Camire, E.J., et al., The Yeast Nbp35-Cfd1 Cytosolic Iron-Sulfur Cluster Scaffold Is an ATPase. J 454 Biol Chem, 2015. 290(39): p. 23793-802. 455 25. Christodoulou, A., et al., Motor protein KIFC5A interacts with Nubp1 and Nubp2, and is implicated 456 in the regulation of centrosome duplication. J Cell Sci, 2006. 119(Pt 10): p. 2035-47. 457 26. Kypri, E., et al., The nucleotide-binding proteins Nubp1 and Nubp2 are negative regulators of 458 ciliogenesis. Cell Mol Life Sci, 2014. 71(3): p. 517-38. 459 27. Schnatwinkel, C. and L. Niswander, Nubp1 Is Required for Lung Branching Morphogenesis and 460 Distal Progenitor Cell Survival in Mice. Plos One, 2012. 7(9). 461 28. Cionni, M., C. Menke, and R.W. Stottmann, Novel genetic tools facilitate the study of cortical neuron 462 migration. Mamm Genome, 2016. 27(1-2): p. 8-16. 463 29. Friedel, R.H., et al., EUCOMM--the European conditional mouse mutagenesis program. Brief Funct 464 Genomic Proteomic, 2007. 6(3): p. 180-5. 465 30. Dixon, J.E., A.C. Shaikh, and P.D. Sadowski, The Flp recombinase cleaves Holliday junctions in 466 trans. Mol Microbiol, 1995. 18(3): p. 449-58. 467 31. Danielian, P.S., et al., Modification of gene activity in mouse embryos in utero by a tamoxifen- 468 inducible form of Cre recombinase. Curr Biol, 1998. 8(24): p. 1323-6. 469 32. Okuno, T., H. Yamabayashi, and K. Kogure, Comparison of intracellular localization of Nubp1 and 470 Nubp2 using GFP fusion proteins. Molecular Biology Reports, 2010. 37(3): p. 1165-1168. 471 33. Belo, J.A., et al., Cerberus-like is a secreted factor with neutralizing activity expressed in the 472 anterior primitive endoderm of the mouse gastrula. Mech Dev, 1997. 68(1-2): p. 45-57. 473 34. Johnson, R.L., et al., Human homolog of patched, a candidate gene for the basal cell nevus 474 syndrome. Science, 1996. 272(5268): p. 1668-1671. 475 35. Hill, R.E., et al., A new family of mouse homeo box-containing genes: molecular structure, 476 chromosomal location, and developmental expression of Hox-7.1. Genes Dev, 1989. 3(1): p. 26- 477 37. 478 36. Crossley, P.H. and G.R. Martin, The mouse Fgf8 gene encodes a family of polypeptides and is 479 expressed in regions that direct outgrowth and patterning in the developing embryo. Development, 480 1995. 121(2): p. 439-51. 481 37. Li, B. and C.N. Dewey, RSEM: accurate transcript quantification from RNA-Seq data with or without 482 a reference genome. BMC Bioinformatics, 2011. 12: p. 323. 483 38. Selleri, L., et al., The TALE homeodomain protein Pbx2 is not essential for development and long- 484 term survival. Mol Cell Biol, 2004. 24(12): p. 5324-31. 485 39. Dickinson, M.E., et al., High-throughput discovery of novel developmental phenotypes. Nature, 486 2016. 537(7621): p. 508-514. 487 40. Ahlgren, S.C. and M. Bronner-Fraser, Inhibition of sonic hedgehog signaling in vivo results in 488 craniofacial neural crest cell death. Curr Biol, 1999. 9(22): p. 1304-14. 489 41. Liu, W., et al., Distinct functions for Bmp signaling in lip and palate fusion in mice. Development, 490 2005. 132(6): p. 1453-61. 491 42. Stottmann, R.W., et al., Cholesterol metabolism is required for intracellular hedgehog signal 492 transduction in vivo. PLoS Genet, 2011. 7(9): p. e1002224. 493 43. Shehu, A., et al., Prolactin receptor-associated protein/17beta-hydroxysteroid dehydrogenase type 494 7 gene (Hsd17b7) plays a crucial role in embryonic development and fetal survival. Mol Endocrinol, 495 2008. 22(10): p. 2268-77. 496 44. Menke, C., et al., Grhl2 is Required in Nonneural Tissues for Neural Progenitor Survival and 497 Forebrain Development. Genesis, 2015. 53(9): p. 573-582. 498 45. Rifat, Y., et al., Regional neural tube closure defined by the Grainy head-like transcription factors. 499 Dev Biol, 2010. 345(2): p. 237-45. 500 46. Dauwerse, J.G., et al., Mutations in genes encoding subunits of RNA polymerases I and III cause 501 Treacher Collins syndrome. Nat Genet, 2011. 43(1): p. 20-2. 502 47. Ghesh, L., et al., Autosomal recessive Treacher Collins syndrome due to POLR1C mutations: 503 Report of a new family and review of the literature. Am J Med Genet A, 2019. bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
504 48. Kunze, S., et al., New mutation in the mouse Xpd/Ercc2 gene leads to recessive cataracts. PLoS 505 One, 2015. 10(5): p. e0125304. 506 49. Tan, X., et al., Sprouty2 Suppresses Epithelial-Mesenchymal Transition of Human Lens Epithelial 507 Cells through Blockade of Smad2 and ERK1/2 Pathways. PLoS One, 2016. 11(7): p. e0159275. 508 50. Rudolf, J., et al., The DNA repair helicases XPD and FancJ have essential iron-sulfur domains. Mol 509 Cell, 2006. 23(6): p. 801-8. 510 51. Wu, X., et al., Mammalian sprouty proteins assemble into large monodisperse particles having the 511 properties of intracellular nanobatteries. Proc Natl Acad Sci U S A, 2005. 102(39): p. 14058-62. 512 52. Song, D. and F.S. Lee, Mouse knock-out of IOP1 protein reveals its essential role in mammalian 513 cytosolic iron-sulfur protein biogenesis. J Biol Chem, 2011. 286(18): p. 15797-805. 514 53. Seki, M., et al., IOP1 protein is an external component of the human cytosolic iron-sulfur cluster 515 assembly (CIA) machinery and functions in the MMS19 protein-dependent CIA pathway. J Biol 516 Chem, 2013. 288(23): p. 16680-9. 517 54. Copley, S.D., An evolutionary perspective on protein moonlighting. Biochem Soc Trans, 2014. 518 42(6): p. 1684-91. 519 55. Volz, K., The functional duality of iron regulatory protein 1. Curr Opin Struct Biol, 2008. 18(1): p. 520 106-11. 521 56. Rouillard, A.D., et al., The harmonizome: a collection of processed datasets gathered to serve and 522 mine knowledge about genes and proteins. Database (Oxford), 2016. 2016. 523 57. Balk, J., et al., The essential WD40 protein Cia1 is involved in a late step of cytosolic and nuclear 524 iron-sulfur protein assembly. Mol Cell Biol, 2005. 25(24): p. 10833-41. 525 58. Maione, V., et al., Investigating the role of the human CIA2A-CIAO1 complex in the maturation of 526 aconitase. Biochim Biophys Acta Gen Subj, 2018. 1862(9): p. 1980-1987. 527 59. van Wietmarschen, N., et al., The mammalian proteins MMS19, MIP18, and ANT2 are involved in 528 cytoplasmic iron-sulfur cluster protein assembly. J Biol Chem, 2012. 287(52): p. 43351-8. 529 60. Kawase, T., et al., PH domain-only protein PHLDA3 is a p53-regulated repressor of Akt. Cell, 2009. 530 136(3): p. 535-50. 531 61. Poppy Roworth, A., F. Ghari, and N.B. La Thangue, To live or let die - complexity within the E2F1 532 pathway. Mol Cell Oncol, 2015. 2(1): p. e970480. 533 62. Lachmann, A., et al., ChEA: transcription factor regulation inferred from integrating genome-wide 534 ChIP-X experiments. Bioinformatics, 2010. 26(19): p. 2438-44.
535
536 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
537 Figure 1: The Dorothy mutants have variable craniofacial phenotypes.
538
539
540 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
541 Figure 2: The dorothy mutation is an allele of Nubp2.
542
543
544
545
546
547
548
549
550 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
551 Figure 3: Conditional ablation of Nubp2 in the neural crest lineage causes midfacial defects and
552 recapitulates the craniofacial phenotype of the dorothy mutant.
553
554
555
556
557 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
558 Figure 4: Craniofacial mesenchymal cells have normal primary cilia and centrioles.
559
560
561
562
563
564
565 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
566 Figure 5: Major developmental signaling pathways are unaffected in Wnt1-cre; Nubp2cKO embryos
567
568
569
570
571
572 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
573
574
575 Figure 6: Loss of Nubp2 leads to decreased survival of craniofacial neural crest.
576
577 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
578 Table 1: Recovery of dorothy mutants at different stages of embryogenesis
E9.5 E10.5 E11.5 E16.5 Genotype Observed Expected Observed Expected Observed Expected Observed Expected Nubp2+/+ 23 20.25 34 30.5 6 5 51 45.25 Nubp2dor/+ 40 40.5 69 61 10 10 120 90.5
Nubp2dor/dor 18 20.25 19 30.5 4 5 10 45.25 p= 0.730 p= 0.055 p= 0.819 p= 6.172E-09 579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
602 Table 2: Dorothy phenotyping at various stages of embryogenesis
603
E9.5 604 605 Term MGI ID (n) (%) hematoma MP: 0008817 13 72.22%606 abnormal first pharyngeal arch morphology MP: 0006337 11 61.11% 607 small frontonasal prominence MP: 0030249 7 38.89% embryonic growth retardation MP: 0003984 1 5.56%608 609 E10.5 610 abnormal lateral nasal prominence morphology MP: 0009902 19 100.00%611 abnormal medial nasal prominence morphology MP: 0009903 19 100.00%612 hematoma MP: 0008817 15 78.95% 613 embryonic growth retardation MP: 0003984 15 78.95%614 small mandibular prominence MP: 0030346 15 78.95%615 small maxillary prominence MP: 0030342 8 42.11%616 absent maxillary prominence MP: 0030344 7 36.84% E11.5 617 small mandibular prominence MP: 0030346 4 100% hematoma MP: 0008817 3 75%618 abnormal lateral nasal prominence morphology MP: 0009902 3 75% abnormal medial nasal prominence morphology MP: 0009903 3 75%619 abnormal eye development MP: 0001286 3 75% absent maxillary prominence MP: 0030344 2 50% 620 E16.5 embryonic lethality during organogenesis MP: 0006207 4 40%621 Remaining phenotypes scored from 6/10 embryos not clearly necrotic abnormal digit development MP: 0006280 6 100% 622 micromelia MP: 0008736 6 100% oligodactyly MP: 0000565 6 100% midline facial cleft MP: 0000108 4 66623% embryonic lethality during organogenesis MP: 0006207 4 66% hematoma MP: 0008817 3 50%624 protruding tongue MP: 0009908 3 50% absent snout MP: 0000450 2 33625% absent mandible MP: 0000087 2 33% embryonic growth arrest MP: 0001730 1 16% 626 encephalomeningocele MP: 0012260 1 16%
627
628 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
629 Table 3: Explanation of exome sequencing result filtering
Total variants 176,315 Filter out non-homozygous variants 36,590 Filter out non-SNP variants 30,733 Filter out variants listed in dbSNP 5,800 Filter out "Low impact" variants 267 Filter out genes with multiple variants 116 Filter out known polymorphisms 4 Filter out variants seen in CCHMC control exomes 3 Filter out genes with no null phenotype 2 Filter out variant that doesn't segregate with phenotype 1 630
631
632 Table 4: Embryonic lethality of Nubp2 ablation
E7.5-E10.5 embryo recovery Genotype Expected Observed Nubp2+/+ 8.75 20 Nubp2Null/+ 17.5 15 Nubp2Null/Null 8.75 0 p= 7.613E-06 633
634 Table 5: Complementation test of Nubp2dor as the causative allele
Embryo recovery E16.5 E10.5 Genotype Expected Observed Expected Observed Nubp2+/+ 4.25 6 7.25 14 Nubp2Null/+ 4.25 3 7.25 8 Nubp2dor/+ 4.25 8 7.25 7 Nubp2Null/dor 4.25 0 7.25 0 p= 0.0344 p= 0.00347 635
636
637 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
638 Table 6: Phenotypic description of Wnt1-cre; Nubp2cKO embryos
E9.5 Term MGI ID (n) (%) no abnormal phenotype detected MP: 0002169 34/35 97% abnormal first pharyngeal arch morphology MP: 0006337 1/35 3% E10.5 MP: abnormal lateral nasal prominence morphology 0009902 14/17 82.35% MP: abnormal medial nasal prominence morphology 0009903 14/17 82.35% MP: small maxillary prominence 0030342 12/17 70.59% MP: small mandibular prominence 0030346 4/17 28.57% MP: no abnormal phenotype detected 0002169 3/17 17.65% MP: embryonic growth retardation 0003984 1/17 5.88% E11.5 MP: abnormal lateral nasal prominence morphology 0009902 7/9 77.78% MP: abnormal medial nasal prominence morphology 0009903 7/9 77.78% MP: small maxillary prominence 0030342 7/9 77.78% MP: absent mandible 0000087 6/9 66.67% MP: hematoma 0008817 4/9 44.44% MP: no abnormal phenotype detected 0002169 2/9 22.22% 639
640
641
642
643
644
645 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
646 Supplemental Table 1: Comparison of phenotypes observed in Wnt1-cre; Nubp2null/fx and Wnt1-cre;
647 Nubp2fx/fx embryos.
E9.5, Wnt1-cre; Nubp2null/fx Nubp2fx/fx Term MGI ID (n) (%) (n) (%) MP: no abnormal phenotype detected 0002169 10 100% 23 96% MP: abnormal first pharyngeal arch morphology 0006337 0 0% 1 4% E10.5, Wnt1-cre; Nubp2null/fx Nubp2fx/fx Term MGI ID (n) (%) (n) (%) MP: no abnormal phenotype detected 0002169 3 33.3% 1 12.5% MP: embryonic growth retardation 0003984 1 11.1% 0 0.0% MP: abnormal lateral nasal prominence morphology 0009902 5 55.6% 7 87.5% MP: abnormal medial nasal prominence morphology 0009903 5 55.6% 7 87.5% MP: small mandibular prominence 0030346 6 66.7% 7 87.5% MP: small maxillary prominence 0030342 6 66.7% 7 87.5% E11.5 Wnt1-cre; Nubp2null/fx Nubp2fx/fx Term MGI ID (n) (%) (n) (%) MP: no abnormal phenotype detected 0002169 2 22.2% MP: hematoma 0008817 4 44.4% MP: absent mandible 0000087 6 66.7% NONE COLLECTED MP: PAST E10.5 abnormal lateral nasal prominence morphology 0009902 7 77.8% MP: abnormal medial nasal prominence morphology 0009903 7 77.8% MP: small maxillary prominence 0030342 7 77.8% 648 bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/656652; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.